COMMON DATATYPE type WGS KEYWORD keyword WGS KEYWORD keyword STANDARD_DRAFT DBLINK project biosample SUBMITTER ab_name ab_name ab_name contact email phone fax institute country city street zip REFERENCE title ab_name ab_name ab_name status Unpublished year COMMENT line Annotated by DFAST v.1.2.20 (https://dfast.nig.ac.jp) ST_COMMENT tagset_id Genome-Assembly-Data Assembly Method Genome Coverage Sequencing Technology sequence001 source 1..48200 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(22..615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00010 CDS complement(1804..2616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00020 CDS 2920..6588 product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 transl_table 11 codon_start 1 locus_tag LOCUS_00030 gene recC CDS 6585..10622 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00040 CDS 10619..12835 product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 transl_table 11 codon_start 1 locus_tag LOCUS_00050 gene recD CDS 12844..14973 product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 transl_table 11 codon_start 1 locus_tag LOCUS_00060 CDS complement(15003..15938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00070 CDS 16063..16665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00080 CDS 16913..17458 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00090 CDS complement(17459..20074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00100 CDS complement(20166..21371) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 transl_table 11 codon_start 1 locus_tag LOCUS_00110 CDS complement(21517..22377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00120 CDS complement(22374..22961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00130 CDS complement(22964..24649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00140 CDS complement(24637..25662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00150 CDS 25718..26560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00160 CDS 26564..27658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00170 CDS 27847..29658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00180 CDS 29667..31004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00190 CDS 31199..32044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00200 CDS complement(32141..35590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00210 CDS complement(35590..36363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00220 CDS complement(36381..37034) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00230 CDS complement(37158..40832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00240 CDS 40831..42264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00250 CDS 42384..43292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00260 CDS 43406..44953 product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141645203.1 transl_table 11 codon_start 1 locus_tag LOCUS_00270 CDS 44950..45576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00280 CDS 45580..46953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00290 misc_feature complement(46982..>48200) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein locus_tag LOCUS_00300 sequence002 source 1..43521 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(76..1389) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 transl_table 11 codon_start 1 locus_tag LOCUS_00310 tRNA 615..708 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00010 CDS complement(1386..3011) product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 transl_table 11 codon_start 1 locus_tag LOCUS_00320 CDS 3157..4017 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00330 CDS 4030..4746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00340 CDS 4856..5662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00350 CDS complement(5671..6999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00360 CDS complement(7026..7937) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00370 CDS complement(8087..8827) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00380 CDS 8925..9836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00390 CDS complement(9840..14219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00400 CDS 14218..15168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00410 CDS complement(15165..16514) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00420 CDS complement(16501..17685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00430 CDS complement(17726..18205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00440 CDS complement(18301..18699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00450 CDS complement(18766..19779) product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 transl_table 11 codon_start 1 locus_tag LOCUS_00460 CDS complement(19827..20597) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00470 CDS complement(20672..21589) product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510049.1 transl_table 11 codon_start 1 locus_tag LOCUS_00480 CDS complement(21669..23378) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00490 CDS complement(23375..23788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00500 CDS 23727..23921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00510 CDS 24020..24991 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 transl_table 11 codon_start 1 locus_tag LOCUS_00520 CDS complement(24983..26188) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_00530 CDS complement(26230..27420) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 transl_table 11 codon_start 1 locus_tag LOCUS_00540 CDS complement(27423..28745) product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 transl_table 11 codon_start 1 locus_tag LOCUS_00550 CDS 28833..29840 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 transl_table 11 codon_start 1 locus_tag LOCUS_00560 CDS 29961..30890 product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00570 CDS 30956..31531 product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 transl_table 11 codon_start 1 locus_tag LOCUS_00580 CDS 31617..32696 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00590 CDS 32693..33823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00600 CDS 33962..35056 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00610 CDS 35053..36054 product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 transl_table 11 codon_start 1 locus_tag LOCUS_00620 CDS 36055..38391 product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 transl_table 11 codon_start 1 locus_tag LOCUS_00630 CDS complement(38488..39852) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 transl_table 11 codon_start 1 locus_tag LOCUS_00640 CDS complement(39849..41840) product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 transl_table 11 codon_start 1 locus_tag LOCUS_00650 CDS 42308..43114 product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 transl_table 11 codon_start 1 locus_tag LOCUS_00660 sequence003 source 1..42320 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 498..2828 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00670 CDS complement(2836..3900) product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 transl_table 11 codon_start 1 locus_tag LOCUS_00680 CDS complement(3897..4793) product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 transl_table 11 codon_start 1 locus_tag LOCUS_00690 gene argB CDS complement(4790..5794) product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 transl_table 11 codon_start 1 locus_tag LOCUS_00700 CDS complement(5791..6927) product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00710 CDS complement(6918..7976) product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 transl_table 11 codon_start 1 locus_tag LOCUS_00720 gene argC CDS complement(7966..9030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403233.1 transl_table 11 codon_start 1 locus_tag LOCUS_00730 CDS complement(9027..10229) product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404940.1 transl_table 11 codon_start 1 locus_tag LOCUS_00740 gene argG CDS complement(10222..10686) product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 transl_table 11 codon_start 1 locus_tag LOCUS_00750 CDS complement(10794..12287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00760 CDS complement(12474..14270) product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 transl_table 11 codon_start 1 locus_tag LOCUS_00770 gene typA CDS complement(14376..15794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00780 CDS complement(15851..16471) product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 transl_table 11 codon_start 1 locus_tag LOCUS_00790 CDS complement(16472..18985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00800 CDS 19307..20335 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00810 CDS 20369..22270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00820 CDS 22270..23838 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00830 CDS 23835..24344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00840 CDS 24341..25840 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508949.1 transl_table 11 codon_start 1 locus_tag LOCUS_00850 CDS complement(25885..26829) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00860 CDS complement(26826..27233) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00870 CDS complement(27254..27760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00880 CDS complement(27757..28026) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00890 CDS 28055..29818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00900 CDS 29854..30792 product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 transl_table 11 codon_start 1 locus_tag LOCUS_00910 CDS 30813..31208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00920 CDS 31243..33786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00930 CDS complement(33796..35886) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00940 CDS complement(35883..38207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00950 CDS complement(38235..38984) product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 transl_table 11 codon_start 1 locus_tag LOCUS_00960 CDS complement(38986..39843) product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 transl_table 11 codon_start 1 locus_tag LOCUS_00970 CDS complement(39843..40658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00980 CDS complement(40659..41072) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_00990 CDS complement(41076..41795) product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 transl_table 11 codon_start 1 locus_tag LOCUS_01000 gene tolQ sequence004 source 1..41732 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 850..2427 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01010 CDS 2462..7768 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 transl_table 11 codon_start 1 locus_tag LOCUS_01020 CDS complement(7842..8966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01030 CDS 9096..9938 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 transl_table 11 codon_start 1 locus_tag LOCUS_01040 CDS complement(10058..10870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01050 CDS complement(10887..11789) product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 transl_table 11 codon_start 1 locus_tag LOCUS_01060 CDS complement(12739..12966) product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939491.1 transl_table 11 codon_start 1 locus_tag LOCUS_01070 gene infA CDS complement(12982..14175) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 transl_table 11 codon_start 1 locus_tag LOCUS_01080 gene tgt CDS complement(14172..15641) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01090 CDS 16094..18784 product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 transl_table 11 codon_start 1 locus_tag LOCUS_01100 gene clpB CDS 18958..20385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01110 CDS complement(20377..21222) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 transl_table 11 codon_start 1 locus_tag LOCUS_01120 CDS 21304..22020 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01130 CDS 22440..22673 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01140 CDS complement(22781..23539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01150 CDS complement(23725..23979) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01160 CDS complement(23976..25358) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120249.1 transl_table 11 codon_start 1 locus_tag LOCUS_01170 CDS complement(25390..25866) product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 transl_table 11 codon_start 1 locus_tag LOCUS_01180 CDS complement(25869..29300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01190 CDS complement(29326..29646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01200 CDS complement(29665..32715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01210 CDS 32893..34164 product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 transl_table 11 codon_start 1 locus_tag LOCUS_01220 CDS 34481..35158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01230 CDS 35207..35563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01240 CDS 35666..36112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01250 CDS complement(36133..36384) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01260 CDS complement(36395..37882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01270 CDS complement(38132..39532) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 transl_table 11 codon_start 1 locus_tag LOCUS_01280 CDS 39677..40336 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 transl_table 11 codon_start 1 locus_tag LOCUS_01290 sequence005 source 1..39561 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(865..2727) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499797.1 transl_table 11 codon_start 1 locus_tag LOCUS_01300 gene mnmG CDS complement(2760..3239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01310 CDS complement(3285..3770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01320 CDS 4107..4904 product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 transl_table 11 codon_start 1 locus_tag LOCUS_01330 gene soj CDS 4901..5791 product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 transl_table 11 codon_start 1 locus_tag LOCUS_01340 CDS 5788..6393 product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 transl_table 11 codon_start 1 locus_tag LOCUS_01350 gene udk CDS 6806..7315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01360 CDS complement(7418..7651) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01370 CDS complement(7722..8324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01380 CDS 8375..9031 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01390 CDS 9262..9729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01400 CDS 9872..10966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01410 CDS 11005..12390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01420 CDS 12437..13048 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01430 CDS 13167..15377 product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 transl_table 11 codon_start 1 locus_tag LOCUS_01440 CDS complement(15296..16078) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 transl_table 11 codon_start 1 locus_tag LOCUS_01450 gene lgt CDS 16167..17855 product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109795256.1 transl_table 11 codon_start 1 locus_tag LOCUS_01460 CDS complement(18096..19766) product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 transl_table 11 codon_start 1 locus_tag LOCUS_01470 gene ubiB CDS complement(19870..20025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01480 CDS 20156..21148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01490 CDS 21401..21850 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01500 CDS 22040..22462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01510 CDS complement(22468..22650) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01520 CDS complement(22808..23338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01530 CDS complement(23347..25086) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 transl_table 11 codon_start 1 locus_tag LOCUS_01540 CDS complement(25351..26004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01550 CDS 26310..27650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01560 CDS 27779..28171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01570 CDS complement(28326..28640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01580 CDS 28722..29030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01590 CDS complement(29140..29601) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01600 CDS complement(29697..30734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01610 CDS complement(30838..32703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01620 CDS complement(32696..33058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01630 CDS 33555..34082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01640 CDS complement(34245..34445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01650 CDS 34690..36069 product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 transl_table 11 codon_start 1 locus_tag LOCUS_01660 CDS 36124..37764 product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 transl_table 11 codon_start 1 locus_tag LOCUS_01670 CDS 37769..38365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01680 CDS 38551..39243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01690 sequence006 source 1..38605 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(285..845) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 transl_table 11 codon_start 1 locus_tag LOCUS_01700 CDS 1019..1312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01710 note possible pseudo, internal stop codon CDS complement(1331..3556) product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 transl_table 11 codon_start 1 locus_tag LOCUS_01720 CDS complement(3666..4466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01730 CDS complement(4597..4950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01740 CDS 4949..8542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01750 CDS 8552..9610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01760 CDS 9607..10440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01770 CDS complement(10510..11772) product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 transl_table 11 codon_start 1 locus_tag LOCUS_01780 CDS 12085..13740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01790 CDS 13821..14759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01800 CDS complement(14965..16809) product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 transl_table 11 codon_start 1 locus_tag LOCUS_01810 CDS complement(16825..17781) product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 transl_table 11 codon_start 1 locus_tag LOCUS_01820 gene lgt CDS complement(17818..18483) product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 transl_table 11 codon_start 1 locus_tag LOCUS_01830 gene radC CDS 18676..18957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01840 CDS complement(18954..20087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01850 CDS complement(20092..20709) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 transl_table 11 codon_start 1 locus_tag LOCUS_01860 CDS complement(20818..21228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01870 CDS complement(21189..22187) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 transl_table 11 codon_start 1 locus_tag LOCUS_01880 CDS 22241..23239 product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 transl_table 11 codon_start 1 locus_tag LOCUS_01890 CDS 23371..23628 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 transl_table 11 codon_start 1 locus_tag LOCUS_01900 CDS complement(23629..24429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01910 CDS complement(24501..27179) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 transl_table 11 codon_start 1 locus_tag LOCUS_01920 CDS 27414..28832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01930 CDS complement(28855..29667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01940 CDS 29784..30743 product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 transl_table 11 codon_start 1 locus_tag LOCUS_01950 gene gldA CDS 30740..32590 product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 transl_table 11 codon_start 1 locus_tag LOCUS_01960 gene selB CDS 33168..34790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01970 CDS 35195..35377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01980 CDS 35404..35916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_01990 CDS 35965..36219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02000 CDS 36276..37262 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02010 CDS complement(37294..37536) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02020 misc_feature complement(37533..>38605) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141544.1:MFS transporter locus_tag LOCUS_02030 sequence007 source 1..38247 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(79..1080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02040 CDS 1317..2213 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 transl_table 11 codon_start 1 locus_tag LOCUS_02050 CDS complement(2226..3662) product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477274.1 transl_table 11 codon_start 1 locus_tag LOCUS_02060 CDS 3815..4996 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 transl_table 11 codon_start 1 locus_tag LOCUS_02070 CDS 5249..6577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02080 CDS 6558..7775 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02090 CDS 7765..10884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02100 CDS complement(10888..11172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02110 CDS 11186..11782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02120 CDS complement(11861..12166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02130 CDS complement(12176..12664) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02140 CDS complement(12764..13123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02150 CDS 13321..14892 product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 transl_table 11 codon_start 1 locus_tag LOCUS_02160 CDS 14904..16061 product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 transl_table 11 codon_start 1 locus_tag LOCUS_02170 gene alr CDS complement(16196..16681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02180 CDS 16773..17876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02190 CDS 17894..19540 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02200 CDS 19540..20805 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02210 CDS complement(20810..22171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02220 CDS complement(22171..24657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02230 CDS complement(24661..25728) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 transl_table 11 codon_start 1 locus_tag LOCUS_02240 CDS 25837..27240 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 transl_table 11 codon_start 1 locus_tag LOCUS_02250 CDS complement(27301..28908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02260 CDS complement(28916..29794) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 transl_table 11 codon_start 1 locus_tag LOCUS_02270 CDS 29942..31513 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948862.1 transl_table 11 codon_start 1 locus_tag LOCUS_02280 CDS 31888..32376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02290 CDS 32398..32652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02300 CDS 32789..33346 product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 transl_table 11 codon_start 1 locus_tag LOCUS_02310 gene sufT CDS 33403..34122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02320 CDS complement(34127..34807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02330 CDS complement(34873..38115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02340 sequence008 source 1..37321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1777..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02350 CDS complement(2677..3468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02360 CDS complement(3985..4206) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02370 CDS complement(4710..7406) product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 transl_table 11 codon_start 1 locus_tag LOCUS_02380 CDS complement(7456..7956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02390 CDS 8069..9505 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 transl_table 11 codon_start 1 locus_tag LOCUS_02400 CDS complement(9581..10807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02410 CDS 11593..12477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02420 CDS 12477..14129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02430 CDS 14126..14710 product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 transl_table 11 codon_start 1 locus_tag LOCUS_02440 gene hisB CDS 14710..16080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02450 CDS 16077..17336 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02460 CDS 17330..18583 product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228145.1 transl_table 11 codon_start 1 locus_tag LOCUS_02470 gene hisD CDS complement(18683..19048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02480 CDS 19196..21241 product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 transl_table 11 codon_start 1 locus_tag LOCUS_02490 CDS 22239..23000 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02500 CDS complement(23154..23447) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02510 CDS complement(24103..24504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02520 CDS complement(24659..26095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02530 CDS complement(26092..27144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02540 CDS complement(27349..27870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02550 CDS complement(27973..29241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02560 note possible pseudo, internal stop codon CDS complement(29219..29677) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02570 CDS complement(29833..30675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02580 CDS 30632..30832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02590 CDS complement(32221..33477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02600 CDS 34020..34382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02610 CDS complement(35011..35871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02620 CDS 36608..37300 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02630 sequence009 source 1..36901 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1413..2024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02640 CDS 2101..3093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02650 CDS 3090..5360 product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 transl_table 11 codon_start 1 locus_tag LOCUS_02660 gene pcrA CDS 5453..6400 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02670 CDS 6428..8320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02680 CDS 8788..9270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02690 CDS 9284..9577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02700 CDS complement(9653..10582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02710 CDS complement(10627..12558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02720 CDS complement(12555..12914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02730 CDS complement(12923..13549) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02740 CDS 13955..14392 product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 transl_table 11 codon_start 1 locus_tag LOCUS_02750 CDS 14393..14671 product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 transl_table 11 codon_start 1 locus_tag LOCUS_02760 CDS 14671..15024 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02770 CDS 15014..15580 product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 transl_table 11 codon_start 1 locus_tag LOCUS_02780 CDS 15577..16008 product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 transl_table 11 codon_start 1 locus_tag LOCUS_02790 CDS 16005..16373 product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 transl_table 11 codon_start 1 locus_tag LOCUS_02800 CDS 16370..17839 product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 transl_table 11 codon_start 1 locus_tag LOCUS_02810 CDS 17836..19308 product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 transl_table 11 codon_start 1 locus_tag LOCUS_02820 CDS 19305..19625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02830 CDS 19618..21321 product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 transl_table 11 codon_start 1 locus_tag LOCUS_02840 CDS complement(21350..22213) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 transl_table 11 codon_start 1 locus_tag LOCUS_02850 gene tesB CDS complement(22362..22676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02860 CDS complement(22717..23487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02870 CDS complement(23484..23861) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02880 CDS complement(23848..24096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02890 CDS complement(24200..25477) product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 transl_table 11 codon_start 1 locus_tag LOCUS_02900 gene hemL CDS complement(25695..26507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02910 CDS complement(26539..29175) product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 transl_table 11 codon_start 1 locus_tag LOCUS_02920 gene gyrA CDS complement(29231..31669) product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 transl_table 11 codon_start 1 locus_tag LOCUS_02930 gene gyrB CDS complement(31880..32983) product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 transl_table 11 codon_start 1 locus_tag LOCUS_02940 gene recF CDS complement(32996..34111) product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 transl_table 11 codon_start 1 locus_tag LOCUS_02950 gene dnaN CDS complement(34408..35730) product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 transl_table 11 codon_start 1 locus_tag LOCUS_02960 gene dnaA CDS 35994..36200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_02970 CDS 36244..36591 product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 transl_table 11 codon_start 1 locus_tag LOCUS_02980 gene rnpA CDS 36588..36842 product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457867.1 transl_table 11 codon_start 1 locus_tag LOCUS_02990 gene yidD sequence010 source 1..35628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(290..2707) product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 transl_table 11 codon_start 1 locus_tag LOCUS_03000 CDS 2739..3932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03010 CDS 3929..5047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03020 CDS complement(5044..7017) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03030 CDS complement(7105..7935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03040 CDS complement(7932..8741) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 transl_table 11 codon_start 1 locus_tag LOCUS_03050 CDS 8930..9199 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03060 CDS 9239..9898 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03070 CDS complement(9822..10193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03080 CDS complement(10304..10747) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03090 CDS complement(10800..11237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03100 CDS complement(11234..12181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03110 CDS 12137..12877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03120 CDS 12927..13568 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03130 CDS 13698..14129 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03140 CDS 14141..14899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03150 CDS 14886..15431 product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 transl_table 11 codon_start 1 locus_tag LOCUS_03160 gene atpH CDS 15515..17041 product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 transl_table 11 codon_start 1 locus_tag LOCUS_03170 gene atpA CDS 17153..18007 product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 transl_table 11 codon_start 1 locus_tag LOCUS_03180 gene atpG CDS 18029..19468 product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 transl_table 11 codon_start 1 locus_tag LOCUS_03190 gene atpD CDS 19513..19908 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03200 CDS 20173..21003 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03210 CDS complement(21349..23028) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03220 CDS complement(23031..24326) product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 transl_table 11 codon_start 1 locus_tag LOCUS_03230 CDS complement(24379..26130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03240 CDS complement(26127..27533) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03250 CDS complement(27609..28460) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 transl_table 11 codon_start 1 locus_tag LOCUS_03260 CDS complement(28536..29855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03270 CDS 29915..30580 product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763772.1 transl_table 11 codon_start 1 locus_tag LOCUS_03280 gene bioD CDS 30657..32510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03290 CDS complement(32635..32997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03300 CDS 32975..33844 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 transl_table 11 codon_start 1 locus_tag LOCUS_03310 CDS complement(33942..34538) product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 transl_table 11 codon_start 1 locus_tag LOCUS_03320 CDS complement(34575..35174) product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 transl_table 11 codon_start 1 locus_tag LOCUS_03330 sequence011 source 1..29623 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(411..2579) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03340 CDS 2560..2748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03350 CDS complement(2745..3539) product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 transl_table 11 codon_start 1 locus_tag LOCUS_03360 gene pcaD CDS complement(3563..3943) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03370 CDS complement(4042..6294) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03380 CDS 6612..7226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03390 CDS complement(7236..8657) product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 transl_table 11 codon_start 1 locus_tag LOCUS_03400 gene pntB CDS complement(8662..10209) product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 transl_table 11 codon_start 1 locus_tag LOCUS_03410 gene pntA CDS complement(10280..10714) product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 transl_table 11 codon_start 1 locus_tag LOCUS_03420 CDS 10885..11901 product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 transl_table 11 codon_start 1 locus_tag LOCUS_03430 gene proB CDS 11898..13178 product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 transl_table 11 codon_start 1 locus_tag LOCUS_03440 CDS 13289..14509 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03450 CDS complement(14620..15738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03460 CDS complement(15872..16654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03470 CDS 16898..17818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03480 CDS 17833..19164 product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 transl_table 11 codon_start 1 locus_tag LOCUS_03490 gene allB CDS 19176..20672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03500 CDS 20669..21007 product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920127.1 transl_table 11 codon_start 1 locus_tag LOCUS_03510 gene hiuH CDS 21009..22340 product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 transl_table 11 codon_start 1 locus_tag LOCUS_03520 CDS 22340..22948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03530 note possible pseudo, internal stop codon CDS 22952..23527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03540 note possible pseudo, internal stop codon CDS 24119..24742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03550 CDS complement(24747..25814) product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 transl_table 11 codon_start 1 locus_tag LOCUS_03560 CDS complement(25811..26425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03570 CDS 26658..26843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03580 CDS 26937..28661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03590 CDS 28658..29167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03600 sequence012 source 1..28892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(634..837) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03610 CDS complement(991..2490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03620 CDS 2708..4330 product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 transl_table 11 codon_start 1 locus_tag LOCUS_03630 CDS complement(4472..4771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03640 CDS 4868..5716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03650 CDS complement(5743..6477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03660 CDS 6575..8065 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 transl_table 11 codon_start 1 locus_tag LOCUS_03670 CDS 8149..9420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03680 CDS complement(9421..10317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03690 CDS complement(10299..12320) product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 transl_table 11 codon_start 1 locus_tag LOCUS_03700 gene uvrB CDS complement(12474..14219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03710 CDS complement(14356..17193) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03720 CDS 17297..19126 product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 transl_table 11 codon_start 1 locus_tag LOCUS_03730 gene uvrC CDS complement(19138..19977) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 transl_table 11 codon_start 1 locus_tag LOCUS_03740 CDS complement(19982..22528) product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 transl_table 11 codon_start 1 locus_tag LOCUS_03750 CDS 22778..24454 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 transl_table 11 codon_start 1 locus_tag LOCUS_03760 CDS 24493..26763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03770 CDS 26766..26996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03780 CDS 27045..28370 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03790 sequence013 source 1..27420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 607..1506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03800 CDS complement(1487..3280) product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 transl_table 11 codon_start 1 locus_tag LOCUS_03810 CDS complement(3321..4010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03820 CDS complement(4071..4820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03830 CDS complement(4817..5896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03840 CDS complement(5941..6999) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03850 CDS complement(6996..8912) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 transl_table 11 codon_start 1 locus_tag LOCUS_03860 CDS complement(8919..11141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03870 CDS complement(11141..12838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03880 CDS complement(12865..14424) product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020918.1 transl_table 11 codon_start 1 locus_tag LOCUS_03890 CDS complement(14424..18044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03900 CDS 18152..19615 product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970025.1 transl_table 11 codon_start 1 locus_tag LOCUS_03910 CDS 19631..20428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03920 CDS 20425..21138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03930 CDS complement(21120..21353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03940 CDS 21609..22760 product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 transl_table 11 codon_start 1 locus_tag LOCUS_03950 gene rnd CDS 22955..23110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_03960 CDS 23338..24192 product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 transl_table 11 codon_start 1 locus_tag LOCUS_03970 gene cpaB CDS 24259..25656 product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 transl_table 11 codon_start 1 locus_tag LOCUS_03980 CDS 25669..26877 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 transl_table 11 codon_start 1 locus_tag LOCUS_03990 sequence014 source 1..27137 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 22..459 product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 transl_table 11 codon_start 1 locus_tag LOCUS_04000 gene ruvX CDS 459..1181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04010 CDS 1178..2083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04020 CDS 2080..3006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04030 CDS complement(3003..4496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04040 CDS complement(4778..5530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04050 CDS 5638..6795 product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 transl_table 11 codon_start 1 locus_tag LOCUS_04060 CDS complement(6785..8884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04070 CDS 8904..10238 product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 transl_table 11 codon_start 1 locus_tag LOCUS_04080 gene selA CDS 10235..11176 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04090 CDS 11176..12153 product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 transl_table 11 codon_start 1 locus_tag LOCUS_04100 CDS complement(12161..13129) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04110 CDS complement(13277..14257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04120 CDS complement(14397..14669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04130 CDS 14709..15644 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04140 CDS complement(15646..16713) product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 transl_table 11 codon_start 1 locus_tag LOCUS_04150 CDS 16758..17420 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 transl_table 11 codon_start 1 locus_tag LOCUS_04160 CDS 17450..18886 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04170 CDS 18883..20535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04180 CDS complement(20532..21623) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04190 CDS complement(21784..22449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04200 CDS complement(22496..23779) product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083037.1 transl_table 11 codon_start 1 locus_tag LOCUS_04210 CDS complement(23782..25179) product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 transl_table 11 codon_start 1 locus_tag LOCUS_04220 CDS complement(25172..26068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04230 misc_feature complement(26068..>27137) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000587238.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_04240 sequence015 source 1..26762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1714..2538 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 transl_table 11 codon_start 1 locus_tag LOCUS_04250 CDS 2540..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04260 CDS 3168..4316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 transl_table 11 codon_start 1 locus_tag LOCUS_04270 tRNA 4485..4556 product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00020 CDS 4599..5561 product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 transl_table 11 codon_start 1 locus_tag LOCUS_04280 CDS 5773..6390 product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 transl_table 11 codon_start 1 locus_tag LOCUS_04290 CDS 6393..7016 product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 transl_table 11 codon_start 1 locus_tag LOCUS_04300 gene pth CDS 7036..9150 product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 transl_table 11 codon_start 1 locus_tag LOCUS_04310 CDS 9169..9666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04320 CDS 9678..10121 product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 transl_table 11 codon_start 1 locus_tag LOCUS_04330 gene rplI CDS 10184..11521 product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 transl_table 11 codon_start 1 locus_tag LOCUS_04340 gene dnaB CDS 11673..12719 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04350 CDS 13056..13658 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 transl_table 11 codon_start 1 locus_tag LOCUS_04360 CDS complement(13655..14392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04370 CDS 14570..16204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04380 CDS 16229..17074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04390 CDS 17135..18673 product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 transl_table 11 codon_start 1 locus_tag LOCUS_04400 gene guaA CDS 18789..19076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04410 CDS 19131..19736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04420 CDS complement(19708..20487) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 transl_table 11 codon_start 1 locus_tag LOCUS_04430 CDS complement(20484..21293) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04440 CDS complement(21301..22095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04450 CDS complement(22250..22942) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04460 CDS 23133..25982 product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929817.1 transl_table 11 codon_start 1 locus_tag LOCUS_04470 sequence016 source 1..26500 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 156..2780 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04480 CDS complement(2909..3211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04490 CDS 3119..3826 product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 transl_table 11 codon_start 1 locus_tag LOCUS_04500 CDS 3807..4388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 transl_table 11 codon_start 1 locus_tag LOCUS_04510 CDS 4418..4750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04520 CDS 4838..6970 product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 transl_table 11 codon_start 1 locus_tag LOCUS_04530 CDS complement(7058..7903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04540 CDS 7998..8909 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241247.1 transl_table 11 codon_start 1 locus_tag LOCUS_04550 CDS complement(9223..10140) product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 transl_table 11 codon_start 1 locus_tag LOCUS_04560 CDS 10332..11054 product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 transl_table 11 codon_start 1 locus_tag LOCUS_04570 CDS complement(11182..11598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04580 CDS complement(11614..12276) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 transl_table 11 codon_start 1 locus_tag LOCUS_04590 CDS 12391..14631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04600 CDS 14631..15935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04610 CDS 15953..16885 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535091.1 transl_table 11 codon_start 1 locus_tag LOCUS_04620 CDS 16990..17460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04630 CDS complement(17525..18121) product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 transl_table 11 codon_start 1 locus_tag LOCUS_04640 gene cynT CDS complement(18205..19062) product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 transl_table 11 codon_start 1 locus_tag LOCUS_04650 gene nhaR CDS 19265..20434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04660 CDS 20441..21223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04670 CDS complement(21285..21743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04680 CDS complement(21736..22224) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04690 CDS 22562..22807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04700 CDS complement(22804..23604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04710 CDS 23707..24660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04720 CDS 24825..25397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04730 CDS 25394..26464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04740 sequence017 source 1..26142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 516..2993 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04750 CDS 3004..4167 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04760 CDS 4172..4999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04770 CDS 5498..5725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04780 CDS 5743..6060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04790 CDS 6369..6512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04800 CDS 6545..6667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04810 CDS complement(6691..7344) product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080696.1 transl_table 11 codon_start 1 locus_tag LOCUS_04820 CDS complement(7335..8195) product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 transl_table 11 codon_start 1 locus_tag LOCUS_04830 CDS 8511..10334 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 transl_table 11 codon_start 1 locus_tag LOCUS_04840 CDS 10374..10847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04850 CDS 10966..11430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04860 CDS 11427..12014 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04870 CDS 12034..12492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04880 CDS complement(12531..14093) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04890 CDS complement(14146..16023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04900 CDS complement(16122..16775) product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 transl_table 11 codon_start 1 locus_tag LOCUS_04910 gene rpe CDS complement(16763..17683) product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 transl_table 11 codon_start 1 locus_tag LOCUS_04920 gene fmt CDS complement(17717..18310) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04930 CDS complement(18307..18831) product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 transl_table 11 codon_start 1 locus_tag LOCUS_04940 gene def CDS 18917..19633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04950 CDS 19630..21138 product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 transl_table 11 codon_start 1 locus_tag LOCUS_04960 CDS 21334..23607 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04970 CDS 23702..24187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04980 CDS 24338..24556 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_04990 CDS 24595..25059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05000 CDS complement(25109..25750) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05010 sequence018 source 1..25315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..2034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05020 CDS complement(2117..3340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05030 CDS 3613..3816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05040 CDS 4198..4419 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05050 CDS complement(4616..5641) product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 transl_table 11 codon_start 1 locus_tag LOCUS_05060 gene rfbB CDS complement(5638..6528) product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 transl_table 11 codon_start 1 locus_tag LOCUS_05070 gene rfbD CDS complement(6525..7070) product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 transl_table 11 codon_start 1 locus_tag LOCUS_05080 gene rfbC CDS complement(7067..7942) product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 transl_table 11 codon_start 1 locus_tag LOCUS_05090 gene rfbA CDS complement(7939..9966) product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 transl_table 11 codon_start 1 locus_tag LOCUS_05100 CDS complement(10043..13279) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05110 CDS 13458..14447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05120 CDS complement(14552..14806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05130 CDS complement(14909..15898) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05140 CDS 16079..17734 product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 transl_table 11 codon_start 1 locus_tag LOCUS_05150 gene recN CDS complement(17823..18389) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05160 CDS complement(18585..20030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05170 CDS complement(20052..21809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05180 CDS complement(21806..22993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05190 CDS 22883..23086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05200 CDS complement(23139..24860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05210 sequence019 source 1..25300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1077..1313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05220 CDS 1303..1722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05230 CDS complement(1719..2210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05240 CDS complement(2305..3270) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 transl_table 11 codon_start 1 locus_tag LOCUS_05250 CDS 3571..4224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05260 CDS 4358..5125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05270 CDS complement(5129..7489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05280 CDS complement(7524..8156) product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 transl_table 11 codon_start 1 locus_tag LOCUS_05290 CDS complement(8156..8320) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05300 CDS 8378..9256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05310 CDS 9320..10150 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841164.1 transl_table 11 codon_start 1 locus_tag LOCUS_05320 CDS complement(10248..11711) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 transl_table 11 codon_start 1 locus_tag LOCUS_05330 CDS complement(11748..13013) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05340 CDS 13127..13897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 transl_table 11 codon_start 1 locus_tag LOCUS_05350 CDS 14023..14793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05360 CDS complement(14902..17532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05370 CDS complement(17570..18217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05380 CDS 18203..18658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05390 CDS 18630..18932 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05400 CDS 19478..21034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05410 CDS 21110..22957 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05420 CDS 22965..24278 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 transl_table 11 codon_start 1 locus_tag LOCUS_05430 sequence020 source 1..25109 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05440 CDS complement(1006..1842) product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 transl_table 11 codon_start 1 locus_tag LOCUS_05450 CDS complement(1940..3574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05460 CDS 3636..4208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05470 CDS complement(4272..5315) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05480 CDS 5792..6763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05490 CDS 6915..8846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05500 CDS complement(8874..9908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05510 CDS 9999..12665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05520 CDS complement(12752..13618) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05530 CDS 13734..15356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05540 CDS 15353..16699 product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 transl_table 11 codon_start 1 locus_tag LOCUS_05550 CDS 16882..18915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05560 CDS 19073..19885 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05570 CDS 20795..22060 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 transl_table 11 codon_start 1 locus_tag LOCUS_05580 CDS 22057..22836 product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 transl_table 11 codon_start 1 locus_tag LOCUS_05590 CDS 22840..24033 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 transl_table 11 codon_start 1 locus_tag LOCUS_05600 CDS 24030..25100 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 transl_table 11 codon_start 1 locus_tag LOCUS_05610 sequence021 source 1..24864 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(510..1484) product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 transl_table 11 codon_start 1 locus_tag LOCUS_05620 CDS 1654..1869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05630 CDS 1956..4892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05640 CDS 4889..5428 product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 transl_table 11 codon_start 1 locus_tag LOCUS_05650 CDS complement(5418..6194) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 transl_table 11 codon_start 1 locus_tag LOCUS_05660 CDS complement(6191..6634) product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 transl_table 11 codon_start 1 locus_tag LOCUS_05670 gene dtd CDS complement(6639..8324) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05680 CDS complement(8493..8753) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05690 CDS 8991..9137 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05700 CDS complement(9237..9596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05710 CDS 9735..11840 product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 transl_table 11 codon_start 1 locus_tag LOCUS_05720 CDS 11844..12842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05730 CDS complement(12843..15275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05740 CDS complement(15290..15652) product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 transl_table 11 codon_start 1 locus_tag LOCUS_05750 gene dksA CDS 15766..16689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05760 CDS complement(16701..17522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05770 CDS 17576..18124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05780 CDS 18127..18309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05790 CDS 18343..19377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05800 CDS complement(19394..20185) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05810 misc_feature complement(20468..