>Feature sequence001 615 22 gene locus_tag LOCUS_00010 615 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2616 1804 gene locus_tag LOCUS_00020 2616 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2920 6588 gene locus_tag LOCUS_00030 gene recC 2920 6588 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942180.1 protein_id gnl|my_center|LOCUS_00030 6585 10622 gene locus_tag LOCUS_00040 6585 10622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 10619 12835 gene locus_tag LOCUS_00050 gene recD 10619 12835 CDS product exodeoxyribonuclease V subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942182.1 protein_id gnl|my_center|LOCUS_00050 12844 14973 gene locus_tag LOCUS_00060 12844 14973 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889379.1 protein_id gnl|my_center|LOCUS_00060 15938 15003 gene locus_tag LOCUS_00070 15938 15003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 16063 16665 gene locus_tag LOCUS_00080 16063 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 16913 17458 gene locus_tag LOCUS_00090 16913 17458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 20074 17459 gene locus_tag LOCUS_00100 20074 17459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 21371 20166 gene locus_tag LOCUS_00110 21371 20166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689532.1 protein_id gnl|my_center|LOCUS_00110 22377 21517 gene locus_tag LOCUS_00120 22377 21517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 22961 22374 gene locus_tag LOCUS_00130 22961 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 24649 22964 gene locus_tag LOCUS_00140 24649 22964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 25662 24637 gene locus_tag LOCUS_00150 25662 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 25718 26560 gene locus_tag LOCUS_00160 25718 26560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 26564 27658 gene locus_tag LOCUS_00170 26564 27658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 27847 29658 gene locus_tag LOCUS_00180 27847 29658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 29667 31004 gene locus_tag LOCUS_00190 29667 31004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 31199 32044 gene locus_tag LOCUS_00200 31199 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 35590 32141 gene locus_tag LOCUS_00210 35590 32141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 36363 35590 gene locus_tag LOCUS_00220 36363 35590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 37034 36381 gene locus_tag LOCUS_00230 37034 36381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 40832 37158 gene locus_tag LOCUS_00240 40832 37158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 40831 42264 gene locus_tag LOCUS_00250 40831 42264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 42384 43292 gene locus_tag LOCUS_00260 42384 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 43406 44953 gene locus_tag LOCUS_00270 43406 44953 CDS product DUF1549 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141645203.1 protein_id gnl|my_center|LOCUS_00270 44950 45576 gene locus_tag LOCUS_00280 44950 45576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 45580 46953 gene locus_tag LOCUS_00290 45580 46953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <48200 46982 gene locus_tag LOCUS_00300 <48200 46982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence002 1389 76 gene locus_tag LOCUS_00310 1389 76 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 protein_id gnl|my_center|LOCUS_00310 615 708 gene locus_tag LOCUS_t00010 615 708 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3011 1386 gene locus_tag LOCUS_00320 3011 1386 CDS product DUF1588 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615747.1 protein_id gnl|my_center|LOCUS_00320 3157 4017 gene locus_tag LOCUS_00330 3157 4017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 4030 4746 gene locus_tag LOCUS_00340 4030 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 4856 5662 gene locus_tag LOCUS_00350 4856 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 6999 5671 gene locus_tag LOCUS_00360 6999 5671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 7937 7026 gene locus_tag LOCUS_00370 7937 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8827 8087 gene locus_tag LOCUS_00380 8827 8087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 8925 9836 gene locus_tag LOCUS_00390 8925 9836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 14219 9840 gene locus_tag LOCUS_00400 14219 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 14218 15168 gene locus_tag LOCUS_00410 14218 15168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 16514 15165 gene locus_tag LOCUS_00420 16514 15165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 17685 16501 gene locus_tag LOCUS_00430 17685 16501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 18205 17726 gene locus_tag LOCUS_00440 18205 17726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 18699 18301 gene locus_tag LOCUS_00450 18699 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 19779 18766 gene locus_tag LOCUS_00460 19779 18766 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275150.1 protein_id gnl|my_center|LOCUS_00460 20597 19827 gene locus_tag LOCUS_00470 20597 19827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 21589 20672 gene locus_tag LOCUS_00480 21589 20672 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510049.1 protein_id gnl|my_center|LOCUS_00480 23378 21669 gene locus_tag LOCUS_00490 23378 21669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 23788 23375 gene locus_tag LOCUS_00500 23788 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 23727 23921 gene locus_tag LOCUS_00510 23727 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 24020 24991 gene locus_tag LOCUS_00520 24020 24991 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_00520 26188 24983 gene locus_tag LOCUS_00530 26188 24983 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_00530 27420 26230 gene locus_tag LOCUS_00540 27420 26230 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967274.1 protein_id gnl|my_center|LOCUS_00540 28745 27423 gene locus_tag LOCUS_00550 28745 27423 CDS product DUF1800 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919844.1 protein_id gnl|my_center|LOCUS_00550 28833 29840 gene locus_tag LOCUS_00560 28833 29840 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965338.1 protein_id gnl|my_center|LOCUS_00560 29961 30890 gene locus_tag LOCUS_00570 29961 30890 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918944.1 protein_id gnl|my_center|LOCUS_00570 30956 31531 gene locus_tag LOCUS_00580 30956 31531 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262281.1 protein_id gnl|my_center|LOCUS_00580 31617 32696 gene locus_tag LOCUS_00590 31617 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 32693 33823 gene locus_tag LOCUS_00600 32693 33823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 33962 35056 gene locus_tag LOCUS_00610 33962 35056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 35053 36054 gene locus_tag LOCUS_00620 35053 36054 CDS product DUF6091 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207688.1 protein_id gnl|my_center|LOCUS_00620 36055 38391 gene locus_tag LOCUS_00630 36055 38391 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207736.1 protein_id gnl|my_center|LOCUS_00630 39852 38488 gene locus_tag LOCUS_00640 39852 38488 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664582.1 protein_id gnl|my_center|LOCUS_00640 41840 39849 gene locus_tag LOCUS_00650 41840 39849 CDS product DUF1592 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922871.1 protein_id gnl|my_center|LOCUS_00650 42308 43114 gene locus_tag LOCUS_00660 42308 43114 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_00660 >Feature sequence003 498 2828 gene locus_tag LOCUS_00670 498 2828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3900 2836 gene locus_tag LOCUS_00680 3900 2836 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_00680 4793 3897 gene locus_tag LOCUS_00690 gene argB 4793 3897 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878775.1 protein_id gnl|my_center|LOCUS_00690 5794 4790 gene locus_tag LOCUS_00700 5794 4790 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 protein_id gnl|my_center|LOCUS_00700 6927 5791 gene locus_tag LOCUS_00710 6927 5791 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_00710 7976 6918 gene locus_tag LOCUS_00720 gene argC 7976 6918 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393773.1 protein_id gnl|my_center|LOCUS_00720 9030 7966 gene locus_tag LOCUS_00730 9030 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403233.1 protein_id gnl|my_center|LOCUS_00730 10229 9027 gene locus_tag LOCUS_00740 gene argG 10229 9027 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404940.1 protein_id gnl|my_center|LOCUS_00740 10686 10222 gene locus_tag LOCUS_00750 10686 10222 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977248.1 protein_id gnl|my_center|LOCUS_00750 12287 10794 gene locus_tag LOCUS_00760 12287 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 14270 12474 gene locus_tag LOCUS_00770 gene typA 14270 12474 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964991.1 protein_id gnl|my_center|LOCUS_00770 15794 14376 gene locus_tag LOCUS_00780 15794 14376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 16471 15851 gene locus_tag LOCUS_00790 16471 15851 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_00790 18985 16472 gene locus_tag LOCUS_00800 18985 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 19307 20335 gene locus_tag LOCUS_00810 19307 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 20369 22270 gene locus_tag LOCUS_00820 20369 22270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 22270 23838 gene locus_tag LOCUS_00830 22270 23838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 23835 24344 gene locus_tag LOCUS_00840 23835 24344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 24341 25840 gene locus_tag LOCUS_00850 24341 25840 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508949.1 protein_id gnl|my_center|LOCUS_00850 26829 25885 gene locus_tag LOCUS_00860 26829 25885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 27233 26826 gene locus_tag LOCUS_00870 27233 26826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 27760 27254 gene locus_tag LOCUS_00880 27760 27254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 28026 27757 gene locus_tag LOCUS_00890 28026 27757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 28055 29818 gene locus_tag LOCUS_00900 28055 29818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 29854 30792 gene locus_tag LOCUS_00910 29854 30792 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_00910 30813 31208 gene locus_tag LOCUS_00920 30813 31208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 31243 33786 gene locus_tag LOCUS_00930 31243 33786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 35886 33796 gene locus_tag LOCUS_00940 35886 33796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 38207 35883 gene locus_tag LOCUS_00950 38207 35883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 38984 38235 gene locus_tag LOCUS_00960 38984 38235 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228016.1 protein_id gnl|my_center|LOCUS_00960 39843 38986 gene locus_tag LOCUS_00970 39843 38986 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820295.1 protein_id gnl|my_center|LOCUS_00970 40658 39843 gene locus_tag LOCUS_00980 40658 39843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 41072 40659 gene locus_tag LOCUS_00990 41072 40659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 41795 41076 gene locus_tag LOCUS_01000 gene tolQ 41795 41076 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence004 850 2427 gene locus_tag LOCUS_01010 850 2427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 2462 7768 gene locus_tag LOCUS_01020 2462 7768 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_01020 8966 7842 gene locus_tag LOCUS_01030 8966 7842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 9096 9938 gene locus_tag LOCUS_01040 9096 9938 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_01040 10870 10058 gene locus_tag LOCUS_01050 10870 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 11789 10887 gene locus_tag LOCUS_01060 11789 10887 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808614.1 protein_id gnl|my_center|LOCUS_01060 12966 12739 gene locus_tag LOCUS_01070 gene infA 12966 12739 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939491.1 protein_id gnl|my_center|LOCUS_01070 14175 12982 gene locus_tag LOCUS_01080 gene tgt 14175 12982 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941835.1 protein_id gnl|my_center|LOCUS_01080 15641 14172 gene locus_tag LOCUS_01090 15641 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 16094 18784 gene locus_tag LOCUS_01100 gene clpB 16094 18784 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094682.1 protein_id gnl|my_center|LOCUS_01100 18958 20385 gene locus_tag LOCUS_01110 18958 20385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 21222 20377 gene locus_tag LOCUS_01120 21222 20377 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229653.1 protein_id gnl|my_center|LOCUS_01120 21304 22020 gene locus_tag LOCUS_01130 21304 22020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 22440 22673 gene locus_tag LOCUS_01140 22440 22673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 23539 22781 gene locus_tag LOCUS_01150 23539 22781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 23979 23725 gene locus_tag LOCUS_01160 23979 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 25358 23976 gene locus_tag LOCUS_01170 25358 23976 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120249.1 protein_id gnl|my_center|LOCUS_01170 25866 25390 gene locus_tag LOCUS_01180 25866 25390 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902983.1 protein_id gnl|my_center|LOCUS_01180 29300 25869 gene locus_tag LOCUS_01190 29300 25869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 29646 29326 gene locus_tag LOCUS_01200 29646 29326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 32715 29665 gene locus_tag LOCUS_01210 32715 29665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 32893 34164 gene locus_tag LOCUS_01220 32893 34164 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783728.1 protein_id gnl|my_center|LOCUS_01220 34481 35158 gene locus_tag LOCUS_01230 34481 35158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 35207 35563 gene locus_tag LOCUS_01240 35207 35563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 35666 36112 gene locus_tag LOCUS_01250 35666 36112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 36384 36133 gene locus_tag LOCUS_01260 36384 36133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 37882 36395 gene locus_tag LOCUS_01270 37882 36395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 39532 38132 gene locus_tag LOCUS_01280 39532 38132 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028809.1 protein_id gnl|my_center|LOCUS_01280 39677 40336 gene locus_tag LOCUS_01290 39677 40336 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230938.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence005 2727 865 gene locus_tag LOCUS_01300 gene mnmG 2727 865 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499797.1 protein_id gnl|my_center|LOCUS_01300 3239 2760 gene locus_tag LOCUS_01310 3239 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 3770 3285 gene locus_tag LOCUS_01320 3770 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 4107 4904 gene locus_tag LOCUS_01330 gene soj 4107 4904 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_01330 4901 5791 gene locus_tag LOCUS_01340 4901 5791 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229053.1 protein_id gnl|my_center|LOCUS_01340 5788 6393 gene locus_tag LOCUS_01350 gene udk 5788 6393 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403303.1 protein_id gnl|my_center|LOCUS_01350 6806 7315 gene locus_tag LOCUS_01360 6806 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 7651 7418 gene locus_tag LOCUS_01370 7651 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 8324 7722 gene locus_tag LOCUS_01380 8324 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 8375 9031 gene locus_tag LOCUS_01390 8375 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 9262 9729 gene locus_tag LOCUS_01400 9262 9729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 9872 10966 gene locus_tag LOCUS_01410 9872 10966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 11005 12390 gene locus_tag LOCUS_01420 11005 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 12437 13048 gene locus_tag LOCUS_01430 12437 13048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 13167 15377 gene locus_tag LOCUS_01440 13167 15377 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888489.1 protein_id gnl|my_center|LOCUS_01440 16078 15296 gene locus_tag LOCUS_01450 gene lgt 16078 15296 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_01450 16167 17855 gene locus_tag LOCUS_01460 16167 17855 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109795256.1 protein_id gnl|my_center|LOCUS_01460 19766 18096 gene locus_tag LOCUS_01470 gene ubiB 19766 18096 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_01470 20025 19870 gene locus_tag LOCUS_01480 20025 19870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 20156 21148 gene locus_tag LOCUS_01490 20156 21148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 21401 21850 gene locus_tag LOCUS_01500 21401 21850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 22040 22462 gene locus_tag LOCUS_01510 22040 22462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 22650 22468 gene locus_tag LOCUS_01520 22650 22468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 23338 22808 gene locus_tag LOCUS_01530 23338 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 25086 23347 gene locus_tag LOCUS_01540 25086 23347 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_01540 26004 25351 gene locus_tag LOCUS_01550 26004 25351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 26310 27650 gene locus_tag LOCUS_01560 26310 27650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 27779 28171 gene locus_tag LOCUS_01570 27779 28171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 28640 28326 gene locus_tag LOCUS_01580 28640 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 28722 29030 gene locus_tag LOCUS_01590 28722 29030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 29601 29140 gene locus_tag LOCUS_01600 29601 29140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 30734 29697 gene locus_tag LOCUS_01610 30734 29697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 32703 30838 gene locus_tag LOCUS_01620 32703 30838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 33058 32696 gene locus_tag LOCUS_01630 33058 32696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 33555 34082 gene locus_tag LOCUS_01640 33555 34082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 34445 34245 gene locus_tag LOCUS_01650 34445 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 34690 36069 gene locus_tag LOCUS_01660 34690 36069 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976750.1 protein_id gnl|my_center|LOCUS_01660 36124 37764 gene locus_tag LOCUS_01670 36124 37764 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804132.1 protein_id gnl|my_center|LOCUS_01670 37769 38365 gene locus_tag LOCUS_01680 37769 38365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 38551 39243 gene locus_tag LOCUS_01690 38551 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 >Feature sequence006 845 285 gene locus_tag LOCUS_01700 845 285 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096602.1 protein_id gnl|my_center|LOCUS_01700 1019 1312 gene locus_tag LOCUS_01710 1019 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01710 3556 1331 gene locus_tag LOCUS_01720 3556 1331 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706412.1 protein_id gnl|my_center|LOCUS_01720 4466 3666 gene locus_tag LOCUS_01730 4466 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4950 4597 gene locus_tag LOCUS_01740 4950 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4949 8542 gene locus_tag LOCUS_01750 4949 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 8552 9610 gene locus_tag LOCUS_01760 8552 9610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9607 10440 gene locus_tag LOCUS_01770 9607 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 11772 10510 gene locus_tag LOCUS_01780 11772 10510 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852462.1 protein_id gnl|my_center|LOCUS_01780 12085 13740 gene locus_tag LOCUS_01790 12085 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 13821 14759 gene locus_tag LOCUS_01800 13821 14759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 16809 14965 gene locus_tag LOCUS_01810 16809 14965 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_01810 17781 16825 gene locus_tag LOCUS_01820 gene lgt 17781 16825 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_01820 18483 17818 gene locus_tag LOCUS_01830 gene radC 18483 17818 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 protein_id gnl|my_center|LOCUS_01830 18676 18957 gene locus_tag LOCUS_01840 18676 18957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20087 18954 gene locus_tag LOCUS_01850 20087 18954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 20709 20092 gene locus_tag LOCUS_01860 20709 20092 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_01860 21228 20818 gene locus_tag LOCUS_01870 21228 20818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 22187 21189 gene locus_tag LOCUS_01880 22187 21189 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_01880 22241 23239 gene locus_tag LOCUS_01890 22241 23239 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_01890 23371 23628 gene locus_tag LOCUS_01900 23371 23628 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764038.1 protein_id gnl|my_center|LOCUS_01900 24429 23629 gene locus_tag LOCUS_01910 24429 23629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 27179 24501 gene locus_tag LOCUS_01920 27179 24501 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207265.1 protein_id gnl|my_center|LOCUS_01920 27414 28832 gene locus_tag LOCUS_01930 27414 28832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 29667 28855 gene locus_tag LOCUS_01940 29667 28855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 29784 30743 gene locus_tag LOCUS_01950 gene gldA 29784 30743 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_01950 30740 32590 gene locus_tag LOCUS_01960 gene selB 30740 32590 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393980.1 protein_id gnl|my_center|LOCUS_01960 33168 34790 gene locus_tag LOCUS_01970 33168 34790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 35195 35377 gene locus_tag LOCUS_01980 35195 35377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 35404 35916 gene locus_tag LOCUS_01990 35404 35916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 35965 36219 gene locus_tag LOCUS_02000 35965 36219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 36276 37262 gene locus_tag LOCUS_02010 36276 37262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 37536 37294 gene locus_tag LOCUS_02020 37536 37294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 <38605 37533 gene locus_tag LOCUS_02030 <38605 37533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141544.1:MFS transporter >Feature sequence007 1080 79 gene locus_tag LOCUS_02040 1080 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 1317 2213 gene locus_tag LOCUS_02050 1317 2213 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085244.1 protein_id gnl|my_center|LOCUS_02050 3662 2226 gene locus_tag LOCUS_02060 3662 2226 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477274.1 protein_id gnl|my_center|LOCUS_02060 3815 4996 gene locus_tag LOCUS_02070 3815 4996 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224733.1 protein_id gnl|my_center|LOCUS_02070 5249 6577 gene locus_tag LOCUS_02080 5249 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 6558 7775 gene locus_tag LOCUS_02090 6558 7775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7765 10884 gene locus_tag LOCUS_02100 7765 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 11172 10888 gene locus_tag LOCUS_02110 11172 10888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 11186 11782 gene locus_tag LOCUS_02120 11186 11782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 12166 11861 gene locus_tag LOCUS_02130 12166 11861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 12664 12176 gene locus_tag LOCUS_02140 12664 12176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 13123 12764 gene locus_tag LOCUS_02150 13123 12764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 13321 14892 gene locus_tag LOCUS_02160 13321 14892 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224392.1 protein_id gnl|my_center|LOCUS_02160 14904 16061 gene locus_tag LOCUS_02170 gene alr 14904 16061 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_02170 16681 16196 gene locus_tag LOCUS_02180 16681 16196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 16773 17876 gene locus_tag LOCUS_02190 16773 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 17894 19540 gene locus_tag LOCUS_02200 17894 19540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 19540 20805 gene locus_tag LOCUS_02210 19540 20805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 22171 20810 gene locus_tag LOCUS_02220 22171 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 24657 22171 gene locus_tag LOCUS_02230 24657 22171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 25728 24661 gene locus_tag LOCUS_02240 25728 24661 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651714.1 protein_id gnl|my_center|LOCUS_02240 25837 27240 gene locus_tag LOCUS_02250 25837 27240 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921988.1 protein_id gnl|my_center|LOCUS_02250 28908 27301 gene locus_tag LOCUS_02260 28908 27301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 29794 28916 gene locus_tag LOCUS_02270 29794 28916 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940902.1 protein_id gnl|my_center|LOCUS_02270 29942 31513 gene locus_tag LOCUS_02280 29942 31513 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948862.1 protein_id gnl|my_center|LOCUS_02280 31888 32376 gene locus_tag LOCUS_02290 31888 32376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 32398 32652 gene locus_tag LOCUS_02300 32398 32652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 32789 33346 gene locus_tag LOCUS_02310 gene sufT 32789 33346 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_02310 33403 34122 gene locus_tag LOCUS_02320 33403 34122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 34807 34127 gene locus_tag LOCUS_02330 34807 34127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 38115 34873 gene locus_tag LOCUS_02340 38115 34873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence008 2583 1777 gene locus_tag LOCUS_02350 2583 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3468 2677 gene locus_tag LOCUS_02360 3468 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 4206 3985 gene locus_tag LOCUS_02370 4206 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7406 4710 gene locus_tag LOCUS_02380 7406 4710 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120545.1 protein_id gnl|my_center|LOCUS_02380 7956 7456 gene locus_tag LOCUS_02390 7956 7456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8069 9505 gene locus_tag LOCUS_02400 8069 9505 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931874.1 protein_id gnl|my_center|LOCUS_02400 10807 9581 gene locus_tag LOCUS_02410 10807 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 11593 12477 gene locus_tag LOCUS_02420 11593 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 12477 14129 gene locus_tag LOCUS_02430 12477 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 14126 14710 gene locus_tag LOCUS_02440 gene hisB 14126 14710 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837141.1 protein_id gnl|my_center|LOCUS_02440 14710 16080 gene locus_tag LOCUS_02450 14710 16080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 16077 17336 gene locus_tag LOCUS_02460 16077 17336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 17330 18583 gene locus_tag LOCUS_02470 gene hisD 17330 18583 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228145.1 protein_id gnl|my_center|LOCUS_02470 19048 18683 gene locus_tag LOCUS_02480 19048 18683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19196 21241 gene locus_tag LOCUS_02490 19196 21241 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_02490 22239 23000 gene locus_tag LOCUS_02500 22239 23000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 23447 23154 gene locus_tag LOCUS_02510 23447 23154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 24504 24103 gene locus_tag LOCUS_02520 24504 24103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 26095 24659 gene locus_tag LOCUS_02530 26095 24659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 27144 26092 gene locus_tag LOCUS_02540 27144 26092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 27870 27349 gene locus_tag LOCUS_02550 27870 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 29241 27973 gene locus_tag LOCUS_02560 29241 27973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02560 29677 29219 gene locus_tag LOCUS_02570 29677 29219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 30675 29833 gene locus_tag LOCUS_02580 30675 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 30632 30832 gene locus_tag LOCUS_02590 30632 30832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 33477 32221 gene locus_tag LOCUS_02600 33477 32221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 34020 34382 gene locus_tag LOCUS_02610 34020 34382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 35871 35011 gene locus_tag LOCUS_02620 35871 35011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 36608 37300 gene locus_tag LOCUS_02630 36608 37300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence009 2024 1413 gene locus_tag LOCUS_02640 2024 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2101 3093 gene locus_tag LOCUS_02650 2101 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3090 5360 gene locus_tag LOCUS_02660 gene pcrA 3090 5360 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_02660 5453 6400 gene locus_tag LOCUS_02670 5453 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6428 8320 gene locus_tag LOCUS_02680 6428 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 8788 9270 gene locus_tag LOCUS_02690 8788 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 9284 9577 gene locus_tag LOCUS_02700 9284 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10582 9653 gene locus_tag LOCUS_02710 10582 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 12558 10627 gene locus_tag LOCUS_02720 12558 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 12914 12555 gene locus_tag LOCUS_02730 12914 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 13549 12923 gene locus_tag LOCUS_02740 13549 12923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 13955 14392 gene locus_tag LOCUS_02750 13955 14392 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335817.1 protein_id gnl|my_center|LOCUS_02750 14393 14671 gene locus_tag LOCUS_02760 14393 14671 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_02760 14671 15024 gene locus_tag LOCUS_02770 14671 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 15014 15580 gene locus_tag LOCUS_02780 15014 15580 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389328.1 protein_id gnl|my_center|LOCUS_02780 15577 16008 gene locus_tag LOCUS_02790 15577 16008 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328225.1 protein_id gnl|my_center|LOCUS_02790 16005 16373 gene locus_tag LOCUS_02800 16005 16373 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_02800 16370 17839 gene locus_tag LOCUS_02810 16370 17839 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_02810 17836 19308 gene locus_tag LOCUS_02820 17836 19308 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921413.1 protein_id gnl|my_center|LOCUS_02820 19305 19625 gene locus_tag LOCUS_02830 19305 19625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 19618 21321 gene locus_tag LOCUS_02840 19618 21321 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118364.1 protein_id gnl|my_center|LOCUS_02840 22213 21350 gene locus_tag LOCUS_02850 gene tesB 22213 21350 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367933.1 protein_id gnl|my_center|LOCUS_02850 22676 22362 gene locus_tag LOCUS_02860 22676 22362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 23487 22717 gene locus_tag LOCUS_02870 23487 22717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 23861 23484 gene locus_tag LOCUS_02880 23861 23484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 24096 23848 gene locus_tag LOCUS_02890 24096 23848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 25477 24200 gene locus_tag LOCUS_02900 gene hemL 25477 24200 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814987.1 protein_id gnl|my_center|LOCUS_02900 26507 25695 gene locus_tag LOCUS_02910 26507 25695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 29175 26539 gene locus_tag LOCUS_02920 gene gyrA 29175 26539 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_02920 31669 29231 gene locus_tag LOCUS_02930 gene gyrB 31669 29231 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_02930 32983 31880 gene locus_tag LOCUS_02940 gene recF 32983 31880 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940680.1 protein_id gnl|my_center|LOCUS_02940 34111 32996 gene locus_tag LOCUS_02950 gene dnaN 34111 32996 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_02950 35730 34408 gene locus_tag LOCUS_02960 gene dnaA 35730 34408 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582428.1 protein_id gnl|my_center|LOCUS_02960 35994 36200 gene locus_tag LOCUS_02970 35994 36200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 36244 36591 gene locus_tag LOCUS_02980 gene rnpA 36244 36591 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_02980 36588 36842 gene locus_tag LOCUS_02990 gene yidD 36588 36842 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002457867.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence010 2707 290 gene locus_tag LOCUS_03000 2707 290 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615777.1 protein_id gnl|my_center|LOCUS_03000 2739 3932 gene locus_tag LOCUS_03010 2739 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3929 5047 gene locus_tag LOCUS_03020 3929 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 7017 5044 gene locus_tag LOCUS_03030 7017 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 7935 7105 gene locus_tag LOCUS_03040 7935 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 8741 7932 gene locus_tag LOCUS_03050 8741 7932 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246573.1 protein_id gnl|my_center|LOCUS_03050 8930 9199 gene locus_tag LOCUS_03060 8930 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 9239 9898 gene locus_tag LOCUS_03070 9239 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 10193 9822 gene locus_tag LOCUS_03080 10193 9822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 10747 10304 gene locus_tag LOCUS_03090 10747 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 11237 10800 gene locus_tag LOCUS_03100 11237 10800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 12181 11234 gene locus_tag LOCUS_03110 12181 11234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 12137 12877 gene locus_tag LOCUS_03120 12137 12877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 12927 13568 gene locus_tag LOCUS_03130 12927 13568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 13698 14129 gene locus_tag LOCUS_03140 13698 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 14141 14899 gene locus_tag LOCUS_03150 14141 14899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 14886 15431 gene locus_tag LOCUS_03160 gene atpH 14886 15431 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964546.1 protein_id gnl|my_center|LOCUS_03160 15515 17041 gene locus_tag LOCUS_03170 gene atpA 15515 17041 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_03170 17153 18007 gene locus_tag LOCUS_03180 gene atpG 17153 18007 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_03180 18029 19468 gene locus_tag LOCUS_03190 gene atpD 18029 19468 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067133.1 protein_id gnl|my_center|LOCUS_03190 19513 19908 gene locus_tag LOCUS_03200 19513 19908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 20173 21003 gene locus_tag LOCUS_03210 20173 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 23028 21349 gene locus_tag LOCUS_03220 23028 21349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 24326 23031 gene locus_tag LOCUS_03230 24326 23031 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124063.1 protein_id gnl|my_center|LOCUS_03230 26130 24379 gene locus_tag LOCUS_03240 26130 24379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 27533 26127 gene locus_tag LOCUS_03250 27533 26127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 28460 27609 gene locus_tag LOCUS_03260 28460 27609 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898851.1 protein_id gnl|my_center|LOCUS_03260 29855 28536 gene locus_tag LOCUS_03270 29855 28536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 29915 30580 gene locus_tag LOCUS_03280 gene bioD 29915 30580 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763772.1 protein_id gnl|my_center|LOCUS_03280 30657 32510 gene locus_tag LOCUS_03290 30657 32510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 32997 32635 gene locus_tag LOCUS_03300 32997 32635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 32975 33844 gene locus_tag LOCUS_03310 32975 33844 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918807.1 protein_id gnl|my_center|LOCUS_03310 34538 33942 gene locus_tag LOCUS_03320 34538 33942 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191635.1 protein_id gnl|my_center|LOCUS_03320 35174 34575 gene locus_tag LOCUS_03330 35174 34575 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence011 2579 411 gene locus_tag LOCUS_03340 2579 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2560 2748 gene locus_tag LOCUS_03350 2560 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 3539 2745 gene locus_tag LOCUS_03360 gene pcaD 3539 2745 CDS product 3-oxoadipate enol-lactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727990.1 protein_id gnl|my_center|LOCUS_03360 3943 3563 gene locus_tag LOCUS_03370 3943 3563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 6294 4042 gene locus_tag LOCUS_03380 6294 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 6612 7226 gene locus_tag LOCUS_03390 6612 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 8657 7236 gene locus_tag LOCUS_03400 gene pntB 8657 7236 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_03400 10209 8662 gene locus_tag LOCUS_03410 gene pntA 10209 8662 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_03410 10714 10280 gene locus_tag LOCUS_03420 10714 10280 CDS product DUF2203 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222744.1 protein_id gnl|my_center|LOCUS_03420 10885 11901 gene locus_tag LOCUS_03430 gene proB 10885 11901 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028438.1 protein_id gnl|my_center|LOCUS_03430 11898 13178 gene locus_tag LOCUS_03440 11898 13178 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_03440 13289 14509 gene locus_tag LOCUS_03450 13289 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 15738 14620 gene locus_tag LOCUS_03460 15738 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 16654 15872 gene locus_tag LOCUS_03470 16654 15872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 16898 17818 gene locus_tag LOCUS_03480 16898 17818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 17833 19164 gene locus_tag LOCUS_03490 gene allB 17833 19164 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223822.1 protein_id gnl|my_center|LOCUS_03490 19176 20672 gene locus_tag LOCUS_03500 19176 20672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 20669 21007 gene locus_tag LOCUS_03510 gene hiuH 20669 21007 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920127.1 protein_id gnl|my_center|LOCUS_03510 21009 22340 gene locus_tag LOCUS_03520 21009 22340 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027563.1 protein_id gnl|my_center|LOCUS_03520 22340 22948 gene locus_tag LOCUS_03530 22340 22948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03530 22952 23527 gene locus_tag LOCUS_03540 22952 23527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 24119 24742 gene locus_tag LOCUS_03550 24119 24742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 25814 24747 gene locus_tag LOCUS_03560 25814 24747 CDS product alkane 1-monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027223809.1 protein_id gnl|my_center|LOCUS_03560 26425 25811 gene locus_tag LOCUS_03570 26425 25811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 26658 26843 gene locus_tag LOCUS_03580 26658 26843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 26937 28661 gene locus_tag LOCUS_03590 26937 28661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 28658 29167 gene locus_tag LOCUS_03600 28658 29167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 >Feature sequence012 837 634 gene locus_tag LOCUS_03610 837 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 2490 991 gene locus_tag LOCUS_03620 2490 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2708 4330 gene locus_tag LOCUS_03630 2708 4330 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888533.1 protein_id gnl|my_center|LOCUS_03630 4771 4472 gene locus_tag LOCUS_03640 4771 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 4868 5716 gene locus_tag LOCUS_03650 4868 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 6477 5743 gene locus_tag LOCUS_03660 6477 5743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 6575 8065 gene locus_tag LOCUS_03670 6575 8065 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480009.1 protein_id gnl|my_center|LOCUS_03670 8149 9420 gene locus_tag LOCUS_03680 8149 9420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 10317 9421 gene locus_tag LOCUS_03690 10317 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 12320 10299 gene locus_tag LOCUS_03700 gene uvrB 12320 10299 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_03700 14219 12474 gene locus_tag LOCUS_03710 14219 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 17193 14356 gene locus_tag LOCUS_03720 17193 14356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 17297 19126 gene locus_tag LOCUS_03730 gene uvrC 17297 19126 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_03730 19977 19138 gene locus_tag LOCUS_03740 19977 19138 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_03740 22528 19982 gene locus_tag LOCUS_03750 22528 19982 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272585.1 protein_id gnl|my_center|LOCUS_03750 22778 24454 gene locus_tag LOCUS_03760 22778 24454 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680776.1 protein_id gnl|my_center|LOCUS_03760 24493 26763 gene locus_tag LOCUS_03770 24493 26763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 26766 26996 gene locus_tag LOCUS_03780 26766 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 27045 28370 gene locus_tag LOCUS_03790 27045 28370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence013 607 1506 gene locus_tag LOCUS_03800 607 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3280 1487 gene locus_tag LOCUS_03810 3280 1487 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120741.1 protein_id gnl|my_center|LOCUS_03810 4010 3321 gene locus_tag LOCUS_03820 4010 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4820 4071 gene locus_tag LOCUS_03830 4820 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 5896 4817 gene locus_tag LOCUS_03840 5896 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 6999 5941 gene locus_tag LOCUS_03850 6999 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 8912 6996 gene locus_tag LOCUS_03860 8912 6996 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_03860 11141 8919 gene locus_tag LOCUS_03870 11141 8919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 12838 11141 gene locus_tag LOCUS_03880 12838 11141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 14424 12865 gene locus_tag LOCUS_03890 14424 12865 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020918.1 protein_id gnl|my_center|LOCUS_03890 18044 14424 gene locus_tag LOCUS_03900 18044 14424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 18152 19615 gene locus_tag LOCUS_03910 18152 19615 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970025.1 protein_id gnl|my_center|LOCUS_03910 19631 20428 gene locus_tag LOCUS_03920 19631 20428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 20425 21138 gene locus_tag LOCUS_03930 20425 21138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21353 21120 gene locus_tag LOCUS_03940 21353 21120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 21609 22760 gene locus_tag LOCUS_03950 gene rnd 21609 22760 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895548.1 protein_id gnl|my_center|LOCUS_03950 22955 23110 gene locus_tag LOCUS_03960 22955 23110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 23338 24192 gene locus_tag LOCUS_03970 gene cpaB 23338 24192 CDS product Flp pilus assembly protein CpaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523372.1 protein_id gnl|my_center|LOCUS_03970 24259 25656 gene locus_tag LOCUS_03980 24259 25656 CDS product type II and III secretion system protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939396.1 protein_id gnl|my_center|LOCUS_03980 25669 26877 gene locus_tag LOCUS_03990 25669 26877 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939398.1 protein_id gnl|my_center|LOCUS_03990 >Feature sequence014 22 459 gene locus_tag LOCUS_04000 gene ruvX 22 459 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428279.1 protein_id gnl|my_center|LOCUS_04000 459 1181 gene locus_tag LOCUS_04010 459 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 1178 2083 gene locus_tag LOCUS_04020 1178 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 2080 3006 gene locus_tag LOCUS_04030 2080 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 4496 3003 gene locus_tag LOCUS_04040 4496 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 5530 4778 gene locus_tag LOCUS_04050 5530 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5638 6795 gene locus_tag LOCUS_04060 5638 6795 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_04060 8884 6785 gene locus_tag LOCUS_04070 8884 6785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 8904 10238 gene locus_tag LOCUS_04080 gene selA 8904 10238 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 protein_id gnl|my_center|LOCUS_04080 10235 11176 gene locus_tag LOCUS_04090 10235 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11176 12153 gene locus_tag LOCUS_04100 11176 12153 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140077.1 protein_id gnl|my_center|LOCUS_04100 13129 12161 gene locus_tag LOCUS_04110 13129 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 14257 13277 gene locus_tag LOCUS_04120 14257 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 14669 14397 gene locus_tag LOCUS_04130 14669 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 14709 15644 gene locus_tag LOCUS_04140 14709 15644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 16713 15646 gene locus_tag LOCUS_04150 16713 15646 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838120.1 protein_id gnl|my_center|LOCUS_04150 16758 17420 gene locus_tag LOCUS_04160 16758 17420 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000194184.1 protein_id gnl|my_center|LOCUS_04160 17450 18886 gene locus_tag LOCUS_04170 17450 18886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 18883 20535 gene locus_tag LOCUS_04180 18883 20535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 21623 20532 gene locus_tag LOCUS_04190 21623 20532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 22449 21784 gene locus_tag LOCUS_04200 22449 21784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 23779 22496 gene locus_tag LOCUS_04210 23779 22496 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083037.1 protein_id gnl|my_center|LOCUS_04210 25179 23782 gene locus_tag LOCUS_04220 25179 23782 CDS product 3-oxoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207046.1 protein_id gnl|my_center|LOCUS_04220 26068 25172 gene locus_tag LOCUS_04230 26068 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 <27137 26068 gene locus_tag LOCUS_04240 <27137 26068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000587238.1:acyl-CoA dehydrogenase family protein >Feature sequence015 1714 2538 gene locus_tag LOCUS_04250 1714 2538 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526405.1 protein_id gnl|my_center|LOCUS_04250 2540 3178 gene locus_tag LOCUS_04260 2540 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 3168 4316 gene locus_tag LOCUS_04270 3168 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470532.1 protein_id gnl|my_center|LOCUS_04270 4485 4556 gene locus_tag LOCUS_t00020 4485 4556 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4599 5561 gene locus_tag LOCUS_04280 4599 5561 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_04280 5773 6390 gene locus_tag LOCUS_04290 5773 6390 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941323.1 protein_id gnl|my_center|LOCUS_04290 6393 7016 gene locus_tag LOCUS_04300 gene pth 6393 7016 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892068.1 protein_id gnl|my_center|LOCUS_04300 7036 9150 gene locus_tag LOCUS_04310 7036 9150 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_04310 9169 9666 gene locus_tag LOCUS_04320 9169 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 9678 10121 gene locus_tag LOCUS_04330 gene rplI 9678 10121 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_04330 10184 11521 gene locus_tag LOCUS_04340 gene dnaB 10184 11521 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_04340 11673 12719 gene locus_tag LOCUS_04350 11673 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 13056 13658 gene locus_tag LOCUS_04360 13056 13658 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 protein_id gnl|my_center|LOCUS_04360 14392 13655 gene locus_tag LOCUS_04370 14392 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 14570 16204 gene locus_tag LOCUS_04380 14570 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 16229 17074 gene locus_tag LOCUS_04390 16229 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 17135 18673 gene locus_tag LOCUS_04400 gene guaA 17135 18673 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_04400 18789 19076 gene locus_tag LOCUS_04410 18789 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 19131 19736 gene locus_tag LOCUS_04420 19131 19736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 20487 19708 gene locus_tag LOCUS_04430 20487 19708 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224130.1 protein_id gnl|my_center|LOCUS_04430 21293 20484 gene locus_tag LOCUS_04440 21293 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 22095 21301 gene locus_tag LOCUS_04450 22095 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 22942 22250 gene locus_tag LOCUS_04460 22942 22250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 23133 25982 gene locus_tag LOCUS_04470 23133 25982 CDS product DNA topoisomerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929817.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence016 156 2780 gene locus_tag LOCUS_04480 156 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3211 2909 gene locus_tag LOCUS_04490 3211 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3119 3826 gene locus_tag LOCUS_04500 3119 3826 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970465.1 protein_id gnl|my_center|LOCUS_04500 3807 4388 gene locus_tag LOCUS_04510 3807 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970466.1 protein_id gnl|my_center|LOCUS_04510 4418 4750 gene locus_tag LOCUS_04520 4418 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 4838 6970 gene locus_tag LOCUS_04530 4838 6970 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923343.1 protein_id gnl|my_center|LOCUS_04530 7903 7058 gene locus_tag LOCUS_04540 7903 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7998 8909 gene locus_tag LOCUS_04550 7998 8909 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241247.1 protein_id gnl|my_center|LOCUS_04550 10140 9223 gene locus_tag LOCUS_04560 10140 9223 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338795.1 protein_id gnl|my_center|LOCUS_04560 10332 11054 gene locus_tag LOCUS_04570 10332 11054 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931055.1 protein_id gnl|my_center|LOCUS_04570 11598 11182 gene locus_tag LOCUS_04580 11598 11182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 12276 11614 gene locus_tag LOCUS_04590 12276 11614 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921310.1 protein_id gnl|my_center|LOCUS_04590 12391 14631 gene locus_tag LOCUS_04600 12391 14631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 14631 15935 gene locus_tag LOCUS_04610 14631 15935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 15953 16885 gene locus_tag LOCUS_04620 15953 16885 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535091.1 protein_id gnl|my_center|LOCUS_04620 16990 17460 gene locus_tag LOCUS_04630 16990 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 18121 17525 gene locus_tag LOCUS_04640 gene cynT 18121 17525 CDS product carbonic anhydrase CynT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107081.1 protein_id gnl|my_center|LOCUS_04640 19062 18205 gene locus_tag LOCUS_04650 gene nhaR 19062 18205 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_04650 19265 20434 gene locus_tag LOCUS_04660 19265 20434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 20441 21223 gene locus_tag LOCUS_04670 20441 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 21743 21285 gene locus_tag LOCUS_04680 21743 21285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 22224 21736 gene locus_tag LOCUS_04690 22224 21736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 22562 22807 gene locus_tag LOCUS_04700 22562 22807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 23604 22804 gene locus_tag LOCUS_04710 23604 22804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 23707 24660 gene locus_tag LOCUS_04720 23707 24660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 24825 25397 gene locus_tag LOCUS_04730 24825 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 25394 26464 gene locus_tag LOCUS_04740 25394 26464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence017 516 2993 gene locus_tag LOCUS_04750 516 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 3004 4167 gene locus_tag LOCUS_04760 3004 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 4172 4999 gene locus_tag LOCUS_04770 4172 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 5498 5725 gene locus_tag LOCUS_04780 5498 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5743 6060 gene locus_tag LOCUS_04790 5743 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 6369 6512 gene locus_tag LOCUS_04800 6369 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 6545 6667 gene locus_tag LOCUS_04810 6545 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 7344 6691 gene locus_tag LOCUS_04820 7344 6691 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080696.1 protein_id gnl|my_center|LOCUS_04820 8195 7335 gene locus_tag LOCUS_04830 8195 7335 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_04830 8511 10334 gene locus_tag LOCUS_04840 8511 10334 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267570.1 protein_id gnl|my_center|LOCUS_04840 10374 10847 gene locus_tag LOCUS_04850 10374 10847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 10966 11430 gene locus_tag LOCUS_04860 10966 11430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 11427 12014 gene locus_tag LOCUS_04870 11427 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 12034 12492 gene locus_tag LOCUS_04880 12034 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 14093 12531 gene locus_tag LOCUS_04890 14093 12531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 16023 14146 gene locus_tag LOCUS_04900 16023 14146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 16775 16122 gene locus_tag LOCUS_04910 gene rpe 16775 16122 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_04910 17683 16763 gene locus_tag LOCUS_04920 gene fmt 17683 16763 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338559.1 protein_id gnl|my_center|LOCUS_04920 18310 17717 gene locus_tag LOCUS_04930 18310 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 18831 18307 gene locus_tag LOCUS_04940 gene def 18831 18307 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391097.1 protein_id gnl|my_center|LOCUS_04940 18917 19633 gene locus_tag LOCUS_04950 18917 19633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 19630 21138 gene locus_tag LOCUS_04960 19630 21138 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_04960 21334 23607 gene locus_tag LOCUS_04970 21334 23607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 23702 24187 gene locus_tag LOCUS_04980 23702 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 24338 24556 gene locus_tag LOCUS_04990 24338 24556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 24595 25059 gene locus_tag LOCUS_05000 24595 25059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 25750 25109 gene locus_tag LOCUS_05010 25750 25109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence018 1 2034 gene locus_tag LOCUS_05020 1 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 3340 2117 gene locus_tag LOCUS_05030 3340 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3613 3816 gene locus_tag LOCUS_05040 3613 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 4198 4419 gene locus_tag LOCUS_05050 4198 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 5641 4616 gene locus_tag LOCUS_05060 gene rfbB 5641 4616 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679073.1 protein_id gnl|my_center|LOCUS_05060 6528 5638 gene locus_tag LOCUS_05070 gene rfbD 6528 5638 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_05070 7070 6525 gene locus_tag LOCUS_05080 gene rfbC 7070 6525 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_05080 7942 7067 gene locus_tag LOCUS_05090 gene rfbA 7942 7067 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_077983464.1 protein_id gnl|my_center|LOCUS_05090 9966 7939 gene locus_tag LOCUS_05100 9966 7939 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226120.1 protein_id gnl|my_center|LOCUS_05100 13279 10043 gene locus_tag LOCUS_05110 13279 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 13458 14447 gene locus_tag LOCUS_05120 13458 14447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 14806 14552 gene locus_tag LOCUS_05130 14806 14552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 15898 14909 gene locus_tag LOCUS_05140 15898 14909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 16079 17734 gene locus_tag LOCUS_05150 gene recN 16079 17734 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_05150 18389 17823 gene locus_tag LOCUS_05160 18389 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 20030 18585 gene locus_tag LOCUS_05170 20030 18585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 21809 20052 gene locus_tag LOCUS_05180 21809 20052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 22993 21806 gene locus_tag LOCUS_05190 22993 21806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 22883 23086 gene locus_tag LOCUS_05200 22883 23086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 24860 23139 gene locus_tag LOCUS_05210 24860 23139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence019 1313 1077 gene locus_tag LOCUS_05220 1313 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1303 1722 gene locus_tag LOCUS_05230 1303 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 2210 1719 gene locus_tag LOCUS_05240 2210 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3270 2305 gene locus_tag LOCUS_05250 3270 2305 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405050.1 protein_id gnl|my_center|LOCUS_05250 3571 4224 gene locus_tag LOCUS_05260 3571 4224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4358 5125 gene locus_tag LOCUS_05270 4358 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 7489 5129 gene locus_tag LOCUS_05280 7489 5129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 8156 7524 gene locus_tag LOCUS_05290 8156 7524 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_05290 8320 8156 gene locus_tag LOCUS_05300 8320 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 8378 9256 gene locus_tag LOCUS_05310 8378 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 9320 10150 gene locus_tag LOCUS_05320 9320 10150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841164.1 protein_id gnl|my_center|LOCUS_05320 11711 10248 gene locus_tag LOCUS_05330 11711 10248 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038655.1 protein_id gnl|my_center|LOCUS_05330 13013 11748 gene locus_tag LOCUS_05340 13013 11748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 13127 13897 gene locus_tag LOCUS_05350 13127 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974768.1 protein_id gnl|my_center|LOCUS_05350 14023 14793 gene locus_tag LOCUS_05360 14023 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 17532 14902 gene locus_tag LOCUS_05370 17532 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 18217 17570 gene locus_tag LOCUS_05380 18217 17570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 18203 18658 gene locus_tag LOCUS_05390 18203 18658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 18630 18932 gene locus_tag LOCUS_05400 18630 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 19478 21034 gene locus_tag LOCUS_05410 19478 21034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 21110 22957 gene locus_tag LOCUS_05420 21110 22957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 22965 24278 gene locus_tag LOCUS_05430 22965 24278 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331975.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence020 883 659 gene locus_tag LOCUS_05440 883 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1842 1006 gene locus_tag LOCUS_05450 1842 1006 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071980.1 protein_id gnl|my_center|LOCUS_05450 3574 1940 gene locus_tag LOCUS_05460 3574 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 3636 4208 gene locus_tag LOCUS_05470 3636 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5315 4272 gene locus_tag LOCUS_05480 5315 4272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 5792 6763 gene locus_tag LOCUS_05490 5792 6763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6915 8846 gene locus_tag LOCUS_05500 6915 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 9908 8874 gene locus_tag LOCUS_05510 9908 8874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 9999 12665 gene locus_tag LOCUS_05520 9999 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 13618 12752 gene locus_tag LOCUS_05530 13618 12752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 13734 15356 gene locus_tag LOCUS_05540 13734 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 15353 16699 gene locus_tag LOCUS_05550 15353 16699 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224193226.1 protein_id gnl|my_center|LOCUS_05550 16882 18915 gene locus_tag LOCUS_05560 16882 18915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 19073 19885 gene locus_tag LOCUS_05570 19073 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 20795 22060 gene locus_tag LOCUS_05580 20795 22060 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_05580 22057 22836 gene locus_tag LOCUS_05590 22057 22836 CDS product DUF1365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388482.1 protein_id gnl|my_center|LOCUS_05590 22840 24033 gene locus_tag LOCUS_05600 22840 24033 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337264.1 protein_id gnl|my_center|LOCUS_05600 24030 25100 gene locus_tag LOCUS_05610 24030 25100 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036518.1 protein_id gnl|my_center|LOCUS_05610 >Feature sequence021 1484 510 gene locus_tag LOCUS_05620 1484 510 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_05620 1654 1869 gene locus_tag LOCUS_05630 1654 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 1956 4892 gene locus_tag LOCUS_05640 1956 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 4889 5428 gene locus_tag LOCUS_05650 4889 5428 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108825999.1 protein_id gnl|my_center|LOCUS_05650 6194 5418 gene locus_tag LOCUS_05660 6194 5418 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_05660 6634 6191 gene locus_tag LOCUS_05670 gene dtd 6634 6191 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_05670 8324 6639 gene locus_tag LOCUS_05680 8324 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 8753 8493 gene locus_tag LOCUS_05690 8753 8493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 8991 9137 gene locus_tag LOCUS_05700 8991 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 9596 9237 gene locus_tag LOCUS_05710 9596 9237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9735 11840 gene locus_tag LOCUS_05720 9735 11840 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066909.1 protein_id gnl|my_center|LOCUS_05720 11844 12842 gene locus_tag LOCUS_05730 11844 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 15275 12843 gene locus_tag LOCUS_05740 15275 12843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 15652 15290 gene locus_tag LOCUS_05750 gene dksA 15652 15290 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_05750 15766 16689 gene locus_tag LOCUS_05760 15766 16689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 17522 16701 gene locus_tag LOCUS_05770 17522 16701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17576 18124 gene locus_tag LOCUS_05780 17576 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 18127 18309 gene locus_tag LOCUS_05790 18127 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 18343 19377 gene locus_tag LOCUS_05800 18343 19377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 20185 19394 gene locus_tag LOCUS_05810 20185 19394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 <24864 20468 gene locus_tag LOCUS_05820 <24864 20468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479069.1:multidrug efflux RND transporter permease subunit VmeK >Feature sequence022 873 1955 gene locus_tag LOCUS_05830 873 1955 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228210.1 protein_id gnl|my_center|LOCUS_05830 3653 2094 gene locus_tag LOCUS_05840 3653 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 4386 3826 gene locus_tag LOCUS_05850 4386 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 5114 5683 gene locus_tag LOCUS_05860 5114 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 6702 5680 gene locus_tag LOCUS_05870 6702 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 7026 8630 gene locus_tag LOCUS_05880 7026 8630 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_05880 11009 8640 gene locus_tag LOCUS_05890 11009 8640 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542519.1 protein_id gnl|my_center|LOCUS_05890 12268 11009 gene locus_tag LOCUS_05900 12268 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 13095 12268 gene locus_tag LOCUS_05910 13095 12268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13531 13127 gene locus_tag LOCUS_05920 13531 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 13642 14502 gene locus_tag LOCUS_05930 13642 14502 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945810.1 protein_id gnl|my_center|LOCUS_05930 14520 14906 gene locus_tag LOCUS_05940 14520 14906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 14941 15486 gene locus_tag LOCUS_05950 14941 15486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 16058 15483 gene locus_tag LOCUS_05960 16058 15483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 16523 17611 gene locus_tag LOCUS_05970 gene aroC 16523 17611 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_05970 18917 17625 gene locus_tag LOCUS_05980 18917 17625 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_05980 19887 18991 gene locus_tag LOCUS_05990 gene add 19887 18991 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259176.1 protein_id gnl|my_center|LOCUS_05990 20964 19903 gene locus_tag LOCUS_06000 20964 19903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 21050 23182 gene locus_tag LOCUS_06010 21050 23182 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922751.1 protein_id gnl|my_center|LOCUS_06010 23179 23478 gene locus_tag LOCUS_06020 23179 23478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 >Feature sequence023 <1 1249 gene locus_tag LOCUS_06030 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640527.1:pitrilysin family protein 1265 2182 gene locus_tag LOCUS_06040 1265 2182 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791450.1 protein_id gnl|my_center|LOCUS_06040 2261 3292 gene locus_tag LOCUS_06050 2261 3292 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_06050 3380 5059 gene locus_tag LOCUS_06060 3380 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 5091 6398 gene locus_tag LOCUS_06070 5091 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 6553 8469 gene locus_tag LOCUS_06080 6553 8469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 8469 9239 gene locus_tag LOCUS_06090 gene xth 8469 9239 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_06090 9239 10039 gene locus_tag LOCUS_06100 9239 10039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 11333 10014 gene locus_tag LOCUS_06110 11333 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 11971 11333 gene locus_tag LOCUS_06120 11971 11333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 13184 12075 gene locus_tag LOCUS_06130 13184 12075 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_06130 13238 14620 gene locus_tag LOCUS_06140 13238 14620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 14875 17418 gene locus_tag LOCUS_06150 14875 17418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 17428 18897 gene locus_tag LOCUS_06160 17428 18897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 19901 18906 gene locus_tag LOCUS_06170 19901 18906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 20872 19898 gene locus_tag LOCUS_06180 20872 19898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 20964 22406 gene locus_tag LOCUS_06190 20964 22406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 22532 24187 gene locus_tag LOCUS_06200 22532 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 24433 24200 gene locus_tag LOCUS_06210 24433 24200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 >Feature sequence024 1209 466 gene locus_tag LOCUS_06220 1209 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1850 1257 gene locus_tag LOCUS_06230 1850 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2019 3008 gene locus_tag LOCUS_06240 2019 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 4138 4983 gene locus_tag LOCUS_06250 4138 4983 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246382.1 protein_id gnl|my_center|LOCUS_06250 6103 5105 gene locus_tag LOCUS_06260 gene eutC 6103 5105 CDS product ectoine utilization protein EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975301.1 protein_id gnl|my_center|LOCUS_06260 6775 6563 gene locus_tag LOCUS_06270 6775 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 6918 8393 gene locus_tag LOCUS_06280 6918 8393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 8593 9093 gene locus_tag LOCUS_06290 8593 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 9074 10069 gene locus_tag LOCUS_06300 9074 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10078 10233 gene locus_tag LOCUS_06310 10078 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 10597 11457 gene locus_tag LOCUS_06320 10597 11457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 12315 13448 gene locus_tag LOCUS_06330 12315 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 13927 13418 gene locus_tag LOCUS_06340 13927 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 14649 14017 gene locus_tag LOCUS_06350 14649 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 16277 15273 gene locus_tag LOCUS_06360 16277 15273 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063171654.1 protein_id gnl|my_center|LOCUS_06360 17408 17863 gene locus_tag LOCUS_06370 17408 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 19802 18036 gene locus_tag LOCUS_06380 19802 18036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 21354 20710 gene locus_tag LOCUS_06390 21354 20710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 21613 22140 gene locus_tag LOCUS_06400 21613 22140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 23317 22244 gene locus_tag LOCUS_06410 23317 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 24035 23511 gene locus_tag LOCUS_06420 24035 23511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 24135 24467 gene locus_tag LOCUS_06430 24135 24467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence025 2089 1181 gene locus_tag LOCUS_06440 2089 1181 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001132585.1 protein_id gnl|my_center|LOCUS_06440 3744 2086 gene locus_tag LOCUS_06450 3744 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 5408 3741 gene locus_tag LOCUS_06460 5408 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5470 5988 gene locus_tag LOCUS_06470 5470 5988 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062684.1 protein_id gnl|my_center|LOCUS_06470 5985 6413 gene locus_tag LOCUS_06480 5985 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 6425 7009 gene locus_tag LOCUS_06490 6425 7009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 7587 7012 gene locus_tag LOCUS_06500 7587 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 8868 7861 gene locus_tag LOCUS_06510 8868 7861 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275143.1 protein_id gnl|my_center|LOCUS_06510 10532 8865 gene locus_tag LOCUS_06520 10532 8865 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_06520 11512 10589 gene locus_tag LOCUS_06530 11512 10589 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259370.1 protein_id gnl|my_center|LOCUS_06530 12537 11521 gene locus_tag LOCUS_06540 12537 11521 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259366.1 protein_id gnl|my_center|LOCUS_06540 12604 13392 gene locus_tag LOCUS_06550 12604 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13518 13330 gene locus_tag LOCUS_06560 13518 13330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 13775 15439 gene locus_tag LOCUS_06570 13775 15439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 15477 15917 gene locus_tag LOCUS_06580 15477 15917 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_06580 15952 17010 gene locus_tag LOCUS_06590 15952 17010 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_06590 17595 17161 gene locus_tag LOCUS_06600 17595 17161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 17756 18124 gene locus_tag LOCUS_06610 17756 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 18121 18483 gene locus_tag LOCUS_06620 18121 18483 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923289.1 protein_id gnl|my_center|LOCUS_06620 18493 18975 gene locus_tag LOCUS_06630 18493 18975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 21181 19145 gene locus_tag LOCUS_06640 21181 19145 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104769.1 protein_id gnl|my_center|LOCUS_06640 21303 22826 gene locus_tag LOCUS_06650 21303 22826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 <24009 22835 gene locus_tag LOCUS_06660 <24009 22835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056043.1:ammonium transporter >Feature sequence026 2000 1059 gene locus_tag LOCUS_06670 2000 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3211 2015 gene locus_tag LOCUS_06680 3211 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 4356 3235 gene locus_tag LOCUS_06690 4356 3235 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036340.1 protein_id gnl|my_center|LOCUS_06690 5676 4522 gene locus_tag LOCUS_06700 5676 4522 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388874.1 protein_id gnl|my_center|LOCUS_06700 5939 6406 gene locus_tag LOCUS_06710 5939 6406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 6403 7083 gene locus_tag LOCUS_06720 6403 7083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 8678 7086 gene locus_tag LOCUS_06730 8678 7086 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_06730 9195 8815 gene locus_tag LOCUS_06740 9195 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9563 9156 gene locus_tag LOCUS_06750 9563 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 10452 10081 gene locus_tag LOCUS_06760 10452 10081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 10988 10566 gene locus_tag LOCUS_06770 10988 10566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 11057 12274 gene locus_tag LOCUS_06780 11057 12274 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877158.1 protein_id gnl|my_center|LOCUS_06780 13083 12748 gene locus_tag LOCUS_06790 13083 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 13096 15300 gene locus_tag LOCUS_06800 13096 15300 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224374.1 protein_id gnl|my_center|LOCUS_06800 15297 16439 gene locus_tag LOCUS_06810 15297 16439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence027 1656 718 gene locus_tag LOCUS_06820 1656 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2102 1653 gene locus_tag LOCUS_06830 2102 1653 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816077.1 protein_id gnl|my_center|LOCUS_06830 3043 2168 gene locus_tag LOCUS_06840 3043 2168 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943899.1 protein_id gnl|my_center|LOCUS_06840 4210 3086 gene locus_tag LOCUS_06850 4210 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4462 4259 gene locus_tag LOCUS_06860 4462 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 5522 4527 gene locus_tag LOCUS_06870 5522 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 7238 5709 gene locus_tag LOCUS_06880 gene paaZ 7238 5709 CDS product phenylacetic acid degradation bifunctional protein PaaZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223462.1 protein_id gnl|my_center|LOCUS_06880 9295 7304 gene locus_tag LOCUS_06890 9295 7304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 9391 10152 gene locus_tag LOCUS_06900 9391 10152 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918723.1 protein_id gnl|my_center|LOCUS_06900 10149 11102 gene locus_tag LOCUS_06910 10149 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 11099 12748 gene locus_tag LOCUS_06920 11099 12748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 15854 12729 gene locus_tag LOCUS_06930 15854 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 15867 16358 gene locus_tag LOCUS_06940 15867 16358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 17061 16330 gene locus_tag LOCUS_06950 17061 16330 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533365.1 protein_id gnl|my_center|LOCUS_06950 17166 17465 gene locus_tag LOCUS_06960 17166 17465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 17737 18723 gene locus_tag LOCUS_06970 17737 18723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 19945 18941 gene locus_tag LOCUS_06980 19945 18941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 20273 21772 gene locus_tag LOCUS_06990 20273 21772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 21778 22881 gene locus_tag LOCUS_07000 21778 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence028 695 1132 gene locus_tag LOCUS_07010 695 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1129 1521 gene locus_tag LOCUS_07020 1129 1521 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086611.1 protein_id gnl|my_center|LOCUS_07020 1518 2240 gene locus_tag LOCUS_07030 1518 2240 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730965.1 protein_id gnl|my_center|LOCUS_07030 2237 3142 gene locus_tag LOCUS_07040 2237 3142 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225234.1 protein_id gnl|my_center|LOCUS_07040 3142 4254 gene locus_tag LOCUS_07050 3142 4254 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897309.1 protein_id gnl|my_center|LOCUS_07050 4258 5883 gene locus_tag LOCUS_07060 4258 5883 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225958.1 protein_id gnl|my_center|LOCUS_07060 5970 6971 gene locus_tag LOCUS_07070 5970 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 6988 8019 gene locus_tag LOCUS_07080 6988 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 8292 8038 gene locus_tag LOCUS_07090 8292 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 8697 8362 gene locus_tag LOCUS_07100 8697 8362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 8928 8725 gene locus_tag LOCUS_07110 8928 8725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 11035 8960 gene locus_tag LOCUS_07120 11035 8960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 11797 11108 gene locus_tag LOCUS_07130 11797 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 12087 11872 gene locus_tag LOCUS_07140 12087 11872 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003696096.1 protein_id gnl|my_center|LOCUS_07140 12233 12715 gene locus_tag