>24864) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479069.1:multidrug efflux RND transporter permease subunit VmeK locus_tag LOCUS_05820 sequence022 source 1..24811 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 873..1955 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 transl_table 11 codon_start 1 locus_tag LOCUS_05830 CDS complement(2094..3653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05840 CDS complement(3826..4386) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05850 CDS 5114..5683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05860 CDS complement(5680..6702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05870 CDS 7026..8630 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 transl_table 11 codon_start 1 locus_tag LOCUS_05880 CDS complement(8640..11009) product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 transl_table 11 codon_start 1 locus_tag LOCUS_05890 CDS complement(11009..12268) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05900 CDS complement(12268..13095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05910 CDS complement(13127..13531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05920 CDS 13642..14502 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945810.1 transl_table 11 codon_start 1 locus_tag LOCUS_05930 CDS 14520..14906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05940 CDS 14941..15486 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05950 CDS complement(15483..16058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_05960 CDS 16523..17611 product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 transl_table 11 codon_start 1 locus_tag LOCUS_05970 gene aroC CDS complement(17625..18917) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 transl_table 11 codon_start 1 locus_tag LOCUS_05980 CDS complement(18991..19887) product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 transl_table 11 codon_start 1 locus_tag LOCUS_05990 gene add CDS complement(19903..20964) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06000 CDS 21050..23182 product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922751.1 transl_table 11 codon_start 1 locus_tag LOCUS_06010 CDS 23179..23478 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06020 sequence023 source 1..24723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1249 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640527.1:pitrilysin family protein locus_tag LOCUS_06030 CDS 1265..2182 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 transl_table 11 codon_start 1 locus_tag LOCUS_06040 CDS 2261..3292 product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06050 CDS 3380..5059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06060 CDS 5091..6398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06070 CDS 6553..8469 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06080 CDS 8469..9239 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 transl_table 11 codon_start 1 locus_tag LOCUS_06090 gene xth CDS 9239..10039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06100 CDS complement(10014..11333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06110 CDS complement(11333..11971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06120 CDS complement(12075..13184) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 transl_table 11 codon_start 1 locus_tag LOCUS_06130 CDS 13238..14620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06140 CDS 14875..17418 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06150 CDS 17428..18897 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06160 CDS complement(18906..19901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06170 CDS complement(19898..20872) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06180 CDS 20964..22406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06190 CDS 22532..24187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06200 CDS complement(24200..24433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06210 sequence024 source 1..24512 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06220 CDS complement(1257..1850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06230 CDS 2019..3008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06240 CDS 4138..4983 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 transl_table 11 codon_start 1 locus_tag LOCUS_06250 CDS complement(5105..6103) product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 transl_table 11 codon_start 1 locus_tag LOCUS_06260 gene eutC CDS complement(6563..6775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06270 CDS 6918..8393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06280 CDS 8593..9093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06290 CDS 9074..10069 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06300 CDS 10078..10233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06310 CDS 10597..11457 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06320 CDS 12315..13448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06330 CDS complement(13418..13927) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06340 CDS complement(14017..14649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06350 CDS complement(15273..16277) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171654.1 transl_table 11 codon_start 1 locus_tag LOCUS_06360 CDS 17408..17863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06370 CDS complement(18036..19802) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06380 CDS complement(20710..21354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06390 CDS 21613..22140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06400 CDS complement(22244..23317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06410 CDS complement(23511..24035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06420 CDS 24135..24467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06430 sequence025 source 1..24009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1181..2089) product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132585.1 transl_table 11 codon_start 1 locus_tag LOCUS_06440 CDS complement(2086..3744) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06450 CDS complement(3741..5408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06460 CDS 5470..5988 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 transl_table 11 codon_start 1 locus_tag LOCUS_06470 CDS 5985..6413 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06480 CDS 6425..7009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06490 CDS complement(7012..7587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06500 CDS complement(7861..8868) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 transl_table 11 codon_start 1 locus_tag LOCUS_06510 CDS complement(8865..10532) product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 transl_table 11 codon_start 1 locus_tag LOCUS_06520 CDS complement(10589..11512) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 transl_table 11 codon_start 1 locus_tag LOCUS_06530 CDS complement(11521..12537) product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 transl_table 11 codon_start 1 locus_tag LOCUS_06540 CDS 12604..13392 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06550 CDS complement(13330..13518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06560 CDS 13775..15439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06570 CDS 15477..15917 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 transl_table 11 codon_start 1 locus_tag LOCUS_06580 CDS 15952..17010 product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 transl_table 11 codon_start 1 locus_tag LOCUS_06590 CDS complement(17161..17595) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06600 CDS 17756..18124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06610 CDS 18121..18483 product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 transl_table 11 codon_start 1 locus_tag LOCUS_06620 CDS 18493..18975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06630 CDS complement(19145..21181) product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 transl_table 11 codon_start 1 locus_tag LOCUS_06640 CDS 21303..22826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06650 misc_feature complement(22835..>24009) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056043.1:ammonium transporter locus_tag LOCUS_06660 sequence026 source 1..23972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1059..2000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06670 CDS complement(2015..3211) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06680 CDS complement(3235..4356) product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 transl_table 11 codon_start 1 locus_tag LOCUS_06690 CDS complement(4522..5676) product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 transl_table 11 codon_start 1 locus_tag LOCUS_06700 CDS 5939..6406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06710 CDS 6403..7083 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06720 CDS complement(7086..8678) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 transl_table 11 codon_start 1 locus_tag LOCUS_06730 CDS complement(8815..9195) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06740 CDS complement(9156..9563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06750 CDS complement(10081..10452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06760 CDS complement(10566..10988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06770 CDS 11057..12274 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 transl_table 11 codon_start 1 locus_tag LOCUS_06780 CDS complement(12748..13083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06790 CDS 13096..15300 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224374.1 transl_table 11 codon_start 1 locus_tag LOCUS_06800 CDS 15297..16439 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06810 sequence027 source 1..23794 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(718..1656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06820 CDS complement(1653..2102) product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 transl_table 11 codon_start 1 locus_tag LOCUS_06830 CDS complement(2168..3043) product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 transl_table 11 codon_start 1 locus_tag LOCUS_06840 CDS complement(3086..4210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06850 CDS complement(4259..4462) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06860 CDS complement(4527..5522) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06870 CDS complement(5709..7238) product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 transl_table 11 codon_start 1 locus_tag LOCUS_06880 gene paaZ CDS complement(7304..9295) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06890 CDS 9391..10152 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 transl_table 11 codon_start 1 locus_tag LOCUS_06900 CDS 10149..11102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06910 CDS 11099..12748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06920 CDS complement(12729..15854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06930 CDS 15867..16358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06940 CDS complement(16330..17061) product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533365.1 transl_table 11 codon_start 1 locus_tag LOCUS_06950 CDS 17166..17465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06960 CDS 17737..18723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06970 CDS complement(18941..19945) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06980 CDS 20273..21772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_06990 CDS 21778..22881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07000 sequence028 source 1..23627 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 695..1132 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07010 CDS 1129..1521 product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 transl_table 11 codon_start 1 locus_tag LOCUS_07020 CDS 1518..2240 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 transl_table 11 codon_start 1 locus_tag LOCUS_07030 CDS 2237..3142 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 transl_table 11 codon_start 1 locus_tag LOCUS_07040 CDS 3142..4254 product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 transl_table 11 codon_start 1 locus_tag LOCUS_07050 CDS 4258..5883 product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225958.1 transl_table 11 codon_start 1 locus_tag LOCUS_07060 CDS 5970..6971 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07070 CDS 6988..8019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07080 CDS complement(8038..8292) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07090 CDS complement(8362..8697) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07100 CDS complement(8725..8928) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07110 CDS complement(8960..11035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07120 CDS complement(11108..11797) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07130 CDS complement(11872..12087) product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696096.1 transl_table 11 codon_start 1 locus_tag LOCUS_07140 CDS 12233..12715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07150 CDS 12597..12866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07160 CDS 12836..13363 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07170 CDS 13360..13731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07180 CDS 13832..15493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07190 CDS complement(15490..16230) product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 transl_table 11 codon_start 1 locus_tag LOCUS_07200 CDS 16320..17183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07210 CDS complement(17537..18658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07220 CDS 18805..19500 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07230 CDS 19497..20495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07240 CDS complement(20434..21486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07250 sequence029 source 1..23520 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1777..5601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07260 CDS 5635..7311 product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 transl_table 11 codon_start 1 locus_tag LOCUS_07270 CDS 7437..8207 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07280 CDS complement(8226..10301) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 transl_table 11 codon_start 1 locus_tag LOCUS_07290 CDS complement(10420..11892) product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 transl_table 11 codon_start 1 locus_tag LOCUS_07300 gene glpK CDS 12021..13349 product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 transl_table 11 codon_start 1 locus_tag LOCUS_07310 CDS 13339..14355 product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 transl_table 11 codon_start 1 locus_tag LOCUS_07320 CDS 14387..15427 product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 transl_table 11 codon_start 1 locus_tag LOCUS_07330 CDS complement(15424..16524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07340 CDS complement(16584..17738) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07350 CDS complement(17719..17985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07360 CDS 18067..19380 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07370 CDS 19373..20347 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07380 CDS complement(20344..21702) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 transl_table 11 codon_start 1 locus_tag LOCUS_07390 misc_feature complement(21699..>23520) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943129.1:PAS domain-containing sensor histidine kinase locus_tag LOCUS_07400 sequence030 source 1..22568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 491..5104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07410 CDS 5149..6525 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07420 CDS 6587..7441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07430 CDS 7502..10036 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 transl_table 11 codon_start 1 locus_tag LOCUS_07440 CDS complement(10059..10715) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07450 CDS complement(10752..11174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07460 CDS 11426..11635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07470 CDS complement(11632..13404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07480 CDS 13581..14963 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07490 CDS 14994..15599 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07500 CDS complement(15607..17907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07510 CDS 18080..19141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07520 CDS 19260..19727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07530 CDS 19717..21057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07540 CDS complement(21335..21700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07550 sequence031 source 1..22460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 657..1064 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07560 CDS 1121..1369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07570 CDS complement(1446..2558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07580 CDS 2645..3646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07590 CDS complement(3659..4054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07600 CDS 4177..5214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07610 CDS complement(5211..5777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07620 CDS 5955..7799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07630 CDS 7911..8450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07640 CDS 8447..9034 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07650 CDS complement(9043..9915) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 transl_table 11 codon_start 1 locus_tag LOCUS_07660 CDS 9914..10237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07670 CDS 10553..11104 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07680 CDS complement(11171..15202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07690 CDS complement(15247..16362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07700 CDS complement(16586..17080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07710 CDS complement(17077..17736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07720 CDS complement(17745..18365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07730 CDS complement(18375..18539) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07740 CDS 19143..20789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07750 CDS 20786..22114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07760 sequence032 source 1..22329 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 749..2398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07770 CDS 2395..3096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07780 CDS 3163..4830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07790 CDS 4919..5761 product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939818.1 transl_table 11 codon_start 1 locus_tag LOCUS_07800 CDS 5758..7452 product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 transl_table 11 codon_start 1 locus_tag LOCUS_07810 CDS complement(7461..9905) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07820 CDS complement(9800..11791) product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 transl_table 11 codon_start 1 locus_tag LOCUS_07830 CDS 11859..12212 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07840 CDS 12289..13227 product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 transl_table 11 codon_start 1 locus_tag LOCUS_07850 CDS 13248..13691 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07860 CDS 13905..14741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07870 CDS complement(14716..15885) product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 transl_table 11 codon_start 1 locus_tag LOCUS_07880 gene tdh CDS complement(16041..16586) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07890 CDS 16736..17038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07900 CDS complement(17048..17767) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07910 CDS complement(18158..19927) product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101855.1 transl_table 11 codon_start 1 locus_tag LOCUS_07920 CDS complement(19965..21341) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07930 tRNA complement(21382..21458) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00030 tRNA complement(21731..21818) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00040 tRNA complement(21852..21936) product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00050 sequence033 source 1..22162 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1847..2731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07940 CDS 2802..3923 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07950 CDS 4089..6065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_07960 CDS 6083..7519 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 transl_table 11 codon_start 1 locus_tag LOCUS_07970 CDS complement(7559..8176) product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 transl_table 11 codon_start 1 locus_tag LOCUS_07980 CDS complement(8166..8762) product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 transl_table 11 codon_start 1 locus_tag LOCUS_07990 gene yihA CDS 8795..9979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08000 CDS 10032..12338 product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 transl_table 11 codon_start 1 locus_tag LOCUS_08010 gene lon CDS complement(12400..16413) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08020 CDS 16467..17669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08030 CDS complement(17666..18661) product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390376.1 transl_table 11 codon_start 1 locus_tag LOCUS_08040 CDS 18796..20070 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327976.1 transl_table 11 codon_start 1 locus_tag LOCUS_08050 gene clpX CDS 20080..20616 product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241129.1 transl_table 11 codon_start 1 locus_tag LOCUS_08060 CDS complement(20631..21707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08070 sequence034 source 1..21885 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..1125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08080 CDS complement(1122..1994) product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 transl_table 11 codon_start 1 locus_tag LOCUS_08090 CDS 2286..4202 product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 transl_table 11 codon_start 1 locus_tag LOCUS_08100 CDS 4266..5408 product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 transl_table 11 codon_start 1 locus_tag LOCUS_08110 CDS 5433..5906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08120 CDS complement(5907..6296) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08130 CDS 6457..6639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08140 CDS 6731..6892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08150 CDS complement(6998..8782) product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 transl_table 11 codon_start 1 locus_tag LOCUS_08160 CDS 9327..10505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08170 CDS complement(10511..10891) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 transl_table 11 codon_start 1 locus_tag LOCUS_08180 CDS complement(10912..11286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08190 CDS complement(11574..11912) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08200 CDS complement(11922..12698) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08210 CDS complement(12870..13283) product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 transl_table 11 codon_start 1 locus_tag LOCUS_08220 CDS complement(13342..14478) product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 transl_table 11 codon_start 1 locus_tag LOCUS_08230 gene acdA CDS complement(14572..15348) product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 transl_table 11 codon_start 1 locus_tag LOCUS_08240 CDS complement(15351..16244) product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 transl_table 11 codon_start 1 locus_tag LOCUS_08250 CDS 16437..19841 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08260 CDS 19823..21790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08270 sequence035 source 1..21164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..516 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112465.1:YceI family protein locus_tag LOCUS_08280 CDS complement(589..1521) product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 transl_table 11 codon_start 1 locus_tag LOCUS_08290 CDS complement(1567..2181) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08300 CDS 2254..2997 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08310 CDS complement(3044..4126) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 transl_table 11 codon_start 1 locus_tag LOCUS_08320 CDS 4371..4703 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08330 CDS complement(4738..4947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08340 CDS 4838..5278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08350 CDS complement(5275..7044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08360 CDS complement(7124..8227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08370 CDS complement(8281..10041) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08380 CDS complement(10133..11608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08390 CDS 11664..12671 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 transl_table 11 codon_start 1 locus_tag LOCUS_08400 CDS complement(12741..13781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08410 CDS complement(13876..15693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08420 CDS complement(15693..16430) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08430 CDS complement(16483..17124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08440 CDS 17164..17832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08450 CDS complement(17833..18621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08460 CDS 19000..19905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08470 CDS complement(19902..20603) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08480 sequence036 source 1..20915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3073..4842) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08490 CDS complement(4897..6675) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 transl_table 11 codon_start 1 locus_tag LOCUS_08500 CDS complement(6754..7464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08510 CDS complement(7482..7925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08520 CDS 8081..9226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08530 CDS 9226..9666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08540 CDS 9676..10422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08550 CDS 10419..11252 product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 transl_table 11 codon_start 1 locus_tag LOCUS_08560 CDS complement(11275..12069) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08570 CDS 12121..13062 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08580 CDS 13153..14124 product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453785.1 transl_table 11 codon_start 1 locus_tag LOCUS_08590 gene bioB CDS complement(14106..15131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08600 CDS 15185..16426 product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 transl_table 11 codon_start 1 locus_tag LOCUS_08610 CDS complement(16437..17717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08620 CDS complement(17717..18460) product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 transl_table 11 codon_start 1 locus_tag LOCUS_08630 misc_feature complement(18457..>20915) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902969.1:sulfatase-like hydrolase/transferase locus_tag LOCUS_08640 sequence037 source 1..20768 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..2776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08650 CDS complement(2910..12929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08660 CDS complement(13071..14564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08670 CDS 14709..15875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08680 CDS 15928..17226 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08690 CDS 17236..18396 product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 transl_table 11 codon_start 1 locus_tag LOCUS_08700 CDS 18555..18959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08710 CDS complement(19028..19504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08720 CDS 19719..20600 product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 transl_table 11 codon_start 1 locus_tag LOCUS_08730 sequence038 source 1..20748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(654..1574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08740 CDS complement(1571..1834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08750 CDS 2283..2660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08760 CDS 2926..3084 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08770 CDS complement(3347..3631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08780 CDS 4059..5633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08790 CDS 5769..7253 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08800 CDS 7768..10422 product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 transl_table 11 codon_start 1 locus_tag LOCUS_08810 gene ppc CDS complement(10693..11397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08820 CDS complement(11648..12259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08830 CDS 12435..12698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08840 CDS complement(12617..13459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08850 CDS complement(13459..14802) product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 transl_table 11 codon_start 1 locus_tag LOCUS_08860 CDS complement(14799..16376) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08870 CDS complement(16469..17551) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 transl_table 11 codon_start 1 locus_tag LOCUS_08880 CDS complement(17595..18728) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 transl_table 11 codon_start 1 locus_tag LOCUS_08890 note possible pseudo, internal stop codon, frameshifted CDS complement(18875..19102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08900 CDS 19026..19760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08910 sequence039 source 1..20727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 477..869 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08920 CDS complement(901..1884) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 transl_table 11 codon_start 1 locus_tag LOCUS_08930 CDS complement(2034..2696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08940 CDS complement(2697..3401) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08950 CDS complement(3448..4194) product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 transl_table 11 codon_start 1 locus_tag LOCUS_08960 gene fdhD CDS 4335..6446 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08970 CDS complement(6486..6971) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08980 CDS complement(6997..8280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_08990 CDS complement(8419..10134) product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052368191.1 transl_table 11 codon_start 1 locus_tag LOCUS_09000 CDS 10196..11851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09010 CDS complement(11954..12715) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 transl_table 11 codon_start 1 locus_tag LOCUS_09020 CDS complement(12712..13122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09030 CDS 13251..14903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09040 CDS 14918..15994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09050 CDS 15998..16219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09060 CDS 16316..16627 product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 transl_table 11 codon_start 1 locus_tag LOCUS_09070 gene clpS CDS 16628..18892 product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 transl_table 11 codon_start 1 locus_tag LOCUS_09080 gene clpA CDS 18911..19276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09090 CDS 19323..20339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09100 sequence040 source 1..20546 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(780..4616) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09110 note possible pseudo, internal stop codon, frameshifted CDS complement(4695..6467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09120 note possible pseudo, internal stop codon CDS complement(6567..6770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09130 CDS 6895..10143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09140 CDS complement(10145..11191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09150 CDS complement(11281..11520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09160 CDS complement(11743..12771) product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 transl_table 11 codon_start 1 locus_tag LOCUS_09170 CDS complement(13036..14259) product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 transl_table 11 codon_start 1 locus_tag LOCUS_09180 gene nqrF CDS complement(14279..14890) product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 transl_table 11 codon_start 1 locus_tag LOCUS_09190 gene nqrE CDS complement(14894..15562) product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 transl_table 11 codon_start 1 locus_tag LOCUS_09200 CDS complement(15565..16326) product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333689.1 transl_table 11 codon_start 1 locus_tag LOCUS_09210 CDS complement(16337..17545) product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208716.1 transl_table 11 codon_start 1 locus_tag LOCUS_09220 CDS complement(17547..18905) product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906078.1 transl_table 11 codon_start 1 locus_tag LOCUS_09230 CDS 19009..19635 product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 transl_table 11 codon_start 1 locus_tag LOCUS_09240 gene rnhB CDS 19635..20408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09250 sequence041 source 1..20418 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..214 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09260 CDS 346..1041 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09270 CDS complement(1131..1436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09280 CDS complement(1441..1887) product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 transl_table 11 codon_start 1 locus_tag LOCUS_09290 CDS 2124..4157 product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530263.1 transl_table 11 codon_start 1 locus_tag LOCUS_09300 CDS 4157..6712 product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 transl_table 11 codon_start 1 locus_tag LOCUS_09310 CDS 7030..9225 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09320 CDS complement(9285..9965) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09330 CDS 10085..11368 product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107018.1 transl_table 11 codon_start 1 locus_tag LOCUS_09340 CDS 11365..15192 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 transl_table 11 codon_start 1 locus_tag LOCUS_09350 CDS complement(15210..15590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09360 CDS 15556..16686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09370 misc_feature complement(16690..>20418) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117689.1:DEAD/DEAH box helicase locus_tag LOCUS_09380 sequence042 source 1..20166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..1307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09390 CDS complement(1351..3180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09400 CDS complement(3177..5822) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09410 CDS 5930..7234 product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869494.1 transl_table 11 codon_start 1 locus_tag LOCUS_09420 CDS complement(7221..7493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09430 CDS complement(7494..8843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09440 CDS complement(9026..9319) product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 transl_table 11 codon_start 1 locus_tag LOCUS_09450 gene hupN CDS complement(9484..9924) product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 transl_table 11 codon_start 1 locus_tag LOCUS_09460 CDS complement(9921..11141) product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 transl_table 11 codon_start 1 locus_tag LOCUS_09470 CDS complement(11141..12394) product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 transl_table 11 codon_start 1 locus_tag LOCUS_09480 gene sufD CDS complement(12406..13158) product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 transl_table 11 codon_start 1 locus_tag LOCUS_09490 gene sufC CDS complement(13202..14653) product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 transl_table 11 codon_start 1 locus_tag LOCUS_09500 gene sufB CDS complement(14650..15144) product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 transl_table 11 codon_start 1 locus_tag LOCUS_09510 CDS 15693..17171 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09520 CDS 17196..17852 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09530 CDS 17852..18724 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 transl_table 11 codon_start 1 locus_tag LOCUS_09540 sequence043 source 1..20056 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 168..1139 product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 transl_table 11 codon_start 1 locus_tag LOCUS_09550 CDS 1563..3110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09560 CDS 3256..4515 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213919.1 transl_table 11 codon_start 1 locus_tag LOCUS_09570 CDS complement(4601..5098) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09580 CDS complement(5104..6231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09590 CDS complement(6570..7796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09600 CDS complement(7926..8930) product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 transl_table 11 codon_start 1 locus_tag LOCUS_09610 CDS complement(8971..10599) product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 transl_table 11 codon_start 1 locus_tag LOCUS_09620 gene gpmI CDS complement(10632..12095) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09630 CDS complement(12168..12887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09640 CDS 12956..13273 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09650 CDS 13427..14986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09660 CDS 15033..15236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09670 CDS 15264..15779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09680 CDS complement(15803..17026) product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 transl_table 11 codon_start 1 locus_tag LOCUS_09690 CDS 17148..19367 product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 transl_table 11 codon_start 1 locus_tag LOCUS_09700 tRNA complement(17662..17741) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00060 sequence044 source 1..19763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(421..1773) product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 transl_table 11 codon_start 1 locus_tag LOCUS_09710 gene nrfD CDS complement(1783..4908) product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 transl_table 11 codon_start 1 locus_tag LOCUS_09720 CDS complement(4920..5657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09730 CDS complement(5770..6132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09740 CDS 6262..6519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09750 CDS 6712..7194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09760 CDS 7315..7767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09770 CDS 7760..8692 product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 transl_table 11 codon_start 1 locus_tag LOCUS_09780 gene meaB CDS 8689..9126 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09790 note possible pseudo, internal stop codon CDS 9142..9474 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09800 CDS 9471..10013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09810 CDS complement(10023..10568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09820 CDS complement(10602..11228) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09830 CDS complement(11225..12871) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09840 CDS complement(12916..13227) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09850 CDS 13535..14149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09860 tRNA complement(14171..14244) product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00070 CDS complement(14298..14648) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09870 CDS 14791..15447 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 transl_table 11 codon_start 1 locus_tag LOCUS_09880 tRNA complement(15429..15512) product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00080 CDS complement(15567..15989) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09890 CDS 16115..16900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09900 CDS complement(16943..17509) product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 transl_table 11 codon_start 1 locus_tag LOCUS_09910 gene coaC CDS 17817..19232 product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 transl_table 11 codon_start 1 locus_tag LOCUS_09920 gene moeB CDS 19300..19722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09930 sequence045 source 1..19685 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1133..1372 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09940 CDS 1601..2260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09950 CDS 2257..3087 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 transl_table 11 codon_start 1 locus_tag LOCUS_09960 CDS 3145..4029 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09970 CDS complement(4116..5111) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_09980 CDS complement(5179..5655) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 transl_table 11 codon_start 1 locus_tag LOCUS_09990 CDS complement(5668..6024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10000 CDS complement(6105..7049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10010 CDS 7390..7767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10020 CDS complement(7764..8777) product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 transl_table 11 codon_start 1 locus_tag LOCUS_10030 CDS complement(8774..9694) product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 transl_table 11 codon_start 1 locus_tag LOCUS_10040 CDS complement(9796..10215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10050 CDS complement(10408..11793) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10060 CDS 12006..12959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10070 CDS 12996..14408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10080 CDS complement(14415..14600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10090 CDS complement(14753..16078) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 transl_table 11 codon_start 1 locus_tag LOCUS_10100 CDS complement(16075..17643) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 transl_table 11 codon_start 1 locus_tag LOCUS_10110 CDS complement(17640..18560) product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 transl_table 11 codon_start 1 locus_tag LOCUS_10120 CDS complement(18563..19180) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10130 sequence046 source 1..19550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(462..1286) product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 transl_table 11 codon_start 1 locus_tag LOCUS_10140 gene kdsA CDS 1318..2637 product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 transl_table 11 codon_start 1 locus_tag LOCUS_10150 CDS 2712..3593 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10160 CDS 3702..4826 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588613.1 transl_table 11 codon_start 1 locus_tag LOCUS_10170 CDS complement(5156..6076) product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727868.1 transl_table 11 codon_start 1 locus_tag LOCUS_10180 CDS complement(6079..6438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10190 CDS 6437..7996 product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 transl_table 11 codon_start 1 locus_tag LOCUS_10200 CDS complement(8011..8553) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10210 CDS 8637..9629 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10220 CDS 9748..11562 product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583233.1 transl_table 11 codon_start 1 locus_tag LOCUS_10230 gene ftsH CDS 11680..13101 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10240 CDS 13139..13870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10250 CDS complement(13877..14995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10260 CDS complement(15035..15583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10270 CDS complement(15658..17280) product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 transl_table 11 codon_start 1 locus_tag LOCUS_10280 gene pruA CDS 17372..17851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10290 CDS 18050..18649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10300 CDS complement(18676..19506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10310 sequence047 source 1..19469 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 92..1186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10320 CDS complement(1191..1655) product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 transl_table 11 codon_start 1 locus_tag LOCUS_10330 CDS complement(1655..2056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10340 CDS complement(2165..2635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10350 CDS complement(2742..3773) product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807459.1 transl_table 11 codon_start 1 locus_tag LOCUS_10360 gene obgE CDS complement(3830..4081) product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 transl_table 11 codon_start 1 locus_tag LOCUS_10370 gene rpmA CDS complement(4097..4405) product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10380 gene rplU CDS complement(4567..6276) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 transl_table 11 codon_start 1 locus_tag LOCUS_10390 CDS 6387..6995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10400 CDS complement(6953..8068) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10410 CDS complement(8284..9450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10420 CDS complement(9471..11063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10430 CDS complement(11045..11476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10440 CDS complement(11521..12351) product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 transl_table 11 codon_start 1 locus_tag LOCUS_10450 CDS complement(12352..13272) product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 transl_table 11 codon_start 1 locus_tag LOCUS_10460 CDS 13341..13757 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10470 CDS complement(13885..14412) product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 transl_table 11 codon_start 1 locus_tag LOCUS_10480 CDS complement(14473..15450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10490 CDS complement(15454..16356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10500 CDS complement(16370..17290) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 transl_table 11 codon_start 1 locus_tag LOCUS_10510 CDS complement(17287..19467) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10520 sequence048 source 1..19197 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1429 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230569.1:serine/threonine-protein kinase locus_tag LOCUS_10530 CDS complement(1569..2984) product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 transl_table 11 codon_start 1 locus_tag LOCUS_10540 gene glgA CDS complement(2984..4375) product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707513.1 transl_table 11 codon_start 1 locus_tag LOCUS_10550 gene glgC CDS complement(4400..5632) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10560 CDS 5738..5914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10570 CDS 5957..6502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10580 CDS 6581..7795 product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 transl_table 11 codon_start 1 locus_tag LOCUS_10590 CDS complement(7813..9039) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 transl_table 11 codon_start 1 locus_tag LOCUS_10600 CDS complement(9100..9831) product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 transl_table 11 codon_start 1 locus_tag LOCUS_10610 CDS complement(9837..11090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10620 CDS complement(11190..12335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10630 CDS complement(12332..13288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10640 CDS 13540..13959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10650 CDS complement(14038..14358) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10660 CDS complement(14471..14695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10670 CDS 14580..14786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10680 CDS 14894..15094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10690 CDS complement(15169..16584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10700 CDS complement(16597..17091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10710 CDS complement(17106..18020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10720 CDS 18089..19087 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10730 sequence049 source 1..18791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..1142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10740 CDS complement(1139..1978) product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461536.1 transl_table 11 codon_start 1 locus_tag LOCUS_10750 gene oppB CDS complement(2468..4042) product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 transl_table 11 codon_start 1 locus_tag LOCUS_10760 CDS complement(4056..5438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10770 CDS complement(5438..7042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10780 CDS complement(7077..7502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10790 CDS complement(7502..8554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10800 CDS complement(8625..9641) product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 transl_table 11 codon_start 1 locus_tag LOCUS_10810 gene dusB CDS complement(9715..10635) product Sel1-like repeat protein HcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892717.1 transl_table 11 codon_start 1 locus_tag LOCUS_10820 gene hcpC CDS complement(10636..11412) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10830 CDS complement(11437..12477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10840 CDS complement(12695..13048) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330483.1 transl_table 11 codon_start 1 locus_tag LOCUS_10850 CDS complement(13172..14002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10860 CDS complement(14034..16301) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161536185.1 transl_table 11 codon_start 1 locus_tag LOCUS_10870 CDS 16569..18725 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 transl_table 11 codon_start 1 locus_tag LOCUS_10880 sequence050 source 1..18731 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1161 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073595568.1:thioredoxin-like domain-containing protein locus_tag LOCUS_10890 CDS 1321..2004 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10900 CDS 2137..2514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10910 CDS complement(2563..3099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10920 CDS complement(3104..3460) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10930 CDS complement(3550..4632) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 transl_table 11 codon_start 1 locus_tag LOCUS_10940 CDS complement(4902..7139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10950 CDS complement(7320..8846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10960 CDS complement(8963..9703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 transl_table 11 codon_start 1 locus_tag LOCUS_10970 CDS 10012..10602 product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 transl_table 11 codon_start 1 locus_tag LOCUS_10980 CDS 10809..13133 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_10990 CDS 13287..13490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11000 CDS complement(13757..14251) product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 transl_table 11 codon_start 1 locus_tag LOCUS_11010 CDS complement(14646..16136) product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098014.1 transl_table 11 codon_start 1 locus_tag LOCUS_11020 CDS 16376..16663 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11030 CDS 16667..17023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11040 CDS complement(17125..17877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11050 sequence051 source 1..18710 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 445..3645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11060 CDS 3769..5703 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 transl_table 11 codon_start 1 locus_tag LOCUS_11070 CDS 5710..7635 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11080 CDS 7632..8747 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11090 CDS 8823..10235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11100 CDS 10275..10520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11110 CDS 10525..11535 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 transl_table 11 codon_start 1 locus_tag LOCUS_11120 CDS 11536..12399 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 transl_table 11 codon_start 1 locus_tag LOCUS_11130 note possible pseudo, internal stop codon, frameshifted CDS 12425..12976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11140 CDS 12973..13470 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11150 CDS 13483..13884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11160 CDS complement(13881..14459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11170 CDS complement(14470..17118) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11180 CDS complement(17119..18444) product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 transl_table 11 codon_start 1 locus_tag LOCUS_11190 sequence052 source 1..18667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(30..1622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11200 CDS 1842..2231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11210 CDS 2424..4388 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11220 CDS complement(4632..4787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11230 CDS 4894..5379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11240 CDS 5366..5677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11250 CDS complement(5725..6756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11260 CDS 7208..7873 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11270 CDS 7911..8549 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11280 CDS 8546..9493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11290 CDS 9585..10190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11300 CDS 10562..11479 product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 transl_table 11 codon_start 1 locus_tag LOCUS_11310 gene cysD CDS 11479..13320 product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268855.1 transl_table 11 codon_start 1 locus_tag LOCUS_11320 gene cysN CDS complement(13487..13789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11330 CDS complement(13866..14663) product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 transl_table 11 codon_start 1 locus_tag LOCUS_11340 CDS complement(14766..16091) product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269217.1 transl_table 11 codon_start 1 locus_tag LOCUS_11350 CDS complement(16088..17530) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11360 CDS 17642..18238 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 transl_table 11 codon_start 1 locus_tag LOCUS_11370 sequence053 source 1..18609 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..515 product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208928.1 transl_table 11 codon_start 1 locus_tag LOCUS_11380 gene glpE CDS 531..3200 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11390 CDS 3294..3959 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 transl_table 11 codon_start 1 locus_tag LOCUS_11400 CDS 3956..4795 product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 transl_table 11 codon_start 1 locus_tag LOCUS_11410 CDS 4825..5445 product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444780.1 transl_table 11 codon_start 1 locus_tag LOCUS_11420 CDS complement(5505..6947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11430 CDS 7313..7837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11440 CDS complement(8014..9477) product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 transl_table 11 codon_start 1 locus_tag LOCUS_11450 CDS complement(9511..9966) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11460 CDS 10043..10417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11470 CDS complement(10371..10835) product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 transl_table 11 codon_start 1 locus_tag LOCUS_11480 CDS complement(10897..11580) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11490 CDS 11738..12661 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11500 CDS complement(12724..13080) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11510 CDS complement(13193..13768) product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085410.1 transl_table 11 codon_start 1 locus_tag LOCUS_11520 gene pdxH CDS complement(13814..15934) product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 transl_table 11 codon_start 1 locus_tag LOCUS_11530 CDS complement(15945..17153) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 transl_table 11 codon_start 1 locus_tag LOCUS_11540 CDS 17309..18457 product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 transl_table 11 codon_start 1 locus_tag LOCUS_11550 sequence054 source 1..18592 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..603 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha locus_tag LOCUS_11560 CDS 616..1626 product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 transl_table 11 codon_start 1 locus_tag LOCUS_11570 CDS 1627..2433 product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 transl_table 11 codon_start 1 locus_tag LOCUS_11580 CDS complement(2430..3680) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11590 CDS 4228..5577 product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 transl_table 11 codon_start 1 locus_tag LOCUS_11600 gene radA CDS 5680..7479 product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 transl_table 11 codon_start 1 locus_tag LOCUS_11610 CDS complement(7507..8502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11620 CDS 8631..9011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11630 CDS 9091..10155 product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190793.1 transl_table 11 codon_start 1 locus_tag LOCUS_11640 CDS 10152..10631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11650 CDS 10808..12061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11660 CDS complement(12024..12617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11670 CDS complement(12685..13335) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11680 CDS complement(13337..13540) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11690 CDS complement(13543..14145) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11700 CDS 14406..15050 product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 transl_table 11 codon_start 1 locus_tag LOCUS_11710 CDS complement(15051..15815) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533327.1 transl_table 11 codon_start 1 locus_tag LOCUS_11720 CDS complement(15818..16381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11730 misc_feature complement(16742..>18592) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036970.1:bifunctional aspartate kinase/homoserine dehydrogenase I locus_tag LOCUS_11740 sequence055 source 1..18584 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(566..721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11750 CDS 808..2877 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11760 CDS complement(2915..5065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11770 CDS complement(5128..6735) product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 transl_table 11 codon_start 1 locus_tag LOCUS_11780 CDS 6722..6922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11790 CDS complement(6931..9336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11800 CDS 9585..11750 product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 transl_table 11 codon_start 1 locus_tag LOCUS_11810 CDS complement(11867..12874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11820 CDS complement(12890..14371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11830 CDS complement(14368..15711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11840 CDS complement(15711..17516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11850 CDS complement(17620..18396) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11860 sequence056 source 1..18033 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1973..2173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11870 CDS 2622..4802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 transl_table 11 codon_start 1 locus_tag LOCUS_11880 CDS 4978..6351 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11890 CDS 6432..7610 product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 transl_table 11 codon_start 1 locus_tag LOCUS_11900 gene chrA CDS complement(7797..8309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11910 CDS 8461..8769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11920 CDS complement(8811..9023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11930 CDS complement(9242..9688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11940 CDS complement(10264..10458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11950 CDS 10603..11697 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11960 CDS 11750..12184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11970 CDS 12455..12814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11980 CDS complement(12857..14398) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_11990 CDS complement(14976..15257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12000 CDS 15165..15350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12010 CDS complement(15357..15779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12020 CDS complement(15731..16288) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12030 CDS 16448..16846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12040 CDS 16890..17021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12050 CDS complement(17164..17520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12060 sequence057 source 1..18018 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..2192 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12070 CDS complement(2369..3481) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12080 CDS complement(3525..4196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12090 CDS complement(4190..5428) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12100 CDS complement(5486..7504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12110 CDS 7670..8359 product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 transl_table 11 codon_start 1 locus_tag LOCUS_12120 gene thiE CDS complement(8318..9592) product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 transl_table 11 codon_start 1 locus_tag LOCUS_12130 gene pabB CDS complement(9593..10765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12140 CDS complement(10774..11346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12150 CDS complement(11351..12985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12160 CDS complement(12995..14242) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12170 CDS complement(14239..15150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12180 CDS complement(15195..15860) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12190 CDS complement(15857..16585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12200 CDS complement(16588..17019) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12210 misc_feature complement(17069..>18018) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798964.1:type II secretion system F family protein locus_tag LOCUS_12220 sequence058 source 1..17948 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..1749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12230 CDS complement(1829..2296) product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 transl_table 11 codon_start 1 locus_tag LOCUS_12240 CDS complement(2324..3517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12250 CDS complement(3614..4006) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12260 CDS 4175..5959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12270 CDS 6162..7778 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 transl_table 11 codon_start 1 locus_tag LOCUS_12280 gene hutH CDS 7771..9297 product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 transl_table 11 codon_start 1 locus_tag LOCUS_12290 gene hutH CDS 9515..9778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12300 CDS 9833..10180 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12310 CDS complement(10419..11168) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 transl_table 11 codon_start 1 locus_tag LOCUS_12320 misc_feature complement(11328..>17948) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:type I polyketide synthase locus_tag LOCUS_12330 sequence059 source 1..17779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 175..1608 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12340 CDS complement(1620..3338) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12350 CDS complement(3335..4303) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12360 CDS 4423..6966 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12370 CDS complement(6973..7458) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12380 CDS 7571..8713 product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 transl_table 11 codon_start 1 locus_tag LOCUS_12390 CDS complement(8710..10683) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12400 CDS 10747..13008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12410 CDS complement(12995..16141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12420 sequence060 source 1..17657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1478..2434) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966037.1 transl_table 11 codon_start 1 locus_tag LOCUS_12430 CDS 2463..2873 product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226457.1 transl_table 11 codon_start 1 locus_tag LOCUS_12440 CDS 3028..4584 product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 transl_table 11 codon_start 1 locus_tag LOCUS_12450 CDS 5535..6365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12460 CDS 6690..6983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12470 CDS complement(8165..8308) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12480 CDS complement(8629..9936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12490 CDS complement(10042..10458) product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 transl_table 11 codon_start 1 locus_tag LOCUS_12500 CDS 10693..10983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12510 CDS 11842..13116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12520 CDS 13198..13740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12530 CDS complement(13983..14483) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12540 CDS complement(15279..15779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12550 CDS 15891..16715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12560 CDS complement(16767..17042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12570 CDS 17218..17397 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12580 sequence061 source 1..17499 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(602..1768) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12590 CDS complement(1812..2000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12600 CDS complement(2235..4142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12610 CDS 4573..6285 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12620 CDS complement(6477..7076) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 transl_table 11 codon_start 1 locus_tag LOCUS_12630 CDS complement(7079..8440) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12640 CDS complement(8664..10007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12650 CDS 10086..10712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12660 CDS 10709..12208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12670 CDS 12265..14610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12680 CDS 14721..16208 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12690 misc_feature complement(16322..>17499) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202330.1:class I SAM-dependent methyltransferase locus_tag LOCUS_12700 sequence062 source 1..17313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(559..1077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12710 CDS complement(1074..2096) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12720 CDS 2344..3006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12730 CDS complement(3139..4038) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12740 CDS 4082..6502 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12750 CDS complement(6510..7472) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12760 CDS complement(7533..8672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12770 CDS complement(8669..9982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12780 CDS 10025..11098 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12790 CDS complement(11138..11371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12800 CDS 11709..12047 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12810 CDS 11984..12358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12820 CDS complement(12589..13404) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12830 CDS complement(13401..13910) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12840 CDS complement(13910..14419) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12850 CDS complement(14437..15852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12860 misc_feature complement(15849..>17313) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921619.1:DUF1592 domain-containing protein locus_tag LOCUS_12870 sequence063 source 1..17230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1119..2510 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12880 CDS 2541..3623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12890 CDS complement(3620..3925) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12900 CDS complement(3928..4689) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 transl_table 11 codon_start 1 locus_tag LOCUS_12910 tRNA complement(4889..4965) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00090 CDS complement(5033..5548) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12920 CDS complement(5545..6207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12930 CDS complement(6304..7071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12940 CDS complement(7155..8219) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12950 CDS complement(8251..8466) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_12960 CDS complement(8463..10172) product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 transl_table 11 codon_start 1 locus_tag LOCUS_12970 CDS complement(10251..12083) product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 transl_table 11 codon_start 1 locus_tag LOCUS_12980 gene sppA CDS complement(12282..13139) product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 transl_table 11 codon_start 1 locus_tag LOCUS_12990 CDS 13469..14074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13000 CDS 14099..15358 product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 transl_table 11 codon_start 1 locus_tag LOCUS_13010 CDS 15500..17050 product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 transl_table 11 codon_start 1 locus_tag LOCUS_13020 gene purH sequence064 source 1..16937 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1734..3884 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13030 CDS complement(3871..4446) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13040 CDS complement(4460..6142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13050 CDS complement(6296..7015) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13060 CDS complement(7151..7408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13070 CDS 7484..8440 product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 transl_table 11 codon_start 1 locus_tag LOCUS_13080 CDS complement(8747..12406) product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 transl_table 11 codon_start 1 locus_tag LOCUS_13090 gene metH CDS 12646..14484 product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13100 CDS complement(14516..16591) product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 transl_table 11 codon_start 1 locus_tag LOCUS_13110 CDS complement(16607..16936) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13120 sequence065 source 1..16770 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(729..1538) product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 transl_table 11 codon_start 1 locus_tag LOCUS_13130 CDS complement(1492..2076) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13140 CDS complement(2096..3304) product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 transl_table 11 codon_start 1 locus_tag LOCUS_13150 CDS complement(3331..4488) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13160 note possible pseudo, internal stop codon CDS complement(4651..4995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13170 note possible pseudo, internal stop codon CDS complement(5181..6272) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112233.1 transl_table 11 codon_start 1 locus_tag LOCUS_13180 note possible pseudo, internal stop codon CDS complement(6276..6518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13190 CDS complement(6525..7214) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13200 CDS 7371..9236 product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 transl_table 11 codon_start 1 locus_tag LOCUS_13210 CDS 9288..10316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13220 CDS complement(10428..12008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13230 CDS 11898..12125 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13240 CDS 12143..13468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13250 CDS complement(13521..14786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13260 CDS complement(14786..16327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13270 sequence066 source 1..16709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1961..2719) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13280 note possible pseudo, internal stop codon CDS complement(2726..7513) product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 transl_table 11 codon_start 1 locus_tag LOCUS_13290 CDS 7748..8455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13300 CDS 8442..10058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13310 CDS complement(10101..10592) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13320 CDS complement(10656..13700) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13330 CDS complement(13898..15187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13340 CDS 15186..15512 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13350 CDS 15797..16138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13360 CDS 16265..16507 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13370 sequence067 source 1..16635 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..270 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13380 CDS 390..665 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13390 CDS 725..2404 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13400 CDS complement(2411..3907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13410 CDS 3917..5227 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13420 CDS 5224..6147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13430 CDS 6163..7626 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615936.1 transl_table 11 codon_start 1 locus_tag LOCUS_13440 CDS complement(7596..8423) product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 transl_table 11 codon_start 1 locus_tag LOCUS_13450 gene lpxC CDS 8511..9002 product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 transl_table 11 codon_start 1 locus_tag LOCUS_13460 gene ruvC CDS 8999..9610 product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 transl_table 11 codon_start 1 locus_tag LOCUS_13470 gene ruvA CDS 9607..10623 product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 transl_table 11 codon_start 1 locus_tag LOCUS_13480 gene ruvB CDS 10620..11042 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13490 CDS complement(11045..11437) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13500 CDS 11321..11542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13510 CDS 11536..11847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13520 CDS 12088..13059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13530 CDS 13056..13619 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13540 CDS complement(13632..14672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13550 CDS 15253..16215 product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275332.1 transl_table 11 codon_start 1 locus_tag LOCUS_13560 sequence068 source 1..16541 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(71..817) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13570 CDS 1049..2011 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13580 CDS complement(2008..3498) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13590 CDS 3741..4535 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13600 CDS complement(5066..5257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13610 note possible pseudo, internal stop codon CDS complement(5353..5622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13620 CDS complement(5861..7678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13630 CDS 7950..10409 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744482.1 transl_table 11 codon_start 1 locus_tag LOCUS_13640 CDS 10424..11038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13650 CDS complement(11103..11504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13660 CDS complement(11569..12405) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13670 CDS complement(12633..13811) product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 transl_table 11 codon_start 1 locus_tag LOCUS_13680 CDS 14105..14491 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13690 CDS 14717..14983 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13700 CDS 15008..15655 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13710 CDS complement(15671..16066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13720 sequence069 source 1..16258 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..627 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921242.1:peptide MFS transporter locus_tag LOCUS_13730 CDS complement(704..1609) product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 transl_table 11 codon_start 1 locus_tag LOCUS_13740 gene rocF CDS 1803..2432 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13750 CDS 2669..3124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13760 CDS 3197..3682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13770 CDS complement(3671..3859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13780 CDS 3971..4597 product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 transl_table 11 codon_start 1 locus_tag LOCUS_13790 CDS 4724..5548 product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 transl_table 11 codon_start 1 locus_tag LOCUS_13800 gene mutM CDS 5602..5808 product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 transl_table 11 codon_start 1 locus_tag LOCUS_13810 gene rpsR CDS complement(5880..7250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13820 CDS complement(7550..11185) product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 transl_table 11 codon_start 1 locus_tag LOCUS_13830 CDS complement(11749..13365) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13840 CDS complement(13362..14960) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 transl_table 11 codon_start 1 locus_tag LOCUS_13850 sequence070 source 1..16246 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1065..1256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13860 CDS complement(1307..5425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13870 CDS complement(5455..6723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13880 CDS 6868..7251 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13890 CDS complement(7357..7617) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13900 CDS complement(7636..7854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13910 CDS 7925..8482 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 transl_table 11 codon_start 1 locus_tag LOCUS_13920 CDS 8485..9996 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13930 CDS complement(9933..10433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13940 note possible pseudo, internal stop codon CDS 10930..11319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13950 CDS 12233..14770 product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 transl_table 11 codon_start 1 locus_tag LOCUS_13960 CDS 15168..15698 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13970 CDS 15689..16102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13980 sequence071 source 1..16074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 21..1361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_13990 CDS 1772..1900 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14000 CDS complement(1924..2877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14010 CDS complement(2877..3131) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14020 CDS 3422..3790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14030 CDS complement(3822..4892) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 transl_table 11 codon_start 1 locus_tag LOCUS_14040 CDS complement(4892..5362) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14050 CDS complement(5568..5762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14060 CDS 6037..7224 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14070 CDS 7283..7756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14080 CDS complement(7832..8803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14090 CDS complement(8832..9140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14100 note possible pseudo, internal stop codon, frameshifted CDS complement(9165..9332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14110 note possible pseudo, internal stop codon, frameshifted CDS complement(10044..10670) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 transl_table 11 codon_start 1 locus_tag LOCUS_14120 CDS complement(10667..11047) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14130 CDS complement(11109..11528) product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 transl_table 11 codon_start 1 locus_tag LOCUS_14140 CDS complement(11525..12778) product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920470.1 transl_table 11 codon_start 1 locus_tag LOCUS_14150 gene guaD CDS 12812..13243 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 transl_table 11 codon_start 1 locus_tag LOCUS_14160 CDS 13240..13749 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14170 sequence072 source 1..15983 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..1333) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 transl_table 11 codon_start 1 locus_tag LOCUS_14180 CDS complement(1561..3384) product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 transl_table 11 codon_start 1 locus_tag LOCUS_14190 gene glmS CDS complement(3428..5452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14200 CDS complement(5508..7211) product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 transl_table 11 codon_start 1 locus_tag LOCUS_14210 gene msbA CDS complement(7208..8671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14220 CDS 8758..9954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14230 CDS 9973..10305 product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 transl_table 11 codon_start 1 locus_tag LOCUS_14240 CDS complement(10302..11354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14250 CDS complement(11371..11901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14260 CDS complement(11898..12332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14270 CDS 12372..12527 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14280 CDS complement(12767..13552) product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 transl_table 11 codon_start 1 locus_tag LOCUS_14290 gene lpxA CDS complement(13606..14037) product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 transl_table 11 codon_start 1 locus_tag LOCUS_14300 gene fabZ CDS complement(14034..14921) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14310 CDS complement(15062..15565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14320 sequence073 source 1..15978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..666 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein locus_tag LOCUS_14330 CDS 663..2399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14340 CDS 2453..2788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14350 CDS complement(2919..4619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14360 CDS 4720..6597 product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 transl_table 11 codon_start 1 locus_tag LOCUS_14370 CDS 6776..8386 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14380 CDS 8374..9378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14390 CDS complement(10002..10730) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14400 CDS complement(11131..11607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14410 CDS 11799..12893 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14420 CDS 13092..14021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14430 CDS complement(14111..15853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14440 sequence074 source 1..15936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..986 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein locus_tag LOCUS_14450 CDS complement(1042..1782) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14460 CDS complement(1896..2504) product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048126054.1 transl_table 11 codon_start 1 locus_tag LOCUS_14470 CDS 2912..5563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14480 CDS complement(5564..6442) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 transl_table 11 codon_start 1 locus_tag LOCUS_14490 CDS 6683..8461 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14500 CDS 8504..10381 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 transl_table 11 codon_start 1 locus_tag LOCUS_14510 CDS 10381..11430 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126536.1 transl_table 11 codon_start 1 locus_tag LOCUS_14520 gene pyrC CDS 11617..11928 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14530 CDS 11977..13677 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14540 CDS 13674..15542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14550 sequence075 source 1..15821 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..1510) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14560 CDS 1639..2298 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14570 CDS 2543..2899 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14580 CDS 3206..3613 product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 transl_table 11 codon_start 1 locus_tag LOCUS_14590 CDS 3672..4589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14600 CDS 4669..5010 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14610 CDS 5062..6600 product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 transl_table 11 codon_start 1 locus_tag LOCUS_14620 gene paaP CDS 6827..7309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14630 CDS complement(7491..8570) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14640 CDS 8750..9880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14650 CDS 10073..13411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14660 sequence076 source 1..15638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(560..1798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14670 CDS complement(1805..2593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14680 CDS 2724..3296 product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 transl_table 11 codon_start 1 locus_tag LOCUS_14690 gene tadA tRNA 3274..3363 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00100 tRNA 3393..3480 product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00110 CDS complement(3645..4247) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14700 CDS complement(4244..4444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14710 CDS complement(4441..5034) product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 transl_table 11 codon_start 1 locus_tag LOCUS_14720 gene recR CDS complement(5034..5354) product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 transl_table 11 codon_start 1 locus_tag LOCUS_14730 CDS complement(5356..7107) product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 transl_table 11 codon_start 1 locus_tag LOCUS_14740 gene dnaX CDS complement(7200..8834) product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931323.1 transl_table 11 codon_start 1 locus_tag LOCUS_14750 gene asnB CDS complement(9049..9693) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14760 CDS 9796..11946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14770 sequence077 source 1..15514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1355..2170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14780 CDS 2254..4281 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14790 CDS 4488..5855 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14800 CDS complement(6021..7352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14810 CDS complement(7352..8455) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14820 CDS 8700..9449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14830 CDS complement(9456..11282) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14840 CDS 11430..12647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14850 CDS complement(12628..13143) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14860 CDS 13043..13345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14870 CDS 13579..15159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14880 sequence078 source 1..15478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1168 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070590.1:MFS transporter locus_tag LOCUS_14890 CDS complement(1250..1627) product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 transl_table 11 codon_start 1 locus_tag LOCUS_14900 gene apaG CDS 1738..2406 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 transl_table 11 codon_start 1 locus_tag LOCUS_14910 CDS 2403..3626 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 transl_table 11 codon_start 1 locus_tag LOCUS_14920 CDS 3629..4882 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 transl_table 11 codon_start 1 locus_tag LOCUS_14930 CDS 4890..5966 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 transl_table 11 codon_start 1 locus_tag LOCUS_14940 CDS 6357..7229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14950 CDS 7323..7991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14960 CDS 8360..9013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14970 CDS complement(9021..10106) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14980 CDS 10484..10798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_14990 CDS 10856..12403 product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 transl_table 11 codon_start 1 locus_tag LOCUS_15000 CDS 12431..13198 product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 transl_table 11 codon_start 1 locus_tag LOCUS_15010 CDS 13198..13992 product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 transl_table 11 codon_start 1 locus_tag LOCUS_15020 CDS 13989..14690 product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 transl_table 11 codon_start 1 locus_tag LOCUS_15030 sequence079 source 1..15444 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1372..1647 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15040 CDS complement(2123..2305) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15050 CDS 2481..3683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15060 CDS complement(3742..4344) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731070.1 transl_table 11 codon_start 1 locus_tag LOCUS_15070 CDS complement(4341..6119) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 transl_table 11 codon_start 1 locus_tag LOCUS_15080 CDS 6540..7460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15090 CDS 7787..8059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15100 CDS complement(8109..10169) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15110 CDS 10197..10649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15120 CDS 10630..11061 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15130 CDS 11264..13006 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15140 sequence080 source 1..15006 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1701..2618 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15150 CDS complement(2656..4068) product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 transl_table 11 codon_start 1 locus_tag LOCUS_15160 CDS complement(4065..6458) product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396915.1 transl_table 11 codon_start 1 locus_tag LOCUS_15170 CDS complement(6455..7279) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188832.1 transl_table 11 codon_start 1 locus_tag LOCUS_15180 CDS 7350..8786 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15190 CDS 8810..9358 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15200 CDS 9366..9863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15210 CDS 9860..10942 product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 transl_table 11 codon_start 1 locus_tag LOCUS_15220 gene bioF CDS 11143..12012 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 transl_table 11 codon_start 1 locus_tag LOCUS_15230 CDS 12031..12789 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15240 CDS 12789..14096 product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15250 gene bioA sequence081 source 1..14876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1747 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase locus_tag LOCUS_15260 CDS 1870..2148 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15270 CDS complement(2219..4675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15280 CDS complement(4747..5850) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15290 CDS complement(5901..6431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15300 CDS complement(6568..8361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15310 CDS 8360..9229 product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263179.1 transl_table 11 codon_start 1 locus_tag LOCUS_15320 gene modA CDS 9265..9894 product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 transl_table 11 codon_start 1 locus_tag LOCUS_15330 gene modB CDS 9887..10981 product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067038.1 transl_table 11 codon_start 1 locus_tag LOCUS_15340 gene modC CDS 11086..12093 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15350 CDS 12117..12266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15360 CDS complement(12422..13357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15370 CDS complement(13357..14334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15380 sequence082 source 1..14872 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(554..949) product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 transl_table 11 codon_start 1 locus_tag LOCUS_15390 gene mutT CDS 1031..1492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15400 CDS 1493..2407 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15410 CDS 2542..3462 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15420 CDS complement(3459..4280) product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15430 gene dapF CDS complement(4280..5041) product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975152.1 transl_table 11 codon_start 1 locus_tag LOCUS_15440 CDS complement(5078..6961) product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 transl_table 11 codon_start 1 locus_tag LOCUS_15450 CDS complement(6958..7827) product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 transl_table 11 codon_start 1 locus_tag LOCUS_15460 CDS complement(7824..8585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15470 CDS complement(8604..10160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15480 CDS complement(10184..11626) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 transl_table 11 codon_start 1 locus_tag LOCUS_15490 gene rlmD CDS 11886..13016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15500 CDS complement(13013..14221) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15510 sequence083 source 1..14716 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..1753 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15520 CDS 1756..2055 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15530 CDS 2082..2381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15540 CDS 2383..2727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15550 CDS 2669..3532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15560 CDS complement(3536..5077) product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094785.1 transl_table 11 codon_start 1 locus_tag LOCUS_15570 CDS 5248..5685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15580 CDS complement(5722..6846) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15590 CDS complement(6843..7637) product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 transl_table 11 codon_start 1 locus_tag LOCUS_15600 CDS complement(7648..9357) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15610 CDS complement(9508..10200) product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 transl_table 11 codon_start 1 locus_tag LOCUS_15620 gene frnE CDS complement(10354..10587) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15630 CDS 10634..10927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15640 CDS 11163..11774 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15650 CDS 11879..12376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15660 CDS 12421..12801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15670 CDS complement(12798..14714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15680 sequence084 source 1..14701 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 4..1305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15690 CDS 1371..2213 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15700 CDS 2223..2819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15710 CDS complement(2960..3259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15720 CDS 3198..3995 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15730 CDS complement(4002..4748) product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 transl_table 11 codon_start 1 locus_tag LOCUS_15740 note possible pseudo, frameshifted CDS complement(4852..6162) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15750 CDS complement(6175..7521) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15760 CDS complement(7649..8812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15770 CDS complement(9093..10220) product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 transl_table 11 codon_start 1 locus_tag LOCUS_15780 CDS complement(10213..10806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15790 CDS 11045..13579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15800 CDS complement(13591..14379) product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 transl_table 11 codon_start 1 locus_tag LOCUS_15810 sequence085 source 1..14659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1735 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein locus_tag LOCUS_15820 CDS 2560..2991 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15830 CDS 3129..3914 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15840 CDS 3967..6396 product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615531.1 transl_table 11 codon_start 1 locus_tag LOCUS_15850 CDS 6393..7952 product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902486.1 transl_table 11 codon_start 1 locus_tag LOCUS_15860 CDS complement(8119..8568) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15870 CDS complement(8792..10243) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15880 CDS complement(10715..11374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15890 CDS complement(11717..12334) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15900 CDS complement(12631..13056) product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 transl_table 11 codon_start 1 locus_tag LOCUS_15910 CDS complement(13108..13923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15920 sequence086 source 1..14579 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 65..823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15930 CDS 823..2760 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 transl_table 11 codon_start 1 locus_tag LOCUS_15940 CDS 2757..3689 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 transl_table 11 codon_start 1 locus_tag LOCUS_15950 CDS 3686..4639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15960 CDS complement(4626..4919) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15970 CDS 5309..5662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15980 CDS 5876..6868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_15990 CDS 6862..8982 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 transl_table 11 codon_start 1 locus_tag LOCUS_16000 CDS 8995..10215 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 transl_table 11 codon_start 1 locus_tag LOCUS_16010 CDS 10363..10587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16020 CDS 10611..11489 product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 transl_table 11 codon_start 1 locus_tag LOCUS_16030 sequence087 source 1..14478 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(5982..7061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16040 CDS 7141..7356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16050 CDS complement(7360..8343) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16060 CDS 8747..10354 product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066699.1 transl_table 11 codon_start 1 locus_tag LOCUS_16070 gene fumB CDS 10375..10812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16080 CDS complement(10928..11794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16090 CDS 12053..13147 product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 transl_table 11 codon_start 1 locus_tag LOCUS_16100 gene carA sequence088 source 1..14419 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(117..1550) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 transl_table 11 codon_start 1 locus_tag LOCUS_16110 CDS 1630..2142 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16120 CDS complement(2046..2612) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084078882.1 transl_table 11 codon_start 1 locus_tag LOCUS_16130 CDS complement(2609..3886) product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 transl_table 11 codon_start 1 locus_tag LOCUS_16140 gene eno CDS 3960..5999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16150 CDS 6014..6754 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16160 CDS 6820..7143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16170 CDS 7143..7937 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16180 CDS 7985..8857 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16190 CDS 8882..9232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16200 CDS 9272..10531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16210 CDS complement(10545..12224) product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 transl_table 11 codon_start 1 locus_tag LOCUS_16220 gene ettA CDS 12569..14095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16230 sequence089 source 1..14388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 703..1728 product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 transl_table 11 codon_start 1 locus_tag LOCUS_16240 CDS 1721..2977 product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 transl_table 11 codon_start 1 locus_tag LOCUS_16250 gene arsJ CDS 3466..5325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16260 CDS 5888..6439 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 transl_table 11 codon_start 1 locus_tag LOCUS_16270 CDS 6436..6999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16280 CDS 6996..8168 product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 transl_table 11 codon_start 1 locus_tag LOCUS_16290 CDS complement(8720..10843) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16300 CDS complement(11202..11963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16310 CDS complement(12202..12873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16320 CDS complement(12965..13723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16330 sequence090 source 1..14303 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 357..1340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16340 CDS 1443..1844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16350 CDS complement(1914..2855) product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218156.1 transl_table 11 codon_start 1 locus_tag LOCUS_16360 gene thrB CDS complement(2927..3202) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16370 CDS complement(3299..4057) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16380 CDS complement(4078..4806) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16390 CDS 4873..5577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16400 CDS 5595..6581 product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265765.1 transl_table 11 codon_start 1 locus_tag LOCUS_16410 CDS 6817..9309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16420 CDS complement(9661..10806) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 transl_table 11 codon_start 1 locus_tag LOCUS_16430 gene rnd CDS complement(11064..11297) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16440 misc_feature complement(12078..>14303) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein locus_tag LOCUS_16450 sequence091 source 1..14261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 77..883 product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 transl_table 11 codon_start 1 locus_tag LOCUS_16460 gene proC CDS complement(880..1833) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16470 CDS complement(2078..2596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16480 CDS complement(2697..3566) product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187713770.1 transl_table 11 codon_start 1 locus_tag LOCUS_16490 CDS complement(3583..4911) product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 transl_table 11 codon_start 1 locus_tag LOCUS_16500 CDS 5031..6329 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16510 CDS 6329..7378 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16520 CDS 7567..8586 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16530 CDS 8586..9539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16540 CDS complement(9536..9769) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16550 CDS complement(9775..12336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16560 CDS complement(12333..13763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16570 sequence092 source 1..14245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(196..4359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16580 CDS complement(4452..5150) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 transl_table 11 codon_start 1 locus_tag LOCUS_16590 CDS complement(5159..6409) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 transl_table 11 codon_start 1 locus_tag LOCUS_16600 CDS complement(6406..7527) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 transl_table 11 codon_start 1 locus_tag LOCUS_16610 CDS complement(7858..8712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16620 CDS complement(8778..9986) product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 transl_table 11 codon_start 1 locus_tag LOCUS_16630 CDS 10058..10549 product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 transl_table 11 codon_start 1 locus_tag LOCUS_16640 CDS 10559..12667 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16650 CDS 12670..13548 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16660 sequence093 source 1..14183 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1381..2244) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16670 CDS complement(2244..3107) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16680 CDS 3270..4766 product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258512.1 transl_table 11 codon_start 1 locus_tag LOCUS_16690 CDS complement(4815..7448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16700 CDS complement(7568..8590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16710 CDS complement(8587..9585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16720 CDS complement(9595..12369) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16730 CDS 12684..13334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16740 sequence094 source 1..14086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(451..1314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16750 CDS 1523..1972 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16760 CDS complement(1969..2850) product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259047.1 transl_table 11 codon_start 1 locus_tag LOCUS_16770 CDS complement(2832..5777) product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 transl_table 11 codon_start 1 locus_tag LOCUS_16780 CDS complement(5793..6671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16790 note possible pseudo, internal stop codon CDS complement(6711..7433) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16800 note possible pseudo, internal stop codon CDS complement(7486..8454) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16810 CDS 8683..10434 product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 transl_table 11 codon_start 1 locus_tag LOCUS_16820 CDS complement(10407..11468) product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 transl_table 11 codon_start 1 locus_tag LOCUS_16830 gene dinB CDS complement(11587..11823) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16840 CDS 11807..12421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16850 CDS 12422..12625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16860 CDS 12693..13085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16870 sequence095 source 1..13961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 111..479 product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 transl_table 11 codon_start 1 locus_tag LOCUS_16880 gene rpsM CDS 509..898 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938622.1 transl_table 11 codon_start 1 locus_tag LOCUS_16890 gene rpsK CDS 1039..2046 product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 transl_table 11 codon_start 1 locus_tag LOCUS_16900 CDS 2066..2611 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16910 CDS complement(2576..3124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16920 CDS 3302..3643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16930 tRNA 3692..3774 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00120 CDS complement(3885..4646) product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 transl_table 11 codon_start 1 locus_tag LOCUS_16940 gene tpiA CDS complement(4646..5839) product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 transl_table 11 codon_start 1 locus_tag LOCUS_16950 CDS complement(5836..6843) product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 transl_table 11 codon_start 1 locus_tag LOCUS_16960 gene gap CDS 7004..8596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 transl_table 11 codon_start 1 locus_tag LOCUS_16970 CDS complement(8593..9033) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16980 tRNA complement(9358..9432) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00130 CDS complement(9469..10815) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_16990 CDS complement(10812..11834) product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 transl_table 11 codon_start 1 locus_tag LOCUS_17000 CDS complement(11837..12433) product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020863053.1 transl_table 11 codon_start 1 locus_tag LOCUS_17010 gene pgsA CDS complement(12446..12985) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17020 sequence096 source 1..13946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 200..1114 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17030 CDS complement(1224..2753) product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 transl_table 11 codon_start 1 locus_tag LOCUS_17040 gene ahcY CDS 2844..3773 product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 transl_table 11 codon_start 1 locus_tag LOCUS_17050 CDS complement(3882..4592) product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 transl_table 11 codon_start 1 locus_tag LOCUS_17060 CDS complement(4592..6094) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 transl_table 11 codon_start 1 locus_tag LOCUS_17070 CDS complement(6094..7833) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 transl_table 11 codon_start 1 locus_tag LOCUS_17080 CDS 7978..8850 product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895332.1 transl_table 11 codon_start 1 locus_tag LOCUS_17090 CDS complement(8851..10629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17100 CDS complement(10631..11017) product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 transl_table 11 codon_start 1 locus_tag LOCUS_17110 CDS 11157..11846 product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 transl_table 11 codon_start 1 locus_tag LOCUS_17120 CDS complement(11848..13440) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882673.1 transl_table 11 codon_start 1 locus_tag LOCUS_17130 sequence097 source 1..13936 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 770..2947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17140 CDS 3029..4297 product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 transl_table 11 codon_start 1 locus_tag LOCUS_17150 CDS complement(4302..5087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17160 CDS 5312..6538 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17170 CDS 6645..8654 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17180 CDS 8661..9935 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17190 CDS complement(9948..11222) product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 transl_table 11 codon_start 1 locus_tag LOCUS_17200 gene preA CDS complement(11222..12523) product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142081328.1 transl_table 11 codon_start 1 locus_tag LOCUS_17210 CDS 12566..13018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17220 note possible pseudo, internal stop codon CDS 13115..13714 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17230 note possible pseudo, internal stop codon sequence098 source 1..13893 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1972 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter locus_tag LOCUS_17240 CDS complement(1969..2280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17250 CDS complement(2290..2565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17260 CDS complement(2604..3794) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 transl_table 11 codon_start 1 locus_tag LOCUS_17270 CDS complement(3874..4869) product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 transl_table 11 codon_start 1 locus_tag LOCUS_17280 CDS complement(5082..5471) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17290 CDS complement(5485..5877) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17300 CDS complement(5870..8689) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17310 CDS 8800..9567 product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 transl_table 11 codon_start 1 locus_tag LOCUS_17320 CDS 9564..10238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17330 CDS 10384..11181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17340 CDS 11181..13082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17350 sequence099 source 1..13875 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3621..5318 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17360 CDS 5561..6652 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17370 CDS 6652..7350 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17380 CDS 7347..7928 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 transl_table 11 codon_start 1 locus_tag LOCUS_17390 CDS 7928..8926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17400 CDS 8923..9441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17410 CDS 9494..10438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17420 CDS complement(10461..12686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17430 CDS 12993..13460 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17440 sequence100 source 1..13778 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1046..3517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17450 CDS complement(3507..4367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17460 CDS complement(4371..6194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17470 CDS complement(6247..7407) product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 transl_table 11 codon_start 1 locus_tag LOCUS_17480 CDS 7545..8138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17490 CDS 8138..9160 product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228888.1 transl_table 11 codon_start 1 locus_tag LOCUS_17500 CDS complement(9175..9564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17510 CDS 9772..10788 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 transl_table 11 codon_start 1 locus_tag LOCUS_17520 CDS complement(10785..11255) product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 transl_table 11 codon_start 1 locus_tag LOCUS_17530 CDS 11321..12844 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17540 sequence101 source 1..13622 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..10221 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:type I polyketide synthase locus_tag LOCUS_17550 CDS complement(10354..10902) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 transl_table 11 codon_start 1 locus_tag LOCUS_17560 note possible pseudo, internal stop codon, frameshifted CDS 11003..13486 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 transl_table 11 codon_start 1 locus_tag LOCUS_17570 sequence102 source 1..13455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(357..1277) product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 transl_table 11 codon_start 1 locus_tag LOCUS_17580 gene trxB CDS complement(1344..3476) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17590 CDS 3543..4184 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17600 CDS complement(4181..4987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17610 CDS complement(4930..5127) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17620 CDS 5393..5791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17630 CDS 5828..6589 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17640 CDS 6593..7459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17650 CDS complement(7742..8908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17660 CDS 8978..12001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17670 CDS 12087..13409 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552000.1 transl_table 11 codon_start 1 locus_tag LOCUS_17680 sequence103 source 1..13428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 474..1238 product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772902.1 transl_table 11 codon_start 1 locus_tag LOCUS_17690 CDS 1235..2695 product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 transl_table 11 codon_start 1 locus_tag LOCUS_17700 CDS 2775..4172 product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 transl_table 11 codon_start 1 locus_tag LOCUS_17710 CDS complement(4169..4582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17720 CDS 4768..5520 product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 transl_table 11 codon_start 1 locus_tag LOCUS_17730 CDS complement(5517..6209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17740 CDS complement(6210..8051) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 transl_table 11 codon_start 1 locus_tag LOCUS_17750 CDS complement(8126..9118) product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 transl_table 11 codon_start 1 locus_tag LOCUS_17760 CDS 9181..10629 product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 transl_table 11 codon_start 1 locus_tag LOCUS_17770 CDS 10614..11045 product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 transl_table 11 codon_start 1 locus_tag LOCUS_17780 gene arfB CDS 11061..12275 product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 transl_table 11 codon_start 1 locus_tag LOCUS_17790 gene vpsB CDS complement(12276..12869) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17800 sequence104 source 1..13405 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1183..1695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17810 CDS complement(1692..2378) product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 transl_table 11 codon_start 1 locus_tag LOCUS_17820 gene aat CDS 2498..3325 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17830 CDS complement(3333..3878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17840 CDS complement(3927..6245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17850 CDS complement(6272..6838) product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 transl_table 11 codon_start 1 locus_tag LOCUS_17860 CDS complement(6835..7209) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17870 CDS 7583..8572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17880 CDS 8713..10116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17890 CDS complement(10224..10835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17900 misc_feature complement(10885..