LOCUS_07150 12233 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 12597 12866 gene locus_tag LOCUS_07160 12597 12866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 12836 13363 gene locus_tag LOCUS_07170 12836 13363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 13360 13731 gene locus_tag LOCUS_07180 13360 13731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13832 15493 gene locus_tag LOCUS_07190 13832 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 16230 15490 gene locus_tag LOCUS_07200 16230 15490 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388409.1 protein_id gnl|my_center|LOCUS_07200 16320 17183 gene locus_tag LOCUS_07210 16320 17183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 18658 17537 gene locus_tag LOCUS_07220 18658 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 18805 19500 gene locus_tag LOCUS_07230 18805 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 19497 20495 gene locus_tag LOCUS_07240 19497 20495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 21486 20434 gene locus_tag LOCUS_07250 21486 20434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence029 1777 5601 gene locus_tag LOCUS_07260 1777 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5635 7311 gene locus_tag LOCUS_07270 5635 7311 CDS product ABC-F family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705884.1 protein_id gnl|my_center|LOCUS_07270 7437 8207 gene locus_tag LOCUS_07280 7437 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 10301 8226 gene locus_tag LOCUS_07290 10301 8226 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963528.1 protein_id gnl|my_center|LOCUS_07290 11892 10420 gene locus_tag LOCUS_07300 gene glpK 11892 10420 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_07300 12021 13349 gene locus_tag LOCUS_07310 12021 13349 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187263000.1 protein_id gnl|my_center|LOCUS_07310 13339 14355 gene locus_tag LOCUS_07320 13339 14355 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897013.1 protein_id gnl|my_center|LOCUS_07320 14387 15427 gene locus_tag LOCUS_07330 14387 15427 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104216.1 protein_id gnl|my_center|LOCUS_07330 16524 15424 gene locus_tag LOCUS_07340 16524 15424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 17738 16584 gene locus_tag LOCUS_07350 17738 16584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 17985 17719 gene locus_tag LOCUS_07360 17985 17719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 18067 19380 gene locus_tag LOCUS_07370 18067 19380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 19373 20347 gene locus_tag LOCUS_07380 19373 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 21702 20344 gene locus_tag LOCUS_07390 21702 20344 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_07390 <23520 21699 gene locus_tag LOCUS_07400 <23520 21699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943129.1:PAS domain-containing sensor histidine kinase >Feature sequence030 491 5104 gene locus_tag LOCUS_07410 491 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 5149 6525 gene locus_tag LOCUS_07420 5149 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 6587 7441 gene locus_tag LOCUS_07430 6587 7441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 7502 10036 gene locus_tag LOCUS_07440 7502 10036 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075123474.1 protein_id gnl|my_center|LOCUS_07440 10715 10059 gene locus_tag LOCUS_07450 10715 10059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 11174 10752 gene locus_tag LOCUS_07460 11174 10752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 11426 11635 gene locus_tag LOCUS_07470 11426 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 13404 11632 gene locus_tag LOCUS_07480 13404 11632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 13581 14963 gene locus_tag LOCUS_07490 13581 14963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 14994 15599 gene locus_tag LOCUS_07500 14994 15599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 17907 15607 gene locus_tag LOCUS_07510 17907 15607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 18080 19141 gene locus_tag LOCUS_07520 18080 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 19260 19727 gene locus_tag LOCUS_07530 19260 19727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 19717 21057 gene locus_tag LOCUS_07540 19717 21057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 21700 21335 gene locus_tag LOCUS_07550 21700 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence031 657 1064 gene locus_tag LOCUS_07560 657 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1121 1369 gene locus_tag LOCUS_07570 1121 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 2558 1446 gene locus_tag LOCUS_07580 2558 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2645 3646 gene locus_tag LOCUS_07590 2645 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4054 3659 gene locus_tag LOCUS_07600 4054 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 4177 5214 gene locus_tag LOCUS_07610 4177 5214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 5777 5211 gene locus_tag LOCUS_07620 5777 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5955 7799 gene locus_tag LOCUS_07630 5955 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 7911 8450 gene locus_tag LOCUS_07640 7911 8450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8447 9034 gene locus_tag LOCUS_07650 8447 9034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 9915 9043 gene locus_tag LOCUS_07660 9915 9043 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121358.1 protein_id gnl|my_center|LOCUS_07660 9914 10237 gene locus_tag LOCUS_07670 9914 10237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10553 11104 gene locus_tag LOCUS_07680 10553 11104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 15202 11171 gene locus_tag LOCUS_07690 15202 11171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 16362 15247 gene locus_tag LOCUS_07700 16362 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 17080 16586 gene locus_tag LOCUS_07710 17080 16586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 17736 17077 gene locus_tag LOCUS_07720 17736 17077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 18365 17745 gene locus_tag LOCUS_07730 18365 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 18539 18375 gene locus_tag LOCUS_07740 18539 18375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 19143 20789 gene locus_tag LOCUS_07750 19143 20789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 20786 22114 gene locus_tag LOCUS_07760 20786 22114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence032 749 2398 gene locus_tag LOCUS_07770 749 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2395 3096 gene locus_tag LOCUS_07780 2395 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3163 4830 gene locus_tag LOCUS_07790 3163 4830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4919 5761 gene locus_tag LOCUS_07800 4919 5761 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939818.1 protein_id gnl|my_center|LOCUS_07800 5758 7452 gene locus_tag LOCUS_07810 5758 7452 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439581.1 protein_id gnl|my_center|LOCUS_07810 9905 7461 gene locus_tag LOCUS_07820 9905 7461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 11791 9800 gene locus_tag LOCUS_07830 11791 9800 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_07830 11859 12212 gene locus_tag LOCUS_07840 11859 12212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 12289 13227 gene locus_tag LOCUS_07850 12289 13227 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070719.1 protein_id gnl|my_center|LOCUS_07850 13248 13691 gene locus_tag LOCUS_07860 13248 13691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 13905 14741 gene locus_tag LOCUS_07870 13905 14741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 15885 14716 gene locus_tag LOCUS_07880 gene tdh 15885 14716 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_07880 16586 16041 gene locus_tag LOCUS_07890 16586 16041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 16736 17038 gene locus_tag LOCUS_07900 16736 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 17767 17048 gene locus_tag LOCUS_07910 17767 17048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 19927 18158 gene locus_tag LOCUS_07920 19927 18158 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101855.1 protein_id gnl|my_center|LOCUS_07920 21341 19965 gene locus_tag LOCUS_07930 21341 19965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 21458 21382 gene locus_tag LOCUS_t00030 21458 21382 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 21818 21731 gene locus_tag LOCUS_t00040 21818 21731 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21936 21852 gene locus_tag LOCUS_t00050 21936 21852 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence033 2731 1847 gene locus_tag LOCUS_07940 2731 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2802 3923 gene locus_tag LOCUS_07950 2802 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 4089 6065 gene locus_tag LOCUS_07960 4089 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6083 7519 gene locus_tag LOCUS_07970 6083 7519 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_07970 8176 7559 gene locus_tag LOCUS_07980 8176 7559 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640290.1 protein_id gnl|my_center|LOCUS_07980 8762 8166 gene locus_tag LOCUS_07990 gene yihA 8762 8166 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943641.1 protein_id gnl|my_center|LOCUS_07990 8795 9979 gene locus_tag LOCUS_08000 8795 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 10032 12338 gene locus_tag LOCUS_08010 gene lon 10032 12338 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_08010 16413 12400 gene locus_tag LOCUS_08020 16413 12400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 16467 17669 gene locus_tag LOCUS_08030 16467 17669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 18661 17666 gene locus_tag LOCUS_08040 18661 17666 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390376.1 protein_id gnl|my_center|LOCUS_08040 18796 20070 gene locus_tag LOCUS_08050 gene clpX 18796 20070 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327976.1 protein_id gnl|my_center|LOCUS_08050 20080 20616 gene locus_tag LOCUS_08060 20080 20616 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064241129.1 protein_id gnl|my_center|LOCUS_08060 21707 20631 gene locus_tag LOCUS_08070 21707 20631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence034 391 1125 gene locus_tag LOCUS_08080 391 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1994 1122 gene locus_tag LOCUS_08090 1994 1122 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878808.1 protein_id gnl|my_center|LOCUS_08090 2286 4202 gene locus_tag LOCUS_08100 2286 4202 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090696.1 protein_id gnl|my_center|LOCUS_08100 4266 5408 gene locus_tag LOCUS_08110 4266 5408 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064316.1 protein_id gnl|my_center|LOCUS_08110 5433 5906 gene locus_tag LOCUS_08120 5433 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 6296 5907 gene locus_tag LOCUS_08130 6296 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 6457 6639 gene locus_tag LOCUS_08140 6457 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 6731 6892 gene locus_tag LOCUS_08150 6731 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8782 6998 gene locus_tag LOCUS_08160 8782 6998 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 protein_id gnl|my_center|LOCUS_08160 9327 10505 gene locus_tag LOCUS_08170 9327 10505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 10891 10511 gene locus_tag LOCUS_08180 10891 10511 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259566.1 protein_id gnl|my_center|LOCUS_08180 11286 10912 gene locus_tag LOCUS_08190 11286 10912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 11912 11574 gene locus_tag LOCUS_08200 11912 11574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 12698 11922 gene locus_tag LOCUS_08210 12698 11922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 13283 12870 gene locus_tag LOCUS_08220 13283 12870 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_08220 14478 13342 gene locus_tag LOCUS_08230 gene acdA 14478 13342 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_08230 15348 14572 gene locus_tag LOCUS_08240 15348 14572 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965999.1 protein_id gnl|my_center|LOCUS_08240 16244 15351 gene locus_tag LOCUS_08250 16244 15351 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390827.1 protein_id gnl|my_center|LOCUS_08250 16437 19841 gene locus_tag LOCUS_08260 16437 19841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 19823 21790 gene locus_tag LOCUS_08270 19823 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence035 <1 516 gene locus_tag LOCUS_08280 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005112465.1:YceI family protein 1521 589 gene locus_tag LOCUS_08290 1521 589 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073308.1 protein_id gnl|my_center|LOCUS_08290 2181 1567 gene locus_tag LOCUS_08300 2181 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2254 2997 gene locus_tag LOCUS_08310 2254 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 4126 3044 gene locus_tag LOCUS_08320 4126 3044 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087057.1 protein_id gnl|my_center|LOCUS_08320 4371 4703 gene locus_tag LOCUS_08330 4371 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 4947 4738 gene locus_tag LOCUS_08340 4947 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 4838 5278 gene locus_tag LOCUS_08350 4838 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 7044 5275 gene locus_tag LOCUS_08360 7044 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 8227 7124 gene locus_tag LOCUS_08370 8227 7124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 10041 8281 gene locus_tag LOCUS_08380 10041 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 11608 10133 gene locus_tag LOCUS_08390 11608 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 11664 12671 gene locus_tag LOCUS_08400 11664 12671 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_08400 13781 12741 gene locus_tag LOCUS_08410 13781 12741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 15693 13876 gene locus_tag LOCUS_08420 15693 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 16430 15693 gene locus_tag LOCUS_08430 16430 15693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 17124 16483 gene locus_tag LOCUS_08440 17124 16483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 17164 17832 gene locus_tag LOCUS_08450 17164 17832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 18621 17833 gene locus_tag LOCUS_08460 18621 17833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 19000 19905 gene locus_tag LOCUS_08470 19000 19905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 20603 19902 gene locus_tag LOCUS_08480 20603 19902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence036 4842 3073 gene locus_tag LOCUS_08490 4842 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 6675 4897 gene locus_tag LOCUS_08500 6675 4897 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974102.1 protein_id gnl|my_center|LOCUS_08500 7464 6754 gene locus_tag LOCUS_08510 7464 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7925 7482 gene locus_tag LOCUS_08520 7925 7482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 8081 9226 gene locus_tag LOCUS_08530 8081 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9226 9666 gene locus_tag LOCUS_08540 9226 9666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9676 10422 gene locus_tag LOCUS_08550 9676 10422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10419 11252 gene locus_tag LOCUS_08560 10419 11252 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_08560 12069 11275 gene locus_tag LOCUS_08570 12069 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 12121 13062 gene locus_tag LOCUS_08580 12121 13062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 13153 14124 gene locus_tag LOCUS_08590 gene bioB 13153 14124 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453785.1 protein_id gnl|my_center|LOCUS_08590 15131 14106 gene locus_tag LOCUS_08600 15131 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 15185 16426 gene locus_tag LOCUS_08610 15185 16426 CDS product EstA family serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208246.1 protein_id gnl|my_center|LOCUS_08610 17717 16437 gene locus_tag LOCUS_08620 17717 16437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 18460 17717 gene locus_tag LOCUS_08630 18460 17717 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173565.1 protein_id gnl|my_center|LOCUS_08630 <20915 18457 gene locus_tag LOCUS_08640 <20915 18457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902969.1:sulfatase-like hydrolase/transferase >Feature sequence037 2776 218 gene locus_tag LOCUS_08650 2776 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 12929 2910 gene locus_tag LOCUS_08660 12929 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 14564 13071 gene locus_tag LOCUS_08670 14564 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 14709 15875 gene locus_tag LOCUS_08680 14709 15875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 15928 17226 gene locus_tag LOCUS_08690 15928 17226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 17236 18396 gene locus_tag LOCUS_08700 17236 18396 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257619.1 protein_id gnl|my_center|LOCUS_08700 18555 18959 gene locus_tag LOCUS_08710 18555 18959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 19504 19028 gene locus_tag LOCUS_08720 19504 19028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 19719 20600 gene locus_tag LOCUS_08730 19719 20600 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977406.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence038 1574 654 gene locus_tag LOCUS_08740 1574 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1834 1571 gene locus_tag LOCUS_08750 1834 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2283 2660 gene locus_tag LOCUS_08760 2283 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2926 3084 gene locus_tag LOCUS_08770 2926 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 3631 3347 gene locus_tag LOCUS_08780 3631 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 4059 5633 gene locus_tag LOCUS_08790 4059 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 5769 7253 gene locus_tag LOCUS_08800 5769 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7768 10422 gene locus_tag LOCUS_08810 gene ppc 7768 10422 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113850.1 protein_id gnl|my_center|LOCUS_08810 11397 10693 gene locus_tag LOCUS_08820 11397 10693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 12259 11648 gene locus_tag LOCUS_08830 12259 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 12435 12698 gene locus_tag LOCUS_08840 12435 12698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 13459 12617 gene locus_tag LOCUS_08850 13459 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 14802 13459 gene locus_tag LOCUS_08860 14802 13459 CDS product DUF1552 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121211.1 protein_id gnl|my_center|LOCUS_08860 16376 14799 gene locus_tag LOCUS_08870 16376 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 17551 16469 gene locus_tag LOCUS_08880 17551 16469 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190236313.1 protein_id gnl|my_center|LOCUS_08880 18728 17595 gene locus_tag LOCUS_08890 18728 17595 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08890 19102 18875 gene locus_tag LOCUS_08900 19102 18875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 19026 19760 gene locus_tag LOCUS_08910 19026 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence039 477 869 gene locus_tag LOCUS_08920 477 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1884 901 gene locus_tag LOCUS_08930 1884 901 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395635.1 protein_id gnl|my_center|LOCUS_08930 2696 2034 gene locus_tag LOCUS_08940 2696 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 3401 2697 gene locus_tag LOCUS_08950 3401 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4194 3448 gene locus_tag LOCUS_08960 gene fdhD 4194 3448 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_08960 4335 6446 gene locus_tag LOCUS_08970 4335 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 6971 6486 gene locus_tag LOCUS_08980 6971 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 8280 6997 gene locus_tag LOCUS_08990 8280 6997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 10134 8419 gene locus_tag LOCUS_09000 10134 8419 CDS product bifunctional metallophosphatase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052368191.1 protein_id gnl|my_center|LOCUS_09000 10196 11851 gene locus_tag LOCUS_09010 10196 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 12715 11954 gene locus_tag LOCUS_09020 12715 11954 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266962.1 protein_id gnl|my_center|LOCUS_09020 13122 12712 gene locus_tag LOCUS_09030 13122 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 13251 14903 gene locus_tag LOCUS_09040 13251 14903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 14918 15994 gene locus_tag LOCUS_09050 14918 15994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 15998 16219 gene locus_tag LOCUS_09060 15998 16219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 16316 16627 gene locus_tag LOCUS_09070 gene clpS 16316 16627 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023812950.1 protein_id gnl|my_center|LOCUS_09070 16628 18892 gene locus_tag LOCUS_09080 gene clpA 16628 18892 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037131.1 protein_id gnl|my_center|LOCUS_09080 18911 19276 gene locus_tag LOCUS_09090 18911 19276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 19323 20339 gene locus_tag LOCUS_09100 19323 20339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence040 4616 780 gene locus_tag LOCUS_09110 4616 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09110 6467 4695 gene locus_tag LOCUS_09120 6467 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09120 6770 6567 gene locus_tag LOCUS_09130 6770 6567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 6895 10143 gene locus_tag LOCUS_09140 6895 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 11191 10145 gene locus_tag LOCUS_09150 11191 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 11520 11281 gene locus_tag LOCUS_09160 11520 11281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 12771 11743 gene locus_tag LOCUS_09170 12771 11743 CDS product FAD:protein FMN transferase ApbE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705065.1 protein_id gnl|my_center|LOCUS_09170 14259 13036 gene locus_tag LOCUS_09180 gene nqrF 14259 13036 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_09180 14890 14279 gene locus_tag LOCUS_09190 gene nqrE 14890 14279 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_09190 15562 14894 gene locus_tag LOCUS_09200 15562 14894 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071350.1 protein_id gnl|my_center|LOCUS_09200 16326 15565 gene locus_tag LOCUS_09210 16326 15565 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333689.1 protein_id gnl|my_center|LOCUS_09210 17545 16337 gene locus_tag LOCUS_09220 17545 16337 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208716.1 protein_id gnl|my_center|LOCUS_09220 18905 17547 gene locus_tag LOCUS_09230 18905 17547 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001906078.1 protein_id gnl|my_center|LOCUS_09230 19009 19635 gene locus_tag LOCUS_09240 gene rnhB 19009 19635 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_09240 19635 20408 gene locus_tag LOCUS_09250 19635 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence041 2 214 gene locus_tag LOCUS_09260 2 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 346 1041 gene locus_tag LOCUS_09270 346 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1436 1131 gene locus_tag LOCUS_09280 1436 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1887 1441 gene locus_tag LOCUS_09290 1887 1441 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763705.1 protein_id gnl|my_center|LOCUS_09290 2124 4157 gene locus_tag LOCUS_09300 2124 4157 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530263.1 protein_id gnl|my_center|LOCUS_09300 4157 6712 gene locus_tag LOCUS_09310 4157 6712 CDS product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_09310 7030 9225 gene locus_tag LOCUS_09320 7030 9225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 9965 9285 gene locus_tag LOCUS_09330 9965 9285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 10085 11368 gene locus_tag LOCUS_09340 10085 11368 CDS product exonuclease SbcCD subunit D C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107018.1 protein_id gnl|my_center|LOCUS_09340 11365 15192 gene locus_tag LOCUS_09350 11365 15192 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932819.1 protein_id gnl|my_center|LOCUS_09350 15590 15210 gene locus_tag LOCUS_09360 15590 15210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 15556 16686 gene locus_tag LOCUS_09370 15556 16686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 <20418 16690 gene locus_tag LOCUS_09380 <20418 16690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117689.1:DEAD/DEAH box helicase >Feature sequence042 1307 21 gene locus_tag LOCUS_09390 1307 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3180 1351 gene locus_tag LOCUS_09400 3180 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 5822 3177 gene locus_tag LOCUS_09410 5822 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5930 7234 gene locus_tag LOCUS_09420 5930 7234 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869494.1 protein_id gnl|my_center|LOCUS_09420 7493 7221 gene locus_tag LOCUS_09430 7493 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 8843 7494 gene locus_tag LOCUS_09440 8843 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9319 9026 gene locus_tag LOCUS_09450 gene hupN 9319 9026 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_09450 9924 9484 gene locus_tag LOCUS_09460 9924 9484 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_09460 11141 9921 gene locus_tag LOCUS_09470 11141 9921 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09470 12394 11141 gene locus_tag LOCUS_09480 gene sufD 12394 11141 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928762.1 protein_id gnl|my_center|LOCUS_09480 13158 12406 gene locus_tag LOCUS_09490 gene sufC 13158 12406 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_09490 14653 13202 gene locus_tag LOCUS_09500 gene sufB 14653 13202 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_09500 15144 14650 gene locus_tag LOCUS_09510 15144 14650 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003391911.1 protein_id gnl|my_center|LOCUS_09510 15693 17171 gene locus_tag LOCUS_09520 15693 17171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 17196 17852 gene locus_tag LOCUS_09530 17196 17852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 17852 18724 gene locus_tag LOCUS_09540 17852 18724 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031095.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence043 168 1139 gene locus_tag LOCUS_09550 168 1139 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_09550 1563 3110 gene locus_tag LOCUS_09560 1563 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3256 4515 gene locus_tag LOCUS_09570 3256 4515 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213919.1 protein_id gnl|my_center|LOCUS_09570 5098 4601 gene locus_tag LOCUS_09580 5098 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6231 5104 gene locus_tag LOCUS_09590 6231 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7796 6570 gene locus_tag LOCUS_09600 7796 6570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 8930 7926 gene locus_tag LOCUS_09610 8930 7926 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142473.1 protein_id gnl|my_center|LOCUS_09610 10599 8971 gene locus_tag LOCUS_09620 gene gpmI 10599 8971 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_09620 12095 10632 gene locus_tag LOCUS_09630 12095 10632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 12887 12168 gene locus_tag LOCUS_09640 12887 12168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 12956 13273 gene locus_tag LOCUS_09650 12956 13273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 13427 14986 gene locus_tag LOCUS_09660 13427 14986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 15033 15236 gene locus_tag LOCUS_09670 15033 15236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 15264 15779 gene locus_tag LOCUS_09680 15264 15779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 17026 15803 gene locus_tag LOCUS_09690 17026 15803 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_09690 17148 19367 gene locus_tag LOCUS_09700 17148 19367 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_09700 17741 17662 gene locus_tag LOCUS_t00060 17741 17662 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 1773 421 gene locus_tag LOCUS_09710 gene nrfD 1773 421 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328378.1 protein_id gnl|my_center|LOCUS_09710 4908 1783 gene locus_tag LOCUS_09720 4908 1783 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_09720 5657 4920 gene locus_tag LOCUS_09730 5657 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6132 5770 gene locus_tag LOCUS_09740 6132 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 6262 6519 gene locus_tag LOCUS_09750 6262 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 6712 7194 gene locus_tag LOCUS_09760 6712 7194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7315 7767 gene locus_tag LOCUS_09770 7315 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 7760 8692 gene locus_tag LOCUS_09780 gene meaB 7760 8692 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227730.1 protein_id gnl|my_center|LOCUS_09780 8689 9126 gene locus_tag LOCUS_09790 8689 9126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09790 9142 9474 gene locus_tag LOCUS_09800 9142 9474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 9471 10013 gene locus_tag LOCUS_09810 9471 10013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 10568 10023 gene locus_tag LOCUS_09820 10568 10023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 11228 10602 gene locus_tag LOCUS_09830 11228 10602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 12871 11225 gene locus_tag LOCUS_09840 12871 11225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 13227 12916 gene locus_tag LOCUS_09850 13227 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 13535 14149 gene locus_tag LOCUS_09860 13535 14149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 14244 14171 gene locus_tag LOCUS_t00070 14244 14171 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14648 14298 gene locus_tag LOCUS_09870 14648 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 14791 15447 gene locus_tag LOCUS_09880 14791 15447 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933691.1 protein_id gnl|my_center|LOCUS_09880 15512 15429 gene locus_tag LOCUS_t00080 15512 15429 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15989 15567 gene locus_tag LOCUS_09890 15989 15567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 16115 16900 gene locus_tag LOCUS_09900 16115 16900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 17509 16943 gene locus_tag LOCUS_09910 gene coaC 17509 16943 CDS product phosphopantothenoylcysteine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359573.1 protein_id gnl|my_center|LOCUS_09910 17817 19232 gene locus_tag LOCUS_09920 gene moeB 17817 19232 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_09920 19300 19722 gene locus_tag LOCUS_09930 19300 19722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence045 1133 1372 gene locus_tag LOCUS_09940 1133 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1601 2260 gene locus_tag LOCUS_09950 1601 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 2257 3087 gene locus_tag LOCUS_09960 2257 3087 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_09960 3145 4029 gene locus_tag LOCUS_09970 3145 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 5111 4116 gene locus_tag LOCUS_09980 5111 4116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 5655 5179 gene locus_tag LOCUS_09990 5655 5179 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037422212.1 protein_id gnl|my_center|LOCUS_09990 6024 5668 gene locus_tag LOCUS_10000 6024 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 7049 6105 gene locus_tag LOCUS_10010 7049 6105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 7390 7767 gene locus_tag LOCUS_10020 7390 7767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 8777 7764 gene locus_tag LOCUS_10030 8777 7764 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312773.1 protein_id gnl|my_center|LOCUS_10030 9694 8774 gene locus_tag LOCUS_10040 9694 8774 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_10040 10215 9796 gene locus_tag LOCUS_10050 10215 9796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 11793 10408 gene locus_tag LOCUS_10060 11793 10408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 12006 12959 gene locus_tag LOCUS_10070 12006 12959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 12996 14408 gene locus_tag LOCUS_10080 12996 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 14600 14415 gene locus_tag LOCUS_10090 14600 14415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 16078 14753 gene locus_tag LOCUS_10100 16078 14753 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035351.1 protein_id gnl|my_center|LOCUS_10100 17643 16075 gene locus_tag LOCUS_10110 17643 16075 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920663.1 protein_id gnl|my_center|LOCUS_10110 18560 17640 gene locus_tag LOCUS_10120 18560 17640 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902312.1 protein_id gnl|my_center|LOCUS_10120 19180 18563 gene locus_tag LOCUS_10130 19180 18563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence046 1286 462 gene locus_tag LOCUS_10140 gene kdsA 1286 462 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120986.1 protein_id gnl|my_center|LOCUS_10140 1318 2637 gene locus_tag LOCUS_10150 1318 2637 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_10150 2712 3593 gene locus_tag LOCUS_10160 2712 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 3702 4826 gene locus_tag LOCUS_10170 3702 4826 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588613.1 protein_id gnl|my_center|LOCUS_10170 6076 5156 gene locus_tag LOCUS_10180 6076 5156 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727868.1 protein_id gnl|my_center|LOCUS_10180 6438 6079 gene locus_tag LOCUS_10190 6438 6079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 6437 7996 gene locus_tag LOCUS_10200 6437 7996 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_10200 8553 8011 gene locus_tag LOCUS_10210 8553 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8637 9629 gene locus_tag LOCUS_10220 8637 9629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9748 11562 gene locus_tag LOCUS_10230 gene ftsH 9748 11562 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583233.1 protein_id gnl|my_center|LOCUS_10230 11680 13101 gene locus_tag LOCUS_10240 11680 13101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 13139 13870 gene locus_tag LOCUS_10250 13139 13870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 14995 13877 gene locus_tag LOCUS_10260 14995 13877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 15583 15035 gene locus_tag LOCUS_10270 15583 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 17280 15658 gene locus_tag LOCUS_10280 gene pruA 17280 15658 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224530.1 protein_id gnl|my_center|LOCUS_10280 17372 17851 gene locus_tag LOCUS_10290 17372 17851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 18050 18649 gene locus_tag LOCUS_10300 18050 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19506 18676 gene locus_tag LOCUS_10310 19506 18676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence047 92 1186 gene locus_tag LOCUS_10320 92 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 1655 1191 gene locus_tag LOCUS_10330 1655 1191 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943826.1 protein_id gnl|my_center|LOCUS_10330 2056 1655 gene locus_tag LOCUS_10340 2056 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2635 2165 gene locus_tag LOCUS_10350 2635 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3773 2742 gene locus_tag LOCUS_10360 gene obgE 3773 2742 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807459.1 protein_id gnl|my_center|LOCUS_10360 4081 3830 gene locus_tag LOCUS_10370 gene rpmA 4081 3830 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902873.1 protein_id gnl|my_center|LOCUS_10370 4405 4097 gene locus_tag LOCUS_10380 gene rplU 4405 4097 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547952.1 protein_id gnl|my_center|LOCUS_10380 6276 4567 gene locus_tag LOCUS_10390 6276 4567 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_10390 6387 6995 gene locus_tag LOCUS_10400 6387 6995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 8068 6953 gene locus_tag LOCUS_10410 8068 6953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9450 8284 gene locus_tag LOCUS_10420 9450 8284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 11063 9471 gene locus_tag LOCUS_10430 11063 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 11476 11045 gene locus_tag LOCUS_10440 11476 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 12351 11521 gene locus_tag LOCUS_10450 12351 11521 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391360.1 protein_id gnl|my_center|LOCUS_10450 13272 12352 gene locus_tag LOCUS_10460 13272 12352 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258807.1 protein_id gnl|my_center|LOCUS_10460 13341 13757 gene locus_tag LOCUS_10470 13341 13757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 14412 13885 gene locus_tag LOCUS_10480 14412 13885 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962228.1 protein_id gnl|my_center|LOCUS_10480 15450 14473 gene locus_tag LOCUS_10490 15450 14473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 16356 15454 gene locus_tag LOCUS_10500 16356 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 17290 16370 gene locus_tag LOCUS_10510 17290 16370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_10510 19467 17287 gene locus_tag LOCUS_10520 19467 17287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence048 <1 1429 gene locus_tag LOCUS_10530 <1 1429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230569.1:serine/threonine-protein kinase 2984 1569 gene locus_tag LOCUS_10540 gene glgA 2984 1569 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697284.1 protein_id gnl|my_center|LOCUS_10540 4375 2984 gene locus_tag LOCUS_10550 gene glgC 4375 2984 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707513.1 protein_id gnl|my_center|LOCUS_10550 5632 4400 gene locus_tag LOCUS_10560 5632 4400 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_10560 5738 5914 gene locus_tag LOCUS_10570 5738 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5957 6502 gene locus_tag LOCUS_10580 5957 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 6581 7795 gene locus_tag LOCUS_10590 6581 7795 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101032.1 protein_id gnl|my_center|LOCUS_10590 9039 7813 gene locus_tag LOCUS_10600 9039 7813 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263541.1 protein_id gnl|my_center|LOCUS_10600 9831 9100 gene locus_tag LOCUS_10610 9831 9100 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259732.1 protein_id gnl|my_center|LOCUS_10610 11090 9837 gene locus_tag LOCUS_10620 11090 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 12335 11190 gene locus_tag LOCUS_10630 12335 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 13288 12332 gene locus_tag LOCUS_10640 13288 12332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 13540 13959 gene locus_tag LOCUS_10650 13540 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 14358 14038 gene locus_tag LOCUS_10660 14358 14038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 14695 14471 gene locus_tag LOCUS_10670 14695 14471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 14580 14786 gene locus_tag LOCUS_10680 14580 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 14894 15094 gene locus_tag LOCUS_10690 14894 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 16584 15169 gene locus_tag LOCUS_10700 16584 15169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 17091 16597 gene locus_tag LOCUS_10710 17091 16597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 18020 17106 gene locus_tag LOCUS_10720 18020 17106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 18089 19087 gene locus_tag LOCUS_10730 18089 19087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence049 1142 315 gene locus_tag LOCUS_10740 1142 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1978 1139 gene locus_tag LOCUS_10750 gene oppB 1978 1139 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461536.1 protein_id gnl|my_center|LOCUS_10750 4042 2468 gene locus_tag LOCUS_10760 4042 2468 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729759.1 protein_id gnl|my_center|LOCUS_10760 5438 4056 gene locus_tag LOCUS_10770 5438 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 7042 5438 gene locus_tag LOCUS_10780 7042 5438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 7502 7077 gene locus_tag LOCUS_10790 7502 7077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 8554 7502 gene locus_tag LOCUS_10800 8554 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 9641 8625 gene locus_tag LOCUS_10810 gene dusB 9641 8625 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_10810 10635 9715 gene locus_tag LOCUS_10820 gene hcpC 10635 9715 CDS product Sel1-like repeat protein HcpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892717.1 protein_id gnl|my_center|LOCUS_10820 11412 10636 gene locus_tag LOCUS_10830 11412 10636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 12477 11437 gene locus_tag LOCUS_10840 12477 11437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 13048 12695 gene locus_tag LOCUS_10850 13048 12695 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330483.1 protein_id gnl|my_center|LOCUS_10850 14002 13172 gene locus_tag LOCUS_10860 14002 13172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 16301 14034 gene locus_tag LOCUS_10870 16301 14034 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161536185.1 protein_id gnl|my_center|LOCUS_10870 16569 18725 gene locus_tag LOCUS_10880 16569 18725 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073719.