>13405) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922335.1:type I polyketide synthase locus_tag LOCUS_17910 sequence105 source 1..13360 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2030..3361) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17920 CDS 3296..3583 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17930 CDS 3782..4393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17940 CDS 4514..4966 product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 transl_table 11 codon_start 1 locus_tag LOCUS_17950 gene purE CDS 5084..5803 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17960 CDS 5902..6615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17970 CDS 6737..7258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17980 CDS 7318..8241 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_17990 CDS complement(8252..8974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18000 CDS complement(9016..9984) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18010 CDS 10474..11412 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18020 CDS 11446..12036 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 transl_table 11 codon_start 1 locus_tag LOCUS_18030 CDS 12033..13277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18040 sequence106 source 1..13306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18050 CDS 918..1595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18060 CDS 1595..2275 product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 transl_table 11 codon_start 1 locus_tag LOCUS_18070 gene ccsA CDS 2415..2858 product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 transl_table 11 codon_start 1 locus_tag LOCUS_18080 gene ccmE CDS 2855..4885 product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 transl_table 11 codon_start 1 locus_tag LOCUS_18090 CDS 4882..5412 product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 transl_table 11 codon_start 1 locus_tag LOCUS_18100 CDS 5409..5915 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18110 CDS 5912..7258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18120 CDS complement(7260..8411) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18130 CDS complement(8730..10673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18140 CDS complement(10692..11000) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18150 sequence107 source 1..13282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1123..1926 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18160 CDS 1991..2293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18170 CDS 2298..4862 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18180 CDS complement(4997..5863) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18190 CDS complement(5961..7436) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18200 CDS 7547..8266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18210 CDS 8251..9102 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18220 CDS complement(9176..10612) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 transl_table 11 codon_start 1 locus_tag LOCUS_18230 CDS complement(10708..11424) product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 transl_table 11 codon_start 1 locus_tag LOCUS_18240 CDS complement(11508..12035) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18250 CDS complement(12049..13077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18260 sequence108 source 1..13179 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(934..2619) product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 transl_table 11 codon_start 1 locus_tag LOCUS_18270 gene kstD CDS 2735..3595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18280 CDS 3592..4785 product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 transl_table 11 codon_start 1 locus_tag LOCUS_18290 CDS 4809..5663 product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 transl_table 11 codon_start 1 locus_tag LOCUS_18300 CDS 5660..6478 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 transl_table 11 codon_start 1 locus_tag LOCUS_18310 CDS 6526..6939 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18320 CDS 6995..8632 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18330 CDS complement(8629..9279) product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 transl_table 11 codon_start 1 locus_tag LOCUS_18340 CDS 9526..10503 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18350 CDS 10614..11600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18360 CDS 11606..13057 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 transl_table 11 codon_start 1 locus_tag LOCUS_18370 sequence109 source 1..13151 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1749..1991) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18380 CDS complement(2080..3312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18390 CDS complement(3360..11084) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18400 misc_feature complement(11116..>13151) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484145.1:type I polyketide synthase locus_tag LOCUS_18410 sequence110 source 1..13130 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(812..1924) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 transl_table 11 codon_start 1 locus_tag LOCUS_18420 CDS 2042..2209 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18430 CDS complement(2307..3194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18440 CDS complement(3240..3755) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18450 CDS complement(3752..4171) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18460 CDS complement(4194..5291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18470 CDS complement(5281..5721) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18480 CDS complement(5749..7329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18490 CDS 7469..8434 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18500 CDS 8424..9218 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 transl_table 11 codon_start 1 locus_tag LOCUS_18510 CDS 9228..10415 product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 transl_table 11 codon_start 1 locus_tag LOCUS_18520 CDS 10443..10769 product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 transl_table 11 codon_start 1 locus_tag LOCUS_18530 gene iscA CDS complement(10773..12332) product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 transl_table 11 codon_start 1 locus_tag LOCUS_18540 sequence111 source 1..12924 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(271..1374) product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 transl_table 11 codon_start 1 locus_tag LOCUS_18550 gene ychF CDS 1517..2131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 transl_table 11 codon_start 1 locus_tag LOCUS_18560 CDS complement(2118..2915) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18570 CDS 2908..4437 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18580 CDS 4441..4968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18590 CDS complement(4989..6218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18600 CDS complement(6215..6901) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 transl_table 11 codon_start 1 locus_tag LOCUS_18610 CDS complement(6920..8155) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 transl_table 11 codon_start 1 locus_tag LOCUS_18620 CDS complement(8159..9382) product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 transl_table 11 codon_start 1 locus_tag LOCUS_18630 CDS complement(9390..10106) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 transl_table 11 codon_start 1 locus_tag LOCUS_18640 CDS complement(10103..10582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18650 CDS 10514..10729 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18660 CDS complement(10692..11771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18670 misc_feature complement(11820..>12924) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707128.1:VWA domain-containing protein locus_tag LOCUS_18680 sequence112 source 1..12866 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2841 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein locus_tag LOCUS_18690 CDS 3054..3371 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18700 CDS complement(3356..3742) product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965250.1 transl_table 11 codon_start 1 locus_tag LOCUS_18710 CDS 3794..5122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18720 CDS complement(5285..6304) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 transl_table 11 codon_start 1 locus_tag LOCUS_18730 CDS complement(6314..7507) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 transl_table 11 codon_start 1 locus_tag LOCUS_18740 CDS complement(7504..8745) product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731374.1 transl_table 11 codon_start 1 locus_tag LOCUS_18750 gene lipE CDS complement(8750..10201) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 transl_table 11 codon_start 1 locus_tag LOCUS_18760 CDS complement(10255..11214) product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 transl_table 11 codon_start 1 locus_tag LOCUS_18770 CDS complement(11301..11876) product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 transl_table 11 codon_start 1 locus_tag LOCUS_18780 CDS 12079..12600 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18790 sequence113 source 1..12843 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1098..1790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18800 CDS 1837..2421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18810 CDS 2440..4704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18820 CDS 4857..5666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18830 CDS complement(5767..7188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18840 CDS complement(7196..7951) product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 transl_table 11 codon_start 1 locus_tag LOCUS_18850 CDS 8109..8726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18860 CDS 8779..10125 product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268131.1 transl_table 11 codon_start 1 locus_tag LOCUS_18870 gene gorA CDS complement(10192..11439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18880 CDS complement(11436..12272) product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 transl_table 11 codon_start 1 locus_tag LOCUS_18890 sequence114 source 1..12671 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(388..2010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18900 CDS 2134..3228 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18910 CDS 3225..4682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18920 CDS 5303..5821 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18930 CDS 5904..7892 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18940 CDS 7902..8822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18950 CDS complement(8825..10831) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18960 CDS complement(10938..11531) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18970 misc_feature complement(11625..>12671) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040705.1:acetylornithine deacetylase locus_tag LOCUS_18980 sequence115 source 1..12664 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(767..1168) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_18990 CDS complement(1439..2056) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19000 CDS complement(2222..2668) product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 transl_table 11 codon_start 1 locus_tag LOCUS_19010 CDS 2894..4159 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19020 CDS 4480..4851 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19030 CDS 4891..6003 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 transl_table 11 codon_start 1 locus_tag LOCUS_19040 gene pfkA CDS complement(6038..7897) product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 transl_table 11 codon_start 1 locus_tag LOCUS_19050 gene aspS CDS complement(7910..8515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19060 CDS complement(8543..9706) product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 transl_table 11 codon_start 1 locus_tag LOCUS_19070 CDS complement(9714..11099) product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 transl_table 11 codon_start 1 locus_tag LOCUS_19080 CDS 11314..12390 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19090 sequence116 source 1..12591 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19100 CDS complement(1567..2895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19110 CDS complement(3542..4984) product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 transl_table 11 codon_start 1 locus_tag LOCUS_19120 CDS complement(4981..5400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19130 CDS complement(5576..7078) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19140 CDS complement(7084..8610) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19150 CDS complement(8610..9845) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19160 CDS 10218..11342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19170 CDS complement(11339..12178) product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 transl_table 11 codon_start 1 locus_tag LOCUS_19180 gene carH sequence117 source 1..12542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1538..4333) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 transl_table 11 codon_start 1 locus_tag LOCUS_19190 CDS complement(4330..6177) product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 transl_table 11 codon_start 1 locus_tag LOCUS_19200 CDS complement(6362..6532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19210 CDS 6594..7376 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19220 CDS complement(7377..7862) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19230 CDS complement(7908..8585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19240 CDS 8812..9609 product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 transl_table 11 codon_start 1 locus_tag LOCUS_19250 gene ttcA CDS 9606..10814 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19260 CDS complement(10823..11824) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19270 CDS 11775..12401 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19280 sequence118 source 1..12538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(165..362) product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 transl_table 11 codon_start 1 locus_tag LOCUS_19290 CDS complement(704..1351) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 transl_table 11 codon_start 1 locus_tag LOCUS_19300 CDS complement(1518..7205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19310 CDS complement(7462..8118) product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 transl_table 11 codon_start 1 locus_tag LOCUS_19320 gene msrA CDS 8155..8841 product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 transl_table 11 codon_start 1 locus_tag LOCUS_19330 gene aat CDS complement(8838..9737) product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 transl_table 11 codon_start 1 locus_tag LOCUS_19340 CDS 9867..10169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19350 CDS 10166..10531 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19360 CDS 10886..11356 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19370 sequence119 source 1..12503 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 958..2157 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 transl_table 11 codon_start 1 locus_tag LOCUS_19380 CDS 2228..4177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19390 CDS complement(4334..4798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19400 CDS 4956..6518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19410 CDS 6591..6986 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19420 CDS complement(7080..8501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19430 CDS 8672..9769 product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 transl_table 11 codon_start 1 locus_tag LOCUS_19440 CDS complement(9773..11032) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19450 CDS complement(11086..11805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19460 sequence120 source 1..12466 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 757..1326 product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043122718.1 transl_table 11 codon_start 1 locus_tag LOCUS_19470 CDS complement(1323..3134) product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19480 CDS complement(3382..5565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19490 CDS 5656..6609 product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 transl_table 11 codon_start 1 locus_tag LOCUS_19500 CDS complement(6715..7854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19510 CDS complement(7892..8074) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19520 CDS 8120..9958 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19530 CDS 9970..10791 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19540 CDS complement(10792..12264) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19550 sequence121 source 1..12440 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(64..1518) product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 transl_table 11 codon_start 1 locus_tag LOCUS_19560 CDS 1592..2116 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19570 CDS complement(2113..3345) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545724.1 transl_table 11 codon_start 1 locus_tag LOCUS_19580 note possible pseudo, internal stop codon CDS complement(3478..4422) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19590 CDS complement(4419..5435) product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929414.1 transl_table 11 codon_start 1 locus_tag LOCUS_19600 CDS complement(5429..5668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19610 CDS 6001..6843 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19620 CDS 7161..7808 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 transl_table 11 codon_start 1 locus_tag LOCUS_19630 CDS 7805..9058 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19640 CDS 9058..10032 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19650 CDS 10044..10742 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19660 sequence122 source 1..12354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3296..3760) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19670 CDS complement(3948..5042) product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 transl_table 11 codon_start 1 locus_tag LOCUS_19680 CDS complement(5092..6414) product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 transl_table 11 codon_start 1 locus_tag LOCUS_19690 CDS complement(6411..6932) product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 transl_table 11 codon_start 1 locus_tag LOCUS_19700 CDS 7286..8071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19710 CDS complement(8083..8607) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19720 CDS 9175..11541 product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 transl_table 11 codon_start 1 locus_tag LOCUS_19730 CDS 11538..12095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19740 CDS 12092..12310 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19750 sequence123 source 1..12276 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(402..1241) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063699.1 transl_table 11 codon_start 1 locus_tag LOCUS_19760 CDS complement(1245..2039) product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 transl_table 11 codon_start 1 locus_tag LOCUS_19770 gene tauC CDS complement(2049..3713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19780 CDS complement(3723..4496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19790 CDS 4690..5412 product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 transl_table 11 codon_start 1 locus_tag LOCUS_19800 CDS complement(5871..6020) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19810 CDS complement(6013..6231) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19820 CDS complement(7419..8555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19830 CDS 8718..9422 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19840 CDS 9495..11726 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19850 sequence124 source 1..12156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..1595 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19860 CDS 2097..2999 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19870 CDS complement(3198..4058) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 transl_table 11 codon_start 1 locus_tag LOCUS_19880 CDS complement(4308..5477) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 transl_table 11 codon_start 1 locus_tag LOCUS_19890 CDS 5526..6977 product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 transl_table 11 codon_start 1 locus_tag LOCUS_19900 CDS 7058..9934 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 transl_table 11 codon_start 1 locus_tag LOCUS_19910 CDS 9934..10920 product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531563.1 transl_table 11 codon_start 1 locus_tag LOCUS_19920 sequence125 source 1..12046 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 328..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19930 CDS 1393..2280 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19940 CDS 2280..5099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19950 CDS 5748..5927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19960 CDS 6042..6506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19970 CDS complement(6528..7340) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19980 CDS 7541..7990 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_19990 CDS complement(8117..9778) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 transl_table 11 codon_start 1 locus_tag LOCUS_20000 CDS complement(9882..10397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20010 CDS complement(10965..11495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20020 CDS complement(11514..11864) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20030 sequence126 source 1..11990 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 470..853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20040 CDS 918..3071 product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 transl_table 11 codon_start 1 locus_tag LOCUS_20050 CDS 3080..3682 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20060 CDS complement(3683..5374) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20070 CDS complement(5371..6906) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20080 CDS 7113..8927 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20090 CDS 8927..9688 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20100 CDS 10093..11382 product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20110 gene bcd CDS 11390..11866 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20120 sequence127 source 1..11836 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 192..1058 product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 transl_table 11 codon_start 1 locus_tag LOCUS_20130 CDS 1085..2272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20140 CDS 2272..3249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20150 tRNA complement(3295..3371) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00140 CDS 3726..4088 product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179272.1 transl_table 11 codon_start 1 locus_tag LOCUS_20160 gene nuoA CDS 4079..4804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20170 CDS 4801..5265 product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 transl_table 11 codon_start 1 locus_tag LOCUS_20180 CDS 5268..6443 product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396802.1 transl_table 11 codon_start 1 locus_tag LOCUS_20190 gene nuoD CDS 6440..7474 product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227702.1 transl_table 11 codon_start 1 locus_tag LOCUS_20200 gene nuoH CDS 7471..8040 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20210 CDS 8037..8540 product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 transl_table 11 codon_start 1 locus_tag LOCUS_20220 CDS 8541..8843 product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 transl_table 11 codon_start 1 locus_tag LOCUS_20230 gene nuoK CDS 8840..10708 product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 transl_table 11 codon_start 1 locus_tag LOCUS_20240 gene nuoL sequence128 source 1..11762 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1257..2756 product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 transl_table 11 codon_start 1 locus_tag LOCUS_20250 CDS 2827..3540 product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 transl_table 11 codon_start 1 locus_tag LOCUS_20260 CDS 3577..5547 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20270 CDS 5707..6096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20280 CDS 6102..7361 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20290 CDS complement(7365..8657) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20300 CDS complement(8664..9146) product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704507.1 transl_table 11 codon_start 1 locus_tag LOCUS_20310 sequence129 source 1..11621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(848..2629) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 transl_table 11 codon_start 1 locus_tag LOCUS_20320 CDS complement(2626..3588) product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 transl_table 11 codon_start 1 locus_tag LOCUS_20330 CDS complement(3585..4484) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20340 CDS complement(4481..5353) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20350 CDS complement(5366..6352) product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 transl_table 11 codon_start 1 locus_tag LOCUS_20360 CDS complement(6361..7497) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 transl_table 11 codon_start 1 locus_tag LOCUS_20370 gene dnaJ CDS complement(7568..9457) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 transl_table 11 codon_start 1 locus_tag LOCUS_20380 gene dnaK CDS 9718..10011 product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 transl_table 11 codon_start 1 locus_tag LOCUS_20390 gene groES CDS 10014..11597 product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 transl_table 11 codon_start 1 locus_tag LOCUS_20400 gene groL sequence130 source 1..11604 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 926..5044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20410 CDS complement(5034..5642) product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 transl_table 11 codon_start 1 locus_tag LOCUS_20420 CDS complement(5746..6207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20430 CDS complement(6368..7783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20440 CDS complement(7814..9517) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 transl_table 11 codon_start 1 locus_tag LOCUS_20450 CDS 9644..10243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20460 sequence131 source 1..11476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..1702) product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420337.1 transl_table 11 codon_start 1 locus_tag LOCUS_20470 gene flhB CDS complement(1702..2457) product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 transl_table 11 codon_start 1 locus_tag LOCUS_20480 gene fliR CDS complement(2457..2723) product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881279.1 transl_table 11 codon_start 1 locus_tag LOCUS_20490 gene fliQ CDS complement(2720..3481) product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 transl_table 11 codon_start 1 locus_tag LOCUS_20500 gene fliP CDS complement(3478..3957) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20510 CDS complement(3954..4232) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20520 CDS complement(4290..5132) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20530 CDS complement(5176..5670) product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 transl_table 11 codon_start 1 locus_tag LOCUS_20540 CDS complement(5657..6400) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20550 CDS complement(6400..7164) product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 transl_table 11 codon_start 1 locus_tag LOCUS_20560 CDS complement(7257..8672) product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 transl_table 11 codon_start 1 locus_tag LOCUS_20570 CDS complement(8819..9121) product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 transl_table 11 codon_start 1 locus_tag LOCUS_20580 CDS complement(9220..9906) product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839909.1 transl_table 11 codon_start 1 locus_tag LOCUS_20590 CDS complement(9958..10773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20600 sequence132 source 1..11345 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(322..759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20610 CDS complement(752..2296) product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 transl_table 11 codon_start 1 locus_tag LOCUS_20620 CDS complement(2296..3378) product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 transl_table 11 codon_start 1 locus_tag LOCUS_20630 CDS complement(3387..5417) product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 transl_table 11 codon_start 1 locus_tag LOCUS_20640 CDS 6011..6856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20650 CDS 6906..8105 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20660 CDS complement(8358..9794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20670 misc_feature complement(9791..>11345) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:efflux RND transporter permease subunit locus_tag LOCUS_20680 sequence133 source 1..11321 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1207..1824 product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 transl_table 11 codon_start 1 locus_tag LOCUS_20690 CDS 2017..2181 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20700 CDS 2289..3770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20710 CDS 3784..4611 product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 transl_table 11 codon_start 1 locus_tag LOCUS_20720 CDS 4726..5043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20730 CDS complement(5109..6743) product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 transl_table 11 codon_start 1 locus_tag LOCUS_20740 CDS complement(6734..7489) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20750 CDS complement(7486..8373) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 transl_table 11 codon_start 1 locus_tag LOCUS_20760 CDS complement(8433..9908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20770 CDS complement(10021..11289) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20780 sequence134 source 1..11308 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..982) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20790 CDS 1598..2236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20800 CDS 2762..5044 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 transl_table 11 codon_start 1 locus_tag LOCUS_20810 CDS 5251..6552 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20820 CDS 6622..6876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20830 CDS 6989..8485 product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123403.1 transl_table 11 codon_start 1 locus_tag LOCUS_20840 CDS 8482..10317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20850 sequence135 source 1..11274 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(904..3000) product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286040.1 transl_table 11 codon_start 1 locus_tag LOCUS_20860 gene ligA CDS 2990..3307 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20870 CDS 3342..4382 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20880 CDS 4475..6676 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20890 CDS complement(6673..7275) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20900 CDS 7430..8947 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 transl_table 11 codon_start 1 locus_tag LOCUS_20910 CDS complement(8951..9490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20920 CDS complement(9544..10692) product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 transl_table 11 codon_start 1 locus_tag LOCUS_20930 misc_feature complement(10682..>11274) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582483.1:TetR/AcrR family transcriptional regulator locus_tag LOCUS_20940 sequence136 source 1..11107 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(343..2349) product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 transl_table 11 codon_start 1 locus_tag LOCUS_20950 CDS 2476..3072 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 transl_table 11 codon_start 1 locus_tag LOCUS_20960 CDS 3062..3859 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20970 CDS complement(3865..5367) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_20980 CDS complement(5427..6461) product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 transl_table 11 codon_start 1 locus_tag LOCUS_20990 gene tgt CDS complement(6538..7569) product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 transl_table 11 codon_start 1 locus_tag LOCUS_21000 gene queA CDS 7710..7973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21010 CDS 7983..10373 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21020 sequence137 source 1..11094 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 210..875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21030 CDS 880..1680 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 transl_table 11 codon_start 1 locus_tag LOCUS_21040 CDS 1702..2106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21050 CDS complement(2112..4382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21060 CDS complement(4379..5926) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21070 CDS 6030..7211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296451.1 transl_table 11 codon_start 1 locus_tag LOCUS_21080 CDS complement(7208..7864) product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 transl_table 11 codon_start 1 locus_tag LOCUS_21090 CDS 8263..8574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21100 CDS 8670..8816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21110 CDS 8879..9727 product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227561.1 transl_table 11 codon_start 1 locus_tag LOCUS_21120 misc_feature complement(9780..>11094) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000786086.1:threonine--tRNA ligase locus_tag LOCUS_21130 sequence138 source 1..11075 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(376..1215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21140 CDS 1484..2332 product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21150 CDS complement(2366..2887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21160 CDS complement(2884..6315) product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267304.1 transl_table 11 codon_start 1 locus_tag LOCUS_21170 gene mfd CDS complement(6322..7590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21180 CDS complement(7673..7882) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21190 CDS complement(7903..8217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21200 CDS 8593..10044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21210 sequence139 source 1..11072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 201..1589 product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 transl_table 11 codon_start 1 locus_tag LOCUS_21220 gene der CDS 1595..3382 product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21230 gene mutL CDS 3379..4272 product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 transl_table 11 codon_start 1 locus_tag LOCUS_21240 gene miaA CDS 4360..5361 product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 transl_table 11 codon_start 1 locus_tag LOCUS_21250 CDS 5365..6648 product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 transl_table 11 codon_start 1 locus_tag LOCUS_21260 gene aroA CDS 6645..7319 product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775570.1 transl_table 11 codon_start 1 locus_tag LOCUS_21270 gene cmk CDS 7543..9387 product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21280 CDS 9493..9798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21290 sequence140 source 1..11063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 496..2295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21300 CDS complement(2345..2818) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21310 CDS complement(3312..4121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21320 CDS 4099..4689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21330 CDS 4686..5153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21340 CDS 5325..6989 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21350 CDS 6986..7699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21360 CDS 7853..8767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21370 CDS complement(8770..10065) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21380 CDS complement(10062..10493) product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 transl_table 11 codon_start 1 locus_tag LOCUS_21390 sequence141 source 1..11027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1293..3287 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21400 CDS 3379..4737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21410 CDS complement(4694..6139) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 transl_table 11 codon_start 1 locus_tag LOCUS_21420 CDS complement(6186..7241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21430 CDS complement(7297..8193) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_21440 CDS 8496..8705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21450 CDS 8754..9278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21460 CDS complement(9285..10304) product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 transl_table 11 codon_start 1 locus_tag LOCUS_21470 CDS 10546..10968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21480 sequence142 source 1..10988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(620..2176) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21490 CDS 2175..3542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21500 CDS 3555..4052 product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 transl_table 11 codon_start 1 locus_tag LOCUS_21510 CDS 4104..5279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21520 CDS 5297..5779 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21530 CDS complement(5782..6294) product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 transl_table 11 codon_start 1 locus_tag LOCUS_21540 gene greB CDS complement(6301..7593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21550 CDS 7655..9694 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21560 sequence143 source 1..10934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(857..1606) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 transl_table 11 codon_start 1 locus_tag LOCUS_21570 CDS complement(1603..2769) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 transl_table 11 codon_start 1 locus_tag LOCUS_21580 CDS complement(2773..3780) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 transl_table 11 codon_start 1 locus_tag LOCUS_21590 CDS complement(3780..4931) product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 transl_table 11 codon_start 1 locus_tag LOCUS_21600 CDS complement(4924..5898) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 transl_table 11 codon_start 1 locus_tag LOCUS_21610 CDS complement(6184..6726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21620 CDS complement(6771..7904) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 transl_table 11 codon_start 1 locus_tag LOCUS_21630 CDS complement(7962..8762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21640 CDS complement(8965..9819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21650 CDS complement(9863..10696) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21660 sequence144 source 1..10904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809761.1:type III pantothenate kinase locus_tag LOCUS_21670 CDS 975..3359 product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 transl_table 11 codon_start 1 locus_tag LOCUS_21680 CDS 3395..4564 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206324.1 transl_table 11 codon_start 1 locus_tag LOCUS_21690 CDS 4568..4936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21700 CDS 5034..5762 product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 transl_table 11 codon_start 1 locus_tag LOCUS_21710 CDS 5764..6423 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 transl_table 11 codon_start 1 locus_tag LOCUS_21720 CDS complement(6425..9070) product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 transl_table 11 codon_start 1 locus_tag LOCUS_21730 gene ppdK misc_feature complement(9083..>10904) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941242.1:glycine--tRNA ligase subunit beta locus_tag LOCUS_21740 sequence145 source 1..10848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1022..1996) product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 transl_table 11 codon_start 1 locus_tag LOCUS_21750 CDS complement(2098..4443) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21760 CDS complement(4880..5044) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21770 CDS 5174..5731 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21780 CDS complement(5861..6853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 transl_table 11 codon_start 1 locus_tag LOCUS_21790 CDS complement(6899..7048) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21800 CDS 7231..8124 product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 transl_table 11 codon_start 1 locus_tag LOCUS_21810 gene lipA CDS 8124..9020 product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776524.1 transl_table 11 codon_start 1 locus_tag LOCUS_21820 CDS 9029..10282 product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 transl_table 11 codon_start 1 locus_tag LOCUS_21830 gene pdhC sequence146 source 1..10813 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(237..641) product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 transl_table 11 codon_start 1 locus_tag LOCUS_21840 gene msrB CDS 739..1740 product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 transl_table 11 codon_start 1 locus_tag LOCUS_21850 gene trpD CDS complement(1807..3252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21860 CDS complement(3278..3673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21870 CDS 3757..4476 product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805091.1 transl_table 11 codon_start 1 locus_tag LOCUS_21880 gene trpC note possible pseudo, internal stop codon CDS 4566..5159 product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723935.1 transl_table 11 codon_start 1 locus_tag LOCUS_21890 CDS 5156..6370 product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016721143.1 transl_table 11 codon_start 1 locus_tag LOCUS_21900 gene trpB CDS 6367..7134 product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 transl_table 11 codon_start 1 locus_tag LOCUS_21910 gene trpA CDS complement(7300..7893) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21920 CDS complement(8065..8778) product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 transl_table 11 codon_start 1 locus_tag LOCUS_21930 CDS 8815..9297 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21940 CDS complement(9301..10086) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21950 sequence147 source 1..10772 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..1031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21960 CDS 1427..1903 product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 transl_table 11 codon_start 1 locus_tag LOCUS_21970 CDS 1879..2490 product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615894.1 transl_table 11 codon_start 1 locus_tag LOCUS_21980 CDS 2487..3455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_21990 CDS 3695..4909 product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 transl_table 11 codon_start 1 locus_tag LOCUS_22000 CDS complement(4940..5866) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22010 CDS 6021..6917 product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 transl_table 11 codon_start 1 locus_tag LOCUS_22020 CDS 7278..8834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22030 CDS 8865..9953 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22040 CDS complement(9961..10524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22050 sequence148 source 1..10735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..1304 product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 transl_table 11 codon_start 1 locus_tag LOCUS_22060 CDS 1394..2317 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22070 CDS complement(2307..3251) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975318.1 transl_table 11 codon_start 1 locus_tag LOCUS_22080 CDS complement(3282..4073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22090 CDS 4452..4601 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22100 CDS complement(4598..5740) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22110 CDS 5783..6511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22120 CDS complement(6477..7775) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22130 note possible pseudo, internal stop codon CDS complement(7854..8240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22140 CDS complement(8294..9097) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22150 CDS complement(9087..9761) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 transl_table 11 codon_start 1 locus_tag LOCUS_22160 CDS 9969..10721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22170 sequence149 source 1..10693 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3105..3314) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22180 CDS 3759..4082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22190 CDS complement(4103..6238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22200 CDS complement(6225..6380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22210 CDS complement(6787..7716) product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 transl_table 11 codon_start 1 locus_tag LOCUS_22220 gene xerC CDS 8344..9693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22230 sequence150 source 1..10638 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..843 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024468.1:prephenate dehydrogenase locus_tag LOCUS_22240 CDS 840..1697 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 transl_table 11 codon_start 1 locus_tag LOCUS_22250 CDS 1694..2650 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22260 CDS complement(2655..3245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22270 CDS 3767..5371 product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482641.1 transl_table 11 codon_start 1 locus_tag LOCUS_22280 CDS complement(5564..6475) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22290 CDS complement(6698..8380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22300 CDS complement(8377..9507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22310 misc_feature complement(9504..>10638) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001292789.1:VWA domain-containing protein locus_tag LOCUS_22320 sequence151 source 1..10535 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2206..8847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22330 CDS complement(8834..10420) product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 transl_table 11 codon_start 1 locus_tag LOCUS_22340 gene pfaD sequence152 source 1..10534 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1497..2528 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22350 CDS complement(2539..4377) product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 transl_table 11 codon_start 1 locus_tag LOCUS_22360 CDS 4273..4581 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22370 CDS 4566..6365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22380 CDS 6372..7685 product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 transl_table 11 codon_start 1 locus_tag LOCUS_22390 CDS 7685..9442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22400 sequence153 source 1..10509 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 158..1672 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22410 CDS 1814..2131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22420 CDS complement(2236..2604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22430 CDS complement(2689..3432) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22440 CDS 3755..4258 product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 transl_table 11 codon_start 1 locus_tag LOCUS_22450 CDS 4255..6450 product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 transl_table 11 codon_start 1 locus_tag LOCUS_22460 CDS 6555..8303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22470 CDS complement(8458..9831) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 transl_table 11 codon_start 1 locus_tag LOCUS_22480 CDS complement(10316..10507) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22490 sequence154 source 1..10468 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..1704) product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 transl_table 11 codon_start 1 locus_tag LOCUS_22500 gene desA CDS complement(1707..2819) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262205.1 transl_table 11 codon_start 1 locus_tag LOCUS_22510 gene asd CDS complement(2850..3839) product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263412.1 transl_table 11 codon_start 1 locus_tag LOCUS_22520 CDS complement(3945..4424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22530 CDS complement(4421..5473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22540 CDS complement(5477..7336) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22550 CDS 7516..7974 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22560 CDS 7974..8441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22570 CDS 8434..8664 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22580 CDS 8665..10170 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22590 sequence155 source 1..10313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..662 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113296.1:c-type cytochrome locus_tag LOCUS_22600 CDS 790..1455 product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329346.1 transl_table 11 codon_start 1 locus_tag LOCUS_22610 CDS 1506..3197 product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 transl_table 11 codon_start 1 locus_tag LOCUS_22620 CDS 3219..3794 product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 transl_table 11 codon_start 1 locus_tag LOCUS_22630 CDS 3804..4256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22640 CDS 4265..4885 product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 transl_table 11 codon_start 1 locus_tag LOCUS_22650 CDS 4882..5124 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22660 CDS 5294..5806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22670 CDS complement(5879..6445) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22680 CDS 6535..7560 product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210686.1 transl_table 11 codon_start 1 locus_tag LOCUS_22690 gene hemE CDS complement(7579..9606) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22700 sequence156 source 1..10302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(218..1177) product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 transl_table 11 codon_start 1 locus_tag LOCUS_22710 CDS complement(1202..1990) product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460372.1 transl_table 11 codon_start 1 locus_tag LOCUS_22720 CDS complement(2024..2647) product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 transl_table 11 codon_start 1 locus_tag LOCUS_22730 CDS complement(2715..3422) product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887978.1 transl_table 11 codon_start 1 locus_tag LOCUS_22740 gene fsa CDS complement(3454..3966) product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 transl_table 11 codon_start 1 locus_tag LOCUS_22750 gene folK CDS complement(3963..4463) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22760 CDS complement(4472..4933) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22770 CDS complement(5013..6083) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22780 CDS complement(6210..8645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22790 CDS complement(8754..9188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22800 CDS complement(9210..10073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22810 sequence157 source 1..10288 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(400..1608) product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403232.1 transl_table 11 codon_start 1 locus_tag LOCUS_22820 CDS 1658..2293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22830 CDS 2284..3861 product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 transl_table 11 codon_start 1 locus_tag LOCUS_22840 CDS 3917..4342 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22850 CDS complement(4376..4573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22860 CDS 4703..5725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22870 misc_feature complement(5816..>10288) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861847.1:collagen-binding adhesin CbpA locus_tag LOCUS_22880 sequence158 source 1..10279 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(575..1996) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22890 note possible pseudo, internal stop codon CDS 2363..2542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_22900 CDS complement(2474..3865) product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 transl_table 11 codon_start 1 locus_tag LOCUS_22910 gene murA CDS complement(4071..4916) product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 transl_table 11 codon_start 1 locus_tag LOCUS_22920 CDS complement(4909..6711) product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833905.1 transl_table 11 codon_start 1 locus_tag LOCUS_22930 gene dnaK CDS complement(7231..8457) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 transl_table 11 codon_start 1 locus_tag LOCUS_22940 CDS complement(8454..9755) product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 transl_table 11 codon_start 1 locus_tag LOCUS_22950 misc_feature complement(9752..>10279) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707094.1:thiamine-phosphate kinase locus_tag LOCUS_22960 sequence159 source 1..10273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(891..1448) product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262533.1 transl_table 11 codon_start 1 locus_tag LOCUS_22970 CDS 1803..2657 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 transl_table 11 codon_start 1 locus_tag LOCUS_22980 CDS complement(2662..3843) product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 transl_table 11 codon_start 1 locus_tag LOCUS_22990 CDS 3986..5674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23000 CDS complement(5819..6985) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 transl_table 11 codon_start 1 locus_tag LOCUS_23010 CDS 7188..8723 product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 transl_table 11 codon_start 1 locus_tag LOCUS_23020 CDS 8744..9487 product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 transl_table 11 codon_start 1 locus_tag LOCUS_23030 CDS 9709..10080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23040 sequence160 source 1..10237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..2232 product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 transl_table 11 codon_start 1 locus_tag LOCUS_23050 CDS 2233..3258 product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 transl_table 11 codon_start 1 locus_tag LOCUS_23060 gene adhP CDS complement(3247..4173) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23070 CDS complement(4170..5057) product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 transl_table 11 codon_start 1 locus_tag LOCUS_23080 CDS complement(5059..6183) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23090 CDS complement(6209..6829) product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 transl_table 11 codon_start 1 locus_tag LOCUS_23100 gene kynB CDS complement(6833..7258) product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895964.1 transl_table 11 codon_start 1 locus_tag LOCUS_23110 CDS complement(7255..9150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23120 CDS 9273..9653 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23130 CDS 9706..10143 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23140 sequence161 source 1..10236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(587..1177) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 transl_table 11 codon_start 1 locus_tag LOCUS_23150 CDS complement(1431..2072) product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 transl_table 11 codon_start 1 locus_tag LOCUS_23160 CDS 2505..3122 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23170 CDS 3156..4292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23180 CDS complement(4298..5359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23190 CDS 5489..5962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23200 CDS complement(5967..6947) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23210 CDS complement(7042..7536) product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 transl_table 11 codon_start 1 locus_tag LOCUS_23220 CDS complement(7596..8708) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 transl_table 11 codon_start 1 locus_tag LOCUS_23230 misc_feature complement(8754..>10236) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615973.1:serine/threonine protein kinase locus_tag LOCUS_23240 sequence162 source 1..10221 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 649..1587 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23250 CDS 1851..2123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23260 CDS 2120..2377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23270 CDS 2411..2683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23280 CDS complement(2661..3611) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 transl_table 11 codon_start 1 locus_tag LOCUS_23290 CDS complement(3614..4786) product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 transl_table 11 codon_start 1 locus_tag LOCUS_23300 CDS complement(4792..5517) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 transl_table 11 codon_start 1 locus_tag LOCUS_23310 CDS complement(5514..7076) product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 transl_table 11 codon_start 1 locus_tag LOCUS_23320 CDS complement(7551..7736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23330 note possible pseudo, internal stop codon, frameshifted CDS 8028..8627 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23340 CDS 8901..9914 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 transl_table 11 codon_start 1 locus_tag LOCUS_23350 sequence163 source 1..10128 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(826..2184) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23360 CDS complement(2396..5770) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23370 CDS 6203..6670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23380 CDS 6671..7057 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23390 CDS complement(7065..7487) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23400 CDS complement(7780..8766) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985094.1 transl_table 11 codon_start 1 locus_tag LOCUS_23410 CDS 9171..10028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23420 sequence164 source 1..10124 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 473..2113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23430 CDS 2179..4365 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23440 CDS 4372..5235 product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 transl_table 11 codon_start 1 locus_tag LOCUS_23450 gene rsmI CDS 5356..5778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23460 CDS 5775..7229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23470 CDS complement(7226..8590) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23480 sequence165 source 1..10098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1966..2505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23490 CDS 2519..4258 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 transl_table 11 codon_start 1 locus_tag LOCUS_23500 CDS 4251..6020 product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 transl_table 11 codon_start 1 locus_tag LOCUS_23510 CDS 6125..6838 product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952746.1 transl_table 11 codon_start 1 locus_tag LOCUS_23520 gene cobB CDS complement(7941..9047) product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028905.1 transl_table 11 codon_start 1 locus_tag LOCUS_23530 CDS 9139..10095 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 transl_table 11 codon_start 1 locus_tag LOCUS_23540 sequence166 source 1..10055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 322..555 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23550 CDS complement(552..1733) product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 transl_table 11 codon_start 1 locus_tag LOCUS_23560 CDS 1841..2641 product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 transl_table 11 codon_start 1 locus_tag LOCUS_23570 CDS complement(2638..4584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23580 CDS complement(4616..5248) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23590 CDS complement(5409..6092) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23600 CDS complement(6089..9322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23610 sequence167 source 1..10052 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..619 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882887.1:3-deoxy-manno-octulosonate cytidylyltransferase locus_tag LOCUS_23620 CDS 691..2367 product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 transl_table 11 codon_start 1 locus_tag LOCUS_23630 CDS 2409..2942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23640 CDS 2935..3642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23650 CDS 3818..5257 product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 transl_table 11 codon_start 1 locus_tag LOCUS_23660 gene rpoN CDS 5299..5637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23670 CDS 5800..6960 product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 transl_table 11 codon_start 1 locus_tag LOCUS_23680 gene metK CDS 7127..7954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 transl_table 11 codon_start 1 locus_tag LOCUS_23690 CDS 7954..9789 product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 transl_table 11 codon_start 1 locus_tag LOCUS_23700 sequence168 source 1..9978 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(423..2921) product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132571.1 transl_table 11 codon_start 1 locus_tag LOCUS_23710 gene leuS CDS complement(3020..3832) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23720 CDS complement(3866..5311) product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 transl_table 11 codon_start 1 locus_tag LOCUS_23730 CDS 5587..6573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23740 CDS 6648..7316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23750 CDS complement(7380..9269) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23760 sequence169 source 1..9958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3650..4474 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524370.1 transl_table 11 codon_start 1 locus_tag LOCUS_23770 CDS 4516..5292 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23780 CDS 5439..8249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23790 CDS 8300..9037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23800 sequence170 source 1..9932 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(299..1060) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23810 CDS complement(1045..1449) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23820 CDS complement(1449..1640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23830 CDS complement(1834..3207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23840 CDS 3294..4421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23850 CDS complement(4447..5325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23860 CDS complement(5379..6047) product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 transl_table 11 codon_start 1 locus_tag LOCUS_23870 gene uppS CDS complement(6047..7504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23880 CDS 7581..9890 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23890 sequence171 source 1..9926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(152..3949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23900 CDS 3893..4279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23910 CDS complement(4376..6277) product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404234.1 transl_table 11 codon_start 1 locus_tag LOCUS_23920 CDS complement(6277..8634) product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 transl_table 11 codon_start 1 locus_tag LOCUS_23930 sequence172 source 1..9911 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1749..2585 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23940 CDS 2585..3526 product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 transl_table 11 codon_start 1 locus_tag LOCUS_23950 CDS 3523..4293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23960 CDS 4290..6206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_23970 CDS 6233..7183 product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 transl_table 11 codon_start 1 locus_tag LOCUS_23980 CDS 7180..8475 product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 transl_table 11 codon_start 1 locus_tag LOCUS_23990 CDS 8497..8793 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24000 CDS 8957..9709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24010 sequence173 source 1..9888 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1053..1997 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954148.1 transl_table 11 codon_start 1 locus_tag LOCUS_24020 CDS 2118..3086 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24030 CDS 3250..4710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24040 CDS complement(4703..5158) product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 transl_table 11 codon_start 1 locus_tag LOCUS_24050 CDS 5629..9831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24060 note possible pseudo, internal stop codon sequence174 source 1..9887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1459 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase locus_tag LOCUS_24070 CDS 1459..2178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24080 CDS 2175..2954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24090 CDS complement(2974..5046) product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 transl_table 11 codon_start 1 locus_tag LOCUS_24100 CDS 5128..5706 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24110 CDS complement(5703..6614) product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 transl_table 11 codon_start 1 locus_tag LOCUS_24120 CDS 6613..7395 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 transl_table 11 codon_start 1 locus_tag LOCUS_24130 CDS 7398..9041 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946539.1 transl_table 11 codon_start 1 locus_tag LOCUS_24140 sequence175 source 1..9876 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 90..1301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24150 CDS 1301..2383 product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 transl_table 11 codon_start 1 locus_tag LOCUS_24160 gene serC CDS 2405..2725 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24170 CDS complement(2735..3934) product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 transl_table 11 codon_start 1 locus_tag LOCUS_24180 CDS 4096..7293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24190 CDS 7300..8157 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24200 CDS complement(8154..8639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 transl_table 11 codon_start 1 locus_tag LOCUS_24210 misc_feature complement(8636..>9876) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:serine/threonine-protein kinase locus_tag LOCUS_24220 sequence176 source 1..9857 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 522..1736 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24230 tRNA complement(1784..1857) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00150 CDS 1941..2777 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24240 CDS 2774..3220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24250 CDS 3213..3716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24260 CDS 3940..4161 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24270 CDS 4170..5273 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 transl_table 11 codon_start 1 locus_tag LOCUS_24280 CDS 5322..5993 product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 transl_table 11 codon_start 1 locus_tag LOCUS_24290 CDS 6009..6869 product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 transl_table 11 codon_start 1 locus_tag LOCUS_24300 gene panB CDS 6869..7717 product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148756109.1 transl_table 11 codon_start 1 locus_tag LOCUS_24310 gene panC CDS 7708..8049 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24320 CDS 8188..9162 product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 transl_table 11 codon_start 1 locus_tag LOCUS_24330 misc_feature complement(9244..>9857) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979323.1:homocitrate synthase locus_tag LOCUS_24340 sequence177 source 1..9771 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 542..919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24350 CDS complement(960..1649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24360 CDS 1804..2781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24370 CDS complement(2955..3641) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 transl_table 11 codon_start 1 locus_tag LOCUS_24380 CDS complement(3651..6497) product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 transl_table 11 codon_start 1 locus_tag LOCUS_24390 CDS complement(7277..8044) product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 transl_table 11 codon_start 1 locus_tag LOCUS_24400 gene yaaA CDS complement(8049..8684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24410 CDS 9241..9402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24420 CDS 9426..9623 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24430 sequence178 source 1..9743 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(324..2399) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24440 CDS complement(2612..4108) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24450 CDS 4269..4625 product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 transl_table 11 codon_start 1 locus_tag LOCUS_24460 CDS 4628..5614 product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24470 CDS complement(5747..6796) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24480 note possible pseudo, internal stop codon CDS complement(6968..7270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24490 note possible pseudo, internal stop codon CDS complement(7683..8600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24500 CDS complement(8597..9535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24510 CDS 9522..9689 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24520 sequence179 source 1..9684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(380..778) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24530 CDS complement(775..1956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24540 CDS complement(1996..2583) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24550 CDS complement(2744..4591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24560 CDS 4848..6209 product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 transl_table 11 codon_start 1 locus_tag LOCUS_24570 CDS complement(6215..7138) product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 transl_table 11 codon_start 1 locus_tag LOCUS_24580 gene murB CDS 7171..7941 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24590 CDS 7957..8520 product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 transl_table 11 codon_start 1 locus_tag LOCUS_24600 CDS complement(8527..9678) product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 transl_table 11 codon_start 1 locus_tag LOCUS_24610 sequence180 source 1..9665 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(669..2144) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24620 CDS complement(2151..2945) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 transl_table 11 codon_start 1 locus_tag LOCUS_24630 CDS complement(2942..3676) product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 transl_table 11 codon_start 1 locus_tag LOCUS_24640 CDS complement(3723..4844) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24650 CDS 4845..5168 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24660 tRNA 5307..5382 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00160 CDS 5467..6111 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 transl_table 11 codon_start 1 locus_tag LOCUS_24670 CDS complement(6245..7309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24680 CDS 7365..8117 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24690 CDS complement(8205..8468) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24700 CDS complement(8644..8826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24710 sequence181 source 1..9647 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1382..1801 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24720 CDS complement(1955..2749) product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 transl_table 11 codon_start 1 locus_tag LOCUS_24730 note possible pseudo, internal stop codon CDS complement(3041..4561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24740 CDS complement(4558..5133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24750 CDS 5236..6138 product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703964.1 transl_table 11 codon_start 1 locus_tag LOCUS_24760 gene ilvY CDS 6252..6836 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 transl_table 11 codon_start 1 locus_tag LOCUS_24770 CDS 6833..7795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24780 CDS complement(8876..9493) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24790 sequence182 source 1..9598 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 182..1039 product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 transl_table 11 codon_start 1 locus_tag LOCUS_24800 gene prmC CDS 1111..2817 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 transl_table 11 codon_start 1 locus_tag LOCUS_24810 CDS 2900..3925 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 transl_table 11 codon_start 1 locus_tag LOCUS_24820 CDS 3933..5096 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24830 CDS 5259..6995 product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 transl_table 11 codon_start 1 locus_tag LOCUS_24840 misc_feature complement(6999..>9598) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein locus_tag LOCUS_24850 sequence183 source 1..9548 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1396 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256440.1:LamG domain-containing protein locus_tag LOCUS_24860 CDS 1535..2131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24870 CDS complement(2223..3116) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 transl_table 11 codon_start 1 locus_tag LOCUS_24880 CDS 3249..3611 product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 transl_table 11 codon_start 1 locus_tag LOCUS_24890 CDS 3939..4205 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24900 note possible pseudo, internal stop codon CDS 4533..4973 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24910 CDS complement(5088..5711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24920 CDS 5910..6059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24930 CDS complement(6265..7461) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24940 sequence184 source 1..9486 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1976..3781) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24950 CDS complement(3781..4407) product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 transl_table 11 codon_start 1 locus_tag LOCUS_24960 CDS complement(4411..5130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24970 CDS complement(5142..5780) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24980 CDS complement(5777..6733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_24990 CDS complement(6724..7929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25000 CDS complement(7926..8564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25010 sequence185 source 1..9400 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 771..1367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25020 CDS 1512..2645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25030 note possible pseudo, internal stop codon CDS 2612..4588 product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25040 CDS complement(4855..6273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25050 CDS 6918..7571 product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051901260.1 transl_table 11 codon_start 1 locus_tag LOCUS_25060 CDS 7573..9153 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25070 sequence186 source 1..9337 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1401 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD locus_tag LOCUS_25080 tRNA 1435..1508 product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00170 CDS 1525..2220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25090 CDS complement(2491..2703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25100 CDS 2811..5087 product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 transl_table 11 codon_start 1 locus_tag LOCUS_25110 CDS complement(5084..6355) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25120 CDS complement(6352..8172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25130 CDS complement(8165..8578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25140 CDS complement(8833..9207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25150 sequence187 source 1..9282 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(17..3616) product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 transl_table 11 codon_start 1 locus_tag LOCUS_25160 gene dnaE CDS 3678..4700 product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 transl_table 11 codon_start 1 locus_tag LOCUS_25170 CDS complement(4701..7001) product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 transl_table 11 codon_start 1 locus_tag LOCUS_25180 CDS 7173..7829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25190 CDS complement(7806..9062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25200 sequence188 source 1..9159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2381 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974111.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase locus_tag LOCUS_25210 CDS complement(2436..3161) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25220 CDS complement(3158..4216) product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896630.1 transl_table 11 codon_start 1 locus_tag LOCUS_25230 CDS complement(4213..5022) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 transl_table 11 codon_start 1 locus_tag LOCUS_25240 CDS complement(5030..5800) product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 transl_table 11 codon_start 1 locus_tag LOCUS_25250 CDS 6164..6625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25260 CDS 6632..6880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25270 CDS 6987..7328 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25280 CDS complement(7372..8277) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25290 sequence189 source 1..9152 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..2297 product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 transl_table 11 codon_start 1 locus_tag LOCUS_25300 gene flhA CDS 2395..3174 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 transl_table 11 codon_start 1 locus_tag LOCUS_25310 gene fliA CDS 3171..3878 product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 transl_table 11 codon_start 1 locus_tag LOCUS_25320 gene flgF CDS 3875..4636 product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 transl_table 11 codon_start 1 locus_tag LOCUS_25330 gene flgG CDS 4640..5239 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25340 CDS 5236..5943 product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 transl_table 11 codon_start 1 locus_tag LOCUS_25350 CDS 6027..7118 product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 transl_table 11 codon_start 1 locus_tag LOCUS_25360 CDS 7134..8681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25370 sequence190 source 1..9133 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(92..1060) product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 transl_table 11 codon_start 1 locus_tag LOCUS_25380 CDS complement(1057..1959) product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 transl_table 11 codon_start 1 locus_tag LOCUS_25390 CDS complement(1956..2966) product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707836.1 transl_table 11 codon_start 1 locus_tag LOCUS_25400 gene pseG CDS complement(2975..3703) product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 transl_table 11 codon_start 1 locus_tag LOCUS_25410 CDS complement(3700..4848) product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 transl_table 11 codon_start 1 locus_tag LOCUS_25420 gene pseC CDS complement(4852..5826) product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 transl_table 11 codon_start 1 locus_tag LOCUS_25430 gene pseB CDS 5922..6560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25440 CDS 6553..7845 product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707838.1 transl_table 11 codon_start 1 locus_tag LOCUS_25450 CDS 7838..8095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25460 CDS 8438..8722 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25470 sequence191 source 1..9111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2045..2566) product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841462.1 transl_table 11 codon_start 1 locus_tag LOCUS_25480 CDS 2637..2870 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25490 CDS complement(2875..4323) product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 transl_table 11 codon_start 1 locus_tag LOCUS_25500 CDS complement(4400..5650) product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 transl_table 11 codon_start 1 locus_tag LOCUS_25510 CDS complement(5647..7218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25520 CDS 7261..8181 product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 transl_table 11 codon_start 1 locus_tag LOCUS_25530 gene deoC sequence192 source 1..9064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(629..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25540 CDS 1361..1822 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25550 CDS 1827..2696 product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 transl_table 11 codon_start 1 locus_tag LOCUS_25560 CDS complement(2748..3983) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25570 CDS complement(3980..4474) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25580 CDS complement(4476..6425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25590 CDS 6517..7089 product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 transl_table 11 codon_start 1 locus_tag LOCUS_25600 CDS 7202..7723 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25610 note possible pseudo, internal stop codon, frameshifted CDS 7727..8494 product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 transl_table 11 codon_start 1 locus_tag LOCUS_25620 sequence193 source 1..9057 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(697..3579) product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972453.1 transl_table 11 codon_start 1 locus_tag LOCUS_25630 CDS complement(3679..5502) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25640 CDS 5700..6320 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25650 CDS 6435..7430 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25660 CDS complement(7391..8218) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25670 sequence194 source 1..9043 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(659..1828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25680 CDS complement(1838..2791) product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 transl_table 11 codon_start 1 locus_tag LOCUS_25690 gene mltG CDS complement(2844..4742) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25700 CDS 4898..5698 product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 transl_table 11 codon_start 1 locus_tag LOCUS_25710 CDS 5667..6398 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25720 CDS complement(6395..7105) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25730 CDS complement(7105..8073) product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 transl_table 11 codon_start 1 locus_tag LOCUS_25740 gene rluD CDS 8184..8951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25750 sequence195 source 1..9029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(648..1952) product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 transl_table 11 codon_start 1 locus_tag LOCUS_25760 gene murD CDS complement(1955..3076) product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 transl_table 11 codon_start 1 locus_tag LOCUS_25770 gene mraY CDS complement(3076..4434) product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 transl_table 11 codon_start 1 locus_tag LOCUS_25780 CDS complement(4515..5873) product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 transl_table 11 codon_start 1 locus_tag LOCUS_25790 CDS complement(6309..8309) product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 transl_table 11 codon_start 1 locus_tag LOCUS_25800 CDS complement(8306..8659) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25810 sequence196 source 1..9013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1139..1900) product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 transl_table 11 codon_start 1 locus_tag LOCUS_25820 CDS complement(1897..2688) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25830 CDS complement(2672..3967) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25840 CDS complement(3957..4904) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25850 CDS 4982..5530 product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 transl_table 11 codon_start 1 locus_tag LOCUS_25860 gene def CDS 5530..6834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25870 CDS complement(6844..7452) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25880 CDS complement(7721..8017) product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389225.1 transl_table 11 codon_start 1 locus_tag LOCUS_25890 gene yhbY CDS complement(8025..8663) product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 transl_table 11 codon_start 1 locus_tag LOCUS_25900 sequence197 source 1..8892 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 51..1856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25910 CDS 2037..2519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25920 CDS 2525..4204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25930 CDS 4195..5643 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25940 CDS 5921..8530 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25950 sequence198 source 1..8881 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 454..1113 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25960 CDS 1098..2420 product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 transl_table 11 codon_start 1 locus_tag LOCUS_25970 gene fliI CDS 2658..3863 product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 transl_table 11 codon_start 1 locus_tag LOCUS_25980 CDS 3758..3964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_25990 CDS 3961..4824 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26000 CDS 5010..5729 product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704963.1 transl_table 11 codon_start 1 locus_tag LOCUS_26010 CDS 6134..7393 product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 transl_table 11 codon_start 1 locus_tag LOCUS_26020 CDS complement(7406..8791) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26030 sequence199 source 1..8877 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1242..2447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26040 CDS complement(2442..3122) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26050 CDS complement(3131..3649) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26060 CDS complement(3712..4425) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26070 CDS complement(4434..5144) product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 transl_table 11 codon_start 1 locus_tag LOCUS_26080 CDS 5104..5763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26090 tRNA complement(5756..5830) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00180 CDS complement(5903..6148) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26100 sequence200 source 1..8869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(490..1410) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 transl_table 11 codon_start 1 locus_tag LOCUS_26110 CDS 1555..2700 product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 transl_table 11 codon_start 1 locus_tag LOCUS_26120 CDS 2719..3321 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 transl_table 11 codon_start 1 locus_tag LOCUS_26130 CDS 3415..4509 product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017613.1 transl_table 11 codon_start 1 locus_tag LOCUS_26140 CDS 4506..5159 product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 transl_table 11 codon_start 1 locus_tag LOCUS_26150 CDS complement(5156..5563) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26160 CDS 5954..7771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26170 CDS 7822..8082 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26180 sequence201 source 1..8867 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(176..1516) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26190 CDS 1565..3256 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26200 CDS complement(3253..4164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26210 CDS complement(4167..5102) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26220 CDS complement(5121..6257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26230 misc_feature complement(6254..>8867) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941653.1:putative baseplate assembly protein locus_tag LOCUS_26240 sequence202 source 1..8845 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1341..2147 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26250 CDS 2147..3151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26260 CDS 3181..4242 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26270 CDS complement(4316..4873) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26280 CDS complement(4883..5578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26290 CDS complement(5575..6834) product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918186.1 transl_table 11 codon_start 1 locus_tag LOCUS_26300 gene purD CDS complement(6873..7382) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26310 CDS complement(7475..8281) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26320 CDS 8396..8572 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26330 sequence203 source 1..8827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 241..2235 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26340 CDS 2232..4265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26350 CDS 4259..5140 product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 transl_table 11 codon_start 1 locus_tag LOCUS_26360 CDS 5137..5817 product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 transl_table 11 codon_start 1 locus_tag LOCUS_26370 CDS 5910..6389 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26380 CDS complement(6396..7643) product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 transl_table 11 codon_start 1 locus_tag LOCUS_26390 sequence204 source 1..8792 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(643..1323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26400 CDS complement(1419..2126) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26410 CDS complement(2123..3151) product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 transl_table 11 codon_start 1 locus_tag LOCUS_26420 CDS complement(3148..3858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26430 CDS complement(3858..4640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26440 CDS 4826..5767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26450 CDS 5835..7268 product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 transl_table 11 codon_start 1 locus_tag LOCUS_26460 gene purB CDS complement(7277..8164) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26470 CDS 8214..8582 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26480 sequence205 source 1..8791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 561..1712 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26490 CDS 1717..3447 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26500 CDS complement(3425..4234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26510 CDS complement(4231..4686) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26520 CDS 4714..5865 product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088637.1 transl_table 11 codon_start 1 locus_tag LOCUS_26530 CDS complement(5914..6816) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26540 CDS complement(6951..8789) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26550 sequence206 source 1..8763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..704 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082863.1:protein phosphatase 2C domain-containing protein locus_tag LOCUS_26560 CDS 766..2367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26570 CDS complement(2374..3408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26580 CDS complement(3405..5291) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26590 CDS complement(5291..6016) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 transl_table 11 codon_start 1 locus_tag LOCUS_26600 CDS complement(6016..6945) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 transl_table 11 codon_start 1 locus_tag LOCUS_26610 CDS complement(6998..8023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26620 misc_feature complement(8028..>8763) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141364.1:DEAD/DEAH box helicase family protein locus_tag LOCUS_26630 sequence207 source 1..8755 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1099..2229) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 transl_table 11 codon_start 1 locus_tag LOCUS_26640 CDS complement(2226..3284) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26650 CDS 3335..5476 product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 transl_table 11 codon_start 1 locus_tag LOCUS_26660 CDS 5470..6108 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26670 CDS 6105..7283 product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 transl_table 11 codon_start 1 locus_tag LOCUS_26680 CDS complement(7287..8291) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 transl_table 11 codon_start 1 locus_tag LOCUS_26690 sequence208 source 1..8753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 131..562 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26700 CDS 622..981 product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 transl_table 11 codon_start 1 locus_tag LOCUS_26710 gene rbfA CDS 978..1946 product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 transl_table 11 codon_start 1 locus_tag LOCUS_26720 gene truB CDS complement(1957..2133) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26730 CDS 2099..2368 product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 transl_table 11 codon_start 1 locus_tag LOCUS_26740 gene rpsO CDS 2642..4744 product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 transl_table 11 codon_start 1 locus_tag LOCUS_26750 gene pnp CDS 4744..5190 product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 transl_table 11 codon_start 1 locus_tag LOCUS_26760 gene dut CDS complement(5195..5890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26770 CDS 5991..7544 product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 transl_table 11 codon_start 1 locus_tag LOCUS_26780 gene ffh CDS 7551..8405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26790 sequence209 source 1..8680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(619..1140) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26800 CDS complement(1137..2249) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26810 CDS complement(2242..2673) product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 transl_table 11 codon_start 1 locus_tag LOCUS_26820 gene mce CDS complement(2726..3373) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26830 CDS complement(3462..4313) product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601184.1 transl_table 11 codon_start 1 locus_tag LOCUS_26840 CDS complement(4310..5005) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26850 CDS 5101..6249 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26860 CDS complement(6278..7441) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26870 CDS complement(7523..7702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26880 sequence210 source 1..8648 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 671..2344 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26890 CDS 2550..2741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26900 CDS complement(3267..3962) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26910 CDS 4447..5700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26920 CDS 5700..6266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26930 CDS complement(6349..6564) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26940 CDS complement(7373..7543) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26950 sequence211 source 1..8616 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 391..585 product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 transl_table 11 codon_start 1 locus_tag LOCUS_26960 gene rpmI CDS 651..1004 product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 transl_table 11 codon_start 1 locus_tag LOCUS_26970 gene rplT CDS 1019..1495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_26980 CDS 1492..1824 product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 transl_table 11 codon_start 1 locus_tag LOCUS_26990 gene ihfA CDS 1817..2218 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27000 tRNA 2255..2331 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00190 CDS 2461..3210 product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 transl_table 11 codon_start 1 locus_tag LOCUS_27010 gene surE CDS 3266..4186 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27020 CDS complement(4297..4902) product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 transl_table 11 codon_start 1 locus_tag LOCUS_27030 gene coaE CDS complement(4904..6682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27040 CDS complement(6775..7596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27050 CDS 7838..8563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27060 sequence212 source 1..8596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(413..1063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27070 CDS complement(1063..1671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27080 CDS 1874..2110 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27090 CDS 2107..3804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27100 CDS 3807..4703 product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 transl_table 11 codon_start 1 locus_tag LOCUS_27110 CDS 4700..5467 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039081.1 transl_table 11 codon_start 1 locus_tag LOCUS_27120 CDS 5460..6083 product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088087.1 transl_table 11 codon_start 1 locus_tag LOCUS_27130 CDS complement(6091..6870) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27140 CDS 6960..8351 product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930451.1 transl_table 11 codon_start 1 locus_tag LOCUS_27150 gene ntrC sequence213 source 1..8514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1923..2327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27160 CDS 2302..2463 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27170 CDS complement(2453..3574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27180 CDS complement(3608..6316) product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_table 11 codon_start 1 transl_except (pos:5246..5248,aa:Sec) note codon on position 357 is selenocysteine opal codon. locus_tag LOCUS_27190 gene fdhF CDS complement(6313..7821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27200 sequence214 source 1..8465 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1005 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943546.1:sigma-54 dependent transcriptional regulator locus_tag LOCUS_27210 CDS complement(998..2464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27220 CDS complement(3316..5319) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27230 CDS complement(5657..6835) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27240 CDS 7264..7614 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27250 sequence215 source 1..8433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 132..947 product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 transl_table 11 codon_start 1 locus_tag LOCUS_27260 CDS 960..2465 product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 transl_table 11 codon_start 1 locus_tag LOCUS_27270 gene fadD4 CDS 2465..2896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27280 CDS 3038..3826 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27290 CDS 3882..4808 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 transl_table 11 codon_start 1 locus_tag LOCUS_27300 CDS 4896..5477 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27310 CDS 5484..5648 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27320 CDS 5703..8420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27330 sequence216 source 1..8428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(187..2427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27340 CDS 2644..2946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27350 CDS 2943..3383 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27360 CDS complement(3512..5344) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27370 CDS 6097..7293 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27380 CDS 7899..8324 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27390 sequence217 source 1..8354 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1390..2691) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27400 CDS 2909..4000 product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 transl_table 11 codon_start 1 locus_tag LOCUS_27410 gene mqnC CDS 4286..4837 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27420 CDS 4816..5532 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27430 CDS complement(5533..5895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27440 CDS 6187..6807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27450 misc_feature complement(6815..>8354) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein locus_tag LOCUS_27460 sequence218 source 1..8306 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..2104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27470 CDS complement(2432..2710) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27480 CDS 2919..3548 product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705143.1 transl_table 11 codon_start 1 locus_tag LOCUS_27490 CDS 3639..5819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27500 CDS 5915..6229 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27510 note possible pseudo, internal stop codon CDS 6233..6955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27520 note possible pseudo, internal stop codon CDS 7153..7776 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27530 CDS 7835..8254 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27540 sequence219 source 1..8302 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(326..1357) product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 transl_table 11 codon_start 1 locus_tag LOCUS_27550 gene gcvT CDS complement(1465..2316) product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 transl_table 11 codon_start 1 locus_tag LOCUS_27560 gene folD CDS complement(2313..2669) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27570 CDS 2785..3594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27580 CDS 3591..4520 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27590 CDS 4517..5602 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 transl_table 11 codon_start 1 locus_tag LOCUS_27600 CDS complement(5626..6642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27610 CDS complement(6672..7631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27620 sequence220 source 1..8286 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..379 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27630 CDS complement(453..1787) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27640 CDS complement(1903..2523) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27650 CDS complement(2600..3085) product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200892.1 transl_table 11 codon_start 1 locus_tag LOCUS_27660 CDS 3238..4266 product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 transl_table 11 codon_start 1 locus_tag LOCUS_27670 CDS 4509..4946 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27680 CDS 5002..5649 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27690 misc_feature complement(6182..>8286) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein locus_tag LOCUS_27700 sequence221 source 1..8281 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(269..874) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27710 CDS 1083..2111 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27720 CDS complement(2108..2671) product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 transl_table 11 codon_start 1 locus_tag LOCUS_27730 CDS complement(2695..5091) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27740 CDS 5249..6163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27750 CDS complement(6126..7325) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27760 sequence222 source 1..8280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2416..3108) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 transl_table 11 codon_start 1 locus_tag LOCUS_27770 CDS complement(3105..4439) product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 transl_table 11 codon_start 1 locus_tag LOCUS_27780 CDS complement(4565..5479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27790 CDS complement(5504..6586) product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 transl_table 11 codon_start 1 locus_tag LOCUS_27800 gene prfB CDS complement(6693..7157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27810 CDS complement(7157..8182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27820 sequence223 source 1..8277 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 235..4206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27830 CDS 4241..7393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27840 CDS complement(7390..8265) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27850 sequence224 source 1..8261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 364..1164 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27860 note possible pseudo, frameshifted CDS 1161..1919 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27870 CDS 1922..3088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27880 CDS 3123..4211 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27890 CDS complement(4254..4706) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27900 CDS complement(4714..5187) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27910 CDS complement(5196..6359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27920 CDS complement(6459..7040) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27930 CDS 7076..7741 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27940 CDS complement(7745..8260) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27950 sequence225 source 1..8209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(638..1012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27960 CDS 1198..1560 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27970 CDS complement(1544..3706) product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 transl_table 11 codon_start 1 locus_tag LOCUS_27980 CDS complement(3741..4547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_27990 CDS 4702..6432 product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 transl_table 11 codon_start 1 locus_tag LOCUS_28000 CDS 6632..8182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28010 sequence226 source 1..8172 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(639..1427) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28020 CDS 1501..4152 product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 transl_table 11 codon_start 1 locus_tag LOCUS_28030 CDS 4218..4670 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28040 CDS complement(4733..5524) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28050 CDS 5622..6767 product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 transl_table 11 codon_start 1 locus_tag LOCUS_28060 CDS 6865..8076 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28070 sequence227 source 1..8091 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(75..1853) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28080 CDS complement(1850..2938) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28090 CDS 3215..3976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28100 CDS 3984..5456 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28110 CDS 5569..6357 product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 transl_table 11 codon_start 1 locus_tag LOCUS_28120 gene gluQRS note possible pseudo, frameshifted CDS complement(6416..8011) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28130 sequence228 source 1..7958 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 436..2220 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28140 tRNA complement(2560..2650) product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00200 CDS complement(2710..3141) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28150 CDS complement(3138..4826) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28160 CDS complement(4887..6626) product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 transl_table 11 codon_start 1 locus_tag LOCUS_28170 gene argS CDS complement(6660..7061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28180 CDS complement(7065..7784) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28190 sequence229 source 1..7956 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(625..852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28200 CDS complement(1308..2531) product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 transl_table 11 codon_start 1 locus_tag LOCUS_28210 CDS complement(2533..3156) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28220 CDS complement(3153..4037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28230 CDS complement(4040..4591) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28240 CDS 4898..5290 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28250 CDS complement(5287..5760) product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 transl_table 11 codon_start 1 locus_tag LOCUS_28260 gene bcp CDS 5844..6683 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28270 sequence230 source 1..7926 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1200..2030 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28280 note possible pseudo, internal stop codon CDS 2109..2660 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28290 note possible pseudo, internal stop codon CDS 2834..3361 product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 transl_table 11 codon_start 1 locus_tag LOCUS_28300 CDS 3358..4620 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28310 CDS 4951..5796 product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030521.1 transl_table 11 codon_start 1 locus_tag LOCUS_28320 CDS 5793..6770 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080280.1 transl_table 11 codon_start 1 locus_tag LOCUS_28330 sequence231 source 1..7894 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1542..2816 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28340 CDS 2813..3187 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28350 CDS 3187..3813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28360 CDS complement(3815..4273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28370 CDS 4481..6295 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28380 CDS complement(6301..7749) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28390 sequence232 source 1..7855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..451 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28400 CDS 823..2760 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28410 CDS 3164..3436 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28420 CDS 3793..4131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28430 sequence233 source 1..7832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(443..1285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28440 CDS complement(1325..1807) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28450 CDS complement(1883..3406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28460 CDS complement(3393..3932) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28470 CDS 4277..4564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28480 CDS complement(4570..4986) product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 transl_table 11 codon_start 1 locus_tag LOCUS_28490 CDS complement(4983..5606) product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 transl_table 11 codon_start 1 locus_tag LOCUS_28500 CDS 5889..6782 product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 transl_table 11 codon_start 1 locus_tag LOCUS_28510 gene rpoD misc_feature complement(6848..>7832) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase locus_tag LOCUS_28520 sequence234 source 1..7827 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1695..2798) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28530 CDS complement(3007..3675) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28540 CDS 3763..4599 product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 transl_table 11 codon_start 1 locus_tag LOCUS_28550 CDS 4592..4975 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28560 CDS 4976..5740 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28570 CDS 5899..7338 product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 transl_table 11 codon_start 1 locus_tag LOCUS_28580 sequence235 source 1..7793 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(150..734) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28590 CDS complement(738..1766) product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 transl_table 11 codon_start 1 locus_tag LOCUS_28600 CDS complement(1826..2716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28610 CDS complement(2737..3615) product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28620 CDS 3655..4848 product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 transl_table 11 codon_start 1 locus_tag LOCUS_28630 gene rlmD CDS 4980..5918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28640 misc_feature complement(5962..>7793) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057830.1:M1 family metallopeptidase locus_tag LOCUS_28650 sequence236 source 1..7791 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 681..3071 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28660 CDS 3068..5428 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28670 CDS complement(5702..7084) product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 transl_table 11 codon_start 1 locus_tag LOCUS_28680 sequence237 source 1..7786 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(416..1237) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28690 CDS 2055..4985 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28700 CDS 5001..5420 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28710 CDS 5617..6243 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28720 CDS 6277..6765 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28730 sequence238 source 1..7766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 97..606 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28740 CDS 608..2692 product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 transl_table 11 codon_start 1 locus_tag LOCUS_28750 gene extM CDS 2689..3675 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28760 CDS 3675..4646 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28770 CDS 4650..5324 product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 transl_table 11 codon_start 1 locus_tag LOCUS_28780 CDS complement(5321..6478) product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 transl_table 11 codon_start 1 locus_tag LOCUS_28790 CDS complement(6475..6777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28800 CDS complement(6804..7658) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28810 sequence239 source 1..7733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA 63..163 product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00210 CDS 301..933 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28820 CDS 1125..1997 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28830 CDS 2470..3279 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28840 CDS 3746..3976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28850 CDS complement(4051..5118) product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 transl_table 11 codon_start 1 locus_tag LOCUS_28860 CDS 5166..6020 product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218228.1 transl_table 11 codon_start 1 locus_tag LOCUS_28870 gene hchA CDS 6215..7717 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28880 sequence240 source 1..7718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1123 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226839.1:aminotransferase class V-fold PLP-dependent enzyme locus_tag LOCUS_28890 CDS 1120..2643 product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391662.1 transl_table 11 codon_start 1 locus_tag LOCUS_28900 CDS complement(2645..2887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28910 CDS complement(2900..3130) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28920 CDS 3365..5740 product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383620.1 transl_table 11 codon_start 1 locus_tag LOCUS_28930 CDS complement(5956..6207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28940 CDS complement(6208..6546) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28950 misc_feature complement(6607..>7718) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112888.1:molybdopterin oxidoreductase family protein locus_tag LOCUS_28960 sequence241 source 1..7714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 640..1557 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122051.1 transl_table 11 codon_start 1 locus_tag LOCUS_28970 CDS 1554..2402 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 transl_table 11 codon_start 1 locus_tag LOCUS_28980 CDS complement(2403..2993) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_28990 CDS 2956..3261 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29000 CDS 3274..5193 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29010 CDS complement(5203..6762) product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 transl_table 11 codon_start 1 locus_tag LOCUS_29020 CDS complement(6952..7464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29030 sequence242 source 1..7714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 680..817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29040 CDS complement(777..1682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29050 CDS complement(1710..2615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29060 CDS 2699..3151 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29070 CDS complement(3141..4970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29080 CDS complement(5660..7267) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29090 sequence243 source 1..7700 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1688..3001) product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 transl_table 11 codon_start 1 locus_tag LOCUS_29100 CDS complement(3124..3828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29110 CDS 3894..5294 product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766760.1 transl_table 11 codon_start 1 locus_tag LOCUS_29120 CDS 5342..6403 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29130 CDS 6449..7669 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29140 sequence244 source 1..7626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 737..3367 product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 transl_table 11 codon_start 1 locus_tag LOCUS_29150 gene alaS CDS 3462..4229 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 transl_table 11 codon_start 1 locus_tag LOCUS_29160 CDS complement(4231..6117) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29170 CDS complement(6114..6644) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29180 sequence245 source 1..7596 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1221..2864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29190 CDS 2861..4078 product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 transl_table 11 codon_start 1 locus_tag LOCUS_29200 gene xseA sequence246 source 1..7536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..493 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29210 CDS complement(497..4042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29220 CDS complement(4035..4973) product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 transl_table 11 codon_start 1 locus_tag LOCUS_29230 CDS complement(5135..5878) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 transl_table 11 codon_start 1 locus_tag LOCUS_29240 tRNA 5980..6055 product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00220 CDS 6215..6850 product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 transl_table 11 codon_start 1 locus_tag LOCUS_29250 CDS 6843..7316 product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 transl_table 11 codon_start 1 locus_tag LOCUS_29260 sequence247 source 1..7513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(21..1997) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29270 CDS complement(2117..3124) product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 transl_table 11 codon_start 1 locus_tag LOCUS_29280 gene mltB CDS complement(3267..3707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29290 CDS 3908..5233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29300 CDS complement(5217..6578) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29310 misc_feature complement(6876..