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence050 <1 1161 gene locus_tag LOCUS_10890 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073595568.1:thioredoxin-like domain-containing protein 1321 2004 gene locus_tag LOCUS_10900 1321 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2137 2514 gene locus_tag LOCUS_10910 2137 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 3099 2563 gene locus_tag LOCUS_10920 3099 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3460 3104 gene locus_tag LOCUS_10930 3460 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 4632 3550 gene locus_tag LOCUS_10940 4632 3550 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037589.1 protein_id gnl|my_center|LOCUS_10940 7139 4902 gene locus_tag LOCUS_10950 7139 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 8846 7320 gene locus_tag LOCUS_10960 8846 7320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 9703 8963 gene locus_tag LOCUS_10970 9703 8963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942024.1 protein_id gnl|my_center|LOCUS_10970 10012 10602 gene locus_tag LOCUS_10980 10012 10602 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143952.1 protein_id gnl|my_center|LOCUS_10980 10809 13133 gene locus_tag LOCUS_10990 10809 13133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 13287 13490 gene locus_tag LOCUS_11000 13287 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 14251 13757 gene locus_tag LOCUS_11010 14251 13757 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332895.1 protein_id gnl|my_center|LOCUS_11010 16136 14646 gene locus_tag LOCUS_11020 16136 14646 CDS product GMC family oxidoreductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098014.1 protein_id gnl|my_center|LOCUS_11020 16376 16663 gene locus_tag LOCUS_11030 16376 16663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 16667 17023 gene locus_tag LOCUS_11040 16667 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 17877 17125 gene locus_tag LOCUS_11050 17877 17125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence051 445 3645 gene locus_tag LOCUS_11060 445 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3769 5703 gene locus_tag LOCUS_11070 3769 5703 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_11070 5710 7635 gene locus_tag LOCUS_11080 5710 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 7632 8747 gene locus_tag LOCUS_11090 7632 8747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 8823 10235 gene locus_tag LOCUS_11100 8823 10235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 10275 10520 gene locus_tag LOCUS_11110 10275 10520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 10525 11535 gene locus_tag LOCUS_11120 10525 11535 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259250.1 protein_id gnl|my_center|LOCUS_11120 11536 12399 gene locus_tag LOCUS_11130 11536 12399 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427744.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11130 12425 12976 gene locus_tag LOCUS_11140 12425 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12973 13470 gene locus_tag LOCUS_11150 12973 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13483 13884 gene locus_tag LOCUS_11160 13483 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 14459 13881 gene locus_tag LOCUS_11170 14459 13881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 17118 14470 gene locus_tag LOCUS_11180 17118 14470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 18444 17119 gene locus_tag LOCUS_11190 18444 17119 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974400.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence052 1622 30 gene locus_tag LOCUS_11200 1622 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1842 2231 gene locus_tag LOCUS_11210 1842 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 2424 4388 gene locus_tag LOCUS_11220 2424 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4787 4632 gene locus_tag LOCUS_11230 4787 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 4894 5379 gene locus_tag LOCUS_11240 4894 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5366 5677 gene locus_tag LOCUS_11250 5366 5677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 6756 5725 gene locus_tag LOCUS_11260 6756 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 7208 7873 gene locus_tag LOCUS_11270 7208 7873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 7911 8549 gene locus_tag LOCUS_11280 7911 8549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 8546 9493 gene locus_tag LOCUS_11290 8546 9493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 9585 10190 gene locus_tag LOCUS_11300 9585 10190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 10562 11479 gene locus_tag LOCUS_11310 gene cysD 10562 11479 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_11310 11479 13320 gene locus_tag LOCUS_11320 gene cysN 11479 13320 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268855.1 protein_id gnl|my_center|LOCUS_11320 13789 13487 gene locus_tag LOCUS_11330 13789 13487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 14663 13866 gene locus_tag LOCUS_11340 14663 13866 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005071548.1 protein_id gnl|my_center|LOCUS_11340 16091 14766 gene locus_tag LOCUS_11350 16091 14766 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269217.1 protein_id gnl|my_center|LOCUS_11350 17530 16088 gene locus_tag LOCUS_11360 17530 16088 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187957.1 protein_id gnl|my_center|LOCUS_11360 17642 18238 gene locus_tag LOCUS_11370 17642 18238 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392204.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence053 177 515 gene locus_tag LOCUS_11380 gene glpE 177 515 CDS product thiosulfate sulfurtransferase GlpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208928.1 protein_id gnl|my_center|LOCUS_11380 531 3200 gene locus_tag LOCUS_11390 531 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 3294 3959 gene locus_tag LOCUS_11400 3294 3959 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_11400 3956 4795 gene locus_tag LOCUS_11410 3956 4795 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_11410 4825 5445 gene locus_tag LOCUS_11420 4825 5445 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444780.1 protein_id gnl|my_center|LOCUS_11420 6947 5505 gene locus_tag LOCUS_11430 6947 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 7313 7837 gene locus_tag LOCUS_11440 7313 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 9477 8014 gene locus_tag LOCUS_11450 9477 8014 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_11450 9966 9511 gene locus_tag LOCUS_11460 9966 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 10043 10417 gene locus_tag LOCUS_11470 10043 10417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 10835 10371 gene locus_tag LOCUS_11480 10835 10371 CDS product DUF1456 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409371.1 protein_id gnl|my_center|LOCUS_11480 11580 10897 gene locus_tag LOCUS_11490 11580 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 11738 12661 gene locus_tag LOCUS_11500 11738 12661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 13080 12724 gene locus_tag LOCUS_11510 13080 12724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 13768 13193 gene locus_tag LOCUS_11520 gene pdxH 13768 13193 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085410.1 protein_id gnl|my_center|LOCUS_11520 15934 13814 gene locus_tag LOCUS_11530 15934 13814 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524570.1 protein_id gnl|my_center|LOCUS_11530 17153 15945 gene locus_tag LOCUS_11540 17153 15945 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525801.1 protein_id gnl|my_center|LOCUS_11540 17309 18457 gene locus_tag LOCUS_11550 17309 18457 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389856.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence054 <1 603 gene locus_tag LOCUS_11560 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108988152.1:2-oxoacid:acceptor oxidoreductase subunit alpha 616 1626 gene locus_tag LOCUS_11570 616 1626 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_11570 1627 2433 gene locus_tag LOCUS_11580 1627 2433 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931500.1 protein_id gnl|my_center|LOCUS_11580 3680 2430 gene locus_tag LOCUS_11590 3680 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4228 5577 gene locus_tag LOCUS_11600 gene radA 4228 5577 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_11600 5680 7479 gene locus_tag LOCUS_11610 5680 7479 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083977.1 protein_id gnl|my_center|LOCUS_11610 8502 7507 gene locus_tag LOCUS_11620 8502 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8631 9011 gene locus_tag LOCUS_11630 8631 9011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 9091 10155 gene locus_tag LOCUS_11640 9091 10155 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190793.1 protein_id gnl|my_center|LOCUS_11640 10152 10631 gene locus_tag LOCUS_11650 10152 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 10808 12061 gene locus_tag LOCUS_11660 10808 12061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 12617 12024 gene locus_tag LOCUS_11670 12617 12024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 13335 12685 gene locus_tag LOCUS_11680 13335 12685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 13540 13337 gene locus_tag LOCUS_11690 13540 13337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 14145 13543 gene locus_tag LOCUS_11700 14145 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 14406 15050 gene locus_tag LOCUS_11710 14406 15050 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 protein_id gnl|my_center|LOCUS_11710 15815 15051 gene locus_tag LOCUS_11720 15815 15051 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533327.1 protein_id gnl|my_center|LOCUS_11720 16381 15818 gene locus_tag LOCUS_11730 16381 15818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 <18592 16742 gene locus_tag LOCUS_11740 <18592 16742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036970.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence055 721 566 gene locus_tag LOCUS_11750 721 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 808 2877 gene locus_tag LOCUS_11760 808 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5065 2915 gene locus_tag LOCUS_11770 5065 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 6735 5128 gene locus_tag LOCUS_11780 6735 5128 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173455.1 protein_id gnl|my_center|LOCUS_11780 6722 6922 gene locus_tag LOCUS_11790 6722 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 9336 6931 gene locus_tag LOCUS_11800 9336 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 9585 11750 gene locus_tag LOCUS_11810 9585 11750 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037676.1 protein_id gnl|my_center|LOCUS_11810 12874 11867 gene locus_tag LOCUS_11820 12874 11867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 14371 12890 gene locus_tag LOCUS_11830 14371 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15711 14368 gene locus_tag LOCUS_11840 15711 14368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 17516 15711 gene locus_tag LOCUS_11850 17516 15711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 18396 17620 gene locus_tag LOCUS_11860 18396 17620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence056 2173 1973 gene locus_tag LOCUS_11870 2173 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 2622 4802 gene locus_tag LOCUS_11880 2622 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_11880 4978 6351 gene locus_tag LOCUS_11890 4978 6351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 6432 7610 gene locus_tag LOCUS_11900 gene chrA 6432 7610 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_11900 8309 7797 gene locus_tag LOCUS_11910 8309 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 8461 8769 gene locus_tag LOCUS_11920 8461 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 9023 8811 gene locus_tag LOCUS_11930 9023 8811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 9688 9242 gene locus_tag LOCUS_11940 9688 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 10458 10264 gene locus_tag LOCUS_11950 10458 10264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 10603 11697 gene locus_tag LOCUS_11960 10603 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 11750 12184 gene locus_tag LOCUS_11970 11750 12184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 12455 12814 gene locus_tag LOCUS_11980 12455 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 14398 12857 gene locus_tag LOCUS_11990 14398 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 15257 14976 gene locus_tag LOCUS_12000 15257 14976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 15165 15350 gene locus_tag LOCUS_12010 15165 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 15779 15357 gene locus_tag LOCUS_12020 15779 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 16288 15731 gene locus_tag LOCUS_12030 16288 15731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 16448 16846 gene locus_tag LOCUS_12040 16448 16846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 16890 17021 gene locus_tag LOCUS_12050 16890 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 17520 17164 gene locus_tag LOCUS_12060 17520 17164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence057 42 2192 gene locus_tag LOCUS_12070 42 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 3481 2369 gene locus_tag LOCUS_12080 3481 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 4196 3525 gene locus_tag LOCUS_12090 4196 3525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 5428 4190 gene locus_tag LOCUS_12100 5428 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 7504 5486 gene locus_tag LOCUS_12110 7504 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 7670 8359 gene locus_tag LOCUS_12120 gene thiE 7670 8359 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172766.1 protein_id gnl|my_center|LOCUS_12120 9592 8318 gene locus_tag LOCUS_12130 gene pabB 9592 8318 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393598.1 protein_id gnl|my_center|LOCUS_12130 10765 9593 gene locus_tag LOCUS_12140 10765 9593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 11346 10774 gene locus_tag LOCUS_12150 11346 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 12985 11351 gene locus_tag LOCUS_12160 12985 11351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 14242 12995 gene locus_tag LOCUS_12170 14242 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 15150 14239 gene locus_tag LOCUS_12180 15150 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 15860 15195 gene locus_tag LOCUS_12190 15860 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 16585 15857 gene locus_tag LOCUS_12200 16585 15857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 17019 16588 gene locus_tag LOCUS_12210 17019 16588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 <18018 17069 gene locus_tag LOCUS_12220 <18018 17069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798964.1:type II secretion system F family protein >Feature sequence058 1749 52 gene locus_tag LOCUS_12230 1749 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 2296 1829 gene locus_tag LOCUS_12240 2296 1829 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_12240 3517 2324 gene locus_tag LOCUS_12250 3517 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 4006 3614 gene locus_tag LOCUS_12260 4006 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 4175 5959 gene locus_tag LOCUS_12270 4175 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 6162 7778 gene locus_tag LOCUS_12280 gene hutH 6162 7778 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922740.1 protein_id gnl|my_center|LOCUS_12280 7771 9297 gene locus_tag LOCUS_12290 gene hutH 7771 9297 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_12290 9515 9778 gene locus_tag LOCUS_12300 9515 9778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 9833 10180 gene locus_tag LOCUS_12310 9833 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 11168 10419 gene locus_tag LOCUS_12320 11168 10419 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142844.1 protein_id gnl|my_center|LOCUS_12320 <17948 11328 gene locus_tag LOCUS_12330 <17948 11328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:type I polyketide synthase >Feature sequence059 175 1608 gene locus_tag LOCUS_12340 175 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 3338 1620 gene locus_tag LOCUS_12350 3338 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4303 3335 gene locus_tag LOCUS_12360 4303 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 4423 6966 gene locus_tag LOCUS_12370 4423 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7458 6973 gene locus_tag LOCUS_12380 7458 6973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 7571 8713 gene locus_tag LOCUS_12390 7571 8713 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208437.1 protein_id gnl|my_center|LOCUS_12390 10683 8710 gene locus_tag LOCUS_12400 10683 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 10747 13008 gene locus_tag LOCUS_12410 10747 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 16141 12995 gene locus_tag LOCUS_12420 16141 12995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence060 2434 1478 gene locus_tag LOCUS_12430 2434 1478 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966037.1 protein_id gnl|my_center|LOCUS_12430 2463 2873 gene locus_tag LOCUS_12440 2463 2873 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226457.1 protein_id gnl|my_center|LOCUS_12440 3028 4584 gene locus_tag LOCUS_12450 3028 4584 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_12450 5535 6365 gene locus_tag LOCUS_12460 5535 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 6690 6983 gene locus_tag LOCUS_12470 6690 6983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 8308 8165 gene locus_tag LOCUS_12480 8308 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 9936 8629 gene locus_tag LOCUS_12490 9936 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 10458 10042 gene locus_tag LOCUS_12500 10458 10042 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_12500 10693 10983 gene locus_tag LOCUS_12510 10693 10983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 11842 13116 gene locus_tag LOCUS_12520 11842 13116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 13198 13740 gene locus_tag LOCUS_12530 13198 13740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 14483 13983 gene locus_tag LOCUS_12540 14483 13983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 15779 15279 gene locus_tag LOCUS_12550 15779 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 15891 16715 gene locus_tag LOCUS_12560 15891 16715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 17042 16767 gene locus_tag LOCUS_12570 17042 16767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 17218 17397 gene locus_tag LOCUS_12580 17218 17397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence061 1768 602 gene locus_tag LOCUS_12590 1768 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2000 1812 gene locus_tag LOCUS_12600 2000 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 4142 2235 gene locus_tag LOCUS_12610 4142 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4573 6285 gene locus_tag LOCUS_12620 4573 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 7076 6477 gene locus_tag LOCUS_12630 7076 6477 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957824.1 protein_id gnl|my_center|LOCUS_12630 8440 7079 gene locus_tag LOCUS_12640 8440 7079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 10007 8664 gene locus_tag LOCUS_12650 10007 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10086 10712 gene locus_tag LOCUS_12660 10086 10712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 10709 12208 gene locus_tag LOCUS_12670 10709 12208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 12265 14610 gene locus_tag LOCUS_12680 12265 14610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 14721 16208 gene locus_tag LOCUS_12690 14721 16208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 <17499 16322 gene locus_tag LOCUS_12700 <17499 16322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202330.1:class I SAM-dependent methyltransferase >Feature sequence062 1077 559 gene locus_tag LOCUS_12710 1077 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2096 1074 gene locus_tag LOCUS_12720 2096 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 2344 3006 gene locus_tag LOCUS_12730 2344 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4038 3139 gene locus_tag LOCUS_12740 4038 3139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4082 6502 gene locus_tag LOCUS_12750 4082 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 7472 6510 gene locus_tag LOCUS_12760 7472 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 8672 7533 gene locus_tag LOCUS_12770 8672 7533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 9982 8669 gene locus_tag LOCUS_12780 9982 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10025 11098 gene locus_tag LOCUS_12790 10025 11098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 11371 11138 gene locus_tag LOCUS_12800 11371 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 11709 12047 gene locus_tag LOCUS_12810 11709 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 11984 12358 gene locus_tag LOCUS_12820 11984 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 13404 12589 gene locus_tag LOCUS_12830 13404 12589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 13910 13401 gene locus_tag LOCUS_12840 13910 13401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 14419 13910 gene locus_tag LOCUS_12850 14419 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 15852 14437 gene locus_tag LOCUS_12860 15852 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 <17313 15849 gene locus_tag LOCUS_12870 <17313 15849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921619.1:DUF1592 domain-containing protein >Feature sequence063 1119 2510 gene locus_tag LOCUS_12880 1119 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2541 3623 gene locus_tag LOCUS_12890 2541 3623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3925 3620 gene locus_tag LOCUS_12900 3925 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 4689 3928 gene locus_tag LOCUS_12910 4689 3928 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_12910 4965 4889 gene locus_tag LOCUS_t00090 4965 4889 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5548 5033 gene locus_tag LOCUS_12920 5548 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 6207 5545 gene locus_tag LOCUS_12930 6207 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 7071 6304 gene locus_tag LOCUS_12940 7071 6304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 8219 7155 gene locus_tag LOCUS_12950 8219 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 8466 8251 gene locus_tag LOCUS_12960 8466 8251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 10172 8463 gene locus_tag LOCUS_12970 10172 8463 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_12970 12083 10251 gene locus_tag LOCUS_12980 gene sppA 12083 10251 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_12980 13139 12282 gene locus_tag LOCUS_12990 13139 12282 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_12990 13469 14074 gene locus_tag LOCUS_13000 13469 14074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 14099 15358 gene locus_tag LOCUS_13010 14099 15358 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_13010 15500 17050 gene locus_tag LOCUS_13020 gene purH 15500 17050 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105151.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence064 1734 3884 gene locus_tag LOCUS_13030 1734 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4446 3871 gene locus_tag LOCUS_13040 4446 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 6142 4460 gene locus_tag LOCUS_13050 6142 4460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 7015 6296 gene locus_tag LOCUS_13060 7015 6296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 7408 7151 gene locus_tag LOCUS_13070 7408 7151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 7484 8440 gene locus_tag LOCUS_13080 7484 8440 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_13080 12406 8747 gene locus_tag LOCUS_13090 gene metH 12406 8747 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_13090 12646 14484 gene locus_tag LOCUS_13100 12646 14484 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_13100 16591 14516 gene locus_tag LOCUS_13110 16591 14516 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140133.1 protein_id gnl|my_center|LOCUS_13110 16936 16607 gene locus_tag LOCUS_13120 16936 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence065 1538 729 gene locus_tag LOCUS_13130 1538 729 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_13130 2076 1492 gene locus_tag LOCUS_13140 2076 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3304 2096 gene locus_tag LOCUS_13150 3304 2096 CDS product flavohemoglobin expression-modulating QEGLA motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038459.1 protein_id gnl|my_center|LOCUS_13150 4488 3331 gene locus_tag LOCUS_13160 4488 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13160 4995 4651 gene locus_tag LOCUS_13170 4995 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13170 6272 5181 gene locus_tag LOCUS_13180 6272 5181 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112233.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13180 6518 6276 gene locus_tag LOCUS_13190 6518 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 7214 6525 gene locus_tag LOCUS_13200 7214 6525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7371 9236 gene locus_tag LOCUS_13210 7371 9236 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_13210 9288 10316 gene locus_tag LOCUS_13220 9288 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 12008 10428 gene locus_tag LOCUS_13230 12008 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 11898 12125 gene locus_tag LOCUS_13240 11898 12125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 12143 13468 gene locus_tag LOCUS_13250 12143 13468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 14786 13521 gene locus_tag LOCUS_13260 14786 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 16327 14786 gene locus_tag LOCUS_13270 16327 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence066 2719 1961 gene locus_tag LOCUS_13280 2719 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13280 7513 2726 gene locus_tag LOCUS_13290 7513 2726 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_13290 7748 8455 gene locus_tag LOCUS_13300 7748 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 8442 10058 gene locus_tag LOCUS_13310 8442 10058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 10592 10101 gene locus_tag LOCUS_13320 10592 10101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 13700 10656 gene locus_tag LOCUS_13330 13700 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 15187 13898 gene locus_tag LOCUS_13340 15187 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 15186 15512 gene locus_tag LOCUS_13350 15186 15512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 15797 16138 gene locus_tag LOCUS_13360 15797 16138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 16265 16507 gene locus_tag LOCUS_13370 16265 16507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence067 1 270 gene locus_tag LOCUS_13380 1 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 390 665 gene locus_tag LOCUS_13390 390 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 725 2404 gene locus_tag LOCUS_13400 725 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3907 2411 gene locus_tag LOCUS_13410 3907 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3917 5227 gene locus_tag LOCUS_13420 3917 5227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 5224 6147 gene locus_tag LOCUS_13430 5224 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 6163 7626 gene locus_tag LOCUS_13440 6163 7626 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615936.1 protein_id gnl|my_center|LOCUS_13440 8423 7596 gene locus_tag LOCUS_13450 gene lpxC 8423 7596 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_13450 8511 9002 gene locus_tag LOCUS_13460 gene ruvC 8511 9002 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084351.1 protein_id gnl|my_center|LOCUS_13460 8999 9610 gene locus_tag LOCUS_13470 gene ruvA 8999 9610 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_13470 9607 10623 gene locus_tag LOCUS_13480 gene ruvB 9607 10623 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194268.1 protein_id gnl|my_center|LOCUS_13480 10620 11042 gene locus_tag LOCUS_13490 10620 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 11437 11045 gene locus_tag LOCUS_13500 11437 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 11321 11542 gene locus_tag LOCUS_13510 11321 11542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 11536 11847 gene locus_tag LOCUS_13520 11536 11847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 12088 13059 gene locus_tag LOCUS_13530 12088 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 13056 13619 gene locus_tag LOCUS_13540 13056 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 14672 13632 gene locus_tag LOCUS_13550 14672 13632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 15253 16215 gene locus_tag LOCUS_13560 15253 16215 CDS product 3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275332.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence068 817 71 gene locus_tag LOCUS_13570 817 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1049 2011 gene locus_tag LOCUS_13580 1049 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 3498 2008 gene locus_tag LOCUS_13590 3498 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3741 4535 gene locus_tag LOCUS_13600 3741 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5257 5066 gene locus_tag LOCUS_13610 5257 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13610 5622 5353 gene locus_tag LOCUS_13620 5622 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 7678 5861 gene locus_tag LOCUS_13630 7678 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7950 10409 gene locus_tag LOCUS_13640 7950 10409 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000744482.1 protein_id gnl|my_center|LOCUS_13640 10424 11038 gene locus_tag LOCUS_13650 10424 11038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 11504 11103 gene locus_tag LOCUS_13660 11504 11103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 12405 11569 gene locus_tag LOCUS_13670 12405 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 13811 12633 gene locus_tag LOCUS_13680 13811 12633 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258647.1 protein_id gnl|my_center|LOCUS_13680 14105 14491 gene locus_tag LOCUS_13690 14105 14491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 14717 14983 gene locus_tag LOCUS_13700 14717 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 15008 15655 gene locus_tag LOCUS_13710 15008 15655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 16066 15671 gene locus_tag LOCUS_13720 16066 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence069 <1 627 gene locus_tag LOCUS_13730 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921242.1:peptide MFS transporter 1609 704 gene locus_tag LOCUS_13740 gene rocF 1609 704 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711572.1 protein_id gnl|my_center|LOCUS_13740 1803 2432 gene locus_tag LOCUS_13750 1803 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2669 3124 gene locus_tag LOCUS_13760 2669 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 3197 3682 gene locus_tag LOCUS_13770 3197 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3859 3671 gene locus_tag LOCUS_13780 3859 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3971 4597 gene locus_tag LOCUS_13790 3971 4597 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869908.1 protein_id gnl|my_center|LOCUS_13790 4724 5548 gene locus_tag LOCUS_13800 gene mutM 4724 5548 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973422.1 protein_id gnl|my_center|LOCUS_13800 5602 5808 gene locus_tag LOCUS_13810 gene rpsR 5602 5808 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 protein_id gnl|my_center|LOCUS_13810 7250 5880 gene locus_tag LOCUS_13820 7250 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 11185 7550 gene locus_tag LOCUS_13830 11185 7550 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087047.1 protein_id gnl|my_center|LOCUS_13830 13365 11749 gene locus_tag LOCUS_13840 13365 11749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 14960 13362 gene locus_tag LOCUS_13850 14960 13362 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence070 1065 1256 gene locus_tag LOCUS_13860 1065 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 5425 1307 gene locus_tag LOCUS_13870 5425 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 6723 5455 gene locus_tag LOCUS_13880 6723 5455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 6868 7251 gene locus_tag LOCUS_13890 6868 7251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 7617 7357 gene locus_tag LOCUS_13900 7617 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 7854 7636 gene locus_tag LOCUS_13910 7854 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 7925 8482 gene locus_tag LOCUS_13920 7925 8482 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222801.1 protein_id gnl|my_center|LOCUS_13920 8485 9996 gene locus_tag LOCUS_13930 8485 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 10433 9933 gene locus_tag LOCUS_13940 10433 9933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13940 10930 11319 gene locus_tag LOCUS_13950 10930 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 12233 14770 gene locus_tag LOCUS_13960 12233 14770 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039318110.1 protein_id gnl|my_center|LOCUS_13960 15168 15698 gene locus_tag LOCUS_13970 15168 15698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 15689 16102 gene locus_tag LOCUS_13980 15689 16102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence071 21 1361 gene locus_tag LOCUS_13990 21 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1772 1900 gene locus_tag LOCUS_14000 1772 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 2877 1924 gene locus_tag LOCUS_14010 2877 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 3131 2877 gene locus_tag LOCUS_14020 3131 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3422 3790 gene locus_tag LOCUS_14030 3422 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 4892 3822 gene locus_tag LOCUS_14040 4892 3822 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106059.1 protein_id gnl|my_center|LOCUS_14040 5362 4892 gene locus_tag LOCUS_14050 5362 4892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5762 5568 gene locus_tag LOCUS_14060 5762 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 6037 7224 gene locus_tag LOCUS_14070 6037 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 7283 7756 gene locus_tag LOCUS_14080 7283 7756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 8803 7832 gene locus_tag LOCUS_14090 8803 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9140 8832 gene locus_tag LOCUS_14100 9140 8832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14100 9332 9165 gene locus_tag LOCUS_14110 9332 9165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14110 10670 10044 gene locus_tag LOCUS_14120 10670 10044 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105706.1 protein_id gnl|my_center|LOCUS_14120 11047 10667 gene locus_tag LOCUS_14130 11047 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 11528 11109 gene locus_tag LOCUS_14140 11528 11109 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706203.1 protein_id gnl|my_center|LOCUS_14140 12778 11525 gene locus_tag LOCUS_14150 gene guaD 12778 11525 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920470.1 protein_id gnl|my_center|LOCUS_14150 12812 13243 gene locus_tag LOCUS_14160 12812 13243 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_14160 13240 13749 gene locus_tag LOCUS_14170 13240 13749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence072 1333 209 gene locus_tag LOCUS_14180 1333 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919038.1 protein_id gnl|my_center|LOCUS_14180 3384 1561 gene locus_tag LOCUS_14190 gene glmS 3384 1561 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328387.1 protein_id gnl|my_center|LOCUS_14190 5452 3428 gene locus_tag LOCUS_14200 5452 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 7211 5508 gene locus_tag LOCUS_14210 gene msbA 7211 5508 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_14210 8671 7208 gene locus_tag LOCUS_14220 8671 7208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 8758 9954 gene locus_tag LOCUS_14230 8758 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 9973 10305 gene locus_tag LOCUS_14240 9973 10305 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705759.1 protein_id gnl|my_center|LOCUS_14240 11354 10302 gene locus_tag LOCUS_14250 11354 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 11901 11371 gene locus_tag LOCUS_14260 11901 11371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 12332 11898 gene locus_tag LOCUS_14270 12332 11898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 12372 12527 gene locus_tag LOCUS_14280 12372 12527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 13552 12767 gene locus_tag LOCUS_14290 gene lpxA 13552 12767 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_14290 14037 13606 gene locus_tag LOCUS_14300 gene fabZ 14037 13606 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257317.1 protein_id gnl|my_center|LOCUS_14300 14921 14034 gene locus_tag LOCUS_14310 14921 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 15565 15062 gene locus_tag LOCUS_14320 15565 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence073 <1 666 gene locus_tag LOCUS_14330 <1 666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein 663 2399 gene locus_tag LOCUS_14340 663 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2453 2788 gene locus_tag LOCUS_14350 2453 2788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 4619 2919 gene locus_tag LOCUS_14360 4619 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 4720 6597 gene locus_tag LOCUS_14370 4720 6597 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183692.1 protein_id gnl|my_center|LOCUS_14370 6776 8386 gene locus_tag LOCUS_14380 6776 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 8374 9378 gene locus_tag LOCUS_14390 8374 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 10730 10002 gene locus_tag LOCUS_14400 10730 