>7513) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528582.1:DMT family transporter locus_tag LOCUS_29320 sequence248 source 1..7459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1388..1972) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29330 CDS complement(2023..2520) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29340 CDS complement(2564..3301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29350 CDS 3638..4702 product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062314.1 transl_table 11 codon_start 1 locus_tag LOCUS_29360 CDS complement(4738..5547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29370 CDS complement(5771..6388) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29380 CDS complement(6475..7431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29390 sequence249 source 1..7422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(1429..1501) product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00230 CDS complement(1548..2447) product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 transl_table 11 codon_start 1 locus_tag LOCUS_29400 CDS complement(2447..3757) product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 transl_table 11 codon_start 1 locus_tag LOCUS_29410 gene tolB CDS complement(3873..4661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29420 CDS complement(4658..5092) product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 transl_table 11 codon_start 1 locus_tag LOCUS_29430 gene tolR CDS complement(5324..5809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29440 note possible pseudo, internal stop codon misc_feature complement(5840..>7422) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268224.1:VRR-NUC domain-containing protein locus_tag LOCUS_29450 sequence250 source 1..7420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1546..1764) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29460 CDS 2112..3449 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 transl_table 11 codon_start 1 locus_tag LOCUS_29470 gene hflX CDS complement(3554..3880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29480 CDS complement(4049..4834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29490 CDS 4718..4954 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29500 CDS complement(4951..5397) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29510 CDS complement(5433..7322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29520 sequence251 source 1..7414 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 319..918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29530 CDS 918..2381 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29540 CDS 2378..3574 product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969409.1 transl_table 11 codon_start 1 locus_tag LOCUS_29550 CDS 3574..6759 product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 transl_table 11 codon_start 1 locus_tag LOCUS_29560 CDS complement(6830..7306) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29570 sequence252 source 1..7314 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 10..252 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29580 CDS complement(189..923) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29590 CDS complement(929..2134) product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 transl_table 11 codon_start 1 locus_tag LOCUS_29600 CDS complement(2127..3530) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29610 CDS complement(3543..3803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29620 CDS complement(3800..4600) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29630 CDS complement(4603..5283) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29640 CDS 5242..5406 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29650 CDS complement(5524..6474) product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927209.1 transl_table 11 codon_start 1 locus_tag LOCUS_29660 misc_feature complement(6476..>7314) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294683.1:CpaF family protein locus_tag LOCUS_29670 sequence253 source 1..7283 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 202..2223 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29680 CDS 2220..3647 product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 transl_table 11 codon_start 1 locus_tag LOCUS_29690 CDS 3767..5299 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29700 CDS 5318..5881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29710 CDS 6160..6489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29720 sequence254 source 1..7271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2398..3393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29730 CDS complement(3390..4307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29740 CDS complement(4358..5062) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29750 CDS 5062..5748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29760 CDS 5797..7233 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29770 sequence255 source 1..7254 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 42..779 product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 transl_table 11 codon_start 1 locus_tag LOCUS_29780 gene ubiE sequence256 source 1..7252 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(846..1823) product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 transl_table 11 codon_start 1 locus_tag LOCUS_29790 CDS complement(1820..2200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29800 CDS complement(2309..4765) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29810 CDS 4915..6270 product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 transl_table 11 codon_start 1 locus_tag LOCUS_29820 gene hisS sequence257 source 1..7209 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..2655) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29830 CDS complement(2652..5555) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29840 CDS complement(5605..5988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29850 CDS complement(5998..6714) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29860 sequence258 source 1..7206 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1080..2363) product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 transl_table 11 codon_start 1 locus_tag LOCUS_29870 CDS complement(2478..3224) product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 transl_table 11 codon_start 1 locus_tag LOCUS_29880 CDS 3956..4141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29890 CDS complement(4262..4792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29900 CDS 5005..5442 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29910 CDS 5634..5876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29920 CDS complement(6176..7075) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29930 sequence259 source 1..7157 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..937 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036281.1:GH92 family glycosyl hydrolase locus_tag LOCUS_29940 CDS 962..2356 product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 transl_table 11 codon_start 1 locus_tag LOCUS_29950 CDS 2629..3948 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29960 CDS 4003..5094 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29970 CDS 5094..6311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29980 sequence260 source 1..7146 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(53..313) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_29990 CDS complement(350..703) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30000 CDS 1201..2316 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30010 CDS 2492..3451 product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 transl_table 11 codon_start 1 locus_tag LOCUS_30020 CDS 3448..4374 product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 transl_table 11 codon_start 1 locus_tag LOCUS_30030 CDS 4470..4748 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30040 CDS complement(4685..5608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30050 CDS 5910..6479 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30060 sequence261 source 1..7070 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(52..1494) product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 transl_table 11 codon_start 1 locus_tag LOCUS_30070 CDS complement(1663..2718) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30080 CDS complement(2719..4776) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30090 CDS 5031..6968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30100 sequence262 source 1..7069 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1143..2936 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30110 CDS complement(2880..4250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30120 CDS complement(4569..5138) product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 transl_table 11 codon_start 1 locus_tag LOCUS_30130 CDS 5249..5596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30140 sequence263 source 1..7049 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..152 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30150 CDS 146..1222 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30160 CDS 1562..2467 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30170 CDS complement(2529..2978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30180 CDS 3319..4134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30190 CDS complement(4207..6240) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30200 sequence264 source 1..7047 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..1192 product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774950.1 transl_table 11 codon_start 1 locus_tag LOCUS_30210 gene mvk CDS 1189..2157 product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 transl_table 11 codon_start 1 locus_tag LOCUS_30220 gene mvaD CDS 2147..3028 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30230 CDS 3021..4055 product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 transl_table 11 codon_start 1 locus_tag LOCUS_30240 gene fni CDS 4140..5204 product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 transl_table 11 codon_start 1 locus_tag LOCUS_30250 CDS 5223..6419 product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30260 sequence265 source 1..7025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..546 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921582.1:methyltransferase domain-containing protein locus_tag LOCUS_30270 CDS 585..1232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30280 CDS complement(1229..2767) product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 transl_table 11 codon_start 1 locus_tag LOCUS_30290 CDS 2839..3960 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30300 CDS 3994..4560 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 transl_table 11 codon_start 1 locus_tag LOCUS_30310 CDS 4557..5699 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30320 CDS complement(5894..7024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30330 sequence266 source 1..7009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2153 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein locus_tag LOCUS_30340 CDS complement(2150..2647) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30350 CDS 2758..3159 product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 transl_table 11 codon_start 1 locus_tag LOCUS_30360 CDS 3220..3489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30370 CDS complement(3512..4003) product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 transl_table 11 codon_start 1 locus_tag LOCUS_30380 CDS 4057..5799 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30390 CDS complement(5796..6935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30400 sequence267 source 1..7000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(752..1684) product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 transl_table 11 codon_start 1 locus_tag LOCUS_30410 gene gshB CDS complement(1699..2973) product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 transl_table 11 codon_start 1 locus_tag LOCUS_30420 CDS complement(2989..4320) product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082971.1 transl_table 11 codon_start 1 locus_tag LOCUS_30430 gene mnmE CDS complement(4325..5431) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30440 misc_feature complement(5453..>7000) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944075.1:membrane protein insertase YidC locus_tag LOCUS_30450 sequence268 source 1..6995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30460 tRNA 960..1036 product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00240 tRNA 1057..1130 product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00250 tRNA 1182..1263 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00260 CDS 1293..2870 product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 transl_table 11 codon_start 1 locus_tag LOCUS_30470 gene tig CDS 3149..3775 product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 transl_table 11 codon_start 1 locus_tag LOCUS_30480 gene clpP CDS 3785..5038 product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 transl_table 11 codon_start 1 locus_tag LOCUS_30490 gene clpX sequence269 source 1..6938 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(7..408) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30500 CDS 671..1369 product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 transl_table 11 codon_start 1 locus_tag LOCUS_30510 CDS 1354..1836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30520 CDS 1857..2858 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30530 note possible pseudo, internal stop codon CDS 3093..4052 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30540 CDS 4049..4807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30550 sequence270 source 1..6930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 209..1471 product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 transl_table 11 codon_start 1 locus_tag LOCUS_30560 CDS complement(1468..1812) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30570 CDS 2101..2625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30580 CDS 2763..3236 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30590 CDS complement(3325..4980) product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 transl_table 11 codon_start 1 locus_tag LOCUS_30600 gene lysS sequence271 source 1..6920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 417..2981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30610 CDS complement(2978..3634) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30620 CDS 3855..4529 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30630 CDS complement(4524..6809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30640 sequence272 source 1..6910 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(99..1121) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30650 CDS complement(1243..1977) product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 transl_table 11 codon_start 1 locus_tag LOCUS_30660 CDS complement(1955..2272) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30670 CDS 3335..3640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30680 sequence273 source 1..6907 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1941..2564 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30690 CDS 2824..5418 product N-acylhomoserine lactone acylase HacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 transl_table 11 codon_start 1 locus_tag LOCUS_30700 gene hacB sequence274 source 1..6899 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1401 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193305.1:translation elongation factor 4 locus_tag LOCUS_30710 CDS 1401..1796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30720 CDS 1845..2753 product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 transl_table 11 codon_start 1 locus_tag LOCUS_30730 CDS 2750..4006 product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880489.1 transl_table 11 codon_start 1 locus_tag LOCUS_30740 CDS 4006..4482 product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 transl_table 11 codon_start 1 locus_tag LOCUS_30750 gene greA sequence275 source 1..6833 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(426..1895) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30760 CDS complement(1964..2794) product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 transl_table 11 codon_start 1 locus_tag LOCUS_30770 CDS 3177..4202 product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 transl_table 11 codon_start 1 locus_tag LOCUS_30780 CDS 4234..6051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30790 CDS 6061..6756 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30800 sequence276 source 1..6826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(464..1237) product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 transl_table 11 codon_start 1 locus_tag LOCUS_30810 CDS 1385..2662 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30820 CDS complement(2579..2785) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30830 CDS complement(2804..4393) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30840 CDS 4546..5367 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30850 note possible pseudo, internal stop codon CDS 5392..5817 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30860 sequence277 source 1..6814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(557..3805) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30870 misc_feature complement(3805..>6814) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase locus_tag LOCUS_30880 sequence278 source 1..6802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 485..1327 product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 transl_table 11 codon_start 1 locus_tag LOCUS_30890 CDS 1413..2255 product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 transl_table 11 codon_start 1 locus_tag LOCUS_30900 CDS complement(2252..3424) product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 transl_table 11 codon_start 1 locus_tag LOCUS_30910 gene cyp142 CDS 3630..3770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30920 CDS complement(3858..5087) product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 transl_table 11 codon_start 1 locus_tag LOCUS_30930 CDS 5995..6465 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30940 sequence279 source 1..6800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1090 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080518.1:signal peptide peptidase SppA locus_tag LOCUS_30950 CDS 1063..2475 product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 transl_table 11 codon_start 1 locus_tag LOCUS_30960 tRNA complement(2798..2873) product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00270 CDS complement(2960..3235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30970 CDS complement(3243..3566) product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 transl_table 11 codon_start 1 locus_tag LOCUS_30980 gene iscA CDS complement(3686..3958) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_30990 CDS 4025..4312 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31000 CDS complement(4239..4598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31010 CDS complement(4595..5068) product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 transl_table 11 codon_start 1 locus_tag LOCUS_31020 gene nusB CDS complement(5070..5543) product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 transl_table 11 codon_start 1 locus_tag LOCUS_31030 gene ribE CDS complement(5603..6745) product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 transl_table 11 codon_start 1 locus_tag LOCUS_31040 sequence280 source 1..6798 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1949..2686 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31050 CDS 2683..4188 product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 transl_table 11 codon_start 1 locus_tag LOCUS_31060 CDS 4363..5856 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31070 sequence281 source 1..6777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1173 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004680467.1:error-prone DNA polymerase locus_tag LOCUS_31080 CDS 1422..2762 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31090 CDS 3514..4053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31100 CDS complement(4039..4842) product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 transl_table 11 codon_start 1 locus_tag LOCUS_31110 CDS complement(4839..5501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31120 sequence282 source 1..6776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(186..1889) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31130 CDS 2003..3013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31140 CDS 3032..3763 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31150 CDS complement(4017..4967) product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 transl_table 11 codon_start 1 locus_tag LOCUS_31160 CDS complement(4972..5745) product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 transl_table 11 codon_start 1 locus_tag LOCUS_31170 sequence283 source 1..6763 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2012 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:efflux RND transporter permease subunit locus_tag LOCUS_31180 CDS 2392..2772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31190 CDS 2909..4399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31200 sequence284 source 1..6748 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 29..4720 product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 transl_table 11 codon_start 1 locus_tag LOCUS_31210 CDS 4724..5326 product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704735.1 transl_table 11 codon_start 1 locus_tag LOCUS_31220 CDS 5335..5826 product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 transl_table 11 codon_start 1 locus_tag LOCUS_31230 CDS 5823..6368 product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 transl_table 11 codon_start 1 locus_tag LOCUS_31240 sequence285 source 1..6733 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1165..2073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31250 CDS complement(2123..2257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31260 CDS 2329..3327 product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039028.1 transl_table 11 codon_start 1 locus_tag LOCUS_31270 gene hemB CDS complement(3340..5433) product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421549.1 transl_table 11 codon_start 1 locus_tag LOCUS_31280 CDS complement(5757..6230) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31290 sequence286 source 1..6684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 180..482 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31300 CDS complement(539..1381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31310 CDS complement(1383..2045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31320 CDS 2117..3682 product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 transl_table 11 codon_start 1 locus_tag LOCUS_31330 CDS complement(3679..5736) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31340 CDS 5786..6625 product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 transl_table 11 codon_start 1 locus_tag LOCUS_31350 sequence287 source 1..6675 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 343..693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31360 CDS complement(768..2276) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31370 CDS complement(2464..2973) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31380 CDS complement(2970..3278) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31390 CDS complement(3263..3763) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31400 CDS complement(4296..4574) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31410 CDS 4703..6298 product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 transl_table 11 codon_start 1 locus_tag LOCUS_31420 sequence288 source 1..6674 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1288 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31430 CDS 1411..2046 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31440 CDS 2115..3446 product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 transl_table 11 codon_start 1 locus_tag LOCUS_31450 gene rimO CDS complement(3434..4609) product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 transl_table 11 codon_start 1 locus_tag LOCUS_31460 CDS 4523..4720 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31470 CDS complement(4802..5605) product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880160.1 transl_table 11 codon_start 1 locus_tag LOCUS_31480 gene murI CDS 5639..6202 product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 transl_table 11 codon_start 1 locus_tag LOCUS_31490 gene nadD sequence289 source 1..6666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..1054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31500 tRNA complement(1091..1166) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00280 tRNA complement(1183..1255) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00290 CDS complement(1310..1852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31510 CDS 1932..2438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31520 CDS 2662..3660 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 transl_table 11 codon_start 1 locus_tag LOCUS_31530 gene plsX CDS 3763..4005 product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 transl_table 11 codon_start 1 locus_tag LOCUS_31540 gene acpP CDS 4246..5295 product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 transl_table 11 codon_start 1 locus_tag LOCUS_31550 gene fabF CDS 5299..5727 product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 transl_table 11 codon_start 1 locus_tag LOCUS_31560 gene rpiB sequence290 source 1..6666 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1649) product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 transl_table 11 codon_start 1 locus_tag LOCUS_31570 CDS 1776..4400 product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 transl_table 11 codon_start 1 locus_tag LOCUS_31580 gene polA CDS 4515..5120 product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 transl_table 11 codon_start 1 locus_tag LOCUS_31590 gene rpoE CDS 5148..6134 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31600 CDS 6131..6637 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31610 sequence291 source 1..6657 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1338..1880 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31620 CDS complement(1890..2351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31630 CDS 2464..3300 product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378215.1 transl_table 11 codon_start 1 locus_tag LOCUS_31640 CDS complement(3312..4283) product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227723.1 transl_table 11 codon_start 1 locus_tag LOCUS_31650 CDS complement(4290..6053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31660 misc_feature complement(6093..>6657) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213089170.1:3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein locus_tag LOCUS_31670 sequence292 source 1..6628 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(510..935) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31680 CDS complement(1095..2027) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31690 CDS complement(2024..2332) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31700 CDS complement(2396..2752) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31710 CDS 2793..3449 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31720 CDS complement(3515..4819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31730 CDS 5005..5505 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31740 sequence293 source 1..6542 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1735 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein note possible pseudo, internal stop codon, frameshifted locus_tag LOCUS_31750 CDS 1920..4736 product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 transl_table 11 codon_start 1 locus_tag LOCUS_31760 sequence294 source 1..6527 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 557..1981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31770 CDS complement(1978..4218) product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 transl_table 11 codon_start 1 locus_tag LOCUS_31780 CDS complement(4215..4961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31790 misc_feature complement(4958..>6527) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921453.1:BatA domain-containing protein locus_tag LOCUS_31800 sequence295 source 1..6497 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1352..1792) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31810 CDS complement(2157..3152) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31820 CDS 3503..3802 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31830 CDS 4149..4769 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31840 CDS complement(4953..5765) product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135690060.1 transl_table 11 codon_start 1 locus_tag LOCUS_31850 CDS 5812..6492 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31860 sequence296 source 1..6495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(427..741) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31870 CDS complement(782..1249) product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 transl_table 11 codon_start 1 locus_tag LOCUS_31880 gene sodN CDS 1354..1833 product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020195.1 transl_table 11 codon_start 1 locus_tag LOCUS_31890 CDS 1852..3189 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 transl_table 11 codon_start 1 locus_tag LOCUS_31900 CDS complement(3191..4309) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31910 CDS 4303..5220 product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 transl_table 11 codon_start 1 locus_tag LOCUS_31920 gene rsgA CDS 5463..6311 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31930 sequence297 source 1..6483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..593 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943766.1:class I SAM-dependent rRNA methyltransferase locus_tag LOCUS_31940 CDS 593..1291 product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 transl_table 11 codon_start 1 locus_tag LOCUS_31950 gene sfsA CDS complement(1296..2021) product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 transl_table 11 codon_start 1 locus_tag LOCUS_31960 CDS 2253..3782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_31970 CDS complement(3827..5428) product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972278.1 transl_table 11 codon_start 1 locus_tag LOCUS_31980 gene thiC sequence298 source 1..6470 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1043 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921964.1:YihY/virulence factor BrkB family protein locus_tag LOCUS_31990 CDS 1063..1455 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32000 CDS complement(1535..3004) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32010 CDS 3231..4604 product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 transl_table 11 codon_start 1 locus_tag LOCUS_32020 CDS 4697..6070 product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 transl_table 11 codon_start 1 locus_tag LOCUS_32030 sequence299 source 1..6459 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(94..804) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32040 CDS 769..1008 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32050 CDS 1414..3258 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32060 CDS complement(3842..4561) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32070 sequence300 source 1..6423 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(394..609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32080 note possible pseudo, internal stop codon CDS complement(616..1548) product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 transl_table 11 codon_start 1 locus_tag LOCUS_32090 note possible pseudo, internal stop codon CDS complement(1541..2923) product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 transl_table 11 codon_start 1 locus_tag LOCUS_32100 CDS 3210..4628 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 transl_table 11 codon_start 1 locus_tag LOCUS_32110 CDS 4705..5421 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32120 CDS complement(5425..5667) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32130 CDS complement(6038..6406) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32140 sequence301 source 1..6385 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(535..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32150 CDS 1763..2569 product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 transl_table 11 codon_start 1 locus_tag LOCUS_32160 gene pssA CDS complement(2576..5050) product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 transl_table 11 codon_start 1 locus_tag LOCUS_32170 sequence302 source 1..6351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1775..2572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32180 CDS 2634..3128 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32190 CDS 3132..5639 product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 transl_table 11 codon_start 1 locus_tag LOCUS_32200 CDS complement(5593..6330) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32210 sequence303 source 1..6323 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(385..1845) product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 transl_table 11 codon_start 1 locus_tag LOCUS_32220 CDS complement(1865..2077) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32230 CDS complement(2120..2608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32240 CDS complement(2734..2952) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32250 tRNA 3046..3122 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00300 CDS complement(3195..3377) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32260 CDS 3514..4089 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32270 CDS 4086..4994 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311772.1 transl_table 11 codon_start 1 locus_tag LOCUS_32280 CDS 5052..5678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32290 CDS 5707..6153 product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888662.1 transl_table 11 codon_start 1 locus_tag LOCUS_32300 sequence304 source 1..6318 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1006 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000348045.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_32310 CDS complement(1008..1490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32320 CDS complement(1487..2191) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32330 CDS complement(2588..3949) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 transl_table 11 codon_start 1 locus_tag LOCUS_32340 CDS complement(4045..4596) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32350 CDS complement(4930..5931) product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 transl_table 11 codon_start 1 locus_tag LOCUS_32360 gene recA CDS complement(5928..6203) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32370 sequence305 source 1..6292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(155..712) product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565533.1 transl_table 11 codon_start 1 locus_tag LOCUS_32380 gene lspA CDS complement(930..2207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32390 CDS 2397..2624 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32400 CDS 2628..4454 product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 transl_table 11 codon_start 1 locus_tag LOCUS_32410 CDS 4462..5595 product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 transl_table 11 codon_start 1 locus_tag LOCUS_32420 CDS complement(5642..6031) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32430 sequence306 source 1..6285 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 463..3468 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32440 CDS 3478..4131 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32450 CDS complement(4338..6014) product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 transl_table 11 codon_start 1 locus_tag LOCUS_32460 gene groL sequence307 source 1..6280 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(755..3235) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32470 CDS complement(3394..4392) product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 transl_table 11 codon_start 1 locus_tag LOCUS_32480 CDS complement(4421..5071) product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 transl_table 11 codon_start 1 locus_tag LOCUS_32490 gene tsaB misc_feature complement(5076..>6280) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816967.1:sigma E protease regulator RseP locus_tag LOCUS_32500 sequence308 source 1..6278 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 461..1339 product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 transl_table 11 codon_start 1 locus_tag LOCUS_32510 CDS 1336..2085 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32520 CDS complement(2089..5598) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32530 sequence309 source 1..6275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(3259..3334) product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00310 CDS complement(3370..4179) product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32540 gene uppP CDS complement(4234..4566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32550 CDS complement(4621..5052) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32560 tRNA complement(5162..5238) product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00320 tRNA complement(5264..5335) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00330 CDS complement(5502..5789) product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 transl_table 11 codon_start 1 locus_tag LOCUS_32570 sequence310 source 1..6268 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(103..1158) product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 transl_table 11 codon_start 1 locus_tag LOCUS_32580 gene pheS CDS 1240..2484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32590 CDS 2532..5678 product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 transl_table 11 codon_start 1 locus_tag LOCUS_32600 gene ileS sequence311 source 1..6249 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32610 CDS 1473..1847 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32620 CDS 2519..2728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32630 CDS 3522..5039 product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 transl_table 11 codon_start 1 locus_tag LOCUS_32640 sequence312 source 1..6208 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2060 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein locus_tag LOCUS_32650 CDS 2118..3560 product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 transl_table 11 codon_start 1 locus_tag LOCUS_32660 gene xdhA CDS 3553..5826 product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329191.1 transl_table 11 codon_start 1 locus_tag LOCUS_32670 gene xdhB sequence313 source 1..6177 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 8..565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32680 CDS 599..1183 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32690 CDS complement(1173..2369) product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119555905.1 transl_table 11 codon_start 1 locus_tag LOCUS_32700 CDS complement(2372..2731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32710 CDS complement(2823..4907) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32720 CDS complement(5024..5575) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32730 CDS complement(5622..5852) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32740 sequence314 source 1..6175 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(952..3450) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32750 CDS 3491..4789 product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 transl_table 11 codon_start 1 locus_tag LOCUS_32760 CDS complement(4793..5761) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32770 sequence315 source 1..6126 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1517..2176 product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 transl_table 11 codon_start 1 locus_tag LOCUS_32780 CDS complement(2204..2746) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32790 CDS 2993..4018 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32800 CDS complement(4046..4447) product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 transl_table 11 codon_start 1 locus_tag LOCUS_32810 CDS complement(4675..4878) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32820 CDS 4766..5575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32830 CDS complement(5601..6104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32840 sequence316 source 1..6116 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(73..915) product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 transl_table 11 codon_start 1 locus_tag LOCUS_32850 CDS complement(912..1976) product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 transl_table 11 codon_start 1 locus_tag LOCUS_32860 CDS complement(1973..2734) product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 transl_table 11 codon_start 1 locus_tag LOCUS_32870 CDS complement(2731..3639) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 transl_table 11 codon_start 1 locus_tag LOCUS_32880 CDS complement(3636..4166) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32890 CDS complement(4439..5110) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32900 CDS 5259..5942 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32910 sequence317 source 1..6085 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1248 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086941.1:amidophosphoribosyltransferase locus_tag LOCUS_32920 CDS complement(1258..2139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32930 CDS 2216..2941 product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 transl_table 11 codon_start 1 locus_tag LOCUS_32940 gene fabG CDS complement(2898..3812) product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 transl_table 11 codon_start 1 locus_tag LOCUS_32950 gene epmA CDS complement(3812..4375) product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 transl_table 11 codon_start 1 locus_tag LOCUS_32960 gene efp CDS 4489..5397 product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918602.1 transl_table 11 codon_start 1 locus_tag LOCUS_32970 sequence318 source 1..6078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..827 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32980 CDS 827..2533 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_32990 CDS 2530..3699 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 transl_table 11 codon_start 1 locus_tag LOCUS_33000 CDS 3696..4538 product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 transl_table 11 codon_start 1 locus_tag LOCUS_33010 CDS 4614..5705 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33020 sequence319 source 1..6078 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 525..1655 product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083535.1 transl_table 11 codon_start 1 locus_tag LOCUS_33030 CDS 1895..3178 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33040 CDS 3182..3628 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33050 CDS 3625..4059 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33060 CDS complement(4060..5622) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33070 sequence320 source 1..6074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1761..2054) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33080 CDS 2123..2542 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33090 CDS complement(2591..3139) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33100 CDS complement(3123..3356) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33110 CDS 3444..4139 product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480573.1 transl_table 11 codon_start 1 locus_tag LOCUS_33120 CDS complement(4175..5620) product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 transl_table 11 codon_start 1 locus_tag LOCUS_33130 sequence321 source 1..6036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 291..3053 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33140 sequence322 source 1..6036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1315..2247) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 transl_table 11 codon_start 1 locus_tag LOCUS_33150 CDS complement(2345..4477) product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 transl_table 11 codon_start 1 locus_tag LOCUS_33160 gene fusA CDS 4722..5888 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33170 sequence323 source 1..6029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33180 CDS complement(263..2371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33190 CDS complement(2392..2682) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33200 CDS complement(2713..5151) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33210 sequence324 source 1..6022 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..738 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000756756.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA locus_tag LOCUS_33220 CDS 735..1928 product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 transl_table 11 codon_start 1 locus_tag LOCUS_33230 CDS 1925..3241 product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902371.1 transl_table 11 codon_start 1 locus_tag LOCUS_33240 CDS 3217..4227 product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 transl_table 11 codon_start 1 locus_tag LOCUS_33250 gene galE CDS complement(4224..5342) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 transl_table 11 codon_start 1 locus_tag LOCUS_33260 misc_feature complement(5350..>6022) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272023.1:nucleoside-diphosphate sugar epimerase/dehydratase locus_tag LOCUS_33270 sequence325 source 1..6021 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 137..1795 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33280 CDS 1870..2829 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33290 CDS 2880..3866 product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33300 gene ugpC CDS 3863..6013 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33310 sequence326 source 1..5999 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2071..3123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33320 CDS complement(3306..4019) product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 transl_table 11 codon_start 1 locus_tag LOCUS_33330 sequence327 source 1..5991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(204..1322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33340 CDS complement(1331..1876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33350 CDS complement(1768..2772) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33360 CDS complement(2849..3346) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33370 CDS 3481..3834 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33380 CDS complement(3831..4727) product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 transl_table 11 codon_start 1 locus_tag LOCUS_33390 CDS 4875..5807 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33400 sequence328 source 1..5988 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1238) product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009277.1 transl_table 11 codon_start 1 locus_tag LOCUS_33410 CDS complement(1354..1518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33420 CDS 1501..2154 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33430 note possible pseudo, internal stop codon CDS 2158..3771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33440 note possible pseudo, internal stop codon misc_feature complement(3768..>5988) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256934.1:ABC transporter substrate-binding protein locus_tag LOCUS_33450 sequence329 source 1..5975 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(66..983) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 transl_table 11 codon_start 1 locus_tag LOCUS_33460 CDS complement(1075..1803) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33470 CDS 1884..2960 product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 transl_table 11 codon_start 1 locus_tag LOCUS_33480 CDS 3228..3761 product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804895.1 transl_table 11 codon_start 1 locus_tag LOCUS_33490 gene folE CDS complement(3758..4645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33500 sequence330 source 1..5951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 216..1277 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33510 CDS 1934..3904 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33520 CDS 3901..5304 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 transl_table 11 codon_start 1 locus_tag LOCUS_33530 misc_feature complement(5311..>5951) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205052.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted locus_tag LOCUS_33540 sequence331 source 1..5940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(977..1879) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33550 CDS complement(2559..2777) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33560 CDS complement(2783..3667) product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 transl_table 11 codon_start 1 locus_tag LOCUS_33570 CDS complement(3667..3978) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33580 CDS complement(3994..5160) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33590 misc_feature complement(5157..>5940) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417940.1:SDR family oxidoreductase locus_tag LOCUS_33600 sequence332 source 1..5918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(217..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33610 CDS complement(1992..3002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33620 CDS complement(3291..3626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33630 CDS complement(3873..4094) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33640 CDS 3984..5006 product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 transl_table 11 codon_start 1 locus_tag LOCUS_33650 CDS 5122..5355 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33660 CDS 5622..5846 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33670 sequence333 source 1..5914 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 853..1518 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33680 CDS 1515..2210 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33690 CDS complement(2303..3010) product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925202.1 transl_table 11 codon_start 1 locus_tag LOCUS_33700 CDS 3151..5781 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33710 sequence334 source 1..5903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1124 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544993.1:DUF3488 and transglutaminase-like domain-containing protein locus_tag LOCUS_33720 CDS 1127..1975 product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 transl_table 11 codon_start 1 locus_tag LOCUS_33730 CDS complement(2257..3021) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33740 CDS 3288..4670 product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 transl_table 11 codon_start 1 locus_tag LOCUS_33750 sequence335 source 1..5902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 457..2778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33760 CDS 2775..3275 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33770 CDS complement(3279..4058) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33780 misc_feature complement(4105..>5902) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000510008.1:ferrous iron transport protein B locus_tag LOCUS_33790 sequence336 source 1..5900 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1945..2733) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33800 CDS complement(2794..3024) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33810 sequence337 source 1..5897 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 984..2642 product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 transl_table 11 codon_start 1 locus_tag LOCUS_33820 gene boxC CDS 2658..3044 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33830 CDS complement(3048..3887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33840 CDS 4098..5825 product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 transl_table 11 codon_start 1 locus_tag LOCUS_33850 sequence338 source 1..5887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(10..642) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33860 CDS 859..2169 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33870 CDS complement(2166..2987) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33880 CDS complement(2984..4489) product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 transl_table 11 codon_start 1 locus_tag LOCUS_33890 CDS complement(4489..5364) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33900 CDS complement(5425..5838) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33910 note possible pseudo, internal stop codon sequence339 source 1..5880 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..2322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33920 CDS 3016..3303 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33930 CDS complement(3452..3646) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33940 CDS 3666..5015 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33950 sequence340 source 1..5868 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(19..2046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33960 CDS complement(2105..2584) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33970 CDS 2739..3716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_33980 misc_feature complement(3720..>5868) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123208.1:protein kinase locus_tag LOCUS_33990 sequence341 source 1..5828 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(562..1995) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34000 CDS complement(1985..2323) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34010 CDS 2382..3614 product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918844.1 transl_table 11 codon_start 1 locus_tag LOCUS_34020 gene hutI CDS complement(3602..3847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34030 CDS complement(3904..4851) product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140199.1 transl_table 11 codon_start 1 locus_tag LOCUS_34040 gene mtnA CDS 5289..5636 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34050 sequence342 source 1..5823 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(624..1280) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34060 CDS 1339..1674 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34070 CDS 1684..2244 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34080 CDS 2330..2875 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34090 CDS complement(2869..4053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34100 CDS 4123..5319 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34110 sequence343 source 1..5814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2731 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266965.1:glycerol-3-phosphate 1-O-acyltransferase PlsB locus_tag LOCUS_34120 CDS 2731..3099 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34130 CDS complement(3096..3854) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34140 note possible pseudo, frameshifted CDS complement(3860..4723) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34150 CDS 4843..5553 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34160 sequence344 source 1..5800 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1596..3236) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34170 CDS 3377..4246 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34180 CDS 4248..5234 product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 transl_table 11 codon_start 1 locus_tag LOCUS_34190 sequence345 source 1..5775 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 12..506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34200 CDS complement(516..1799) product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 transl_table 11 codon_start 1 locus_tag LOCUS_34210 CDS complement(1799..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34220 CDS 3229..3408 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34230 CDS complement(3388..3717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34240 CDS complement(3734..4090) product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 transl_table 11 codon_start 1 locus_tag LOCUS_34250 CDS 4149..5003 product UTP--glucose-1-phosphate uridylyltransferase BpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757832.1 transl_table 11 codon_start 1 locus_tag LOCUS_34260 gene bpsC CDS complement(5036..5593) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34270 sequence346 source 1..5756 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..588 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase locus_tag LOCUS_34280 CDS complement(761..1756) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34290 CDS complement(1831..2259) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34300 CDS complement(2241..3641) product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 transl_table 11 codon_start 1 locus_tag LOCUS_34310 CDS complement(3695..4159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34320 CDS complement(4261..4806) product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 transl_table 11 codon_start 1 locus_tag LOCUS_34330 gene pyrE sequence347 source 1..5750 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1722..2441 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34340 CDS 2603..3253 product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 transl_table 11 codon_start 1 locus_tag LOCUS_34350 gene rplC CDS 3340..5280 product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704166.1 transl_table 11 codon_start 1 locus_tag LOCUS_34360 sequence348 source 1..5740 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 747..1022 product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 transl_table 11 codon_start 1 locus_tag LOCUS_34370 CDS complement(1123..1800) product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 transl_table 11 codon_start 1 locus_tag LOCUS_34380 CDS complement(1797..2651) product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594607.1 transl_table 11 codon_start 1 locus_tag LOCUS_34390 gene prmA CDS complement(2651..4042) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34400 CDS complement(4055..4510) product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 transl_table 11 codon_start 1 locus_tag LOCUS_34410 gene smpB CDS 4763..5209 product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 transl_table 11 codon_start 1 locus_tag LOCUS_34420 gene mraZ sequence349 source 1..5735 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 793..1782 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34430 CDS 1779..1994 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34440 CDS 2046..2570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34450 CDS complement(2575..3504) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34460 CDS complement(3633..4010) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34470 CDS 4158..4490 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34480 misc_feature complement(4497..>5735) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator locus_tag LOCUS_34490 sequence350 source 1..5720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1048..1410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 transl_table 11 codon_start 1 locus_tag LOCUS_34500 CDS complement(1658..3442) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34510 CDS complement(3449..4312) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34520 CDS complement(4309..4629) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34530 CDS 4917..5615 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34540 sequence351 source 1..5711 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(588..2099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34550 CDS complement(2099..2788) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34560 CDS complement(2801..4090) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34570 CDS complement(4198..5112) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34580 sequence352 source 1..5709 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..750 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249166.1:amidophosphoribosyltransferase locus_tag LOCUS_34590 CDS 793..1680 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34600 CDS complement(1787..2023) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34610 CDS 1923..2354 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34620 CDS 2364..2639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34630 CDS complement(2803..3558) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34640 CDS 3710..4747 product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 transl_table 11 codon_start 1 locus_tag LOCUS_34650 CDS 4744..5340 product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 transl_table 11 codon_start 1 locus_tag LOCUS_34660 sequence353 source 1..5707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2348..3238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34670 CDS 3330..5051 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34680 sequence354 source 1..5667 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2945..3967 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34690 CDS complement(4144..5517) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34700 sequence355 source 1..5655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(964..1040) product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00340 CDS complement(1086..2210) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34710 CDS 2428..4440 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34720 CDS 4560..5342 product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 transl_table 11 codon_start 1 locus_tag LOCUS_34730 gene pyrF sequence356 source 1..5568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(973..2565) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34740 CDS complement(2568..5360) product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 transl_table 11 codon_start 1 locus_tag LOCUS_34750 gene cphA sequence357 source 1..5567 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 477..881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34760 CDS 881..1771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34770 CDS 2023..2571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34780 CDS complement(2735..3316) product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 transl_table 11 codon_start 1 locus_tag LOCUS_34790 gene rdgB CDS 3383..3868 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34800 misc_feature complement(3870..>5567) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335531.1:fused MFS/spermidine synthase locus_tag LOCUS_34810 sequence358 source 1..5554 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(889..1653) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34820 CDS complement(1650..3257) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34830 CDS 3372..4823 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34840 sequence359 source 1..5514 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..828) product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228316.1 transl_table 11 codon_start 1 locus_tag LOCUS_34850 CDS complement(825..1757) product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 transl_table 11 codon_start 1 locus_tag LOCUS_34860 CDS complement(1754..2710) product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 transl_table 11 codon_start 1 locus_tag LOCUS_34870 CDS complement(2792..3820) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34880 CDS 3939..5339 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34890 sequence360 source 1..5498 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 405..1088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34900 CDS 1241..1759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34910 CDS 1804..2265 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34920 sequence361 source 1..5483 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..867 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein locus_tag LOCUS_34930 CDS complement(1091..2287) product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479723.1 transl_table 11 codon_start 1 locus_tag LOCUS_34940 CDS 2389..3234 product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 transl_table 11 codon_start 1 locus_tag LOCUS_34950 CDS complement(3479..5287) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34960 sequence362 source 1..5454 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2969 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta locus_tag LOCUS_34970 sequence363 source 1..5442 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..645 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804263.1:MATE family efflux transporter locus_tag LOCUS_34980 CDS 698..1060 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_34990 CDS 1104..1871 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35000 CDS complement(1877..2557) product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071539.1 transl_table 11 codon_start 1 locus_tag LOCUS_35010 gene mutH CDS complement(2554..3684) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35020 CDS complement(3681..4541) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35030 misc_feature complement(4538..>5442) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332180.1:SpoIIE family protein phosphatase locus_tag LOCUS_35040 sequence364 source 1..5436 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(720..974) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35050 CDS 1000..2190 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35060 CDS 2346..3284 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35070 sequence365 source 1..5388 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(562..2826) product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 transl_table 11 codon_start 1 locus_tag LOCUS_35080 CDS complement(2901..3572) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35090 CDS complement(3634..5049) product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 transl_table 11 codon_start 1 locus_tag LOCUS_35100 gene boxB sequence366 source 1..5373 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(469..2547) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35110 CDS complement(2544..3329) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35120 CDS complement(3326..4171) product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 transl_table 11 codon_start 1 locus_tag LOCUS_35130 CDS complement(4189..4878) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 transl_table 11 codon_start 1 locus_tag LOCUS_35140 sequence367 source 1..5343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 807..5234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35150 sequence368 source 1..5341 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1076 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit locus_tag LOCUS_35160 CDS 1073..1573 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35170 CDS 1570..3213 product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 transl_table 11 codon_start 1 locus_tag LOCUS_35180 CDS complement(3189..4088) product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405474.1 transl_table 11 codon_start 1 locus_tag LOCUS_35190 CDS 4181..4573 product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 transl_table 11 codon_start 1 locus_tag LOCUS_35200 gene tatB CDS 4570..4746 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35210 sequence369 source 1..5297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 574..2508 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35220 CDS complement(2477..3088) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35230 CDS complement(3085..3813) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35240 CDS complement(3868..5037) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35250 sequence370 source 1..5295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(349..981) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35260 CDS complement(1012..2601) product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 transl_table 11 codon_start 1 locus_tag LOCUS_35270 CDS 2637..3773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35280 CDS 3777..4721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35290 sequence371 source 1..5287 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1081..1824) product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 transl_table 11 codon_start 1 locus_tag LOCUS_35300 CDS 1970..2356 product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 transl_table 11 codon_start 1 locus_tag LOCUS_35310 gene dksA CDS complement(2353..3702) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35320 CDS complement(3707..4738) product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 transl_table 11 codon_start 1 locus_tag LOCUS_35330 gene moaA CDS complement(4735..5286) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35340 sequence372 source 1..5261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1117..1731) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35350 CDS complement(1728..2372) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35360 CDS complement(2369..3082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35370 sequence373 source 1..5243 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(886..2001) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35380 CDS complement(1998..2624) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35390 misc_feature complement(2621..>5243) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256934.1:ABC transporter substrate-binding protein locus_tag LOCUS_35400 sequence374 source 1..5238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 326..1459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35410 CDS 1353..1574 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35420 CDS 2005..2964 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35430 note possible pseudo, internal stop codon sequence375 source 1..5237 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(184..363) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35440 CDS 401..658 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35450 CDS 721..1167 product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 transl_table 11 codon_start 1 locus_tag LOCUS_35460 CDS complement(1376..1615) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35470 CDS 2001..2357 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35480 CDS 3385..3891 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35490 CDS complement(3863..4858) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35500 sequence376 source 1..5228 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..979 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943205.1:tRNA 2-thiouridine(34) synthase MnmA locus_tag LOCUS_35510 CDS 976..1680 product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 transl_table 11 codon_start 1 locus_tag LOCUS_35520 gene rnc CDS 1677..2654 product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080334.1 transl_table 11 codon_start 1 locus_tag LOCUS_35530 CDS 2651..3583 product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 transl_table 11 codon_start 1 locus_tag LOCUS_35540 gene era CDS 3634..4074 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35550 sequence377 source 1..5219 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 394..2166 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35560 CDS complement(2163..3671) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35570 CDS complement(3668..4063) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35580 CDS complement(4117..5043) product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 transl_table 11 codon_start 1 locus_tag LOCUS_35590 sequence378 source 1..5218 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1281 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein locus_tag LOCUS_35600 CDS 1317..2582 product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 transl_table 11 codon_start 1 locus_tag LOCUS_35610 CDS 2579..3598 product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 transl_table 11 codon_start 1 locus_tag LOCUS_35620 CDS 3595..4617 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35630 misc_feature complement(4630..>5218) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014752.1:sigma-70 family RNA polymerase sigma factor locus_tag LOCUS_35640 sequence379 source 1..5210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 100..1500 product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260104.1 transl_table 11 codon_start 1 locus_tag LOCUS_35650 gene lpdA CDS 1528..2817 product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 transl_table 11 codon_start 1 locus_tag LOCUS_35660 CDS 3412..4038 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35670 CDS 4035..5081 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35680 sequence380 source 1..5204 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2636..4930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35690 CDS 4865..5065 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35700 sequence381 source 1..5203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..572 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056086.1:quinolinate synthase NadA locus_tag LOCUS_35710 CDS 615..1019 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35720 CDS complement(1400..2752) product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 transl_table 11 codon_start 1 locus_tag LOCUS_35730 CDS complement(2927..4093) product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356919.1 transl_table 11 codon_start 1 locus_tag LOCUS_35740 gene bamB CDS complement(4093..4821) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35750 sequence382 source 1..5196 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1433..2914) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35760 CDS complement(2917..4716) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35770 sequence383 source 1..5193 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(107..934) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35780 CDS complement(931..3834) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35790 misc_feature complement(3972..>5193) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein locus_tag LOCUS_35800 sequence384 source 1..5166 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1122 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH locus_tag LOCUS_35810 CDS 1122..1934 product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 transl_table 11 codon_start 1 locus_tag LOCUS_35820 gene folP CDS 1931..2761 product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 transl_table 11 codon_start 1 locus_tag LOCUS_35830 gene cdaA CDS 2751..3695 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35840 CDS 3692..5005 product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418304.1 transl_table 11 codon_start 1 locus_tag LOCUS_35850 gene glmM sequence385 source 1..5160 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1347 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249997.1:DNRLRE domain-containing protein locus_tag LOCUS_35860 CDS complement(1515..2903) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35870 CDS complement(3021..3239) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35880 CDS 3127..3645 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35890 CDS 4155..4811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35900 sequence386 source 1..5144 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 148..1836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35910 CDS complement(1826..2656) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35920 CDS complement(2685..4082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35930 sequence387 source 1..5117 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(693..2099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35940 CDS 2285..2896 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35950 CDS 2900..3499 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35960 sequence388 source 1..5113 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..658 product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 transl_table 11 codon_start 1 locus_tag LOCUS_35970 gene gloA CDS 658..1206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35980 CDS complement(1223..2053) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_35990 CDS complement(2056..2598) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 transl_table 11 codon_start 1 locus_tag LOCUS_36000 misc_feature complement(2595..>5113) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908844.1:adenylate/guanylate cyclase domain-containing protein locus_tag LOCUS_36010 sequence389 source 1..5111 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(245..448) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36020 CDS complement(414..632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36030 CDS complement(840..1979) product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 transl_table 11 codon_start 1 locus_tag LOCUS_36040 CDS complement(2058..2762) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36050 CDS 3076..3405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36060 CDS complement(3495..3725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36070 CDS complement(3835..4215) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36080 sequence390 source 1..5104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 699..2642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36090 CDS 2673..2921 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36100 sequence391 source 1..5072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(62..913) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 transl_table 11 codon_start 1 locus_tag LOCUS_36110 CDS complement(910..1362) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 transl_table 11 codon_start 1 locus_tag LOCUS_36120 CDS complement(1359..1814) product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184577.1 transl_table 11 codon_start 1 locus_tag LOCUS_36130 CDS 1978..3306 product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 transl_table 11 codon_start 1 locus_tag LOCUS_36140 CDS 3350..4051 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 transl_table 11 codon_start 1 locus_tag LOCUS_36150 sequence392 source 1..5031 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(348..2189) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36160 CDS 2384..3415 product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328145.1 transl_table 11 codon_start 1 locus_tag LOCUS_36170 gene pdhA CDS 3421..4398 product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 transl_table 11 codon_start 1 locus_tag LOCUS_36180 sequence393 source 1..5027 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(649..2223) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36190 CDS complement(2372..3901) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36200 misc_feature complement(4185..>5027) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837921.1:SCO family protein locus_tag LOCUS_36210 sequence394 source 1..5003 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1448..2410) product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 transl_table 11 codon_start 1 locus_tag LOCUS_36220 gene accD CDS complement(2481..3485) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36230 CDS 3525..4316 product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 transl_table 11 codon_start 1 locus_tag LOCUS_36240 sequence395 source 1..5000 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 323..4219 product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221777.1 transl_table 11 codon_start 1 locus_tag LOCUS_36250 gene purL misc_feature complement(4273..>5000) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002220499.1:formylglycine-generating enzyme family protein locus_tag LOCUS_36260 sequence396 source 1..4976 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..1723 product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 transl_table 11 codon_start 1 locus_tag LOCUS_36270 CDS 1756..3219 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36280 misc_feature complement(3216..>4976) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000498183.1:phenylalanine--tRNA ligase subunit beta locus_tag LOCUS_36290 sequence397 source 1..4973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence398 source 1..4971 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(488..2302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36300 CDS complement(2346..3194) product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 transl_table 11 codon_start 1 locus_tag LOCUS_36310 CDS 3278..3625 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36320 CDS 3637..3804 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36330 sequence399 source 1..4961 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(67..1506) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36340 CDS complement(1557..1880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36350 CDS complement(2090..4285) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36360 CDS complement(4315..4896) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36370 sequence400 source 1..4951 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(602..1066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36380 tRNA complement(1161..1237) product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00350 CDS complement(1356..2201) product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 transl_table 11 codon_start 1 locus_tag LOCUS_36390 gene rluB CDS complement(2313..2894) product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 transl_table 11 codon_start 1 locus_tag LOCUS_36400 gene scpB CDS complement(2875..3699) product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124353.1 transl_table 11 codon_start 1 locus_tag LOCUS_36410 CDS complement(3702..4769) product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 transl_table 11 codon_start 1 locus_tag LOCUS_36420 gene bcd sequence401 source 1..4946 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1740 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein locus_tag LOCUS_36430 CDS 1740..3878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36440 CDS complement(3840..4061) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36450 CDS complement(4058..4639) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36460 sequence402 source 1..4940 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(359..1582) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36470 CDS complement(1525..3351) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36480 CDS 3379..4242 product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 transl_table 11 codon_start 1 locus_tag LOCUS_36490 sequence403 source 1..4934 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..695 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811442.1:(deoxy)nucleoside triphosphate pyrophosphohydrolase locus_tag LOCUS_36500 CDS complement(679..2424) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36510 CDS 2580..3296 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36520 CDS complement(3265..3645) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36530 CDS 3834..4577 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36540 sequence404 source 1..4902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2107..3594 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36550 sequence405 source 1..4898 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(55..666) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36560 CDS complement(673..1545) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36570 CDS complement(1992..2729) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36580 tRNA 2779..2855 product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00360 CDS complement(2857..3819) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36590 CDS 3973..4728 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36600 sequence406 source 1..4879 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 25..984 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 transl_table 11 codon_start 1 locus_tag LOCUS_36610 CDS 1171..2334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36620 sequence407 source 1..4860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..513 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943695.1:putative lipid II flippase FtsW locus_tag LOCUS_36630 CDS 517..1905 product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 transl_table 11 codon_start 1 locus_tag LOCUS_36640 gene murC CDS 1902..2783 product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111588.1 transl_table 11 codon_start 1 locus_tag LOCUS_36650 gene murB CDS 2810..3712 product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 transl_table 11 codon_start 1 locus_tag LOCUS_36660 CDS 4109..4798 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36670 sequence408 source 1..4844 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1818..3233) product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 transl_table 11 codon_start 1 locus_tag LOCUS_36680 CDS complement(3311..4663) product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 transl_table 11 codon_start 1 locus_tag LOCUS_36690 gene trkA sequence409 source 1..4832 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 373..864 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36700 CDS 972..1565 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36710 CDS complement(1502..4135) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36720 sequence410 source 1..4784 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(58..456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36730 CDS complement(494..751) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36740 CDS 1517..1819 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36750 CDS 1816..2136 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36760 CDS complement(2670..2825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36770 CDS 2951..3115 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36780 CDS 3120..3530 product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 transl_table 11 codon_start 1 locus_tag LOCUS_36790 CDS 3627..3767 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36800 CDS 3928..4596 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36810 sequence411 source 1..4777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1082) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36820 CDS 1285..1770 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36830 note possible pseudo, internal stop codon, frameshifted CDS 2252..3784 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36840 sequence412 source 1..4776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1196..1717) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36850 CDS complement(1825..3123) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36860 CDS complement(3114..3845) product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 transl_table 11 codon_start 1 locus_tag LOCUS_36870 CDS complement(3842..4762) product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 transl_table 11 codon_start 1 locus_tag LOCUS_36880 gene gldA sequence413 source 1..4766 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(2455..4410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36890 sequence414 source 1..4765 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1260 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051300116.1:fatty acyl-AMP ligase locus_tag LOCUS_36900 CDS 1284..1571 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36910 sequence415 source 1..4764 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 177..710 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36920 CDS 933..2366 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36930 CDS complement(2367..3245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36940 CDS 3388..3639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36950 sequence416 source 1..4758 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(466..1722) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_36960 CDS complement(1796..2365) product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 transl_table 11 codon_start 1 locus_tag LOCUS_36970 CDS complement(2365..3771) product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 transl_table 11 codon_start 1 locus_tag LOCUS_36980 gene trpE sequence417 source 1..4757 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1761..2825) product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 transl_table 11 codon_start 1 locus_tag LOCUS_36990 gene dnaJ CDS complement(2854..3963) product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 transl_table 11 codon_start 1 locus_tag LOCUS_37000 gene hemW misc_feature complement(3984..>4757) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973289.1:pitrilysin family protein locus_tag LOCUS_37010 sequence418 source 1..4754 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 329..1264 product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 transl_table 11 codon_start 1 locus_tag LOCUS_37020 CDS 1541..1813 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37030 CDS complement(2017..3045) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37040 CDS 3578..3895 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37050 CDS 3932..4405 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37060 CDS 4412..4570 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37070 sequence419 source 1..4753 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1315 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein locus_tag LOCUS_37080 CDS complement(1271..2407) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 transl_table 11 codon_start 1 locus_tag LOCUS_37090 CDS complement(2404..3423) product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 transl_table 11 codon_start 1 locus_tag LOCUS_37100 CDS complement(3429..3908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37110 note possible pseudo, frameshifted CDS complement(3905..4342) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37120 note possible pseudo, frameshifted CDS complement(4344..4676) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37130 sequence420 source 1..4739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(227..712) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37140 CDS complement(709..1002) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37150 CDS complement(1054..2373) product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074184.1 transl_table 11 codon_start 1 locus_tag LOCUS_37160 gene ftsY misc_feature complement(2406..>4739) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC locus_tag LOCUS_37170 sequence421 source 1..4739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 109..1278 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37180 CDS 1278..2210 product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 transl_table 11 codon_start 1 locus_tag LOCUS_37190 CDS complement(2207..2950) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37200 note possible pseudo, internal stop codon CDS complement(2955..3878) product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 transl_table 11 codon_start 1 locus_tag LOCUS_37210 gene ldeG tRNA complement(3990..4065) product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00370 tRNA complement(4078..4150) product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00380 misc_feature complement(4200..>4739) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393792.1:adenylosuccinate synthase locus_tag LOCUS_37220 sequence422 source 1..4727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1486) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37230 CDS complement(1477..4161) product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 transl_table 11 codon_start 1 locus_tag LOCUS_37240 sequence423 source 1..4720 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(822..1472) product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008153.1 transl_table 11 codon_start 1 locus_tag LOCUS_37250 gene gmk CDS complement(1475..2353) product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 transl_table 11 codon_start 1 locus_tag LOCUS_37260 CDS complement(2399..3322) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37270 CDS complement(3422..4720) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37280 sequence424 source 1..4708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(609..815) product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383180.1 transl_table 11 codon_start 1 locus_tag LOCUS_37290 CDS complement(827..3196) product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 transl_table 11 codon_start 1 locus_tag LOCUS_37300 gene copA1 CDS complement(3245..4327) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37310 sequence425 source 1..4706 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(608..859) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37320 CDS 919..1140 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37330 CDS 1707..2012 product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 transl_table 11 codon_start 1 locus_tag LOCUS_37340 gene rpsN CDS complement(2127..3623) product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 transl_table 11 codon_start 1 locus_tag LOCUS_37350 misc_feature complement(3763..>4706) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383016.1:FAD-dependent thymidylate synthase locus_tag LOCUS_37360 sequence426 source 1..4690 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(288..1640) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37370 CDS complement(1986..2513) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37380 CDS complement(2568..3125) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37390 CDS complement(3277..3939) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37400 CDS complement(4132..4368) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37410 sequence427 source 1..4684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1053..2513 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37420 CDS complement(2510..3868) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 transl_table 11 codon_start 1 locus_tag LOCUS_37430 sequence428 source 1..4682 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1217..1681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37440 CDS complement(1678..4359) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37450 sequence429 source 1..4680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(56..1633) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37460 CDS 2137..4182 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37470 sequence430 source 1..4678 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 78..593 product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 transl_table 11 codon_start 1 locus_tag LOCUS_37480 CDS 590..3271 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37490 CDS 3381..4388 product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 transl_table 11 codon_start 1 locus_tag LOCUS_37500 sequence431 source 1..4655 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(61..888) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37510 CDS complement(881..2632) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37520 CDS complement(2780..4456) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37530 sequence432 source 1..4631 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(115..567) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37540 CDS complement(564..794) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37550 CDS complement(812..1066) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37560 CDS complement(1088..1360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37570 CDS complement(1446..2381) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37580 CDS complement(2378..4417) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37590 sequence433 source 1..4626 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(688..2025) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 transl_table 11 codon_start 1 locus_tag LOCUS_37600 CDS 2113..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37610 CDS complement(3133..4410) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37620 sequence434 source 1..4618 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 222..749 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 transl_table 11 codon_start 1 locus_tag LOCUS_37630 gene nusG CDS 802..1230 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 transl_table 11 codon_start 1 locus_tag LOCUS_37640 gene rplK CDS 1478..2095 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 transl_table 11 codon_start 1 locus_tag LOCUS_37650 gene rplA CDS 2104..2628 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 transl_table 11 codon_start 1 locus_tag LOCUS_37660 gene rplJ CDS 2716..3084 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 transl_table 11 codon_start 1 locus_tag LOCUS_37670 gene rplL sequence435 source 1..4586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 248..982 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37680 CDS complement(979..1494) product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 transl_table 11 codon_start 1 locus_tag LOCUS_37690 CDS 1670..2602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37700 CDS complement(3056..3505) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37710 sequence436 source 1..4564 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(197..1759) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37720 CDS complement(1843..3465) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37730 CDS complement(3803..4456) product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324308.1 transl_table 11 codon_start 1 locus_tag LOCUS_37740 sequence437 source 1..4536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1438 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393064.1:3-dehydroquinate synthase locus_tag LOCUS_37750 CDS 1435..1959 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37760 CDS 1963..2853 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37770 CDS 2853..3305 product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369457.1 transl_table 11 codon_start 1 locus_tag LOCUS_37780 gene aroQ CDS 3396..3860 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37790 sequence438 source 1..4511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 535..918 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37800 CDS 953..1486 product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 transl_table 11 codon_start 1 locus_tag LOCUS_37810 gene nusG CDS 1514..1942 product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 transl_table 11 codon_start 1 locus_tag LOCUS_37820 gene rplK CDS 2035..2754 product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 transl_table 11 codon_start 1 locus_tag LOCUS_37830 gene rplA CDS 2764..3306 product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 transl_table 11 codon_start 1 locus_tag LOCUS_37840 gene rplJ CDS 3391..3768 product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 transl_table 11 codon_start 1 locus_tag LOCUS_37850 gene rplL sequence439 source 1..4496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 861..1550 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37860 CDS 2392..2523 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37870 CDS complement(2747..3142) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37880 CDS 3397..3831 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37890 sequence440 source 1..4492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(3359..4024) product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 transl_table 11 codon_start 1 locus_tag LOCUS_37900 sequence441 source 1..4480 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(958..2808) product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 transl_table 11 codon_start 1 locus_tag LOCUS_37910 CDS complement(2818..3795) product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 transl_table 11 codon_start 1 locus_tag LOCUS_37920 gene dusA CDS complement(3873..4388) product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 transl_table 11 codon_start 1 locus_tag LOCUS_37930 sequence442 source 1..4467 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(13..1338) product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 transl_table 11 codon_start 1 locus_tag LOCUS_37940 gene serS CDS complement(1366..3060) product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 transl_table 11 codon_start 1 locus_tag LOCUS_37950 CDS complement(3057..3767) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 transl_table 11 codon_start 1 locus_tag LOCUS_37960 gene lipB CDS complement(3774..4406) product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 transl_table 11 codon_start 1 locus_tag LOCUS_37970 gene tmk sequence443 source 1..4452 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1202..2266 product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 transl_table 11 codon_start 1 locus_tag LOCUS_37980 gene fbp CDS complement(2263..3174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_37990 sequence444 source 1..4445 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 860..1144 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38000 CDS complement(1148..1924) product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 transl_table 11 codon_start 1 locus_tag LOCUS_38010 CDS complement(1878..2726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38020 sequence445 source 1..4433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..526 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38030 CDS 567..704 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38040 CDS complement(845..2695) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38050 CDS complement(3388..4074) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 transl_table 11 codon_start 1 locus_tag LOCUS_38060 CDS complement(4052..4300) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38070 sequence446 source 1..4428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38080 CDS complement(1020..4241) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38090 sequence447 source 1..4420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 267..1412 product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 transl_table 11 codon_start 1 locus_tag LOCUS_38100 CDS 1505..2740 product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 transl_table 11 codon_start 1 locus_tag LOCUS_38110 gene sucC CDS 2744..3622 product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 transl_table 11 codon_start 1 locus_tag LOCUS_38120 gene sucD CDS 3862..4293 product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 transl_table 11 codon_start 1 locus_tag LOCUS_38130 gene ndk sequence448 source 1..4413 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..1772 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38140 CDS 1769..2815 product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 transl_table 11 codon_start 1 locus_tag LOCUS_38150 CDS 2812..3321 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38160 CDS complement(3318..3662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38170 CDS complement(3741..4079) product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 transl_table 11 codon_start 1 locus_tag LOCUS_38180 CDS complement(4088..4411) product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 transl_table 11 codon_start 1 locus_tag LOCUS_38190 sequence449 source 1..4408 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(398..847) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38200 CDS complement(1137..1661) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38210 CDS complement(1661..3094) product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 transl_table 11 codon_start 1 locus_tag LOCUS_38220 gene rlmD CDS 3201..4037 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38230 CDS 4034..4216 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38240 sequence450 source 1..4397 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 230..1504 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38250 CDS 1504..3009 product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 transl_table 11 codon_start 1 locus_tag LOCUS_38260 CDS 3060..3935 product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 transl_table 11 codon_start 1 locus_tag LOCUS_38270 sequence451 source 1..4391 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 595..1962 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38280 CDS complement(2181..2492) product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 transl_table 11 codon_start 1 locus_tag LOCUS_38290 sequence452 source 1..4379 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(14..970) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38300 CDS complement(1132..1908) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38310 CDS 2562..3206 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38320 CDS 3154..3666 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38330 CDS complement(3705..4217) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38340 sequence453 source 1..4377 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 409..777 product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 transl_table 11 codon_start 1 locus_tag LOCUS_38350 gene rplS CDS 905..1165 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38360 CDS complement(1168..2157) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38370 CDS complement(2333..3697) product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 transl_table 11 codon_start 1 locus_tag LOCUS_38380 CDS 3812..4309 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38390 sequence454 source 1..4351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(80..1012) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38400 CDS complement(1009..1200) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38410 CDS complement(1539..3494) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38420 misc_feature complement(3491..>4351) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920957.1:NAD(P)/FAD-dependent oxidoreductase locus_tag LOCUS_38430 sequence455 source 1..4344 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..858) product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 transl_table 11 codon_start 1 locus_tag LOCUS_38440 CDS 1068..1340 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38450 CDS 1365..2669 product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 transl_table 11 codon_start 1 locus_tag LOCUS_38460 gene asnS CDS 2798..3916 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38470 sequence456 source 1..4343 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(404..1009) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38480 CDS complement(1006..1830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38490 CDS complement(1854..2429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38500 CDS complement(2426..2956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058286.1 transl_table 11 codon_start 1 locus_tag LOCUS_38510 CDS 3115..3732 product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225434.1 transl_table 11 codon_start 1 locus_tag LOCUS_38520 sequence457 source 1..4325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 808..1149 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38530 CDS complement(1146..2099) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38540 CDS 2068..3783 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_38550 sequence458 source 1..4300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 472..3576 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38560 sequence459 source 1..4270 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1080 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461820.1:radical SAM protein locus_tag LOCUS_38570 CDS 1077..1943 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38580 CDS complement(2275..2490) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38590 sequence460 source 1..4261 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 533..1195 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38600 sequence461 source 1..4245 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(367..855) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38610 CDS 950..2830 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38620 CDS complement(2837..3196) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38630 sequence462 source 1..4238 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 147..3311 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 transl_table 11 codon_start 1 locus_tag LOCUS_38640 CDS 3316..3501 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38650 misc_feature complement(3498..>4238) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022878.1:alpha/beta fold hydrolase locus_tag LOCUS_38660 sequence463 source 1..4234 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tmRNA 525..927 product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_tm00010 CDS complement(1007..1705) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38670 CDS 1825..2715 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38680 CDS 2824..3759 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 transl_table 11 codon_start 1 locus_tag LOCUS_38690 CDS 3756..4208 product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 transl_table 11 codon_start 1 locus_tag LOCUS_38700 sequence464 source 1..4226 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 584..1783 product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 transl_table 11 codon_start 1 locus_tag LOCUS_38710 gene kbl CDS complement(1780..2544) product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 transl_table 11 codon_start 1 locus_tag LOCUS_38720 sequence465 source 1..4225 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(458..1546) product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 transl_table 11 codon_start 1 locus_tag LOCUS_38730 gene murG CDS complement(1550..2830) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38740 CDS complement(2893..3597) product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 transl_table 11 codon_start 1 locus_tag LOCUS_38750 CDS 3657..4157 product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403468.1 transl_table 11 codon_start 1 locus_tag LOCUS_38760 sequence466 source 1..4189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence467 source 1..4169 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..645 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter locus_tag LOCUS_38770 CDS 734..1963 product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 transl_table 11 codon_start 1 locus_tag LOCUS_38780 CDS complement(1970..2368) product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 transl_table 11 codon_start 1 locus_tag LOCUS_38790 CDS 2424..3233 product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 transl_table 11 codon_start 1 locus_tag LOCUS_38800 CDS 3255..4112 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38810 sequence468 source 1..4164 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 507..2231 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38820 CDS complement(2187..2609) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38830 sequence469 source 1..4161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..750 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38840 CDS complement(747..1400) product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 transl_table 11 codon_start 1 locus_tag LOCUS_38850 sequence470 source 1..4140 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 389..1897 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 transl_table 11 codon_start 1 locus_tag LOCUS_38860 CDS complement(1894..2496) product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 transl_table 11 codon_start 1 locus_tag LOCUS_38870 gene cysC CDS 2572..3615 product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 transl_table 11 codon_start 1 locus_tag LOCUS_38880 gene plsX sequence471 source 1..4119 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 119..697 product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067285.1 transl_table 11 codon_start 1 locus_tag LOCUS_38890 CDS 694..2727 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38900 sequence472 source 1..4098 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(444..3857) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38910 sequence473 source 1..4093 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2044 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921689.1:ATP-dependent helicase HrpB locus_tag LOCUS_38920 tRNA 2058..2134 product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00390 CDS 2857..4080 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38930 sequence474 source 1..4088 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 260..1420 product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143175.1 transl_table 11 codon_start 1 locus_tag LOCUS_38940 gene ahcY CDS 1422..2177 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38950 CDS 2307..3968 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38960 sequence475 source 1..4082 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1036..1608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38970 CDS complement(1619..1825) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38980 CDS complement(1847..2254) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_38990 sequence476 source 1..4076 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..509 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546134.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase locus_tag LOCUS_39000 CDS complement(506..1552) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39010 CDS complement(1633..2295) product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 transl_table 11 codon_start 1 locus_tag LOCUS_39020 gene purN CDS complement(2292..3299) product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 transl_table 11 codon_start 1 locus_tag LOCUS_39030 gene purM CDS complement(3322..4008) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39040 sequence477 source 1..4074 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 246..1127 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39050 CDS 1124..2107 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39060 CDS 2112..3185 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39070 sequence478 source 1..4068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 530..1771 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39080 sequence479 source 1..4053 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 398..1771 product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 transl_table 11 codon_start 1 locus_tag LOCUS_39090 gene mgtE CDS 1771..2514 product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 transl_table 11 codon_start 1 locus_tag LOCUS_39100 gene recO CDS 2535..3269 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39110 CDS 3470..3778 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39120 CDS 3788..4036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39130 sequence480 source 1..4036 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..905 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39140 CDS 902..1489 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39150 CDS 1913..2575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39160 CDS 2572..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39170 CDS 2976..4016 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39180 sequence481 source 1..4034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(264..635) product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 transl_table 11 codon_start 1 locus_tag LOCUS_39190 CDS complement(632..1630) product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 transl_table 11 codon_start 1 locus_tag LOCUS_39200 CDS 1847..2227 product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 transl_table 11 codon_start 1 locus_tag LOCUS_39210 gene trxA CDS complement(2228..3361) product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 transl_table 11 codon_start 1 locus_tag LOCUS_39220 sequence482 source 1..4019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 833..1036 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39230 CDS complement(1114..1776) product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 transl_table 11 codon_start 1 locus_tag LOCUS_39240 CDS 1921..2685 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39250 CDS 2669..3079 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39260 CDS 3144..3773 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39270 sequence483 source 1..3986 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..480 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39280 CDS 570..1163 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39290 CDS complement(1248..1940) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39300 CDS 2074..2544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39310 CDS complement(2553..3437) product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 transl_table 11 codon_start 1 locus_tag LOCUS_39320 CDS 3548..3922 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39330 sequence484 source 1..3972 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(32..2788) product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 transl_table 11 codon_start 1 locus_tag LOCUS_39340 gene secA CDS complement(2923..3699) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39350 sequence485 source 1..3968 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1575 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter locus_tag LOCUS_39360 CDS 1572..2075 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805188.1 transl_table 11 codon_start 1 locus_tag LOCUS_39370 CDS complement(2102..2950) product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 transl_table 11 codon_start 1 locus_tag LOCUS_39380 sequence486 source 1..3928 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2608 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS locus_tag LOCUS_39390 CDS 2612..3505 product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 transl_table 11 codon_start 1 locus_tag LOCUS_39400 gene xerD sequence487 source 1..3927 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 654..881 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39410 CDS 1006..1836 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39420 CDS complement(1859..2371) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39430 CDS complement(2382..3854) product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 transl_table 11 codon_start 1 locus_tag LOCUS_39440 sequence488 source 1..3923 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(145..1491) product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405201.1 transl_table 11 codon_start 1 locus_tag LOCUS_39450 CDS 1585..2511 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39460 sequence489 source 1..3918 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..870 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:ATP-binding protein locus_tag LOCUS_39470 CDS 919..1434 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39480 CDS complement(1440..1961) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39490 CDS 2487..3167 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 transl_table 11 codon_start 1 locus_tag LOCUS_39500 sequence490 source 1..3913 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(389..1141) product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 transl_table 11 codon_start 1 locus_tag LOCUS_39510 gene rlmB CDS complement(1154..2509) product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 transl_table 11 codon_start 1 locus_tag LOCUS_39520 CDS complement(2601..3317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39530 sequence491 source 1..3908 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence492 source 1..3904 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1258..2253 product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 transl_table 11 codon_start 1 locus_tag LOCUS_39540 CDS complement(2254..3225) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39550 misc_feature complement(3289..