10002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 11607 11131 gene locus_tag LOCUS_14410 11607 11131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 11799 12893 gene locus_tag LOCUS_14420 11799 12893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 13092 14021 gene locus_tag LOCUS_14430 13092 14021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 15853 14111 gene locus_tag LOCUS_14440 15853 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence074 <1 986 gene locus_tag LOCUS_14450 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein 1782 1042 gene locus_tag LOCUS_14460 1782 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2504 1896 gene locus_tag LOCUS_14470 2504 1896 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048126054.1 protein_id gnl|my_center|LOCUS_14470 2912 5563 gene locus_tag LOCUS_14480 2912 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6442 5564 gene locus_tag LOCUS_14490 6442 5564 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_14490 6683 8461 gene locus_tag LOCUS_14500 6683 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 8504 10381 gene locus_tag LOCUS_14510 8504 10381 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_14510 10381 11430 gene locus_tag LOCUS_14520 gene pyrC 10381 11430 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126536.1 protein_id gnl|my_center|LOCUS_14520 11617 11928 gene locus_tag LOCUS_14530 11617 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 11977 13677 gene locus_tag LOCUS_14540 11977 13677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 13674 15542 gene locus_tag LOCUS_14550 13674 15542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence075 1510 554 gene locus_tag LOCUS_14560 1510 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 1639 2298 gene locus_tag LOCUS_14570 1639 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 2543 2899 gene locus_tag LOCUS_14580 2543 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 3206 3613 gene locus_tag LOCUS_14590 3206 3613 CDS product DUF454 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095896.1 protein_id gnl|my_center|LOCUS_14590 3672 4589 gene locus_tag LOCUS_14600 3672 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4669 5010 gene locus_tag LOCUS_14610 4669 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 5062 6600 gene locus_tag LOCUS_14620 gene paaP 5062 6600 CDS product aminopeptidase PaaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101464.1 protein_id gnl|my_center|LOCUS_14620 6827 7309 gene locus_tag LOCUS_14630 6827 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 8570 7491 gene locus_tag LOCUS_14640 8570 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 8750 9880 gene locus_tag LOCUS_14650 8750 9880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 10073 13411 gene locus_tag LOCUS_14660 10073 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence076 1798 560 gene locus_tag LOCUS_14670 1798 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 2593 1805 gene locus_tag LOCUS_14680 2593 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 2724 3296 gene locus_tag LOCUS_14690 gene tadA 2724 3296 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703380.1 protein_id gnl|my_center|LOCUS_14690 3274 3363 gene locus_tag LOCUS_t00100 3274 3363 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3393 3480 gene locus_tag LOCUS_t00110 3393 3480 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4247 3645 gene locus_tag LOCUS_14700 4247 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4444 4244 gene locus_tag LOCUS_14710 4444 4244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 5034 4441 gene locus_tag LOCUS_14720 gene recR 5034 4441 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391578.1 protein_id gnl|my_center|LOCUS_14720 5354 5034 gene locus_tag LOCUS_14730 5354 5034 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706069.1 protein_id gnl|my_center|LOCUS_14730 7107 5356 gene locus_tag LOCUS_14740 gene dnaX 7107 5356 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_14740 8834 7200 gene locus_tag LOCUS_14750 gene asnB 8834 7200 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931323.1 protein_id gnl|my_center|LOCUS_14750 9693 9049 gene locus_tag LOCUS_14760 9693 9049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 9796 11946 gene locus_tag LOCUS_14770 9796 11946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence077 1355 2170 gene locus_tag LOCUS_14780 1355 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2254 4281 gene locus_tag LOCUS_14790 2254 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 4488 5855 gene locus_tag LOCUS_14800 4488 5855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 7352 6021 gene locus_tag LOCUS_14810 7352 6021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 8455 7352 gene locus_tag LOCUS_14820 8455 7352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 8700 9449 gene locus_tag LOCUS_14830 8700 9449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 11282 9456 gene locus_tag LOCUS_14840 11282 9456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 11430 12647 gene locus_tag LOCUS_14850 11430 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 13143 12628 gene locus_tag LOCUS_14860 13143 12628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 13043 13345 gene locus_tag LOCUS_14870 13043 13345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 13579 15159 gene locus_tag LOCUS_14880 13579 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence078 <1 1168 gene locus_tag LOCUS_14890 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070590.1:MFS transporter 1627 1250 gene locus_tag LOCUS_14900 gene apaG 1627 1250 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172741.1 protein_id gnl|my_center|LOCUS_14900 1738 2406 gene locus_tag LOCUS_14910 1738 2406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796460.1 protein_id gnl|my_center|LOCUS_14910 2403 3626 gene locus_tag LOCUS_14920 2403 3626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_14920 3629 4882 gene locus_tag LOCUS_14930 3629 4882 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_14930 4890 5966 gene locus_tag LOCUS_14940 4890 5966 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_14940 6357 7229 gene locus_tag LOCUS_14950 6357 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7323 7991 gene locus_tag LOCUS_14960 7323 7991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8360 9013 gene locus_tag LOCUS_14970 8360 9013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 10106 9021 gene locus_tag LOCUS_14980 10106 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10484 10798 gene locus_tag LOCUS_14990 10484 10798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 10856 12403 gene locus_tag LOCUS_15000 10856 12403 CDS product FadD3 family acyl-CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083087609.1 protein_id gnl|my_center|LOCUS_15000 12431 13198 gene locus_tag LOCUS_15010 12431 13198 CDS product enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225235.1 protein_id gnl|my_center|LOCUS_15010 13198 13992 gene locus_tag LOCUS_15020 13198 13992 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225236.1 protein_id gnl|my_center|LOCUS_15020 13989 14690 gene locus_tag LOCUS_15030 13989 14690 CDS product CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730967.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence079 1372 1647 gene locus_tag LOCUS_15040 1372 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 2305 2123 gene locus_tag LOCUS_15050 2305 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2481 3683 gene locus_tag LOCUS_15060 2481 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 4344 3742 gene locus_tag LOCUS_15070 4344 3742 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731070.1 protein_id gnl|my_center|LOCUS_15070 6119 4341 gene locus_tag LOCUS_15080 6119 4341 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539143.1 protein_id gnl|my_center|LOCUS_15080 6540 7460 gene locus_tag LOCUS_15090 6540 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 7787 8059 gene locus_tag LOCUS_15100 7787 8059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 10169 8109 gene locus_tag LOCUS_15110 10169 8109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 10197 10649 gene locus_tag LOCUS_15120 10197 10649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 10630 11061 gene locus_tag LOCUS_15130 10630 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 11264 13006 gene locus_tag LOCUS_15140 11264 13006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence080 1701 2618 gene locus_tag LOCUS_15150 1701 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4068 2656 gene locus_tag LOCUS_15160 4068 2656 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900628.1 protein_id gnl|my_center|LOCUS_15160 6458 4065 gene locus_tag LOCUS_15170 6458 4065 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002396915.1 protein_id gnl|my_center|LOCUS_15170 7279 6455 gene locus_tag LOCUS_15180 7279 6455 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188832.1 protein_id gnl|my_center|LOCUS_15180 7350 8786 gene locus_tag LOCUS_15190 7350 8786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 8810 9358 gene locus_tag LOCUS_15200 8810 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 9366 9863 gene locus_tag LOCUS_15210 9366 9863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 9860 10942 gene locus_tag LOCUS_15220 gene bioF 9860 10942 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943267.1 protein_id gnl|my_center|LOCUS_15220 11143 12012 gene locus_tag LOCUS_15230 11143 12012 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_15230 12031 12789 gene locus_tag LOCUS_15240 12031 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 12789 14096 gene locus_tag LOCUS_15250 gene bioA 12789 14096 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048655595.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence081 <1 1747 gene locus_tag LOCUS_15260 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011026868.1:type I polyketide synthase 1870 2148 gene locus_tag LOCUS_15270 1870 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 4675 2219 gene locus_tag LOCUS_15280 4675 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5850 4747 gene locus_tag LOCUS_15290 5850 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 6431 5901 gene locus_tag LOCUS_15300 6431 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8361 6568 gene locus_tag LOCUS_15310 8361 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 8360 9229 gene locus_tag LOCUS_15320 gene modA 8360 9229 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263179.1 protein_id gnl|my_center|LOCUS_15320 9265 9894 gene locus_tag LOCUS_15330 gene modB 9265 9894 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553595.1 protein_id gnl|my_center|LOCUS_15330 9887 10981 gene locus_tag LOCUS_15340 gene modC 9887 10981 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067038.1 protein_id gnl|my_center|LOCUS_15340 11086 12093 gene locus_tag LOCUS_15350 11086 12093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 12117 12266 gene locus_tag LOCUS_15360 12117 12266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 13357 12422 gene locus_tag LOCUS_15370 13357 12422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 14334 13357 gene locus_tag LOCUS_15380 14334 13357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 >Feature sequence082 949 554 gene locus_tag LOCUS_15390 gene mutT 949 554 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932370.1 protein_id gnl|my_center|LOCUS_15390 1031 1492 gene locus_tag LOCUS_15400 1031 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 1493 2407 gene locus_tag LOCUS_15410 1493 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 2542 3462 gene locus_tag LOCUS_15420 2542 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4280 3459 gene locus_tag LOCUS_15430 gene dapF 4280 3459 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_15430 5041 4280 gene locus_tag LOCUS_15440 5041 4280 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975152.1 protein_id gnl|my_center|LOCUS_15440 6961 5078 gene locus_tag LOCUS_15450 6961 5078 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081158863.1 protein_id gnl|my_center|LOCUS_15450 7827 6958 gene locus_tag LOCUS_15460 7827 6958 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_15460 8585 7824 gene locus_tag LOCUS_15470 8585 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 10160 8604 gene locus_tag LOCUS_15480 10160 8604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 11626 10184 gene locus_tag LOCUS_15490 gene rlmD 11626 10184 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722228.1 protein_id gnl|my_center|LOCUS_15490 11886 13016 gene locus_tag LOCUS_15500 11886 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 14221 13013 gene locus_tag LOCUS_15510 14221 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence083 461 1753 gene locus_tag LOCUS_15520 461 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 1756 2055 gene locus_tag LOCUS_15530 1756 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2082 2381 gene locus_tag LOCUS_15540 2082 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 2383 2727 gene locus_tag LOCUS_15550 2383 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2669 3532 gene locus_tag LOCUS_15560 2669 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 5077 3536 gene locus_tag LOCUS_15570 5077 3536 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094785.1 protein_id gnl|my_center|LOCUS_15570 5248 5685 gene locus_tag LOCUS_15580 5248 5685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 6846 5722 gene locus_tag LOCUS_15590 6846 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 7637 6843 gene locus_tag LOCUS_15600 7637 6843 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086933.1 protein_id gnl|my_center|LOCUS_15600 9357 7648 gene locus_tag LOCUS_15610 9357 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 10200 9508 gene locus_tag LOCUS_15620 gene frnE 10200 9508 CDS product protein disulfide isomerase FrnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887304.1 protein_id gnl|my_center|LOCUS_15620 10587 10354 gene locus_tag LOCUS_15630 10587 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 10634 10927 gene locus_tag LOCUS_15640 10634 10927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11163 11774 gene locus_tag LOCUS_15650 11163 11774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 11879 12376 gene locus_tag LOCUS_15660 11879 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 12421 12801 gene locus_tag LOCUS_15670 12421 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 14714 12798 gene locus_tag LOCUS_15680 14714 12798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence084 4 1305 gene locus_tag LOCUS_15690 4 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1371 2213 gene locus_tag LOCUS_15700 1371 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 2223 2819 gene locus_tag LOCUS_15710 2223 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 3259 2960 gene locus_tag LOCUS_15720 3259 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3198 3995 gene locus_tag LOCUS_15730 3198 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4748 4002 gene locus_tag LOCUS_15740 4748 4002 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403948.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15740 6162 4852 gene locus_tag LOCUS_15750 6162 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7521 6175 gene locus_tag LOCUS_15760 7521 6175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 8812 7649 gene locus_tag LOCUS_15770 8812 7649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 10220 9093 gene locus_tag LOCUS_15780 10220 9093 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405145.1 protein_id gnl|my_center|LOCUS_15780 10806 10213 gene locus_tag LOCUS_15790 10806 10213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 11045 13579 gene locus_tag LOCUS_15800 11045 13579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 14379 13591 gene locus_tag LOCUS_15810 14379 13591 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256218.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence085 <1 1735 gene locus_tag LOCUS_15820 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein 2560 2991 gene locus_tag LOCUS_15830 2560 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3129 3914 gene locus_tag LOCUS_15840 3129 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 3967 6396 gene locus_tag LOCUS_15850 3967 6396 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615531.1 protein_id gnl|my_center|LOCUS_15850 6393 7952 gene locus_tag LOCUS_15860 6393 7952 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902486.1 protein_id gnl|my_center|LOCUS_15860 8568 8119 gene locus_tag LOCUS_15870 8568 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 10243 8792 gene locus_tag LOCUS_15880 10243 8792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 11374 10715 gene locus_tag LOCUS_15890 11374 10715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 12334 11717 gene locus_tag LOCUS_15900 12334 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 13056 12631 gene locus_tag LOCUS_15910 13056 12631 CDS product BLUF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055933.1 protein_id gnl|my_center|LOCUS_15910 13923 13108 gene locus_tag LOCUS_15920 13923 13108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence086 65 823 gene locus_tag LOCUS_15930 65 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 823 2760 gene locus_tag LOCUS_15940 823 2760 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_15940 2757 3689 gene locus_tag LOCUS_15950 2757 3689 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_15950 3686 4639 gene locus_tag LOCUS_15960 3686 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4919 4626 gene locus_tag LOCUS_15970 4919 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5309 5662 gene locus_tag LOCUS_15980 5309 5662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 5876 6868 gene locus_tag LOCUS_15990 5876 6868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 6862 8982 gene locus_tag LOCUS_16000 6862 8982 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_16000 8995 10215 gene locus_tag LOCUS_16010 8995 10215 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616381.1 protein_id gnl|my_center|LOCUS_16010 10363 10587 gene locus_tag LOCUS_16020 10363 10587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 10611 11489 gene locus_tag LOCUS_16030 10611 11489 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence087 7061 5982 gene locus_tag LOCUS_16040 7061 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7141 7356 gene locus_tag LOCUS_16050 7141 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 8343 7360 gene locus_tag LOCUS_16060 8343 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 8747 10354 gene locus_tag LOCUS_16070 gene fumB 8747 10354 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066699.1 protein_id gnl|my_center|LOCUS_16070 10375 10812 gene locus_tag LOCUS_16080 10375 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 11794 10928 gene locus_tag LOCUS_16090 11794 10928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 12053 13147 gene locus_tag LOCUS_16100 gene carA 12053 13147 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660544.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence088 1550 117 gene locus_tag LOCUS_16110 1550 117 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767052.1 protein_id gnl|my_center|LOCUS_16110 1630 2142 gene locus_tag LOCUS_16120 1630 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 2612 2046 gene locus_tag LOCUS_16130 2612 2046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084078882.1 protein_id gnl|my_center|LOCUS_16130 3886 2609 gene locus_tag LOCUS_16140 gene eno 3886 2609 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_16140 3960 5999 gene locus_tag LOCUS_16150 3960 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6014 6754 gene locus_tag LOCUS_16160 6014 6754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 6820 7143 gene locus_tag LOCUS_16170 6820 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 7143 7937 gene locus_tag LOCUS_16180 7143 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 7985 8857 gene locus_tag LOCUS_16190 7985 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 8882 9232 gene locus_tag LOCUS_16200 8882 9232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 9272 10531 gene locus_tag LOCUS_16210 9272 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 12224 10545 gene locus_tag LOCUS_16220 gene ettA 12224 10545 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_16220 12569 14095 gene locus_tag LOCUS_16230 12569 14095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence089 703 1728 gene locus_tag LOCUS_16240 703 1728 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070877.1 protein_id gnl|my_center|LOCUS_16240 1721 2977 gene locus_tag LOCUS_16250 gene arsJ 1721 2977 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181712457.1 protein_id gnl|my_center|LOCUS_16250 3466 5325 gene locus_tag LOCUS_16260 3466 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5888 6439 gene locus_tag LOCUS_16270 5888 6439 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107186.1 protein_id gnl|my_center|LOCUS_16270 6436 6999 gene locus_tag LOCUS_16280 6436 6999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 6996 8168 gene locus_tag LOCUS_16290 6996 8168 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258998.1 protein_id gnl|my_center|LOCUS_16290 10843 8720 gene locus_tag LOCUS_16300 10843 8720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 11963 11202 gene locus_tag LOCUS_16310 11963 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 12873 12202 gene locus_tag LOCUS_16320 12873 12202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 13723 12965 gene locus_tag LOCUS_16330 13723 12965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence090 357 1340 gene locus_tag LOCUS_16340 357 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1443 1844 gene locus_tag LOCUS_16350 1443 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2855 1914 gene locus_tag LOCUS_16360 gene thrB 2855 1914 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218156.1 protein_id gnl|my_center|LOCUS_16360 3202 2927 gene locus_tag LOCUS_16370 3202 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 4057 3299 gene locus_tag LOCUS_16380 4057 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4806 4078 gene locus_tag LOCUS_16390 4806 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 4873 5577 gene locus_tag LOCUS_16400 4873 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5595 6581 gene locus_tag LOCUS_16410 5595 6581 CDS product medium chain dehydrogenase/reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265765.1 protein_id gnl|my_center|LOCUS_16410 6817 9309 gene locus_tag LOCUS_16420 6817 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 10806 9661 gene locus_tag LOCUS_16430 gene rnd 10806 9661 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_16430 11297 11064 gene locus_tag LOCUS_16440 11297 11064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 <14303 12078 gene locus_tag LOCUS_16450 <14303 12078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence091 77 883 gene locus_tag LOCUS_16460 gene proC 77 883 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_16460 1833 880 gene locus_tag LOCUS_16470 1833 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2596 2078 gene locus_tag LOCUS_16480 2596 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3566 2697 gene locus_tag LOCUS_16490 3566 2697 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187713770.1 protein_id gnl|my_center|LOCUS_16490 4911 3583 gene locus_tag LOCUS_16500 4911 3583 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838492.1 protein_id gnl|my_center|LOCUS_16500 5031 6329 gene locus_tag LOCUS_16510 5031 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 6329 7378 gene locus_tag LOCUS_16520 6329 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 7567 8586 gene locus_tag LOCUS_16530 7567 8586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8586 9539 gene locus_tag LOCUS_16540 8586 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 9769 9536 gene locus_tag LOCUS_16550 9769 9536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 12336 9775 gene locus_tag LOCUS_16560 12336 9775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 13763 12333 gene locus_tag LOCUS_16570 13763 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence092 4359 196 gene locus_tag LOCUS_16580 4359 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 5150 4452 gene locus_tag LOCUS_16590 5150 4452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_16590 6409 5159 gene locus_tag LOCUS_16600 6409 5159 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_16600 7527 6406 gene locus_tag LOCUS_16610 7527 6406 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_16610 8712 7858 gene locus_tag LOCUS_16620 8712 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9986 8778 gene locus_tag LOCUS_16630 9986 8778 CDS product threonine/serine exporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035879.1 protein_id gnl|my_center|LOCUS_16630 10058 10549 gene locus_tag LOCUS_16640 10058 10549 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704464.1 protein_id gnl|my_center|LOCUS_16640 10559 12667 gene locus_tag LOCUS_16650 10559 12667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 12670 13548 gene locus_tag LOCUS_16660 12670 13548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence093 2244 1381 gene locus_tag LOCUS_16670 2244 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 3107 2244 gene locus_tag LOCUS_16680 3107 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3270 4766 gene locus_tag LOCUS_16690 3270 4766 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258512.1 protein_id gnl|my_center|LOCUS_16690 7448 4815 gene locus_tag LOCUS_16700 7448 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 8590 7568 gene locus_tag LOCUS_16710 8590 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 9585 8587 gene locus_tag LOCUS_16720 9585 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 12369 9595 gene locus_tag LOCUS_16730 12369 9595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 12684 13334 gene locus_tag LOCUS_16740 12684 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence094 1314 451 gene locus_tag LOCUS_16750 1314 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 1523 1972 gene locus_tag LOCUS_16760 1523 1972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 2850 1969 gene locus_tag LOCUS_16770 2850 1969 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259047.1 protein_id gnl|my_center|LOCUS_16770 5777 2832 gene locus_tag LOCUS_16780 5777 2832 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_16780 6671 5793 gene locus_tag LOCUS_16790 6671 5793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16790 7433 6711 gene locus_tag LOCUS_16800 7433 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16800 8454 7486 gene locus_tag LOCUS_16810 8454 7486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 8683 10434 gene locus_tag LOCUS_16820 8683 10434 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937364.1 protein_id gnl|my_center|LOCUS_16820 11468 10407 gene locus_tag LOCUS_16830 gene dinB 11468 10407 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989855.1 protein_id gnl|my_center|LOCUS_16830 11823 11587 gene locus_tag LOCUS_16840 11823 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 11807 12421 gene locus_tag LOCUS_16850 11807 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 12422 12625 gene locus_tag LOCUS_16860 12422 12625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 12693 13085 gene locus_tag LOCUS_16870 12693 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence095 111 479 gene locus_tag LOCUS_16880 gene rpsM 111 479 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633368.1 protein_id gnl|my_center|LOCUS_16880 509 898 gene locus_tag LOCUS_16890 gene rpsK 509 898 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938622.1 protein_id gnl|my_center|LOCUS_16890 1039 2046 gene locus_tag LOCUS_16900 1039 2046 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_16900 2066 2611 gene locus_tag LOCUS_16910 2066 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3124 2576 gene locus_tag LOCUS_16920 3124 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 3302 3643 gene locus_tag LOCUS_16930 3302 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3692 3774 gene locus_tag LOCUS_t00120 3692 3774 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4646 3885 gene locus_tag LOCUS_16940 gene tpiA 4646 3885 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259656.1 protein_id gnl|my_center|LOCUS_16940 5839 4646 gene locus_tag LOCUS_16950 5839 4646 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391807.1 protein_id gnl|my_center|LOCUS_16950 6843 5836 gene locus_tag LOCUS_16960 gene gap 6843 5836 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_16960 7004 8596 gene locus_tag LOCUS_16970 7004 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941782.1 protein_id gnl|my_center|LOCUS_16970 9033 8593 gene locus_tag LOCUS_16980 9033 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9432 9358 gene locus_tag LOCUS_t00130 9432 9358 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10815 9469 gene locus_tag LOCUS_16990 10815 9469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 11834 10812 gene locus_tag LOCUS_17000 11834 10812 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228062.1 protein_id gnl|my_center|LOCUS_17000 12433 11837 gene locus_tag LOCUS_17010 gene pgsA 12433 11837 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020863053.1 protein_id gnl|my_center|LOCUS_17010 12985 12446 gene locus_tag LOCUS_17020 12985 12446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence096 200 1114 gene locus_tag LOCUS_17030 200 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 2753 1224 gene locus_tag LOCUS_17040 gene ahcY 2753 1224 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975788.1 protein_id gnl|my_center|LOCUS_17040 2844 3773 gene locus_tag LOCUS_17050 2844 3773 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937909.1 protein_id gnl|my_center|LOCUS_17050 4592 3882 gene locus_tag LOCUS_17060 4592 3882 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030174.1 protein_id gnl|my_center|LOCUS_17060 6094 4592 gene locus_tag LOCUS_17070 6094 4592 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941596.1 protein_id gnl|my_center|LOCUS_17070 7833 6094 gene locus_tag LOCUS_17080 7833 6094 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941595.1 protein_id gnl|my_center|LOCUS_17080 7978 8850 gene locus_tag LOCUS_17090 7978 8850 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895332.1 protein_id gnl|my_center|LOCUS_17090 10629 8851 gene locus_tag LOCUS_17100 10629 8851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 11017 10631 gene locus_tag LOCUS_17110 11017 10631 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_17110 11157 11846 gene locus_tag LOCUS_17120 11157 11846 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_17120 13440 11848 gene locus_tag LOCUS_17130 13440 11848 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882673.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence097 770 2947 gene locus_tag LOCUS_17140 770 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3029 4297 gene locus_tag LOCUS_17150 3029 4297 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073021.1 protein_id gnl|my_center|LOCUS_17150 5087 4302 gene locus_tag LOCUS_17160 5087 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 5312 6538 gene locus_tag LOCUS_17170 5312 6538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 6645 8654 gene locus_tag LOCUS_17180 6645 8654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 8661 9935 gene locus_tag LOCUS_17190 8661 9935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 11222 9948 gene locus_tag LOCUS_17200 gene preA 11222 9948 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_17200 12523 11222 gene locus_tag LOCUS_17210 12523 11222 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142081328.1 protein_id gnl|my_center|LOCUS_17210 12566 13018 gene locus_tag LOCUS_17220 12566 13018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17220 13115 13714 gene locus_tag LOCUS_17230 13115 13714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17230 >Feature sequence098 <1 1972 gene locus_tag LOCUS_17240 <1 1972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter 2280 1969 gene locus_tag LOCUS_17250 2280 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 2565 2290 gene locus_tag LOCUS_17260 2565 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 3794 2604 gene locus_tag LOCUS_17270 3794 2604 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020871.1 protein_id gnl|my_center|LOCUS_17270 4869 3874 gene locus_tag LOCUS_17280 4869 3874 CDS product glutamine synthetase beta-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028199.1 protein_id gnl|my_center|LOCUS_17280 5471 5082 gene locus_tag LOCUS_17290 5471 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 5877 5485 gene locus_tag LOCUS_17300 5877 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 8689 5870 gene locus_tag LOCUS_17310 8689 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 8800 9567 gene locus_tag LOCUS_17320 8800 9567 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349517.1 protein_id gnl|my_center|LOCUS_17320 9564 10238 gene locus_tag LOCUS_17330 9564 10238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 10384 11181 gene locus_tag LOCUS_17340 10384 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 11181 13082 gene locus_tag LOCUS_17350 11181 13082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence099 3621 5318 gene locus_tag LOCUS_17360 3621 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5561 6652 gene locus_tag LOCUS_17370 5561 6652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 6652 7350 gene locus_tag LOCUS_17380 6652 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 7347 7928 gene locus_tag LOCUS_17390 7347 7928 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388480.1 protein_id gnl|my_center|LOCUS_17390 7928 8926 gene locus_tag LOCUS_17400 7928 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 8923 9441 gene locus_tag LOCUS_17410 8923 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 9494 10438 gene locus_tag LOCUS_17420 9494 10438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 12686 10461 gene locus_tag LOCUS_17430 12686 10461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 12993 13460 gene locus_tag LOCUS_17440 12993 13460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence100 3517 1046 gene locus_tag LOCUS_17450 3517 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4367 3507 gene locus_tag LOCUS_17460 4367 3507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 6194 4371 gene locus_tag LOCUS_17470 6194 4371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 7407 6247 gene locus_tag LOCUS_17480 7407 6247 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941780.1 protein_id gnl|my_center|LOCUS_17480 7545 8138 gene locus_tag LOCUS_17490 7545 8138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 8138 9160 gene locus_tag LOCUS_17500 8138 9160 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228888.1 protein_id gnl|my_center|LOCUS_17500 9564 9175 gene locus_tag LOCUS_17510 9564 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 9772 10788 gene locus_tag LOCUS_17520 9772 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000982215.1 protein_id gnl|my_center|LOCUS_17520 11255 10785 gene locus_tag LOCUS_17530 11255 10785 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629306.1 protein_id gnl|my_center|LOCUS_17530 11321 12844 gene locus_tag LOCUS_17540 11321 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence101 <1 10221 gene locus_tag LOCUS_17550 <1 10221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726922.1:type I polyketide synthase 10902 10354 gene locus_tag LOCUS_17560 10902 10354 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640623.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17560 11003 13486 gene locus_tag LOCUS_17570 11003 13486 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence102 1277 357 gene locus_tag LOCUS_17580 gene trxB 1277 357 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_17580 3476 1344 gene locus_tag LOCUS_17590 3476 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 3543 4184 gene locus_tag LOCUS_17600 3543 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 4987 4181 gene locus_tag LOCUS_17610 4987 4181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 5127 4930 gene locus_tag LOCUS_17620 5127 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 5393 5791 gene locus_tag LOCUS_17630 5393 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 5828 6589 gene locus_tag LOCUS_17640 5828 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6593 7459 gene locus_tag LOCUS_17650 6593 7459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8908 7742 gene locus_tag LOCUS_17660 8908 7742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 8978 12001 gene locus_tag LOCUS_17670 8978 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 12087 13409 gene locus_tag LOCUS_17680 12087 13409 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552000.