>3904) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258358.1:TlpA disulfide reductase family protein locus_tag LOCUS_39560 sequence493 source 1..3903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 46..3021 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39570 CDS complement(3027..3566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39580 sequence494 source 1..3903 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1019..2962 product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 transl_table 11 codon_start 1 locus_tag LOCUS_39590 gene acs sequence495 source 1..3895 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2109 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932772.1:DUF87 domain-containing protein locus_tag LOCUS_39600 CDS 2173..3480 product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992205.1 transl_table 11 codon_start 1 locus_tag LOCUS_39610 gene miaB sequence496 source 1..3870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(776..1597) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 transl_table 11 codon_start 1 locus_tag LOCUS_39620 CDS 2171..2800 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39630 sequence497 source 1..3869 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 191..1750 product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680223.1 transl_table 11 codon_start 1 locus_tag LOCUS_39640 CDS 1810..3804 product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 transl_table 11 codon_start 1 locus_tag LOCUS_39650 gene htpG sequence498 source 1..3863 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1690 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890715.1:PAS domain-containing sensor histidine kinase locus_tag LOCUS_39660 sequence499 source 1..3860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 360..1592 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39670 CDS complement(1594..2250) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39680 CDS complement(2253..3440) product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 transl_table 11 codon_start 1 locus_tag LOCUS_39690 sequence500 source 1..3859 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 212..1198 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39700 CDS 1215..2579 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39710 CDS 2656..2979 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39720 sequence501 source 1..3858 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1560 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase locus_tag LOCUS_39730 CDS complement(1562..2929) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39740 sequence502 source 1..3853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2533..3639 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39750 sequence503 source 1..3848 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(712..2268) product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 transl_table 11 codon_start 1 locus_tag LOCUS_39760 CDS 2392..3825 product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 transl_table 11 codon_start 1 locus_tag LOCUS_39770 sequence504 source 1..3841 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 236..1309 product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 transl_table 11 codon_start 1 locus_tag LOCUS_39780 CDS 1511..1681 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39790 CDS 1697..3724 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39800 sequence505 source 1..3820 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(102..2030) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39810 CDS 2273..3301 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39820 sequence506 source 1..3819 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 143..598 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 transl_table 11 codon_start 1 locus_tag LOCUS_39830 gene tsaE CDS 660..1238 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39840 note possible pseudo, internal stop codon CDS 1334..2410 product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 transl_table 11 codon_start 1 locus_tag LOCUS_39850 gene nifS CDS complement(2378..3274) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39860 sequence507 source 1..3814 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 720..2414 product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 transl_table 11 codon_start 1 locus_tag LOCUS_39870 CDS complement(2411..3409) product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 transl_table 11 codon_start 1 locus_tag LOCUS_39880 sequence508 source 1..3777 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1284 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946754.1:efflux RND transporter periplasmic adaptor subunit locus_tag LOCUS_39890 sequence509 source 1..3776 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(249..986) product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887572.1 transl_table 11 codon_start 1 locus_tag LOCUS_39900 CDS 1075..1725 product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 transl_table 11 codon_start 1 locus_tag LOCUS_39910 gene mexL CDS 1728..3338 product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 transl_table 11 codon_start 1 locus_tag LOCUS_39920 gene atuC sequence510 source 1..3727 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence511 source 1..3723 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 776..2047 product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 transl_table 11 codon_start 1 locus_tag LOCUS_39930 gene thrC sequence512 source 1..3712 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 220..450 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39940 CDS complement(599..1429) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39950 CDS 1728..1934 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39960 CDS 1925..2938 product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 transl_table 11 codon_start 1 locus_tag LOCUS_39970 gene holA CDS complement(3061..3339) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39980 sequence513 source 1..3707 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(898..1956) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_39990 CDS complement(1944..2501) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40000 sequence514 source 1..3684 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 269..1234 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40010 CDS 1222..3072 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40020 sequence515 source 1..3681 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(362..1516) product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 transl_table 11 codon_start 1 locus_tag LOCUS_40030 CDS complement(1509..1949) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40040 CDS 1948..2448 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40050 CDS 2507..3334 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40060 sequence516 source 1..3680 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(505..654) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40070 CDS complement(698..1204) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40080 CDS complement(1201..1635) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40090 CDS complement(1915..2238) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40100 CDS complement(2346..2828) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40110 CDS complement(2879..3205) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40120 CDS complement(3376..3678) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40130 sequence517 source 1..3661 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(281..1093) product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706245.1 transl_table 11 codon_start 1 locus_tag LOCUS_40140 CDS complement(1148..2452) product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 transl_table 11 codon_start 1 locus_tag LOCUS_40150 sequence518 source 1..3659 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1369..2043 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40160 misc_feature complement(2183..>3659) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144121.1:ABC transporter ATP-binding protein locus_tag LOCUS_40170 sequence519 source 1..3634 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1061..2272 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40180 sequence520 source 1..3633 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1229 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012437413.1:amidohydrolase locus_tag LOCUS_40190 CDS 1226..2452 product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 transl_table 11 codon_start 1 locus_tag LOCUS_40200 CDS 2449..3633 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40210 sequence521 source 1..3621 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 279..1967 product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 transl_table 11 codon_start 1 locus_tag LOCUS_40220 CDS 2135..3169 product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 transl_table 11 codon_start 1 locus_tag LOCUS_40230 sequence522 source 1..3612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1113..1700 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40240 CDS 1697..2266 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40250 sequence523 source 1..3586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(448..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40260 CDS complement(2034..2765) product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 transl_table 11 codon_start 1 locus_tag LOCUS_40270 CDS complement(2775..3515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40280 sequence524 source 1..3572 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 101..1315 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40290 CDS 1305..2945 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40300 misc_feature complement(2952..>3572) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922522.1:sulfatase-like hydrolase/transferase locus_tag LOCUS_40310 sequence525 source 1..3568 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(209..886) product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 transl_table 11 codon_start 1 locus_tag LOCUS_40320 CDS 962..1822 product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 transl_table 11 codon_start 1 locus_tag LOCUS_40330 gene hslO CDS complement(1823..2626) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40340 CDS 2719..3354 product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 transl_table 11 codon_start 1 locus_tag LOCUS_40350 CDS complement(3312..3566) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40360 sequence526 source 1..3566 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1590..2939) product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 transl_table 11 codon_start 1 locus_tag LOCUS_40370 gene accC CDS complement(2953..3360) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40380 sequence527 source 1..3562 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..548 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390226.1:PAS-domain containing protein locus_tag LOCUS_40390 CDS 802..1005 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40400 CDS complement(1059..2585) product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 transl_table 11 codon_start 1 locus_tag LOCUS_40410 CDS 3263..3466 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40420 sequence528 source 1..3553 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 295..483 product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 transl_table 11 codon_start 1 locus_tag LOCUS_40430 gene rpmG CDS 592..1164 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124564.1 transl_table 11 codon_start 1 locus_tag LOCUS_40440 gene rpsD CDS complement(1488..2477) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40450 CDS complement(2474..3301) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40460 sequence529 source 1..3551 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..613 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529278.1:acyl-CoA dehydrogenase family protein locus_tag LOCUS_40470 CDS 623..2560 product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 transl_table 11 codon_start 1 locus_tag LOCUS_40480 CDS 2550..3407 product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083805.1 transl_table 11 codon_start 1 locus_tag LOCUS_40490 sequence530 source 1..3550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 423..812 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40500 CDS 820..1710 product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 transl_table 11 codon_start 1 locus_tag LOCUS_40510 sequence531 source 1..3539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..3106 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme locus_tag LOCUS_40520 sequence532 source 1..3536 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 558..1574 product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 transl_table 11 codon_start 1 locus_tag LOCUS_40530 CDS 1667..2794 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40540 tRNA 2972..3045 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00400 tRNA 3092..3174 product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00410 tRNA 3200..3275 product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00420 tRNA 3303..3377 product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00430 sequence533 source 1..3525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence534 source 1..3525 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 7..543 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40550 CDS complement(571..2334) product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 transl_table 11 codon_start 1 locus_tag LOCUS_40560 CDS 2424..3191 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40570 sequence535 source 1..3518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(244..1473) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40580 CDS 1601..2260 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40590 CDS 2257..3294 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40600 sequence536 source 1..3515 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 656..1117 product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 transl_table 11 codon_start 1 locus_tag LOCUS_40610 CDS complement(1172..3154) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40620 sequence537 source 1..3504 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 536..3106 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40630 sequence538 source 1..3501 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..2007 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40640 CDS complement(2153..3067) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40650 sequence539 source 1..3489 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..194 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40660 CDS 761..1009 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40670 CDS 1183..2526 product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530401.1 transl_table 11 codon_start 1 locus_tag LOCUS_40680 gene fliD CDS 2570..2944 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40690 CDS 2941..3237 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40700 sequence540 source 1..3473 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 326..2863 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40710 sequence541 source 1..3455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(135..2150) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40720 CDS complement(2313..2996) product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 transl_table 11 codon_start 1 locus_tag LOCUS_40730 sequence542 source 1..3453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 325..1131 product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 transl_table 11 codon_start 1 locus_tag LOCUS_40740 gene ccsB CDS 1121..2353 product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 transl_table 11 codon_start 1 locus_tag LOCUS_40750 gene hemA CDS 2353..3228 product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 transl_table 11 codon_start 1 locus_tag LOCUS_40760 gene hemC sequence543 source 1..3428 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(572..1519) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40770 CDS 2638..3369 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40780 sequence544 source 1..3420 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 474..2459 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40790 CDS 2459..3154 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062678.1 transl_table 11 codon_start 1 locus_tag LOCUS_40800 sequence545 source 1..3410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 377..610 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40810 CDS complement(828..2528) product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 transl_table 11 codon_start 1 locus_tag LOCUS_40820 CDS 2624..2902 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40830 note possible pseudo, internal stop codon sequence546 source 1..3403 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence547 source 1..3402 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1219..2376 product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459897.1 transl_table 11 codon_start 1 locus_tag LOCUS_40840 gene iadA CDS 2443..3261 product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 transl_table 11 codon_start 1 locus_tag LOCUS_40850 sequence548 source 1..3352 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence549 source 1..3351 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence550 source 1..3340 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..807 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943428.1:cytochrome c family protein locus_tag LOCUS_40860 CDS 913..2118 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40870 CDS 2124..2975 product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 transl_table 11 codon_start 1 locus_tag LOCUS_40880 sequence551 source 1..3339 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..1331) product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 transl_table 11 codon_start 1 locus_tag LOCUS_40890 gene selD CDS 1526..1981 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40900 CDS 2064..2345 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40910 sequence552 source 1..3336 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(292..726) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40920 CDS complement(1125..1304) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40930 CDS 1649..2377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40940 CDS 2374..3045 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40950 sequence553 source 1..3325 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..994 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015490.1:quinone-dependent L-lactate dehydrogenase locus_tag LOCUS_40960 CDS 991..2460 product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 transl_table 11 codon_start 1 locus_tag LOCUS_40970 sequence554 source 1..3313 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..732 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141490.1:tetracycline resistance MFS efflux pump locus_tag LOCUS_40980 CDS 874..1701 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_40990 CDS 1728..2693 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41000 sequence555 source 1..3300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 113..1822 product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 transl_table 11 codon_start 1 locus_tag LOCUS_41010 gene hflX CDS 1810..2289 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41020 CDS 2286..3158 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 transl_table 11 codon_start 1 locus_tag LOCUS_41030 sequence556 source 1..3300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 193..810 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41040 CDS complement(820..1182) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 transl_table 11 codon_start 1 locus_tag LOCUS_41050 CDS 1304..3232 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41060 sequence557 source 1..3296 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..528 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein locus_tag LOCUS_41070 CDS 619..1458 product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 transl_table 11 codon_start 1 locus_tag LOCUS_41080 CDS 1525..2424 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41090 sequence558 source 1..3295 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(412..1191) product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 transl_table 11 codon_start 1 locus_tag LOCUS_41100 gene mazG CDS 1308..2759 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41110 misc_feature complement(2756..>3295) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937579.1:PAS domain S-box protein locus_tag LOCUS_41120 sequence559 source 1..3294 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(2649..>3294) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta locus_tag LOCUS_41130 sequence560 source 1..3271 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 415..1023 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41140 CDS complement(1285..2307) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41150 CDS complement(2304..2909) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41160 CDS complement(3013..3270) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41170 sequence561 source 1..3236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(623..1621) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41180 sequence562 source 1..3236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(441..1007) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41190 CDS complement(1375..1713) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41200 CDS 2158..2898 product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 transl_table 11 codon_start 1 locus_tag LOCUS_41210 sequence563 source 1..3236 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 75..1811 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41220 CDS 2151..2876 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41230 sequence564 source 1..3233 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(744..1418) product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 transl_table 11 codon_start 1 locus_tag LOCUS_41240 CDS complement(1477..2880) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41250 sequence565 source 1..3230 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..1351 product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266134.1 transl_table 11 codon_start 1 locus_tag LOCUS_41260 gene dprA CDS 1348..1602 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41270 CDS 1755..2486 product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 transl_table 11 codon_start 1 locus_tag LOCUS_41280 gene xerC sequence566 source 1..3216 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(162..608) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41290 CDS 677..1849 product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 transl_table 11 codon_start 1 locus_tag LOCUS_41300 sequence567 source 1..3213 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(917..1177) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41310 CDS complement(1373..2380) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41320 CDS complement(2601..3029) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41330 CDS complement(3029..3172) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41340 sequence568 source 1..3189 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(482..1159) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41350 misc_feature complement(1421..>3189) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393356.1:glycoside hydrolase family 13 protein locus_tag LOCUS_41360 sequence569 source 1..3186 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 237..506 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41370 CDS 506..883 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41380 CDS 887..2260 product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 transl_table 11 codon_start 1 locus_tag LOCUS_41390 gene flgK CDS 2257..3141 product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981404.1 transl_table 11 codon_start 1 locus_tag LOCUS_41400 gene flgL sequence570 source 1..3159 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1221..2705) product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 transl_table 11 codon_start 1 locus_tag LOCUS_41410 sequence571 source 1..3147 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 583..2088 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41420 sequence572 source 1..3141 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(501..1073) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41430 CDS complement(1124..1438) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41440 CDS complement(1435..1662) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41450 CDS complement(1696..2049) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41460 CDS complement(2046..2318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41470 CDS complement(2315..2518) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41480 sequence573 source 1..3135 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1192 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682356.1:elongation factor G locus_tag LOCUS_41490 CDS 1238..2464 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41500 sequence574 source 1..3132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(315..1151) product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531744.1 transl_table 11 codon_start 1 locus_tag LOCUS_41510 gene kynA CDS 1286..1882 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41520 sequence575 source 1..3106 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1014..2495 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41530 sequence576 source 1..3086 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 140..1453 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41540 CDS 1447..1947 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41550 sequence577 source 1..3063 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence578 source 1..3055 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 493..1257 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41560 CDS 1806..2141 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41570 CDS 2376..2519 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41580 misc_feature complement(2544..>3055) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171654.1:sterol desaturase family protein locus_tag LOCUS_41590 sequence579 source 1..3050 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(188..586) product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 transl_table 11 codon_start 1 locus_tag LOCUS_41600 gene rpsI CDS complement(605..1039) product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 transl_table 11 codon_start 1 locus_tag LOCUS_41610 gene rplM CDS complement(1154..2614) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41620 sequence580 source 1..3048 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(224..724) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41630 CDS complement(733..1464) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41640 CDS complement(1461..1940) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 transl_table 11 codon_start 1 locus_tag LOCUS_41650 CDS complement(2111..2497) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41660 CDS complement(2516..2920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41670 sequence581 source 1..3040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 841..1518 product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970193.1 transl_table 11 codon_start 1 locus_tag LOCUS_41680 CDS complement(1520..2971) product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 transl_table 11 codon_start 1 locus_tag LOCUS_41690 gene pyk sequence582 source 1..3040 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 234..1721 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41700 CDS 1776..2651 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41710 sequence583 source 1..3039 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1348..1818 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41720 sequence584 source 1..3032 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(607..2202) product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 transl_table 11 codon_start 1 locus_tag LOCUS_41730 misc_feature complement(2169..>3032) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973526.1:glycine cleavage system aminomethyltransferase GcvT locus_tag LOCUS_41740 sequence585 source 1..3029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(170..1252) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41750 CDS complement(1260..2201) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41760 CDS complement(2230..2988) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41770 sequence586 source 1..3029 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..697 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920241.1:UDP-glucose 4-epimerase GalE locus_tag LOCUS_41780 CDS complement(792..2234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41790 CDS complement(2363..2917) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41800 sequence587 source 1..3025 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence588 source 1..3019 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence589 source 1..3014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 868..1563 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41810 sequence590 source 1..3014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence591 source 1..3013 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1002..2696) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41820 sequence592 source 1..3009 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..2976 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41830 sequence593 source 1..2995 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..629 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338826.1:alpha/beta fold hydrolase locus_tag LOCUS_41840 CDS 748..1659 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41850 sequence594 source 1..2993 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(333..1535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41860 sequence595 source 1..2991 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(536..1369) product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 transl_table 11 codon_start 1 locus_tag LOCUS_41870 CDS complement(1385..2371) product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 transl_table 11 codon_start 1 locus_tag LOCUS_41880 sequence596 source 1..2980 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(748..1347) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41890 CDS complement(1752..2087) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41900 CDS complement(2077..2535) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41910 CDS complement(2635..2883) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41920 sequence597 source 1..2973 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1143..1832 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41930 CDS 1823..2704 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 transl_table 11 codon_start 1 locus_tag LOCUS_41940 sequence598 source 1..2953 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 221..559 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41950 CDS 560..796 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41960 CDS complement(797..1207) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41970 CDS complement(1307..2101) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_41980 CDS complement(2150..2758) product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275459.1 transl_table 11 codon_start 1 locus_tag LOCUS_41990 sequence599 source 1..2944 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(563..1534) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42000 CDS 1598..2305 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42010 sequence600 source 1..2943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1747..2820 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42020 sequence601 source 1..2943 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(537..1310) product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 transl_table 11 codon_start 1 locus_tag LOCUS_42030 CDS 1415..2158 product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 transl_table 11 codon_start 1 locus_tag LOCUS_42040 CDS 2232..2393 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42050 CDS complement(2513..2749) product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 transl_table 11 codon_start 1 locus_tag LOCUS_42060 gene rpmB sequence602 source 1..2930 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(116..1945) product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 transl_table 11 codon_start 1 locus_tag LOCUS_42070 misc_feature complement(1942..>2930) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145033984.1:DUF1501 domain-containing protein locus_tag LOCUS_42080 sequence603 source 1..2929 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(681..2681) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258466.1 transl_table 11 codon_start 1 locus_tag LOCUS_42090 sequence604 source 1..2920 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..679 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643969.1:excinuclease ABC subunit UvrA locus_tag LOCUS_42100 CDS complement(868..2253) product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 transl_table 11 codon_start 1 locus_tag LOCUS_42110 gene lpdA misc_feature complement(2293..>2920) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001062320.1:dihydrolipoamide acetyltransferase family protein locus_tag LOCUS_42120 sequence605 source 1..2915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(851..1612) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42130 CDS complement(1578..1991) product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 transl_table 11 codon_start 1 locus_tag LOCUS_42140 CDS complement(1991..2230) product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 transl_table 11 codon_start 1 locus_tag LOCUS_42150 gene moaD sequence606 source 1..2915 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(44..2884) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42160 sequence607 source 1..2902 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 160..834 product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 transl_table 11 codon_start 1 locus_tag LOCUS_42170 CDS 831..2297 product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 transl_table 11 codon_start 1 locus_tag LOCUS_42180 CDS complement(2300..2725) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42190 sequence608 source 1..2890 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(605..1444) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42200 CDS 1724..2557 product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054418.1 transl_table 11 codon_start 1 locus_tag LOCUS_42210 sequence609 source 1..2887 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(896..1585) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42220 CDS 2008..2517 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42230 sequence610 source 1..2878 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(1034..>2878) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125282.1:acetoacetate metabolism transcriptional regulator AtoC locus_tag LOCUS_42240 sequence611 source 1..2870 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(287..451) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42250 CDS complement(480..1799) product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 transl_table 11 codon_start 1 locus_tag LOCUS_42260 gene ltrA CDS complement(1816..1944) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42270 CDS complement(2558..2701) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42280 sequence612 source 1..2860 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(414..797) product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 transl_table 11 codon_start 1 locus_tag LOCUS_42290 gene rpsL misc_feature complement(908..>2860) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' locus_tag LOCUS_42300 sequence613 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1262..1438 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42310 CDS complement(1489..1920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42320 misc_feature complement(1934..>2855) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227050.1:diaminopimelate decarboxylase locus_tag LOCUS_42330 sequence614 source 1..2855 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..782 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942870.1:DNA polymerase III subunit delta' locus_tag LOCUS_42340 CDS complement(786..2099) product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 transl_table 11 codon_start 1 locus_tag LOCUS_42350 sequence615 source 1..2853 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 446..1414 product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 transl_table 11 codon_start 1 locus_tag LOCUS_42360 gene tsaD CDS 1411..2247 product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 transl_table 11 codon_start 1 locus_tag LOCUS_42370 gene rsmA sequence616 source 1..2830 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(419..1750) product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 transl_table 11 codon_start 1 locus_tag LOCUS_42380 gene secY CDS complement(1752..2198) product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 transl_table 11 codon_start 1 locus_tag LOCUS_42390 gene rplO CDS complement(2216..2407) product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 transl_table 11 codon_start 1 locus_tag LOCUS_42400 gene rpmD sequence617 source 1..2826 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..2409 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083904.1:OmpA family protein locus_tag LOCUS_42410 sequence618 source 1..2804 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(381..773) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42420 CDS complement(954..1163) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42430 sequence619 source 1..2802 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(579..1682) product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 transl_table 11 codon_start 1 locus_tag LOCUS_42440 misc_feature complement(1767..>2802) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256854.1:serine protein kinase locus_tag LOCUS_42450 sequence620 source 1..2801 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1458..2672) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42460 sequence621 source 1..2796 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(220..573) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42470 CDS 590..2332 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42480 CDS 2376..2537 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42490 sequence622 source 1..2779 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..1230 product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 transl_table 11 codon_start 1 locus_tag LOCUS_42500 CDS 1288..1806 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42510 CDS 2393..2716 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42520 sequence623 source 1..2767 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 251..1039 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42530 tRNA 1051..1134 product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00440 CDS complement(1180..2562) product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 transl_table 11 codon_start 1 locus_tag LOCUS_42540 sequence624 source 1..2749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 633..1514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42550 CDS complement(1519..1779) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42560 CDS complement(1785..2318) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42570 sequence625 source 1..2749 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(223..1089) product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 transl_table 11 codon_start 1 locus_tag LOCUS_42580 gene mtnP CDS complement(1135..2361) product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 transl_table 11 codon_start 1 locus_tag LOCUS_42590 gene rlmN sequence626 source 1..2739 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..737 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42600 CDS 734..1489 product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 transl_table 11 codon_start 1 locus_tag LOCUS_42610 CDS complement(1486..2604) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42620 sequence627 source 1..2728 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1876) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42630 CDS complement(1873..2631) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42640 sequence628 source 1..2726 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1303..1575 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42650 sequence629 source 1..2718 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1593 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975685.1:urocanate hydratase locus_tag LOCUS_42660 CDS 1722..2315 product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 transl_table 11 codon_start 1 locus_tag LOCUS_42670 sequence630 source 1..2714 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1..2544 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42680 sequence631 source 1..2708 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(514..2136) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42690 CDS complement(2476..2685) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42700 sequence632 source 1..2702 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 479..1204 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42710 CDS 1201..1377 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42720 CDS 1377..2384 product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 transl_table 11 codon_start 1 locus_tag LOCUS_42730 sequence633 source 1..2676 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 424..2607 product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 transl_table 11 codon_start 1 locus_tag LOCUS_42740 sequence634 source 1..2670 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(242..1174) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42750 CDS complement(1171..1887) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42760 misc_feature complement(1889..>2670) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976585.1:ABC transporter permease subunit locus_tag LOCUS_42770 sequence635 source 1..2669 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 106..330 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42780 CDS 387..626 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42790 CDS 651..1514 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42800 CDS complement(1625..2515) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42810 sequence636 source 1..2662 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(551..1594) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42820 CDS complement(1616..1963) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42830 sequence637 source 1..2637 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 122..709 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42840 CDS 1179..1640 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42850 sequence638 source 1..2636 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..816 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156916.1:bile acid:sodium symporter family protein locus_tag LOCUS_42860 CDS 900..2264 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42870 sequence639 source 1..2619 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence640 source 1..2614 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 577..1386 product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 transl_table 11 codon_start 1 locus_tag LOCUS_42880 CDS complement(1549..2532) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42890 sequence641 source 1..2612 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(543..1673) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42900 CDS complement(1670..2392) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42910 sequence642 source 1..2610 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 825..2048 product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 transl_table 11 codon_start 1 locus_tag LOCUS_42920 sequence643 source 1..2600 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 278..2539 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_42930 sequence644 source 1..2588 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1410 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201786535.1:type IA DNA topoisomerase locus_tag LOCUS_42940 misc_feature complement(1416..>2588) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein locus_tag LOCUS_42950 sequence645 source 1..2586 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 719..1123 product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 transl_table 11 codon_start 1 locus_tag LOCUS_42960 gene flgB CDS 1127..1549 product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 transl_table 11 codon_start 1 locus_tag LOCUS_42970 gene flgC CDS 1552..1863 product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 transl_table 11 codon_start 1 locus_tag LOCUS_42980 gene fliE sequence646 source 1..2583 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(195..>2583) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486214.1:Stk1 family PASTA domain-containing Ser/Thr kinase locus_tag LOCUS_42990 sequence647 source 1..2580 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence648 source 1..2576 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 398..1201 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43000 note possible pseudo, internal stop codon CDS 1215..2399 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43010 sequence649 source 1..2574 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(823..1104) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43020 CDS 1449..2417 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43030 sequence650 source 1..2563 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1237..2001 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43040 sequence651 source 1..2557 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence652 source 1..2550 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(41..619) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43050 CDS complement(715..1194) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43060 CDS complement(1288..2250) product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 transl_table 11 codon_start 1 locus_tag LOCUS_43070 sequence653 source 1..2539 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 676..1938 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43080 CDS complement(1935..2354) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43090 sequence654 source 1..2538 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence655 source 1..2529 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(846..1115) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43100 CDS 1890..2138 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43110 sequence656 source 1..2526 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..942 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917171.1:IS21 family transposase locus_tag LOCUS_43120 CDS 942..1679 product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122401609.1 transl_table 11 codon_start 1 locus_tag LOCUS_43130 gene istB sequence657 source 1..2518 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(516..707) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43140 CDS 691..1095 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43150 CDS complement(1287..2234) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43160 CDS complement(2319..2495) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43170 sequence658 source 1..2513 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(296..1453) product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 transl_table 11 codon_start 1 locus_tag LOCUS_43180 sequence659 source 1..2511 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 334..903 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43190 CDS 900..2351 product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 transl_table 11 codon_start 1 locus_tag LOCUS_43200 sequence660 source 1..2502 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence661 source 1..2496 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 797..2038 product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 transl_table 11 codon_start 1 locus_tag LOCUS_43210 sequence662 source 1..2495 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(918..1439) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43220 CDS complement(1505..2317) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43230 sequence663 source 1..2492 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..715 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458327.1:endonuclease locus_tag LOCUS_43240 CDS complement(801..2216) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43250 sequence664 source 1..2477 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 573..1421 product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 transl_table 11 codon_start 1 locus_tag LOCUS_43260 gene nadC CDS 1418..1828 product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 transl_table 11 codon_start 1 locus_tag LOCUS_43270 sequence665 source 1..2476 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence666 source 1..2463 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(456..1337) product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706595.1 transl_table 11 codon_start 1 locus_tag LOCUS_43280 gene ylqF sequence667 source 1..2460 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(664..1299) product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 transl_table 11 codon_start 1 locus_tag LOCUS_43290 gene lexA CDS 1329..1484 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43300 CDS 1672..2385 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43310 sequence668 source 1..2458 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 611..1006 product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065467.1 transl_table 11 codon_start 1 locus_tag LOCUS_43320 tRNA complement(1160..1231) product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00450 CDS 1393..2382 product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 transl_table 11 codon_start 1 locus_tag LOCUS_43330 sequence669 source 1..2455 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(233..1786) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43340 misc_feature complement(1904..>2455) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081992.1:metal-dependent hydrolase locus_tag LOCUS_43350 sequence670 source 1..2453 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..873 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839326.1:aconitate hydratase AcnA locus_tag LOCUS_43360 CDS complement(876..1496) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43370 note possible pseudo, frameshifted sequence671 source 1..2433 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence672 source 1..2426 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(925..1809) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43380 CDS complement(1806..2357) product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 transl_table 11 codon_start 1 locus_tag LOCUS_43390 sequence673 source 1..2425 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1009..1302) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43400 sequence674 source 1..2422 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 144..842 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43410 CDS complement(929..1711) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43420 sequence675 source 1..2421 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(855..1394) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43430 CDS 1432..2307 product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083434.1 transl_table 11 codon_start 1 locus_tag LOCUS_43440 sequence676 source 1..2412 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(779..1483) product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 transl_table 11 codon_start 1 locus_tag LOCUS_43450 sequence677 source 1..2410 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(345..1229) product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 transl_table 11 codon_start 1 locus_tag LOCUS_43460 CDS 1407..2276 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43470 sequence678 source 1..2395 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence679 source 1..2394 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1130..1861) product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 transl_table 11 codon_start 1 locus_tag LOCUS_43480 sequence680 source 1..2393 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 268..666 product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 transl_table 11 codon_start 1 locus_tag LOCUS_43490 gene rpsK CDS 698..1324 product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 transl_table 11 codon_start 1 locus_tag LOCUS_43500 gene rpsD sequence681 source 1..2346 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1584..2123 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43510 sequence682 source 1..2330 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence683 source 1..2317 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 3..362 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43520 CDS 363..2066 product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 transl_table 11 codon_start 1 locus_tag LOCUS_43530 gene gspE sequence684 source 1..2315 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(1078..1245) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43540 sequence685 source 1..2300 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 2..790 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43550 CDS complement(794..1771) product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 transl_table 11 codon_start 1 locus_tag LOCUS_43560 gene arsS CDS complement(1771..2046) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43570 sequence686 source 1..2297 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(711..920) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43580 CDS complement(983..1771) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43590 CDS 1871..2113 product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 transl_table 11 codon_start 1 locus_tag LOCUS_43600 sequence687 source 1..2292 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(90..166) product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00460 CDS 337..927 product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 transl_table 11 codon_start 1 locus_tag LOCUS_43610 CDS 1130..1642 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43620 CDS 1673..1951 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43630 sequence688 source 1..2275 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(660..968) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43640 CDS complement(1042..1479) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43650 CDS complement(1559..2128) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43660 sequence689 source 1..2273 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ repeat_region 155..285 inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtcgacgggcggtgcggtgtc CDS complement(844..1554) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43670 CDS complement(1600..1890) product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 transl_table 11 codon_start 1 locus_tag LOCUS_43680 gene arsC CDS complement(1992..2273) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43690 sequence690 source 1..2257 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence691 source 1..2256 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(161..556) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43700 CDS complement(560..1600) product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 transl_table 11 codon_start 1 locus_tag LOCUS_43710 CDS 1701..1955 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43720 sequence692 source 1..2220 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 229..411 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43730 CDS 451..969 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43740 note possible pseudo, internal stop codon, frameshifted CDS 978..1217 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43750 note possible pseudo, frameshifted sequence693 source 1..2214 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence694 source 1..2211 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(313..>2211) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_096580277.1:DUF4157 domain-containing protein locus_tag LOCUS_43760 sequence695 source 1..2210 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence696 source 1..2205 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 651..878 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43770 sequence697 source 1..2203 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1158) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43780 CDS complement(1204..1848) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43790 sequence698 source 1..2198 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(922..1890) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43800 sequence699 source 1..2170 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 60..479 product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 transl_table 11 codon_start 1 locus_tag LOCUS_43810 CDS 698..2068 product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 transl_table 11 codon_start 1 locus_tag LOCUS_43820 sequence700 source 1..2161 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 483..980 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43830 CDS 977..2002 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259759.1 transl_table 11 codon_start 1 locus_tag LOCUS_43840 sequence701 source 1..2156 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 458..1375 product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135338848.1 transl_table 11 codon_start 1 locus_tag LOCUS_43850 sequence702 source 1..2150 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence703 source 1..2142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(741..2015) product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 transl_table 11 codon_start 1 locus_tag LOCUS_43860 sequence704 source 1..2142 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(359..808) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43870 CDS complement(876..1124) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43880 CDS complement(1124..1381) product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 transl_table 11 codon_start 1 locus_tag LOCUS_43890 gene rpsP misc_feature complement(1457..>2142) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:acyl-CoA carboxylase subunit beta locus_tag LOCUS_43900 sequence705 source 1..2134 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature complement(470..>2134) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257643.1:carbamoyl-phosphate synthase large subunit locus_tag LOCUS_43910 sequence706 source 1..2132 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1611 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein locus_tag LOCUS_43920 sequence707 source 1..2127 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence708 source 1..2125 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 465..1304 product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 transl_table 11 codon_start 1 locus_tag LOCUS_43930 sequence709 source 1..2114 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 52..1596 product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 transl_table 11 codon_start 1 locus_tag LOCUS_43940 CDS 1754..1909 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43950 sequence710 source 1..2104 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence711 source 1..2092 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1412 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790264.1:TonB-dependent receptor plug domain-containing protein locus_tag LOCUS_43960 sequence712 source 1..2079 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1349 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136932681.1:VCBS repeat-containing protein locus_tag LOCUS_43970 sequence713 source 1..2072 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 275..445 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43980 CDS complement(442..930) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_43990 CDS complement(994..1188) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44000 CDS complement(1208..2071) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44010 sequence714 source 1..2068 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ misc_feature <1..1612 inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036149.1:OmpA family protein locus_tag LOCUS_44020 sequence715 source 1..2064 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 948..1631 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44030 sequence716 source 1..2042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 1457..1906 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44040 sequence717 source 1..2042 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(109..1668) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44050 sequence718 source 1..2034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(641..1459) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44060 sequence719 source 1..2034 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(366..743) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44070 CDS complement(1268..1627) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44080 CDS complement(1634..1783) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44090 sequence720 source 1..2028 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS 289..678 product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44100 sequence721 source 1..2026 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ tRNA complement(531..605) product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 locus_tag LOCUS_t00470 CDS complement(651..1268) product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 transl_table 11 codon_start 1 locus_tag LOCUS_44110 gene lipB sequence722 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(468..1352) product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_table 11 codon_start 1 locus_tag LOCUS_44120 misc_feature complement(1468..>2016) inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257905.1:hypoxanthine phosphoribosyltransferase locus_tag LOCUS_44130 sequence723 source 1..2016 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ sequence724 source 1..2014 mol_type genomic DNA organism submitter_seqid @@[entry]@@ ff_definition @@[organism]@@ @@[strain]@@ DNA, @@[submitter_seqid]@@ CDS complement(478..1377) product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 transl_table 11 codon_start 1 locus_tag LOCUS_44140