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence103 474 1238 gene locus_tag LOCUS_17690 474 1238 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772902.1 protein_id gnl|my_center|LOCUS_17690 1235 2695 gene locus_tag LOCUS_17700 1235 2695 CDS product aryl-sulfate sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003144052.1 protein_id gnl|my_center|LOCUS_17700 2775 4172 gene locus_tag LOCUS_17710 2775 4172 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263817.1 protein_id gnl|my_center|LOCUS_17710 4582 4169 gene locus_tag LOCUS_17720 4582 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 4768 5520 gene locus_tag LOCUS_17730 4768 5520 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_17730 6209 5517 gene locus_tag LOCUS_17740 6209 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 8051 6210 gene locus_tag LOCUS_17750 8051 6210 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896448.1 protein_id gnl|my_center|LOCUS_17750 9118 8126 gene locus_tag LOCUS_17760 9118 8126 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594045.1 protein_id gnl|my_center|LOCUS_17760 9181 10629 gene locus_tag LOCUS_17770 9181 10629 CDS product DUF3336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073515.1 protein_id gnl|my_center|LOCUS_17770 10614 11045 gene locus_tag LOCUS_17780 gene arfB 10614 11045 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_17780 11061 12275 gene locus_tag LOCUS_17790 gene vpsB 11061 12275 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase VpsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482531.1 protein_id gnl|my_center|LOCUS_17790 12869 12276 gene locus_tag LOCUS_17800 12869 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence104 1183 1695 gene locus_tag LOCUS_17810 1183 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2378 1692 gene locus_tag LOCUS_17820 gene aat 2378 1692 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_17820 2498 3325 gene locus_tag LOCUS_17830 2498 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3878 3333 gene locus_tag LOCUS_17840 3878 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 6245 3927 gene locus_tag LOCUS_17850 6245 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 6838 6272 gene locus_tag LOCUS_17860 6838 6272 CDS product isoprenylcysteine carboxyl methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405935.1 protein_id gnl|my_center|LOCUS_17860 7209 6835 gene locus_tag LOCUS_17870 7209 6835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 7583 8572 gene locus_tag LOCUS_17880 7583 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 8713 10116 gene locus_tag LOCUS_17890 8713 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 10835 10224 gene locus_tag LOCUS_17900 10835 10224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 <13405 10885 gene locus_tag LOCUS_17910 <13405 10885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922335.1:type I polyketide synthase >Feature sequence105 3361 2030 gene locus_tag LOCUS_17920 3361 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 3296 3583 gene locus_tag LOCUS_17930 3296 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 3782 4393 gene locus_tag LOCUS_17940 3782 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 4514 4966 gene locus_tag LOCUS_17950 gene purE 4514 4966 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019247930.1 protein_id gnl|my_center|LOCUS_17950 5084 5803 gene locus_tag LOCUS_17960 5084 5803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 5902 6615 gene locus_tag LOCUS_17970 5902 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6737 7258 gene locus_tag LOCUS_17980 6737 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 7318 8241 gene locus_tag LOCUS_17990 7318 8241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 8974 8252 gene locus_tag LOCUS_18000 8974 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 9984 9016 gene locus_tag LOCUS_18010 9984 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 10474 11412 gene locus_tag LOCUS_18020 10474 11412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 11446 12036 gene locus_tag LOCUS_18030 11446 12036 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143573.1 protein_id gnl|my_center|LOCUS_18030 12033 13277 gene locus_tag LOCUS_18040 12033 13277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence106 319 921 gene locus_tag LOCUS_18050 319 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 918 1595 gene locus_tag LOCUS_18060 918 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 1595 2275 gene locus_tag LOCUS_18070 gene ccsA 1595 2275 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_18070 2415 2858 gene locus_tag LOCUS_18080 gene ccmE 2415 2858 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228655.1 protein_id gnl|my_center|LOCUS_18080 2855 4885 gene locus_tag LOCUS_18090 2855 4885 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886991.1 protein_id gnl|my_center|LOCUS_18090 4882 5412 gene locus_tag LOCUS_18100 4882 5412 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886990.1 protein_id gnl|my_center|LOCUS_18100 5409 5915 gene locus_tag LOCUS_18110 5409 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 5912 7258 gene locus_tag LOCUS_18120 5912 7258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 8411 7260 gene locus_tag LOCUS_18130 8411 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 10673 8730 gene locus_tag LOCUS_18140 10673 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 11000 10692 gene locus_tag LOCUS_18150 11000 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 >Feature sequence107 1123 1926 gene locus_tag LOCUS_18160 1123 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1991 2293 gene locus_tag LOCUS_18170 1991 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2298 4862 gene locus_tag LOCUS_18180 2298 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 5863 4997 gene locus_tag LOCUS_18190 5863 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 7436 5961 gene locus_tag LOCUS_18200 7436 5961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 7547 8266 gene locus_tag LOCUS_18210 7547 8266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 8251 9102 gene locus_tag LOCUS_18220 8251 9102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 10612 9176 gene locus_tag LOCUS_18230 10612 9176 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_18230 11424 10708 gene locus_tag LOCUS_18240 11424 10708 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090970.1 protein_id gnl|my_center|LOCUS_18240 12035 11508 gene locus_tag LOCUS_18250 12035 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 13077 12049 gene locus_tag LOCUS_18260 13077 12049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence108 2619 934 gene locus_tag LOCUS_18270 gene kstD 2619 934 CDS product 3-oxosteroid 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419253.1 protein_id gnl|my_center|LOCUS_18270 2735 3595 gene locus_tag LOCUS_18280 2735 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3592 4785 gene locus_tag LOCUS_18290 3592 4785 CDS product flavin-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224393.1 protein_id gnl|my_center|LOCUS_18290 4809 5663 gene locus_tag LOCUS_18300 4809 5663 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224395.1 protein_id gnl|my_center|LOCUS_18300 5660 6478 gene locus_tag LOCUS_18310 5660 6478 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047906135.1 protein_id gnl|my_center|LOCUS_18310 6526 6939 gene locus_tag LOCUS_18320 6526 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 6995 8632 gene locus_tag LOCUS_18330 6995 8632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 9279 8629 gene locus_tag LOCUS_18340 9279 8629 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036586.1 protein_id gnl|my_center|LOCUS_18340 9526 10503 gene locus_tag LOCUS_18350 9526 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 10614 11600 gene locus_tag LOCUS_18360 10614 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 11606 13057 gene locus_tag LOCUS_18370 11606 13057 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_18370 >Feature sequence109 1991 1749 gene locus_tag LOCUS_18380 1991 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 3312 2080 gene locus_tag LOCUS_18390 3312 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 11084 3360 gene locus_tag LOCUS_18400 11084 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 <13151 11116 gene locus_tag LOCUS_18410 <13151 11116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484145.1:type I polyketide synthase >Feature sequence110 1924 812 gene locus_tag LOCUS_18420 1924 812 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_18420 2042 2209 gene locus_tag LOCUS_18430 2042 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 3194 2307 gene locus_tag LOCUS_18440 3194 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 3755 3240 gene locus_tag LOCUS_18450 3755 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 4171 3752 gene locus_tag LOCUS_18460 4171 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 5291 4194 gene locus_tag LOCUS_18470 5291 4194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 5721 5281 gene locus_tag LOCUS_18480 5721 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 7329 5749 gene locus_tag LOCUS_18490 7329 5749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 7469 8434 gene locus_tag LOCUS_18500 7469 8434 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_18500 8424 9218 gene locus_tag LOCUS_18510 8424 9218 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_18510 9228 10415 gene locus_tag LOCUS_18520 9228 10415 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597728.1 protein_id gnl|my_center|LOCUS_18520 10443 10769 gene locus_tag LOCUS_18530 gene iscA 10443 10769 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072278.1 protein_id gnl|my_center|LOCUS_18530 12332 10773 gene locus_tag LOCUS_18540 12332 10773 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence111 1374 271 gene locus_tag LOCUS_18550 gene ychF 1374 271 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524669.1 protein_id gnl|my_center|LOCUS_18550 1517 2131 gene locus_tag LOCUS_18560 1517 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927105.1 protein_id gnl|my_center|LOCUS_18560 2915 2118 gene locus_tag LOCUS_18570 2915 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2908 4437 gene locus_tag LOCUS_18580 2908 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 4441 4968 gene locus_tag LOCUS_18590 4441 4968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 6218 4989 gene locus_tag LOCUS_18600 6218 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 6901 6215 gene locus_tag LOCUS_18610 6901 6215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_18610 8155 6920 gene locus_tag LOCUS_18620 8155 6920 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_18620 9382 8159 gene locus_tag LOCUS_18630 9382 8159 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_18630 10106 9390 gene locus_tag LOCUS_18640 10106 9390 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_18640 10582 10103 gene locus_tag LOCUS_18650 10582 10103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 10514 10729 gene locus_tag LOCUS_18660 10514 10729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 11771 10692 gene locus_tag LOCUS_18670 11771 10692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 <12924 11820 gene locus_tag LOCUS_18680 <12924 11820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707128.1:VWA domain-containing protein >Feature sequence112 <1 2841 gene locus_tag LOCUS_18690 <1 2841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein 3054 3371 gene locus_tag LOCUS_18700 3054 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 3742 3356 gene locus_tag LOCUS_18710 3742 3356 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965250.1 protein_id gnl|my_center|LOCUS_18710 3794 5122 gene locus_tag LOCUS_18720 3794 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 6304 5285 gene locus_tag LOCUS_18730 6304 5285 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919913.1 protein_id gnl|my_center|LOCUS_18730 7507 6314 gene locus_tag LOCUS_18740 7507 6314 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083841.1 protein_id gnl|my_center|LOCUS_18740 8745 7504 gene locus_tag LOCUS_18750 gene lipE 8745 7504 CDS product lipase LipE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731374.1 protein_id gnl|my_center|LOCUS_18750 10201 8750 gene locus_tag LOCUS_18760 10201 8750 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_18760 11214 10255 gene locus_tag LOCUS_18770 11214 10255 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184731.1 protein_id gnl|my_center|LOCUS_18770 11876 11301 gene locus_tag LOCUS_18780 11876 11301 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976494.1 protein_id gnl|my_center|LOCUS_18780 12079 12600 gene locus_tag LOCUS_18790 12079 12600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence113 1098 1790 gene locus_tag LOCUS_18800 1098 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1837 2421 gene locus_tag LOCUS_18810 1837 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2440 4704 gene locus_tag LOCUS_18820 2440 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 4857 5666 gene locus_tag LOCUS_18830 4857 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 7188 5767 gene locus_tag LOCUS_18840 7188 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 7951 7196 gene locus_tag LOCUS_18850 7951 7196 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_18850 8109 8726 gene locus_tag LOCUS_18860 8109 8726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 8779 10125 gene locus_tag LOCUS_18870 gene gorA 8779 10125 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268131.1 protein_id gnl|my_center|LOCUS_18870 11439 10192 gene locus_tag LOCUS_18880 11439 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 12272 11436 gene locus_tag LOCUS_18890 12272 11436 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419748.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence114 2010 388 gene locus_tag LOCUS_18900 2010 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2134 3228 gene locus_tag LOCUS_18910 2134 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 3225 4682 gene locus_tag LOCUS_18920 3225 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 5303 5821 gene locus_tag LOCUS_18930 5303 5821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 5904 7892 gene locus_tag LOCUS_18940 5904 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7902 8822 gene locus_tag LOCUS_18950 7902 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 10831 8825 gene locus_tag LOCUS_18960 10831 8825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 11531 10938 gene locus_tag LOCUS_18970 11531 10938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 <12671 11625 gene locus_tag LOCUS_18980 <12671 11625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015040705.1:acetylornithine deacetylase >Feature sequence115 1168 767 gene locus_tag LOCUS_18990 1168 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2056 1439 gene locus_tag LOCUS_19000 2056 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 2668 2222 gene locus_tag LOCUS_19010 2668 2222 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268094.1 protein_id gnl|my_center|LOCUS_19010 2894 4159 gene locus_tag LOCUS_19020 2894 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 4480 4851 gene locus_tag LOCUS_19030 4480 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 4891 6003 gene locus_tag LOCUS_19040 gene pfkA 4891 6003 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_19040 7897 6038 gene locus_tag LOCUS_19050 gene aspS 7897 6038 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389825.1 protein_id gnl|my_center|LOCUS_19050 8515 7910 gene locus_tag LOCUS_19060 8515 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 9706 8543 gene locus_tag LOCUS_19070 9706 8543 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947959.1 protein_id gnl|my_center|LOCUS_19070 11099 9714 gene locus_tag LOCUS_19080 11099 9714 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947960.1 protein_id gnl|my_center|LOCUS_19080 11314 12390 gene locus_tag LOCUS_19090 11314 12390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence116 1417 296 gene locus_tag LOCUS_19100 1417 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 2895 1567 gene locus_tag LOCUS_19110 2895 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4984 3542 gene locus_tag LOCUS_19120 4984 3542 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055870.1 protein_id gnl|my_center|LOCUS_19120 5400 4981 gene locus_tag LOCUS_19130 5400 4981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 7078 5576 gene locus_tag LOCUS_19140 7078 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 8610 7084 gene locus_tag LOCUS_19150 8610 7084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 9845 8610 gene locus_tag LOCUS_19160 9845 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 10218 11342 gene locus_tag LOCUS_19170 10218 11342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 12178 11339 gene locus_tag LOCUS_19180 gene carH 12178 11339 CDS product HTH-type transcriptional repressor CarH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229194.1 protein_id gnl|my_center|LOCUS_19180 >Feature sequence117 4333 1538 gene locus_tag LOCUS_19190 4333 1538 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258962.1 protein_id gnl|my_center|LOCUS_19190 6177 4330 gene locus_tag LOCUS_19200 6177 4330 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259247.1 protein_id gnl|my_center|LOCUS_19200 6532 6362 gene locus_tag LOCUS_19210 6532 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 6594 7376 gene locus_tag LOCUS_19220 6594 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 7862 7377 gene locus_tag LOCUS_19230 7862 7377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 8585 7908 gene locus_tag LOCUS_19240 8585 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 8812 9609 gene locus_tag LOCUS_19250 gene ttcA 8812 9609 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156215.1 protein_id gnl|my_center|LOCUS_19250 9606 10814 gene locus_tag LOCUS_19260 9606 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 11824 10823 gene locus_tag LOCUS_19270 11824 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 11775 12401 gene locus_tag LOCUS_19280 11775 12401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence118 362 165 gene locus_tag LOCUS_19290 362 165 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326931.1 protein_id gnl|my_center|LOCUS_19290 1351 704 gene locus_tag LOCUS_19300 1351 704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266341.1 protein_id gnl|my_center|LOCUS_19300 7205 1518 gene locus_tag LOCUS_19310 7205 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 8118 7462 gene locus_tag LOCUS_19320 gene msrA 8118 7462 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918878.1 protein_id gnl|my_center|LOCUS_19320 8155 8841 gene locus_tag LOCUS_19330 gene aat 8155 8841 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947494.1 protein_id gnl|my_center|LOCUS_19330 9737 8838 gene locus_tag LOCUS_19340 9737 8838 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921431.1 protein_id gnl|my_center|LOCUS_19340 9867 10169 gene locus_tag LOCUS_19350 9867 10169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 10166 10531 gene locus_tag LOCUS_19360 10166 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 10886 11356 gene locus_tag LOCUS_19370 10886 11356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 >Feature sequence119 958 2157 gene locus_tag LOCUS_19380 958 2157 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145923747.1 protein_id gnl|my_center|LOCUS_19380 2228 4177 gene locus_tag LOCUS_19390 2228 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 4798 4334 gene locus_tag LOCUS_19400 4798 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4956 6518 gene locus_tag LOCUS_19410 4956 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 6591 6986 gene locus_tag LOCUS_19420 6591 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 8501 7080 gene locus_tag LOCUS_19430 8501 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 8672 9769 gene locus_tag LOCUS_19440 8672 9769 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211853.1 protein_id gnl|my_center|LOCUS_19440 11032 9773 gene locus_tag LOCUS_19450 11032 9773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 11805 11086 gene locus_tag LOCUS_19460 11805 11086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence120 757 1326 gene locus_tag LOCUS_19470 757 1326 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043122718.1 protein_id gnl|my_center|LOCUS_19470 3134 1323 gene locus_tag LOCUS_19480 3134 1323 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063724.1 protein_id gnl|my_center|LOCUS_19480 5565 3382 gene locus_tag LOCUS_19490 5565 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 5656 6609 gene locus_tag LOCUS_19500 5656 6609 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032931383.1 protein_id gnl|my_center|LOCUS_19500 7854 6715 gene locus_tag LOCUS_19510 7854 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 8074 7892 gene locus_tag LOCUS_19520 8074 7892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 8120 9958 gene locus_tag LOCUS_19530 8120 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 9970 10791 gene locus_tag LOCUS_19540 9970 10791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 12264 10792 gene locus_tag LOCUS_19550 12264 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence121 1518 64 gene locus_tag LOCUS_19560 1518 64 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048068.1 protein_id gnl|my_center|LOCUS_19560 1592 2116 gene locus_tag LOCUS_19570 1592 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 3345 2113 gene locus_tag LOCUS_19580 3345 2113 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545724.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19580 4422 3478 gene locus_tag LOCUS_19590 4422 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 5435 4419 gene locus_tag LOCUS_19600 5435 4419 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929414.1 protein_id gnl|my_center|LOCUS_19600 5668 5429 gene locus_tag LOCUS_19610 5668 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 6001 6843 gene locus_tag LOCUS_19620 6001 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7161 7808 gene locus_tag LOCUS_19630 7161 7808 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_19630 7805 9058 gene locus_tag LOCUS_19640 7805 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 9058 10032 gene locus_tag LOCUS_19650 9058 10032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 10044 10742 gene locus_tag LOCUS_19660 10044 10742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence122 3760 3296 gene locus_tag LOCUS_19670 3760 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 5042 3948 gene locus_tag LOCUS_19680 5042 3948 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_19680 6414 5092 gene locus_tag LOCUS_19690 6414 5092 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403751.1 protein_id gnl|my_center|LOCUS_19690 6932 6411 gene locus_tag LOCUS_19700 6932 6411 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_19700 7286 8071 gene locus_tag LOCUS_19710 7286 8071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 8607 8083 gene locus_tag LOCUS_19720 8607 8083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9175 11541 gene locus_tag LOCUS_19730 9175 11541 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_19730 11538 12095 gene locus_tag LOCUS_19740 11538 12095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 12092 12310 gene locus_tag LOCUS_19750 12092 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence123 1241 402 gene locus_tag LOCUS_19760 1241 402 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063699.1 protein_id gnl|my_center|LOCUS_19760 2039 1245 gene locus_tag LOCUS_19770 gene tauC 2039 1245 CDS product taurine ABC transporter permease TauC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704532.1 protein_id gnl|my_center|LOCUS_19770 3713 2049 gene locus_tag LOCUS_19780 3713 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4496 3723 gene locus_tag LOCUS_19790 4496 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4690 5412 gene locus_tag LOCUS_19800 4690 5412 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390408.1 protein_id gnl|my_center|LOCUS_19800 6020 5871 gene locus_tag LOCUS_19810 6020 5871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 6231 6013 gene locus_tag LOCUS_19820 6231 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 8555 7419 gene locus_tag LOCUS_19830 8555 7419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 8718 9422 gene locus_tag LOCUS_19840 8718 9422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 9495 11726 gene locus_tag LOCUS_19850 9495 11726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 >Feature sequence124 417 1595 gene locus_tag LOCUS_19860 417 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 2097 2999 gene locus_tag LOCUS_19870 2097 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 4058 3198 gene locus_tag LOCUS_19880 4058 3198 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113577.1 protein_id gnl|my_center|LOCUS_19880 5477 4308 gene locus_tag LOCUS_19890 5477 4308 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031816.1 protein_id gnl|my_center|LOCUS_19890 5526 6977 gene locus_tag LOCUS_19900 5526 6977 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856630.1 protein_id gnl|my_center|LOCUS_19900 7058 9934 gene locus_tag LOCUS_19910 7058 9934 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_19910 9934 10920 gene locus_tag LOCUS_19920 9934 10920 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531563.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence125 328 1164 gene locus_tag LOCUS_19930 328 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 1393 2280 gene locus_tag LOCUS_19940 1393 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 2280 5099 gene locus_tag LOCUS_19950 2280 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 5748 5927 gene locus_tag LOCUS_19960 5748 5927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 6042 6506 gene locus_tag LOCUS_19970 6042 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 7340 6528 gene locus_tag LOCUS_19980 7340 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 7541 7990 gene locus_tag LOCUS_19990 7541 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 9778 8117 gene locus_tag LOCUS_20000 9778 8117 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_20000 10397 9882 gene locus_tag LOCUS_20010 10397 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 11495 10965 gene locus_tag LOCUS_20020 11495 10965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 11864 11514 gene locus_tag LOCUS_20030 11864 11514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 >Feature sequence126 470 853 gene locus_tag LOCUS_20040 470 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 918 3071 gene locus_tag LOCUS_20050 918 3071 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203288.1 protein_id gnl|my_center|LOCUS_20050 3080 3682 gene locus_tag LOCUS_20060 3080 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5374 3683 gene locus_tag LOCUS_20070 5374 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 6906 5371 gene locus_tag LOCUS_20080 6906 5371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 7113 8927 gene locus_tag LOCUS_20090 7113 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 8927 9688 gene locus_tag LOCUS_20100 8927 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 10093 11382 gene locus_tag LOCUS_20110 gene bcd 10093 11382 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_20110 11390 11866 gene locus_tag LOCUS_20120 11390 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 >Feature sequence127 192 1058 gene locus_tag LOCUS_20130 192 1058 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_20130 1085 2272 gene locus_tag LOCUS_20140 1085 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2272 3249 gene locus_tag LOCUS_20150 2272 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 3371 3295 gene locus_tag LOCUS_t00140 3371 3295 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3726 4088 gene locus_tag LOCUS_20160 gene nuoA 3726 4088 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179272.1 protein_id gnl|my_center|LOCUS_20160 4079 4804 gene locus_tag LOCUS_20170 4079 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 4801 5265 gene locus_tag LOCUS_20180 4801 5265 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392494.1 protein_id gnl|my_center|LOCUS_20180 5268 6443 gene locus_tag LOCUS_20190 gene nuoD 5268 6443 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396802.1 protein_id gnl|my_center|LOCUS_20190 6440 7474 gene locus_tag LOCUS_20200 gene nuoH 6440 7474 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227702.1 protein_id gnl|my_center|LOCUS_20200 7471 8040 gene locus_tag LOCUS_20210 7471 8040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 8037 8540 gene locus_tag LOCUS_20220 8037 8540 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974343.1 protein_id gnl|my_center|LOCUS_20220 8541 8843 gene locus_tag LOCUS_20230 gene nuoK 8541 8843 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_20230 8840 10708 gene locus_tag LOCUS_20240 gene nuoL 8840 10708 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence128 1257 2756 gene locus_tag LOCUS_20250 1257 2756 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433878.1 protein_id gnl|my_center|LOCUS_20250 2827 3540 gene locus_tag LOCUS_20260 2827 3540 CDS product phosphatidylcholine/phosphatidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105024.1 protein_id gnl|my_center|LOCUS_20260 3577 5547 gene locus_tag LOCUS_20270 3577 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 5707 6096 gene locus_tag LOCUS_20280 5707 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 6102 7361 gene locus_tag LOCUS_20290 6102 7361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 8657 7365 gene locus_tag LOCUS_20300 8657 7365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 9146 8664 gene locus_tag LOCUS_20310 9146 8664 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704507.1 protein_id gnl|my_center|LOCUS_20310 >Feature sequence129 2629 848 gene locus_tag LOCUS_20320 2629 848 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 protein_id gnl|my_center|LOCUS_20320 3588 2626 gene locus_tag LOCUS_20330 3588 2626 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839880.1 protein_id gnl|my_center|LOCUS_20330 4484 3585 gene locus_tag LOCUS_20340 4484 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 5353 4481 gene locus_tag LOCUS_20350 5353 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6352 5366 gene locus_tag LOCUS_20360 6352 5366 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404896.1 protein_id gnl|my_center|LOCUS_20360 7497 6361 gene locus_tag LOCUS_20370 gene dnaJ 7497 6361 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482993.1 protein_id gnl|my_center|LOCUS_20370 9457 7568 gene locus_tag LOCUS_20380 gene dnaK 9457 7568 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_20380 9718 10011 gene locus_tag LOCUS_20390 gene groES 9718 10011 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_20390 10014 11597 gene locus_tag LOCUS_20400 gene groL 10014 11597 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_20400 >Feature sequence130 926 5044 gene locus_tag LOCUS_20410 926 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 5642 5034 gene locus_tag LOCUS_20420 5642 5034 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_20420 6207 5746 gene locus_tag LOCUS_20430 6207 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 7783 6368 gene locus_tag LOCUS_20440 7783 6368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 9517 7814 gene locus_tag LOCUS_20450 9517 7814 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921289.1 protein_id gnl|my_center|LOCUS_20450 9644 10243 gene locus_tag LOCUS_20460 9644 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 >Feature sequence131 1702 629 gene locus_tag LOCUS_20470 gene flhB 1702 629 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420337.1 protein_id gnl|my_center|LOCUS_20470 2457 1702 gene locus_tag LOCUS_20480 gene fliR 2457 1702 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_20480 2723 2457 gene locus_tag LOCUS_20490 gene fliQ 2723 2457 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881279.1 protein_id gnl|my_center|LOCUS_20490 3481 2720 gene locus_tag LOCUS_20500 gene fliP 3481 2720 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_20500 3957 3478 gene locus_tag LOCUS_20510 3957 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 4232 3954 gene locus_tag LOCUS_20520 4232 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 5132 4290 gene locus_tag LOCUS_20530 5132 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 5670 5176 gene locus_tag LOCUS_20540 5670 5176 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793169.1 protein_id gnl|my_center|LOCUS_20540 6400 5657 gene locus_tag LOCUS_20550 6400 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 7164 6400 gene locus_tag LOCUS_20560 7164 6400 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_20560 8672 7257 gene locus_tag LOCUS_20570 8672 7257 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545614.1 protein_id gnl|my_center|LOCUS_20570 9121 8819 gene locus_tag LOCUS_20580 9121 8819 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941086.1 protein_id gnl|my_center|LOCUS_20580 9906 9220 gene locus_tag LOCUS_20590 9906 9220 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839909.1 protein_id gnl|my_center|LOCUS_20590 10773 9958 gene locus_tag LOCUS_20600 10773 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 >Feature sequence132 759 322 gene locus_tag LOCUS_20610 759 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2296 752 gene locus_tag LOCUS_20620 2296 752 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228236.1 protein_id gnl|my_center|LOCUS_20620 3378 2296 gene locus_tag LOCUS_20630 3378 2296 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_20630 5417 3387 gene locus_tag LOCUS_20640 5417 3387 CDS product serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256854.1 protein_id gnl|my_center|LOCUS_20640 6011 6856 gene locus_tag LOCUS_20650 6011 6856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 6906 8105 gene locus_tag LOCUS_20660 6906 8105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 9794 8358 gene locus_tag LOCUS_20670 9794 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 <11345 9791 gene locus_tag LOCUS_20680 <11345 9791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037292.1:efflux RND transporter permease subunit >Feature sequence133 1207 1824 gene locus_tag LOCUS_20690 1207 1824 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_20690 2017 2181 gene locus_tag LOCUS_20700 2017 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 2289 3770 gene locus_tag LOCUS_20710 2289 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 3784 4611 gene locus_tag LOCUS_20720 3784 4611 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142046.1 protein_id gnl|my_center|LOCUS_20720 4726 5043 gene locus_tag LOCUS_20730 4726 5043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 6743 5109 gene locus_tag LOCUS_20740 6743 5109 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_20740 7489 6734 gene locus_tag LOCUS_20750 7489 6734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 8373 7486 gene locus_tag LOCUS_20760 8373 7486 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_20760 9908 8433 gene locus_tag LOCUS_20770 9908 8433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 11289 10021 gene locus_tag LOCUS_20780 11289 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 >Feature sequence134 982 641 gene locus_tag LOCUS_20790 982 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 1598 2236 gene locus_tag LOCUS_20800 1598 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 2762 5044 gene locus_tag LOCUS_20810 2762 5044 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483542.1 protein_id gnl|my_center|LOCUS_20810 5251 6552 gene locus_tag LOCUS_20820 5251 6552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 6622 6876 gene locus_tag LOCUS_20830 6622 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 6989 8485 gene locus_tag LOCUS_20840 6989 8485 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123403.1 protein_id gnl|my_center|LOCUS_20840 8482 10317 gene locus_tag LOCUS_20850 8482 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 >Feature sequence135 3000 904 gene locus_tag LOCUS_20860 gene ligA 3000 904 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286040.1 protein_id gnl|my_center|LOCUS_20860 2990 3307 gene locus_tag LOCUS_20870 2990 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 3342 4382 gene locus_tag LOCUS_20880 3342 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 4475 6676 gene locus_tag LOCUS_20890 4475 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 7275 6673 gene locus_tag LOCUS_20900 7275 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 7430 8947 gene locus_tag LOCUS_20910 7430 8947 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036964.1 protein_id gnl|my_center|LOCUS_20910 9490 8951 gene locus_tag LOCUS_20920 9490 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 10692 9544 gene locus_tag LOCUS_20930 10692 9544 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259226.1 protein_id gnl|my_center|LOCUS_20930 <11274 10682 gene locus_tag LOCUS_20940 <11274 10682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582483.1:TetR/AcrR family transcriptional regulator >Feature sequence136 2349 343 gene locus_tag LOCUS_20950 2349 343 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963795.1 protein_id gnl|my_center|LOCUS_20950 2476 3072 gene locus_tag LOCUS_20960 2476 3072 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028028074.1 protein_id gnl|my_center|LOCUS_20960 3062 3859 gene locus_tag LOCUS_20970 3062 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 5367 3865 gene locus_tag LOCUS_20980 5367 3865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 6461 5427 gene locus_tag LOCUS_20990 gene tgt 6461 5427 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_20990 7569 6538 gene locus_tag LOCUS_21000 gene queA 7569 6538 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771042.1 protein_id gnl|my_center|LOCUS_21000 7710 7973 gene locus_tag LOCUS_21010 7710 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7983 10373 gene locus_tag LOCUS_21020 7983 10373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence137 210 875 gene locus_tag LOCUS_21030 210 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 880 1680 gene locus_tag LOCUS_21040 880 1680 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_21040 1702 2106 gene locus_tag LOCUS_21050 1702 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 4382 2112 gene locus_tag LOCUS_21060 4382 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 5926 4379 gene locus_tag LOCUS_21070 5926 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 6030 7211 gene locus_tag LOCUS_21080 6030 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296451.1 protein_id gnl|my_center|LOCUS_21080 7864 7208 gene locus_tag LOCUS_21090 7864 7208 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_21090 8263 8574 gene locus_tag LOCUS_21100 8263 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 8670 8816 gene locus_tag LOCUS_21110 8670 8816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 8879 9727 gene locus_tag LOCUS_21120 8879 9727 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227561.1 protein_id gnl|my_center|LOCUS_21120 <11094 9780 gene locus_tag LOCUS_21130 <11094 9780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000786086.1:threonine--tRNA ligase >Feature sequence138 1215 376 gene locus_tag LOCUS_21140 1215 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1484 2332 gene locus_tag LOCUS_21150 1484 2332 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530162.1 protein_id gnl|my_center|LOCUS_21150 2887 2366 gene locus_tag LOCUS_21160 2887 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 6315 2884 gene locus_tag LOCUS_21170 gene mfd 6315 2884 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267304.1 protein_id gnl|my_center|LOCUS_21170 7590 6322 gene locus_tag LOCUS_21180 7590 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 7882 7673 gene locus_tag LOCUS_21190 7882 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 8217 7903 gene locus_tag LOCUS_21200 8217 7903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 8593 10044 gene locus_tag LOCUS_21210 8593 10044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 >Feature sequence139 201 1589 gene locus_tag LOCUS_21220 gene der 201 1589 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_21220 1595 3382 gene locus_tag LOCUS_21230 gene mutL 1595 3382 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_21230 3379 4272 gene locus_tag LOCUS_21240 gene miaA 3379 4272 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_21240 4360 5361 gene locus_tag LOCUS_21250 4360 5361 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_21250 5365 6648 gene locus_tag LOCUS_21260 gene aroA 5365 6648 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000664618.1 protein_id gnl|my_center|LOCUS_21260 6645 7319 gene locus_tag LOCUS_21270 gene cmk 6645 7319 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775570.1 protein_id gnl|my_center|LOCUS_21270 7543 9387 gene locus_tag LOCUS_21280 7543 9387 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_21280 9493 9798 gene locus_tag LOCUS_21290 9493 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence140 496 2295 gene locus_tag LOCUS_21300 496 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 2818 2345 gene locus_tag LOCUS_21310 2818 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 4121 3312 gene locus_tag LOCUS_21320 4121 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 4099 4689 gene locus_tag LOCUS_21330 4099 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 4686 5153 gene locus_tag LOCUS_21340 4686 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 5325 6989 gene locus_tag LOCUS_21350 5325 6989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 6986 7699 gene locus_tag LOCUS_21360 6986 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 7853 8767 gene locus_tag LOCUS_21370 7853 8767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 10065 8770 gene locus_tag LOCUS_21380 10065 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 10493 10062 gene locus_tag LOCUS_21390 10493 10062 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010917947.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence141 1293 3287 gene locus_tag LOCUS_21400 1293 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 3379 4737 gene locus_tag LOCUS_21410 3379 4737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 6139 4694 gene locus_tag LOCUS_21420 6139 4694 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093946795.1 protein_id gnl|my_center|LOCUS_21420 7241 6186 gene locus_tag LOCUS_21430 7241 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 8193 7297 gene locus_tag LOCUS_21440 8193 7297 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_21440 8496 8705 gene locus_tag LOCUS_21450 8496 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 8754 9278 gene locus_tag LOCUS_21460 8754 9278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 10304 9285 gene locus_tag LOCUS_21470 10304 9285 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964801.1 protein_id gnl|my_center|LOCUS_21470 10546 10968 gene locus_tag LOCUS_21480 10546 10968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 >Feature sequence142 2176 620 gene locus_tag LOCUS_21490 2176 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 2175 3542 gene locus_tag LOCUS_21500 2175 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3555 4052 gene locus_tag LOCUS_21510 3555 4052 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406868.1 protein_id gnl|my_center|LOCUS_21510 4104 5279 gene locus_tag LOCUS_21520 4104 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 5297 5779 gene locus_tag LOCUS_21530 5297 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 6294 5782 gene locus_tag LOCUS_21540 gene greB 6294 5782 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694166.1 protein_id gnl|my_center|LOCUS_21540 7593 6301 gene locus_tag LOCUS_21550 7593 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7655 9694 gene locus_tag LOCUS_21560 7655 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence143 1606 857 gene locus_tag LOCUS_21570 1606 857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225241.1 protein_id gnl|my_center|LOCUS_21570 2769 1603 gene locus_tag LOCUS_21580 2769 1603 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113162.1 protein_id gnl|my_center|LOCUS_21580 3780 2773 gene locus_tag LOCUS_21590 3780 2773 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228928.1 protein_id gnl|my_center|LOCUS_21590 4931 3780 gene locus_tag LOCUS_21600 4931 3780 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225240.1 protein_id gnl|my_center|LOCUS_21600 5898 4924 gene locus_tag LOCUS_21610 5898 4924 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113158.1 protein_id gnl|my_center|LOCUS_21610 6726 6184 gene locus_tag LOCUS_21620 6726 6184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 7904 6771 gene locus_tag LOCUS_21630 7904 6771 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225245.1 protein_id gnl|my_center|LOCUS_21630 8762 7962 gene locus_tag LOCUS_21640 8762 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 9819 8965 gene locus_tag LOCUS_21650 9819 8965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 10696 9863 gene locus_tag LOCUS_21660 10696 9863 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225244.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence144 <1 690 gene locus_tag LOCUS_21670 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809761.1:type III pantothenate kinase 975 3359 gene locus_tag LOCUS_21680 975 3359 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_21680 3395 4564 gene locus_tag LOCUS_21690 3395 4564 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001206324.1 protein_id gnl|my_center|LOCUS_21690 4568 4936 gene locus_tag LOCUS_21700 4568 4936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 5034 5762 gene locus_tag LOCUS_21710 5034 5762 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403082.1 protein_id gnl|my_center|LOCUS_21710 5764 6423 gene locus_tag LOCUS_21720 5764 6423 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454984.1 protein_id gnl|my_center|LOCUS_21720 9070 6425 gene locus_tag LOCUS_21730 gene ppdK 9070 6425 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_21730 <10904 9083 gene locus_tag LOCUS_21740 <10904 9083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941242.1:glycine--tRNA ligase subunit beta >Feature sequence145 1996 1022 gene locus_tag LOCUS_21750 1996 1022 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208008.1 protein_id gnl|my_center|LOCUS_21750 4443 2098 gene locus_tag LOCUS_21760 4443 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 5044 4880 gene locus_tag LOCUS_21770 5044 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5174 5731 gene locus_tag LOCUS_21780 5174 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6853 5861 gene locus_tag LOCUS_21790 6853 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_21790 7048 6899 gene locus_tag LOCUS_21800 7048 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 7231 8124 gene locus_tag LOCUS_21810 gene lipA 7231 8124 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903644.1 protein_id gnl|my_center|LOCUS_21810 8124 9020 gene locus_tag LOCUS_21820 8124 9020 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776524.1 protein_id gnl|my_center|LOCUS_21820 9029 10282 gene locus_tag LOCUS_21830 gene pdhC 9029 10282 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_21830 >Feature sequence146 641 237 gene locus_tag LOCUS_21840 gene msrB 641 237 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971244.1 protein_id gnl|my_center|LOCUS_21840 739 1740 gene locus_tag LOCUS_21850 gene trpD 739 1740 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_21850 3252 1807 gene locus_tag LOCUS_21860 3252 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3673 3278 gene locus_tag LOCUS_21870 3673 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3757 4476 gene locus_tag LOCUS_21880 gene trpC 3757 4476 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805091.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21880 4566 5159 gene locus_tag LOCUS_21890 4566 5159 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723935.1 protein_id gnl|my_center|LOCUS_21890 5156 6370 gene locus_tag LOCUS_21900 gene trpB 5156 6370 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016721143.1 protein_id gnl|my_center|LOCUS_21900 6367 7134 gene locus_tag LOCUS_21910 gene trpA 6367 7134 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_21910 7893 7300 gene locus_tag LOCUS_21920 7893 7300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 8778 8065 gene locus_tag LOCUS_21930 8778 8065 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_21930 8815 9297 gene locus_tag LOCUS_21940 8815 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 10086 9301 gene locus_tag LOCUS_21950 10086 9301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence147 1031 423 gene locus_tag LOCUS_21960 1031 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1427 1903 gene locus_tag LOCUS_21970 1427 1903 CDS product tryptophan-rich sensory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036969.1 protein_id gnl|my_center|LOCUS_21970 1879 2490 gene locus_tag LOCUS_21980 1879 2490 CDS product DUF1990 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615894.1 protein_id gnl|my_center|LOCUS_21980 2487 3455 gene locus_tag LOCUS_21990 2487 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3695 4909 gene locus_tag LOCUS_22000 3695 4909 CDS product deoxyribodipyrimidine photolyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121881.1 protein_id gnl|my_center|LOCUS_22000 5866 4940 gene locus_tag LOCUS_22010 5866 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 6021 6917 gene locus_tag LOCUS_22020 6021 6917 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_22020 7278 8834 gene locus_tag LOCUS_22030 7278 8834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 8865 9953 gene locus_tag LOCUS_22040 8865 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 10524 9961 gene locus_tag LOCUS_22050 10524 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence148 3 1304 gene locus_tag LOCUS_22060 3 1304 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_22060 1394 2317 gene locus_tag LOCUS_22070 1394 2317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 3251 2307 gene locus_tag LOCUS_22080 3251 2307 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975318.1 protein_id gnl|my_center|LOCUS_22080 4073 3282 gene locus_tag LOCUS_22090 4073 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 4452 4601 gene locus_tag LOCUS_22100 4452 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5740 4598 gene locus_tag LOCUS_22110 5740 4598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 5783 6511 gene locus_tag LOCUS_22120 5783 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 7775 6477 gene locus_tag LOCUS_22130 7775 6477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22130 8240 7854 gene locus_tag LOCUS_22140 8240 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 9097 8294 gene locus_tag LOCUS_22150 9097 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 9761 9087 gene locus_tag LOCUS_22160 9761 9087 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_22160 9969 10721 gene locus_tag LOCUS_22170 9969 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence149 3314 3105 gene locus_tag LOCUS_22180 3314 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3759 4082 gene locus_tag LOCUS_22190 3759 4082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 6238 4103 gene locus_tag LOCUS_22200 6238 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 6380 6225 gene locus_tag LOCUS_22210 6380 6225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 7716 6787 gene locus_tag LOCUS_22220 gene xerC 7716 6787 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_22220 8344 9693 gene locus_tag LOCUS_22230 8344 9693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 >Feature sequence150 <1 843 gene locus_tag LOCUS_22240 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024468.1:prephenate dehydrogenase 840 1697 gene locus_tag LOCUS_22250 840 1697 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839268.1 protein_id gnl|my_center|LOCUS_22250 1694 2650 gene locus_tag LOCUS_22260 1694 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 3245 2655 gene locus_tag LOCUS_22270 3245 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3767 5371 gene locus_tag LOCUS_22280 3767 5371 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482641.1 protein_id gnl|my_center|LOCUS_22280 6475 5564 gene locus_tag LOCUS_22290 6475 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 8380 6698 gene locus_tag LOCUS_22300 8380 6698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 9507 8377 gene locus_tag LOCUS_22310 9507 8377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 <10638 9504 gene locus_tag LOCUS_22320 <10638 9504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001292789.1:VWA domain-containing protein >Feature sequence151 8847 2206 gene locus_tag LOCUS_22330 8847 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 10420 8834 gene locus_tag LOCUS_22340 gene pfaD 10420 8834 CDS product eicosapentaenoate synthase subunit PfaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071756.1 protein_id gnl|my_center|LOCUS_22340 >Feature sequence152 1497 2528 gene locus_tag LOCUS_22350 1497 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 4377 2539 gene locus_tag LOCUS_22360 4377 2539 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942647.1 protein_id gnl|my_center|LOCUS_22360 4273 4581 gene locus_tag LOCUS_22370 4273 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 4566 6365 gene locus_tag LOCUS_22380 4566 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 6372 7685 gene locus_tag LOCUS_22390 6372 7685 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921843.1 protein_id gnl|my_center|LOCUS_22390 7685 9442 gene locus_tag LOCUS_22400 7685 9442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 >Feature sequence153 158 1672 gene locus_tag LOCUS_22410 158 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1814 2131 gene locus_tag LOCUS_22420 1814 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 2604 2236 gene locus_tag LOCUS_22430 2604 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 3432 2689 gene locus_tag LOCUS_22440 3432 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 3755 4258 gene locus_tag LOCUS_22450 3755 4258 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_22450 4255 6450 gene locus_tag LOCUS_22460 4255 6450 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529192.1 protein_id gnl|my_center|LOCUS_22460 6555 8303 gene locus_tag LOCUS_22470 6555 8303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 9831 8458 gene locus_tag LOCUS_22480 9831 8458 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118042.1 protein_id gnl|my_center|LOCUS_22480 10507 10316 gene locus_tag LOCUS_22490 10507 10316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence154 1704 349 gene locus_tag LOCUS_22500 gene desA 1704 349 CDS product lysine decarboxylase DesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028583.1 protein_id gnl|my_center|LOCUS_22500 2819 1707 gene locus_tag LOCUS_22510 gene asd 2819 1707 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262205.1 protein_id gnl|my_center|LOCUS_22510 3839 2850 gene locus_tag LOCUS_22520 3839 2850 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263412.1 protein_id gnl|my_center|LOCUS_22520 4424 3945 gene locus_tag LOCUS_22530 4424 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 5473 4421 gene locus_tag LOCUS_22540 5473 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 7336 5477 gene locus_tag LOCUS_22550 7336 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 7516 7974 gene locus_tag LOCUS_22560 7516 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 7974 8441 gene locus_tag LOCUS_22570 7974 8441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 8434 8664 gene locus_tag LOCUS_22580 8434 8664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 8665 10170 gene locus_tag LOCUS_22590 8665 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence155 <1 662 gene locus_tag LOCUS_22600 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113296.1:c-type cytochrome 790 1455 gene locus_tag LOCUS_22610 790 1455 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329346.1 protein_id gnl|my_center|LOCUS_22610 1506 3197 gene locus_tag LOCUS_22620 1506 3197 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962550.1 protein_id gnl|my_center|LOCUS_22620 3219 3794 gene locus_tag LOCUS_22630 3219 3794 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940895.1 protein_id gnl|my_center|LOCUS_22630 3804 4256 gene locus_tag LOCUS_22640 3804 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 4265 4885 gene locus_tag LOCUS_22650 4265 4885 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284302.1 protein_id gnl|my_center|LOCUS_22650 4882 5124 gene locus_tag LOCUS_22660 4882 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5294 5806 gene locus_tag LOCUS_22670 5294 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 6445 5879 gene locus_tag LOCUS_22680 6445 5879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 6535 7560 gene locus_tag LOCUS_22690 gene hemE 6535 7560 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210686.1 protein_id gnl|my_center|LOCUS_22690 9606 7579 gene locus_tag LOCUS_22700 9606 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 >Feature sequence156 1177 218 gene locus_tag LOCUS_22710 1177 218 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_22710 1990 1202 gene locus_tag LOCUS_22720 1990 1202 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460372.1 protein_id gnl|my_center|LOCUS_22720 2647 2024 gene locus_tag LOCUS_22730 2647 2024 CDS product TetR/AcrR family transcriptional regulator C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742222.1 protein_id gnl|my_center|LOCUS_22730 3422 2715 gene locus_tag LOCUS_22740 gene fsa 3422 2715 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887978.1 protein_id gnl|my_center|LOCUS_22740 3966 3454 gene locus_tag LOCUS_22750 gene folK 3966 3454 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_22750 4463 3963 gene locus_tag LOCUS_22760 4463 3963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4933 4472 gene locus_tag LOCUS_22770 4933 4472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6083 5013 gene locus_tag LOCUS_22780 6083 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 8645 6210 gene locus_tag LOCUS_22790 8645 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 9188 8754 gene locus_tag LOCUS_22800 9188 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 10073 9210 gene locus_tag LOCUS_22810 10073 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence157 1608 400 gene locus_tag LOCUS_22820 1608 400 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403232.1 protein_id gnl|my_center|LOCUS_22820 1658 2293 gene locus_tag LOCUS_22830 1658 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 2284 3861 gene locus_tag LOCUS_22840 2284 3861 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528777.1 protein_id gnl|my_center|LOCUS_22840 3917 4342 gene locus_tag LOCUS_22850 3917 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 4573 4376 gene locus_tag LOCUS_22860 4573 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 4703 5725 gene locus_tag LOCUS_22870 4703 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 <10288 5816 gene locus_tag LOCUS_22880 <10288 5816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861847.1:collagen-binding adhesin CbpA >Feature sequence158 1996 575 gene locus_tag LOCUS_22890 1996 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22890 2363 2542 gene locus_tag LOCUS_22900 2363 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3865 2474 gene locus_tag LOCUS_22910 gene murA 3865 2474 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_22910 4916 4071 gene locus_tag LOCUS_22920 4916 4071 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_22920 6711 4909 gene locus_tag LOCUS_22930 gene dnaK 6711 4909 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091833905.1 protein_id gnl|my_center|LOCUS_22930 8457 7231 gene locus_tag LOCUS_22940 8457 7231 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228155.1 protein_id gnl|my_center|LOCUS_22940 9755 8454 gene locus_tag LOCUS_22950 9755 8454 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_22950 <10279 9752 gene locus_tag LOCUS_22960 <10279 9752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707094.1:thiamine-phosphate kinase >Feature sequence159 1448 891 gene locus_tag LOCUS_22970 1448 891 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262533.1 protein_id gnl|my_center|LOCUS_22970 1803 2657 gene locus_tag LOCUS_22980 1803 2657 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207709.1 protein_id gnl|my_center|LOCUS_22980 3843 2662 gene locus_tag LOCUS_22990 3843 2662 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933712.1 protein_id gnl|my_center|LOCUS_22990 3986 5674 gene locus_tag LOCUS_23000 3986 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 6985 5819 gene locus_tag LOCUS_23010 6985 5819 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_23010 7188 8723 gene locus_tag LOCUS_23020 7188 8723 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037523.1 protein_id gnl|my_center|LOCUS_23020 8744 9487 gene locus_tag LOCUS_23030 8744 9487 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257319.1 protein_id gnl|my_center|LOCUS_23030 9709 10080 gene locus_tag LOCUS_23040 9709 10080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence160 364 2232 gene locus_tag LOCUS_23050 364 2232 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026866.1 protein_id gnl|my_center|LOCUS_23050 2233 3258 gene locus_tag LOCUS_23060 gene adhP 2233 3258 CDS product alcohol dehydrogenase AdhP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978667.1 protein_id gnl|my_center|LOCUS_23060 4173 3247 gene locus_tag LOCUS_23070 4173 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 5057 4170 gene locus_tag LOCUS_23080 5057 4170 CDS product 3,4-dihydroxyphenylacetate 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523563.1 protein_id gnl|my_center|LOCUS_23080 6183 5059 gene locus_tag LOCUS_23090 6183 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 6829 6209 gene locus_tag LOCUS_23100 gene kynB 6829 6209 CDS product kynurenine formamidase KynB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114853.1 protein_id gnl|my_center|LOCUS_23100 7258 6833 gene locus_tag LOCUS_23110 7258 6833 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002895964.1 protein_id gnl|my_center|LOCUS_23110 9150 7255 gene locus_tag LOCUS_23120 9150 7255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 9273 9653 gene locus_tag LOCUS_23130 9273 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 9706 10143 gene locus_tag LOCUS_23140 9706 10143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence161 1177 587 gene locus_tag LOCUS_23150 1177 587 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189774.1 protein_id gnl|my_center|LOCUS_23150 2072 1431 gene locus_tag LOCUS_23160 2072 1431 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_23160 2505 3122 gene locus_tag LOCUS_23170 2505 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 3156 4292 gene locus_tag LOCUS_23180 3156 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 5359 4298 gene locus_tag LOCUS_23190 5359 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 5489 5962 gene locus_tag LOCUS_23200 5489 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 6947 5967 gene locus_tag LOCUS_23210 6947 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 7536 7042 gene locus_tag LOCUS_23220 7536 7042 CDS product phosphoglycerate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071056.1 protein_id gnl|my_center|LOCUS_23220 8708 7596 gene locus_tag LOCUS_23230 8708 7596 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975598.1 protein_id gnl|my_center|LOCUS_23230 <10236 8754 gene locus_tag LOCUS_23240 <10236 8754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615973.1:serine/threonine protein kinase >Feature sequence162 649 1587 gene locus_tag LOCUS_23250 649 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1851 2123 gene locus_tag LOCUS_23260 1851 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2120 2377 gene locus_tag LOCUS_23270 2120 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2411 2683 gene locus_tag LOCUS_23280 2411 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 3611 2661 gene locus_tag LOCUS_23290 3611 2661 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112221.1 protein_id gnl|my_center|LOCUS_23290 4786 3614 gene locus_tag LOCUS_23300 4786 3614 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418997.1 protein_id gnl|my_center|LOCUS_23300 5517 4792 gene locus_tag LOCUS_23310 5517 4792 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459737.1 protein_id gnl|my_center|LOCUS_23310 7076 5514 gene locus_tag LOCUS_23320 7076 5514 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730889.1 protein_id gnl|my_center|LOCUS_23320 7736 7551 gene locus_tag LOCUS_23330 7736 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_23330 8028 8627 gene locus_tag LOCUS_23340 8028 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 8901 9914 gene locus_tag LOCUS_23350 8901 9914 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence163 2184 826 gene locus_tag LOCUS_23360 2184 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 5770 2396 gene locus_tag LOCUS_23370 5770 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 6203 6670 gene locus_tag LOCUS_23380 6203 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6671 7057 gene locus_tag LOCUS_23390 6671 7057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 7487 7065 gene locus_tag LOCUS_23400 7487 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 8766 7780 gene locus_tag LOCUS_23410 8766 7780 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985094.1 protein_id gnl|my_center|LOCUS_23410 9171 10028 gene locus_tag LOCUS_23420 9171 10028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 >Feature sequence164 473 2113 gene locus_tag LOCUS_23430 473 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2179 4365 gene locus_tag LOCUS_23440 2179 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 4372 5235 gene locus_tag LOCUS_23450 gene rsmI 4372 5235 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809262.1 protein_id gnl|my_center|LOCUS_23450 5356 5778 gene locus_tag LOCUS_23460 5356 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 5775 7229 gene locus_tag LOCUS_23470 5775 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 8590 7226 gene locus_tag LOCUS_23480 8590 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 >Feature sequence165 1966 2505 gene locus_tag LOCUS_23490 1966 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 2519 4258 gene locus_tag LOCUS_23500 2519 4258 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940770.1 protein_id gnl|my_center|LOCUS_23500 4251 6020 gene locus_tag LOCUS_23510 4251 6020 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940777.1 protein_id gnl|my_center|LOCUS_23510 6125 6838 gene locus_tag LOCUS_23520 gene cobB 6125 6838 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952746.1 protein_id gnl|my_center|LOCUS_23520 9047 7941 gene locus_tag LOCUS_23530 9047 7941 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028905.1 protein_id gnl|my_center|LOCUS_23530 9139 10095 gene locus_tag LOCUS_23540 9139 10095 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_23540 >Feature sequence166 322 555 gene locus_tag LOCUS_23550 322 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 1733 552 gene locus_tag LOCUS_23560 1733 552 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_23560 1841 2641 gene locus_tag LOCUS_23570 1841 2641 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078448.1 protein_id gnl|my_center|LOCUS_23570 4584 2638 gene locus_tag LOCUS_23580 4584 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 5248 4616 gene locus_tag LOCUS_23590 5248 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 6092 5409 gene locus_tag LOCUS_23600 6092 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 9322 6089 gene locus_tag LOCUS_23610 9322 6089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence167 <1 619 gene locus_tag LOCUS_23620 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882887.1:3-deoxy-manno-octulosonate cytidylyltransferase 691 2367 gene locus_tag LOCUS_23630 691 2367 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942540.1 protein_id gnl|my_center|LOCUS_23630 2409 2942 gene locus_tag LOCUS_23640 2409 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2935 3642 gene locus_tag LOCUS_23650 2935 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 3818 5257 gene locus_tag LOCUS_23660 gene rpoN 3818 5257 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938919.1 protein_id gnl|my_center|LOCUS_23660 5299 5637 gene locus_tag LOCUS_23670 5299 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 5800 6960 gene locus_tag LOCUS_23680 gene metK 5800 6960 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_23680 7127 7954 gene locus_tag LOCUS_23690 7127 7954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_23690 7954 9789 gene locus_tag LOCUS_23700 7954 9789 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224226.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence168 2921 423 gene locus_tag LOCUS_23710 gene leuS 2921 423 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132571.1 protein_id gnl|my_center|LOCUS_23710 3832 3020 gene locus_tag LOCUS_23720 3832 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 5311 3866 gene locus_tag LOCUS_23730 5311 3866 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_23730 5587 6573 gene locus_tag LOCUS_23740 5587 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 6648 7316 gene locus_tag LOCUS_23750 6648 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 9269 7380 gene locus_tag LOCUS_23760 9269 7380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 >Feature sequence169 3650 4474 gene locus_tag LOCUS_23770 3650 4474 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524370.1 protein_id gnl|my_center|LOCUS_23770 4516 5292 gene locus_tag LOCUS_23780 4516 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 5439 8249 gene locus_tag LOCUS_23790 5439 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 8300 9037 gene locus_tag LOCUS_23800 8300 9037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence170 1060 299 gene locus_tag LOCUS_23810 1060 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1449 1045 gene locus_tag LOCUS_23820 1449 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 1640 1449 gene locus_tag LOCUS_23830 1640 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 3207 1834 gene locus_tag LOCUS_23840 3207 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 3294 4421 gene locus_tag LOCUS_23850 3294 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 5325 4447 gene locus_tag LOCUS_23860 5325 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 6047 5379 gene locus_tag LOCUS_23870 gene uppS 6047 5379 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675801.1 protein_id gnl|my_center|LOCUS_23870 7504 6047 gene locus_tag LOCUS_23880 7504 6047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 7581 9890 gene locus_tag LOCUS_23890 7581 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence171 3949 152 gene locus_tag LOCUS_23900 3949 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3893 4279 gene locus_tag LOCUS_23910 3893 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 6277 4376 gene locus_tag LOCUS_23920 6277 4376 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404234.1 protein_id gnl|my_center|LOCUS_23920 8634 6277 gene locus_tag LOCUS_23930 8634 6277 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404233.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence172 1749 2585 gene locus_tag LOCUS_23940 1749 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 2585 3526 gene locus_tag LOCUS_23950 2585 3526 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268793.1 protein_id gnl|my_center|LOCUS_23950 3523 4293 gene locus_tag LOCUS_23960 3523 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 4290 6206 gene locus_tag LOCUS_23970 4290 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 6233 7183 gene locus_tag LOCUS_23980 6233 7183 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_23980 7180 8475 gene locus_tag LOCUS_23990 7180 8475 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121952.1 protein_id gnl|my_center|LOCUS_23990 8497 8793 gene locus_tag LOCUS_24000 8497 8793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 8957 9709 gene locus_tag LOCUS_24010 8957 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence173 1053 1997 gene locus_tag LOCUS_24020 1053 1997 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000954148.1 protein_id gnl|my_center|LOCUS_24020 2118 3086 gene locus_tag LOCUS_24030 2118 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 3250 4710 gene locus_tag LOCUS_24040 3250 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 5158 4703 gene locus_tag LOCUS_24050 5158 4703 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072803.1 protein_id gnl|my_center|LOCUS_24050 5629 9831 gene locus_tag LOCUS_24060 5629 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24060 >Feature sequence174 <1 1459 gene locus_tag LOCUS_24070 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase 1459 2178 gene locus_tag LOCUS_24080 1459 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 2175 2954 gene locus_tag LOCUS_24090 2175 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 5046 2974 gene locus_tag LOCUS_24100 5046 2974 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073607.1 protein_id gnl|my_center|LOCUS_24100 5128 5706 gene locus_tag LOCUS_24110 5128 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 6614 5703 gene locus_tag LOCUS_24120 6614 5703 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190190.1 protein_id gnl|my_center|LOCUS_24120 6613 7395 gene locus_tag LOCUS_24130 6613 7395 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707415.1 protein_id gnl|my_center|LOCUS_24130 7398 9041 gene locus_tag LOCUS_24140 7398 9041 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946539.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence175 90 1301 gene locus_tag LOCUS_24150 90 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 1301 2383 gene locus_tag LOCUS_24160 gene serC 1301 2383 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_24160 2405 2725 gene locus_tag LOCUS_24170 2405 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 3934 2735 gene locus_tag LOCUS_24180 3934 2735 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_24180 4096 7293 gene locus_tag LOCUS_24190 4096 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 7300 8157 gene locus_tag LOCUS_24200 7300 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 8639 8154 gene locus_tag LOCUS_24210 8639 8154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112531.1 protein_id gnl|my_center|LOCUS_24210 <9876 8636 gene locus_tag LOCUS_24220 <9876 8636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584135.1:serine/threonine-protein kinase >Feature sequence176 522 1736 gene locus_tag LOCUS_24230 522 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1857 1784 gene locus_tag LOCUS_t00150 1857 1784 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1941 2777 gene locus_tag LOCUS_24240 1941 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2774 3220 gene locus_tag LOCUS_24250 2774 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 3213 3716 gene locus_tag LOCUS_24260 3213 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 3940 4161 gene locus_tag LOCUS_24270 3940 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 4170 5273 gene locus_tag LOCUS_24280 4170 5273 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444177.1 protein_id gnl|my_center|LOCUS_24280 5322 5993 gene locus_tag LOCUS_24290 5322 5993 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_24290 6009 6869 gene locus_tag LOCUS_24300 gene panB 6009 6869 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_24300 6869 7717 gene locus_tag LOCUS_24310 gene panC 6869 7717 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148756109.1 protein_id gnl|my_center|LOCUS_24310 7708 8049 gene locus_tag LOCUS_24320 7708 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 8188 9162 gene locus_tag LOCUS_24330 8188 9162 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_24330 <9857 9244 gene locus_tag LOCUS_24340 <9857 9244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979323.1:homocitrate synthase >Feature sequence177 542 919 gene locus_tag LOCUS_24350 542 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 1649 960 gene locus_tag LOCUS_24360 1649 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1804 2781 gene locus_tag LOCUS_24370 1804 2781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 3641 2955 gene locus_tag LOCUS_24380 3641 2955 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_24380 6497 3651 gene locus_tag LOCUS_24390 6497 3651 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_24390 8044 7277 gene locus_tag LOCUS_24400 gene yaaA 8044 7277 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906171.1 protein_id gnl|my_center|LOCUS_24400 8684 8049 gene locus_tag LOCUS_24410 8684 8049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 9241 9402 gene locus_tag LOCUS_24420 9241 9402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 9426 9623 gene locus_tag LOCUS_24430 9426 9623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 >Feature sequence178 2399 324 gene locus_tag LOCUS_24440 2399 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4108 2612 gene locus_tag LOCUS_24450 4108 2612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 4269 4625 gene locus_tag LOCUS_24460 4269 4625 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206564.1 protein_id gnl|my_center|LOCUS_24460 4628 5614 gene locus_tag LOCUS_24470 4628 5614 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_24470 6796 5747 gene locus_tag LOCUS_24480 6796 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24480 7270 6968 gene locus_tag LOCUS_24490 7270 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24490 8600 7683 gene locus_tag LOCUS_24500 8600 7683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 9535 8597 gene locus_tag LOCUS_24510 9535 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 9522 9689 gene locus_tag LOCUS_24520 9522 9689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 >Feature sequence179 778 380 gene locus_tag LOCUS_24530 778 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 1956 775 gene locus_tag LOCUS_24540 1956 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2583 1996 gene locus_tag LOCUS_24550 2583 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 4591 2744 gene locus_tag LOCUS_24560 4591 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 4848 6209 gene locus_tag LOCUS_24570 4848 6209 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_24570 7138 6215 gene locus_tag LOCUS_24580 gene murB 7138 6215 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_24580 7171 7941 gene locus_tag LOCUS_24590 7171 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 7957 8520 gene locus_tag LOCUS_24600 7957 8520 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_24600 9678 8527 gene locus_tag LOCUS_24610 9678 8527 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762594.1 protein_id gnl|my_center|LOCUS_24610 >Feature sequence180 2144 669 gene locus_tag LOCUS_24620 2144 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 2945 2151 gene locus_tag LOCUS_24630 2945 2151 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_24630 3676 2942 gene locus_tag LOCUS_24640 3676 2942 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_24640 4844 3723 gene locus_tag LOCUS_24650 4844 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 4845 5168 gene locus_tag LOCUS_24660 4845 5168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 5307 5382 gene locus_tag LOCUS_t00160 5307 5382 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5467 6111 gene locus_tag LOCUS_24670 5467 6111 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_24670 7309 6245 gene locus_tag LOCUS_24680 7309 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 7365 8117 gene locus_tag LOCUS_24690 7365 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 8468 8205 gene locus_tag LOCUS_24700 8468 8205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 8826 8644 gene locus_tag LOCUS_24710 8826 8644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 >Feature sequence181 1382 1801 gene locus_tag LOCUS_24720 1382 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 2749 1955 gene locus_tag LOCUS_24730 2749 1955 CDS product M14 family metallocarboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037185.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24730 4561 3041 gene locus_tag LOCUS_24740 4561 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 5133 4558 gene locus_tag LOCUS_24750 5133 4558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 5236 6138 gene locus_tag LOCUS_24760 gene ilvY 5236 6138 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703964.1 protein_id gnl|my_center|LOCUS_24760 6252 6836 gene locus_tag LOCUS_24770 6252 6836 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085822.1 protein_id gnl|my_center|LOCUS_24770 6833 7795 gene locus_tag LOCUS_24780 6833 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 9493 8876 gene locus_tag LOCUS_24790 9493 8876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 >Feature sequence182 182 1039 gene locus_tag LOCUS_24800 gene prmC 182 1039 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_24800 1111 2817 gene locus_tag LOCUS_24810 1111 2817 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_24810 2900 3925 gene locus_tag LOCUS_24820 2900 3925 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933295.1 protein_id gnl|my_center|LOCUS_24820 3933 5096 gene locus_tag LOCUS_24830 3933 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 5259 6995 gene locus_tag LOCUS_24840 5259 6995 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_24840 <9598 6999 gene locus_tag LOCUS_24850 <9598 6999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein >Feature sequence183 <1 1396 gene locus_tag LOCUS_24860 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256440.1:LamG domain-containing protein 1535 2131 gene locus_tag LOCUS_24870 1535 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 3116 2223 gene locus_tag LOCUS_24880 3116 2223 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038750.1 protein_id gnl|my_center|LOCUS_24880 3249 3611 gene locus_tag LOCUS_24890 3249 3611 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404036.1 protein_id gnl|my_center|LOCUS_24890 3939 4205 gene locus_tag LOCUS_24900 3939 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24900 4533 4973 gene locus_tag LOCUS_24910 4533 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 5711 5088 gene locus_tag LOCUS_24920 5711 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 5910 6059 gene locus_tag LOCUS_24930 5910 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 7461 6265 gene locus_tag LOCUS_24940 7461 6265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 >Feature sequence184 3781 1976 gene locus_tag LOCUS_24950 3781 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 4407 3781 gene locus_tag LOCUS_24960 4407 3781 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393242.1 protein_id gnl|my_center|LOCUS_24960 5130 4411 gene locus_tag LOCUS_24970 5130 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 5780 5142 gene locus_tag LOCUS_24980 5780 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 6733 5777 gene locus_tag LOCUS_24990 6733 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 7929 6724 gene locus_tag LOCUS_25000 7929 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 8564 7926 gene locus_tag LOCUS_25010 8564 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence185 771 1367 gene locus_tag LOCUS_25020 771 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 1512 2645 gene locus_tag LOCUS_25030 1512 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25030 2612 4588 gene locus_tag LOCUS_25040 2612 4588 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883150.1 protein_id gnl|my_center|LOCUS_25040 6273 4855 gene locus_tag LOCUS_25050 6273 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 6918 7571 gene locus_tag LOCUS_25060 6918 7571 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051901260.1 protein_id gnl|my_center|LOCUS_25060 7573 9153 gene locus_tag LOCUS_25070 7573 9153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence186 <1 1401 gene locus_tag LOCUS_25080 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD 1435 1508 gene locus_tag LOCUS_t00170 1435 1508 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1525 2220 gene locus_tag LOCUS_25090 1525 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2703 2491 gene locus_tag LOCUS_25100 2703 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 2811 5087 gene locus_tag LOCUS_25110 2811 5087 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_25110 6355 5084 gene locus_tag LOCUS_25120 6355 5084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 8172 6352 gene locus_tag LOCUS_25130 8172 6352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 8578 8165 gene locus_tag LOCUS_25140 8578 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 9207 8833 gene locus_tag LOCUS_25150 9207 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence187 3616 17 gene locus_tag LOCUS_25160 gene dnaE 3616 17 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_25160 3678 4700 gene locus_tag LOCUS_25170 3678 4700 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932879.1 protein_id gnl|my_center|LOCUS_25170 7001 4701 gene locus_tag LOCUS_25180 7001 4701 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_25180 7173 7829 gene locus_tag LOCUS_25190 7173 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 9062 7806 gene locus_tag LOCUS_25200 9062 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 >Feature sequence188 <1 2381 gene locus_tag LOCUS_25210 <1 2381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974111.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 3161 2436 gene locus_tag LOCUS_25220 3161 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4216 3158 gene locus_tag LOCUS_25230 4216 3158 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896630.1 protein_id gnl|my_center|LOCUS_25230 5022 4213 gene locus_tag LOCUS_25240 5022 4213 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920196.1 protein_id gnl|my_center|LOCUS_25240 5800 5030 gene locus_tag LOCUS_25250 5800 5030 CDS product 3-oxo-5-alpha-steroid 4-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111358.1 protein_id gnl|my_center|LOCUS_25250 6164 6625 gene locus_tag LOCUS_25260 6164 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 6632 6880 gene locus_tag LOCUS_25270 6632 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 6987 7328 gene locus_tag LOCUS_25280 6987 7328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 8277 7372 gene locus_tag LOCUS_25290 8277 7372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence189 216 2297 gene locus_tag LOCUS_25300 gene flhA 216 2297 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943681.1 protein_id gnl|my_center|LOCUS_25300 2395 3174 gene locus_tag LOCUS_25310 gene fliA 2395 3174 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_25310 3171 3878 gene locus_tag LOCUS_25320 gene flgF 3171 3878 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937818.1 protein_id gnl|my_center|LOCUS_25320 3875 4636 gene locus_tag LOCUS_25330 gene flgG 3875 4636 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_25330 4640 5239 gene locus_tag LOCUS_25340 4640 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 5236 5943 gene locus_tag LOCUS_25350 5236 5943 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_25350 6027 7118 gene locus_tag LOCUS_25360 6027 7118 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_25360 7134 8681 gene locus_tag LOCUS_25370 7134 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence190 1060 92 gene locus_tag LOCUS_25380 1060 92 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_25380 1959 1057 gene locus_tag LOCUS_25390 1959 1057 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_25390 2966 1956 gene locus_tag LOCUS_25400 gene pseG 2966 1956 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707836.1 protein_id gnl|my_center|LOCUS_25400 3703 2975 gene locus_tag LOCUS_25410 3703 2975 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965489.1 protein_id gnl|my_center|LOCUS_25410 4848 3700 gene locus_tag LOCUS_25420 gene pseC 4848 3700 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_25420 5826 4852 gene locus_tag LOCUS_25430 gene pseB 5826 4852 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_25430 5922 6560 gene locus_tag LOCUS_25440 5922 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 6553 7845 gene locus_tag LOCUS_25450 6553 7845 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707838.1 protein_id gnl|my_center|LOCUS_25450 7838 8095 gene locus_tag LOCUS_25460 7838 8095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 8438 8722 gene locus_tag LOCUS_25470 8438 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence191 2566 2045 gene locus_tag LOCUS_25480 2566 2045 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841462.1 protein_id gnl|my_center|LOCUS_25480 2637 2870 gene locus_tag LOCUS_25490 2637 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 4323 2875 gene locus_tag LOCUS_25500 4323 2875 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_25500 5650 4400 gene locus_tag LOCUS_25510 5650 4400 CDS product thymidine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349496.1 protein_id gnl|my_center|LOCUS_25510 7218 5647 gene locus_tag LOCUS_25520 7218 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7261 8181 gene locus_tag LOCUS_25530 gene deoC 7261 8181 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029945.1 protein_id gnl|my_center|LOCUS_25530 >Feature sequence192 1252 629 gene locus_tag LOCUS_25540 1252 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1361 1822 gene locus_tag LOCUS_25550 1361 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 1827 2696 gene locus_tag LOCUS_25560 1827 2696 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_25560 3983 2748 gene locus_tag LOCUS_25570 3983 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 4474 3980 gene locus_tag LOCUS_25580 4474 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 6425 4476 gene locus_tag LOCUS_25590 6425 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 6517 7089 gene locus_tag LOCUS_25600 6517 7089 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388397.1 protein_id gnl|my_center|LOCUS_25600 7202 7723 gene locus_tag LOCUS_25610 7202 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25610 7727 8494 gene locus_tag LOCUS_25620 7727 8494 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence193 3579 697 gene locus_tag LOCUS_25630 3579 697 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972453.1 protein_id gnl|my_center|LOCUS_25630 5502 3679 gene locus_tag LOCUS_25640 5502 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 5700 6320 gene locus_tag LOCUS_25650 5700 6320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 6435 7430 gene locus_tag LOCUS_25660 6435 7430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 8218 7391 gene locus_tag LOCUS_25670 8218 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence194 1828 659 gene locus_tag LOCUS_25680 1828 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 2791 1838 gene locus_tag LOCUS_25690 gene mltG 2791 1838 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438164.1 protein_id gnl|my_center|LOCUS_25690 4742 2844 gene locus_tag LOCUS_25700 4742 2844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 4898 5698 gene locus_tag LOCUS_25710 4898 5698 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_25710 5667 6398 gene locus_tag LOCUS_25720 5667 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 7105 6395 gene locus_tag LOCUS_25730 7105 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 8073 7105 gene locus_tag LOCUS_25740 gene rluD 8073 7105 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_25740 8184 8951 gene locus_tag LOCUS_25750 8184 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 >Feature sequence195 1952 648 gene locus_tag LOCUS_25760 gene murD 1952 648 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_25760 3076 1955 gene locus_tag LOCUS_25770 gene mraY 3076 1955 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_25770 4434 3076 gene locus_tag LOCUS_25780 4434 3076 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_25780 5873 4515 gene locus_tag LOCUS_25790 5873 4515 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_25790 8309 6309 gene locus_tag LOCUS_25800 8309 6309 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_25800 8659 8306 gene locus_tag LOCUS_25810 8659 8306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 >Feature sequence196 1900 1139 gene locus_tag LOCUS_25820 1900 1139 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389873.1 protein_id gnl|my_center|LOCUS_25820 2688 1897 gene locus_tag LOCUS_25830 2688 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 3967 2672 gene locus_tag LOCUS_25840 3967 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4904 3957 gene locus_tag LOCUS_25850 4904 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4982 5530 gene locus_tag LOCUS_25860 gene def 4982 5530 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_25860 5530 6834 gene locus_tag LOCUS_25870 5530 6834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 7452 6844 gene locus_tag LOCUS_25880 7452 6844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 8017 7721 gene locus_tag LOCUS_25890 gene yhbY 8017 7721 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004389225.1 protein_id gnl|my_center|LOCUS_25890 8663 8025 gene locus_tag LOCUS_25900 8663 8025 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164275233.1 protein_id gnl|my_center|LOCUS_25900 >Feature sequence197 51 1856 gene locus_tag LOCUS_25910 51 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2037 2519 gene locus_tag LOCUS_25920 2037 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 2525 4204 gene locus_tag LOCUS_25930 2525 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 4195 5643 gene locus_tag LOCUS_25940 4195 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 5921 8530 gene locus_tag LOCUS_25950 5921 8530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 >Feature sequence198 454 1113 gene locus_tag LOCUS_25960 454 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 1098 2420 gene locus_tag LOCUS_25970 gene fliI 1098 2420 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_25970 2658 3863 gene locus_tag LOCUS_25980 2658 3863 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_25980 3758 3964 gene locus_tag LOCUS_25990 3758 3964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 3961 4824 gene locus_tag LOCUS_26000 3961 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 5010 5729 gene locus_tag LOCUS_26010 5010 5729 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704963.1 protein_id gnl|my_center|LOCUS_26010 6134 7393 gene locus_tag LOCUS_26020 6134 7393 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895625.1 protein_id gnl|my_center|LOCUS_26020 8791 7406 gene locus_tag LOCUS_26030 8791 7406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 >Feature sequence199 1242 2447 gene locus_tag LOCUS_26040 1242 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 3122 2442 gene locus_tag LOCUS_26050 3122 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3649 3131 gene locus_tag LOCUS_26060 3649 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4425 3712 gene locus_tag LOCUS_26070 4425 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 5144 4434 gene locus_tag LOCUS_26080 5144 4434 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975365.1 protein_id gnl|my_center|LOCUS_26080 5104 5763 gene locus_tag LOCUS_26090 5104 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 5830 5756 gene locus_tag LOCUS_t00180 5830 5756 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6148 5903 gene locus_tag LOCUS_26100 6148 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence200 1410 490 gene locus_tag LOCUS_26110 1410 490 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256673.1 protein_id gnl|my_center|LOCUS_26110 1555 2700 gene locus_tag LOCUS_26120 1555 2700 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103930.1 protein_id gnl|my_center|LOCUS_26120 2719 3321 gene locus_tag LOCUS_26130 2719 3321 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944032.1 protein_id gnl|my_center|LOCUS_26130 3415 4509 gene locus_tag LOCUS_26140 3415 4509 CDS product tRNA-uridine aminocarboxypropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102017613.1 protein_id gnl|my_center|LOCUS_26140 4506 5159 gene locus_tag LOCUS_26150 4506 5159 CDS product CatA-like O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963558.1 protein_id gnl|my_center|LOCUS_26150 5563 5156 gene locus_tag LOCUS_26160 5563 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 5954 7771 gene locus_tag LOCUS_26170 5954 7771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 7822 8082 gene locus_tag LOCUS_26180 7822 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 >Feature sequence201 1516 176 gene locus_tag LOCUS_26190 1516 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1565 3256 gene locus_tag LOCUS_26200 1565 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 4164 3253 gene locus_tag LOCUS_26210 4164 3253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 5102 4167 gene locus_tag LOCUS_26220 5102 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 6257 5121 gene locus_tag LOCUS_26230 6257 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 <8867 6254 gene locus_tag LOCUS_26240 <8867 6254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941653.1:putative baseplate assembly protein >Feature sequence202 1341 2147 gene locus_tag LOCUS_26250 1341 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 2147 3151 gene locus_tag LOCUS_26260 2147 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 3181 4242 gene locus_tag LOCUS_26270 3181 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 4873 4316 gene locus_tag LOCUS_26280 4873 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 5578 4883 gene locus_tag LOCUS_26290 5578 4883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 6834 5575 gene locus_tag LOCUS_26300 gene purD 6834 5575 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918186.1 protein_id gnl|my_center|LOCUS_26300 7382 6873 gene locus_tag LOCUS_26310 7382 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 8281 7475 gene locus_tag LOCUS_26320 8281 7475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 8396 8572 gene locus_tag LOCUS_26330 8396 8572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 >Feature sequence203 241 2235 gene locus_tag LOCUS_26340 241 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2232 4265 gene locus_tag LOCUS_26350 2232 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4259 5140 gene locus_tag LOCUS_26360 4259 5140 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_26360 5137 5817 gene locus_tag LOCUS_26370 5137 5817 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986926.1 protein_id gnl|my_center|LOCUS_26370 5910 6389 gene locus_tag LOCUS_26380 5910 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 7643 6396 gene locus_tag LOCUS_26390 7643 6396 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224717.1 protein_id gnl|my_center|LOCUS_26390 >Feature sequence204 1323 643 gene locus_tag LOCUS_26400 1323 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2126 1419 gene locus_tag LOCUS_26410 2126 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 3151 2123 gene locus_tag LOCUS_26420 3151 2123 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_26420 3858 3148 gene locus_tag LOCUS_26430 3858 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 4640 3858 gene locus_tag LOCUS_26440 4640 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4826 5767 gene locus_tag LOCUS_26450 4826 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 5835 7268 gene locus_tag LOCUS_26460 gene purB 5835 7268 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121816.1 protein_id gnl|my_center|LOCUS_26460 8164 7277 gene locus_tag LOCUS_26470 8164 7277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 8214 8582 gene locus_tag LOCUS_26480 8214 8582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 >Feature sequence205 561 1712 gene locus_tag LOCUS_26490 561 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1717 3447 gene locus_tag LOCUS_26500 1717 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 4234 3425 gene locus_tag LOCUS_26510 4234 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 4686 4231 gene locus_tag LOCUS_26520 4686 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 4714 5865 gene locus_tag LOCUS_26530 4714 5865 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088637.1 protein_id gnl|my_center|LOCUS_26530 6816 5914 gene locus_tag LOCUS_26540 6816 5914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 8789 6951 gene locus_tag LOCUS_26550 8789 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 >Feature sequence206 <1 704 gene locus_tag LOCUS_26560 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005082863.1:protein phosphatase 2C domain-containing protein 766 2367 gene locus_tag LOCUS_26570 766 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3408 2374 gene locus_tag LOCUS_26580 3408 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 5291 3405 gene locus_tag LOCUS_26590 5291 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 6016 5291 gene locus_tag LOCUS_26600 6016 5291 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000487316.1 protein_id gnl|my_center|LOCUS_26600 6945 6016 gene locus_tag LOCUS_26610 6945 6016 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_26610 8023 6998 gene locus_tag LOCUS_26620 8023 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 <8763 8028 gene locus_tag LOCUS_26630 <8763 8028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141364.1:DEAD/DEAH box helicase family protein >Feature sequence207 2229 1099 gene locus_tag LOCUS_26640 2229 1099 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338703.1 protein_id gnl|my_center|LOCUS_26640 3284 2226 gene locus_tag LOCUS_26650 3284 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 3335 5476 gene locus_tag LOCUS_26660 3335 5476 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_26660 5470 6108 gene locus_tag LOCUS_26670 5470 6108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 6105 7283 gene locus_tag LOCUS_26680 6105 7283 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256328.1 protein_id gnl|my_center|LOCUS_26680 8291 7287 gene locus_tag LOCUS_26690 8291 7287 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403060.1 protein_id gnl|my_center|LOCUS_26690 >Feature sequence208 131 562 gene locus_tag LOCUS_26700 131 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 622 981 gene locus_tag LOCUS_26710 gene rbfA 622 981 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_26710 978 1946 gene locus_tag LOCUS_26720 gene truB 978 1946 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_26720 2133 1957 gene locus_tag LOCUS_26730 2133 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 2099 2368 gene locus_tag LOCUS_26740 gene rpsO 2099 2368 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894036.1 protein_id gnl|my_center|LOCUS_26740 2642 4744 gene locus_tag LOCUS_26750 gene pnp 2642 4744 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_26750 4744 5190 gene locus_tag LOCUS_26760 gene dut 4744 5190 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_26760 5890 5195 gene locus_tag LOCUS_26770 5890 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5991 7544 gene locus_tag LOCUS_26780 gene ffh 5991 7544 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081977.1 protein_id gnl|my_center|LOCUS_26780 7551 8405 gene locus_tag LOCUS_26790 7551 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 >Feature sequence209 1140 619 gene locus_tag LOCUS_26800 1140 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 2249 1137 gene locus_tag LOCUS_26810 2249 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 2673 2242 gene locus_tag LOCUS_26820 gene mce 2673 2242 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_26820 3373 2726 gene locus_tag LOCUS_26830 3373 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 4313 3462 gene locus_tag LOCUS_26840 4313 3462 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601184.1 protein_id gnl|my_center|LOCUS_26840 5005 4310 gene locus_tag LOCUS_26850 5005 4310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 5101 6249 gene locus_tag LOCUS_26860 5101 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 7441 6278 gene locus_tag LOCUS_26870 7441 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 7702 7523 gene locus_tag LOCUS_26880 7702 7523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 >Feature sequence210 671 2344 gene locus_tag LOCUS_26890 671 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 2550 2741 gene locus_tag LOCUS_26900 2550 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 3962 3267 gene locus_tag LOCUS_26910 3962 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 4447 5700 gene locus_tag LOCUS_26920 4447 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 5700 6266 gene locus_tag LOCUS_26930 5700 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 6564 6349 gene locus_tag LOCUS_26940 6564 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 7543 7373 gene locus_tag LOCUS_26950 7543 7373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence211 391 585 gene locus_tag LOCUS_26960 gene rpmI 391 585 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808207.1 protein_id gnl|my_center|LOCUS_26960 651 1004 gene locus_tag LOCUS_26970 gene rplT 651 1004 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037598.1 protein_id gnl|my_center|LOCUS_26970 1019 1495 gene locus_tag LOCUS_26980 1019 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 1492 1824 gene locus_tag LOCUS_26990 gene ihfA 1492 1824 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719760.1 protein_id gnl|my_center|LOCUS_26990 1817 2218 gene locus_tag LOCUS_27000 1817 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 2255 2331 gene locus_tag LOCUS_t00190 2255 2331 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2461 3210 gene locus_tag LOCUS_27010 gene surE 2461 3210 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704774.1 protein_id gnl|my_center|LOCUS_27010 3266 4186 gene locus_tag LOCUS_27020 3266 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 4902 4297 gene locus_tag LOCUS_27030 gene coaE 4902 4297 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976822.1 protein_id gnl|my_center|LOCUS_27030 6682 4904 gene locus_tag LOCUS_27040 6682 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 7596 6775 gene locus_tag LOCUS_27050 7596 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 7838 8563 gene locus_tag LOCUS_27060 7838 8563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence212 1063 413 gene locus_tag LOCUS_27070 1063 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 1671 1063 gene locus_tag LOCUS_27080 1671 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 1874 2110 gene locus_tag LOCUS_27090 1874 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 2107 3804 gene locus_tag LOCUS_27100 2107 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3807 4703 gene locus_tag LOCUS_27110 3807 4703 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_27110 4700 5467 gene locus_tag LOCUS_27120 4700 5467 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039081.1 protein_id gnl|my_center|LOCUS_27120 5460 6083 gene locus_tag LOCUS_27130 5460 6083 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005088087.1 protein_id gnl|my_center|LOCUS_27130 6870 6091 gene locus_tag LOCUS_27140 6870 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6960 8351 gene locus_tag LOCUS_27150 gene ntrC 6960 8351 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930451.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence213 2327 1923 gene locus_tag LOCUS_27160 2327 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 2302 2463 gene locus_tag LOCUS_27170 2302 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 3574 2453 gene locus_tag LOCUS_27180 3574 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 6316 3608 gene locus_tag LOCUS_27190 gene fdhF 6316 3608 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(5246..5248),aa:Sec) note codon on position 357 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_27190 7821 6313 gene locus_tag LOCUS_27200 7821 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence214 <1 1005 gene locus_tag LOCUS_27210 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943546.1:sigma-54 dependent transcriptional regulator 2464 998 gene locus_tag LOCUS_27220 2464 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 5319 3316 gene locus_tag LOCUS_27230 5319 3316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 6835 5657 gene locus_tag LOCUS_27240 6835 5657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 7264 7614 gene locus_tag LOCUS_27250 7264 7614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence215 132 947 gene locus_tag LOCUS_27260 132 947 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224429.1 protein_id gnl|my_center|LOCUS_27260 960 2465 gene locus_tag LOCUS_27270 gene fadD4 960 2465 CDS product fatty-acid--CoA ligase FadD4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726785.1 protein_id gnl|my_center|LOCUS_27270 2465 2896 gene locus_tag LOCUS_27280 2465 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 3038 3826 gene locus_tag LOCUS_27290 3038 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 3882 4808 gene locus_tag LOCUS_27300 3882 4808 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_27300 4896 5477 gene locus_tag LOCUS_27310 4896 5477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 5484 5648 gene locus_tag LOCUS_27320 5484 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 5703 8420 gene locus_tag LOCUS_27330 5703 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 >Feature sequence216 2427 187 gene locus_tag LOCUS_27340 2427 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 2644 2946 gene locus_tag LOCUS_27350 2644 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2943 3383 gene locus_tag LOCUS_27360 2943 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 5344 3512 gene locus_tag LOCUS_27370 5344 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 6097 7293 gene locus_tag LOCUS_27380 6097 7293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 7899 8324 gene locus_tag LOCUS_27390 7899 8324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 >Feature sequence217 2691 1390 gene locus_tag LOCUS_27400 2691 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27400 2909 4000 gene locus_tag LOCUS_27410 gene mqnC 2909 4000 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_27410 4286 4837 gene locus_tag LOCUS_27420 4286 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 4816 5532 gene locus_tag LOCUS_27430 4816 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 5895 5533 gene locus_tag LOCUS_27440 5895 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 6187 6807 gene locus_tag LOCUS_27450 6187 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 <8354 6815 gene locus_tag LOCUS_27460 <8354 6815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence218 2104 116 gene locus_tag LOCUS_27470 2104 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2710 2432 gene locus_tag LOCUS_27480 2710 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2919 3548 gene locus_tag LOCUS_27490 2919 3548 CDS product cysteine dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705143.1 protein_id gnl|my_center|LOCUS_27490 3639 5819 gene locus_tag LOCUS_27500 3639 5819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 5915 6229 gene locus_tag LOCUS_27510 5915 6229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27510 6233 6955 gene locus_tag LOCUS_27520 6233 6955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27520 7153 7776 gene locus_tag LOCUS_27530 7153 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 7835 8254 gene locus_tag LOCUS_27540 7835 8254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence219 1357 326 gene locus_tag LOCUS_27550 gene gcvT 1357 326 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_27550 2316 1465 gene locus_tag LOCUS_27560 gene folD 2316 1465 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686899.1 protein_id gnl|my_center|LOCUS_27560 2669 2313 gene locus_tag LOCUS_27570 2669 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2785 3594 gene locus_tag LOCUS_27580 2785 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3591 4520 gene locus_tag LOCUS_27590 3591 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 4517 5602 gene locus_tag LOCUS_27600 4517 5602 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419740.1 protein_id gnl|my_center|LOCUS_27600 6642 5626 gene locus_tag LOCUS_27610 6642 5626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 7631 6672 gene locus_tag LOCUS_27620 7631 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence220 2 379 gene locus_tag LOCUS_27630 2 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1787 453 gene locus_tag LOCUS_27640 1787 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 2523 1903 gene locus_tag LOCUS_27650 2523 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 3085 2600 gene locus_tag LOCUS_27660 3085 2600 CDS product hotdog fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200892.1 protein_id gnl|my_center|LOCUS_27660 3238 4266 gene locus_tag LOCUS_27670 3238 4266 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112080.1 protein_id gnl|my_center|LOCUS_27670 4509 4946 gene locus_tag LOCUS_27680 4509 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 5002 5649 gene locus_tag LOCUS_27690 5002 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 <8286 6182 gene locus_tag LOCUS_27700 <8286 6182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141450.1:FG-GAP-like repeat-containing protein >Feature sequence221 874 269 gene locus_tag LOCUS_27710 874 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 1083 2111 gene locus_tag LOCUS_27720 1083 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 2671 2108 gene locus_tag LOCUS_27730 2671 2108 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_27730 5091 2695 gene locus_tag LOCUS_27740 5091 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5249 6163 gene locus_tag LOCUS_27750 5249 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 7325 6126 gene locus_tag LOCUS_27760 7325 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence222 3108 2416 gene locus_tag LOCUS_27770 3108 2416 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919795.1 protein_id gnl|my_center|LOCUS_27770 4439 3105 gene locus_tag LOCUS_27780 4439 3105 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_27780 5479 4565 gene locus_tag LOCUS_27790 5479 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 6586 5504 gene locus_tag LOCUS_27800 gene prfB 6586 5504 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 protein_id gnl|my_center|LOCUS_27800 7157 6693 gene locus_tag LOCUS_27810 7157 6693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 8182 7157 gene locus_tag LOCUS_27820 8182 7157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence223 235 4206 gene locus_tag LOCUS_27830 235 4206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 4241 7393 gene locus_tag LOCUS_27840 4241 7393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 8265 7390 gene locus_tag LOCUS_27850 8265 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 >Feature sequence224 364 1164 gene locus_tag LOCUS_27860 364 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27860 1161 1919 gene locus_tag LOCUS_27870 1161 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 1922 3088 gene locus_tag LOCUS_27880 1922 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 3123 4211 gene locus_tag LOCUS_27890 3123 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 4706 4254 gene locus_tag LOCUS_27900 4706 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 5187 4714 gene locus_tag LOCUS_27910 5187 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 6359 5196 gene locus_tag LOCUS_27920 6359 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 7040 6459 gene locus_tag LOCUS_27930 7040 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 7076 7741 gene locus_tag LOCUS_27940 7076 7741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 8260 7745 gene locus_tag LOCUS_27950 8260 7745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence225 1012 638 gene locus_tag LOCUS_27960 1012 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1198 1560 gene locus_tag LOCUS_27970 1198 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 3706 1544 gene locus_tag LOCUS_27980 3706 1544 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119948893.1 protein_id gnl|my_center|LOCUS_27980 4547 3741 gene locus_tag LOCUS_27990 4547 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 4702 6432 gene locus_tag LOCUS_28000 4702 6432 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_28000 6632 8182 gene locus_tag LOCUS_28010 6632 8182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 >Feature sequence226 1427 639 gene locus_tag LOCUS_28020 1427 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1501 4152 gene locus_tag LOCUS_28030 1501 4152 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_28030 4218 4670 gene locus_tag LOCUS_28040 4218 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 5524 4733 gene locus_tag LOCUS_28050 5524 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 5622 6767 gene locus_tag LOCUS_28060 5622 6767 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_28060 6865 8076 gene locus_tag LOCUS_28070 6865 8076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence227 1853 75 gene locus_tag LOCUS_28080 1853 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 2938 1850 gene locus_tag LOCUS_28090 2938 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 3215 3976 gene locus_tag LOCUS_28100 3215 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 3984 5456 gene locus_tag LOCUS_28110 3984 5456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 5569 6357 gene locus_tag LOCUS_28120 gene gluQRS 5569 6357 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792234.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28120 8011 6416 gene locus_tag LOCUS_28130 8011 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence228 436 2220 gene locus_tag LOCUS_28140 436 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 2650 2560 gene locus_tag LOCUS_t00200 2650 2560 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3141 2710 gene locus_tag LOCUS_28150 3141 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 4826 3138 gene locus_tag LOCUS_28160 4826 3138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 6626 4887 gene locus_tag LOCUS_28170 gene argS 6626 4887 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016438.1 protein_id gnl|my_center|LOCUS_28170 7061 6660 gene locus_tag LOCUS_28180 7061 6660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7784 7065 gene locus_tag LOCUS_28190 7784 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 >Feature sequence229 852 625 gene locus_tag LOCUS_28200 852 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2531 1308 gene locus_tag LOCUS_28210 2531 1308 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_28210 3156 2533 gene locus_tag LOCUS_28220 3156 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 4037 3153 gene locus_tag LOCUS_28230 4037 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 4591 4040 gene locus_tag LOCUS_28240 4591 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 4898 5290 gene locus_tag LOCUS_28250 4898 5290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 5760 5287 gene locus_tag LOCUS_28260 gene bcp 5760 5287 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229449.1 protein_id gnl|my_center|LOCUS_28260 5844 6683 gene locus_tag LOCUS_28270 5844 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 >Feature sequence230 1200 2030 gene locus_tag LOCUS_28280 1200 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28280 2109 2660 gene locus_tag LOCUS_28290 2109 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28290 2834 3361 gene locus_tag LOCUS_28300 2834 3361 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402962.1 protein_id gnl|my_center|LOCUS_28300 3358 4620 gene locus_tag LOCUS_28310 3358 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 4951 5796 gene locus_tag LOCUS_28320 4951 5796 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030521.1 protein_id gnl|my_center|LOCUS_28320 5793 6770 gene locus_tag LOCUS_28330 5793 6770 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005080280.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence231 1542 2816 gene locus_tag LOCUS_28340 1542 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2813 3187 gene locus_tag LOCUS_28350 2813 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 3187 3813 gene locus_tag LOCUS_28360 3187 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 4273 3815 gene locus_tag LOCUS_28370 4273 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 4481 6295 gene locus_tag LOCUS_28380 4481 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 7749 6301 gene locus_tag LOCUS_28390 7749 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence232 278 451 gene locus_tag LOCUS_28400 278 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 823 2760 gene locus_tag LOCUS_28410 823 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 3164 3436 gene locus_tag LOCUS_28420 3164 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 3793 4131 gene locus_tag LOCUS_28430 3793 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence233 1285 443 gene locus_tag LOCUS_28440 1285 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 1807 1325 gene locus_tag LOCUS_28450 1807 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 3406 1883 gene locus_tag LOCUS_28460 3406 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 3932 3393 gene locus_tag LOCUS_28470 3932 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 4277 4564 gene locus_tag LOCUS_28480 4277 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 4986 4570 gene locus_tag LOCUS_28490 4986 4570 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707897.1 protein_id gnl|my_center|LOCUS_28490 5606 4983 gene locus_tag LOCUS_28500 5606 4983 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_28500 5889 6782 gene locus_tag LOCUS_28510 gene rpoD 5889 6782 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_28510 <7832 6848 gene locus_tag LOCUS_28520 <7832 6848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140250.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence234 2798 1695 gene locus_tag LOCUS_28530 2798 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 3675 3007 gene locus_tag LOCUS_28540 3675 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 3763 4599 gene locus_tag LOCUS_28550 3763 4599 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111464.1 protein_id gnl|my_center|LOCUS_28550 4592 4975 gene locus_tag LOCUS_28560 4592 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 4976 5740 gene locus_tag LOCUS_28570 4976 5740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 5899 7338 gene locus_tag LOCUS_28580 5899 7338 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 protein_id gnl|my_center|LOCUS_28580 >Feature sequence235 734 150 gene locus_tag LOCUS_28590 734 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 1766 738 gene locus_tag LOCUS_28600 1766 738 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_28600 2716 1826 gene locus_tag LOCUS_28610 2716 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 3615 2737 gene locus_tag LOCUS_28620 3615 2737 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552051.1 protein_id gnl|my_center|LOCUS_28620 3655 4848 gene locus_tag LOCUS_28630 gene rlmD 3655 4848 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167240.1 protein_id gnl|my_center|LOCUS_28630 4980 5918 gene locus_tag LOCUS_28640 4980 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 <7793 5962 gene locus_tag LOCUS_28650 <7793 5962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057830.1:M1 family metallopeptidase >Feature sequence236 681 3071 gene locus_tag LOCUS_28660 681 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 3068 5428 gene locus_tag LOCUS_28670 3068 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 7084 5702 gene locus_tag LOCUS_28680 7084 5702 CDS product S1C family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125226.1 protein_id gnl|my_center|LOCUS_28680 >Feature sequence237 1237 416 gene locus_tag LOCUS_28690 1237 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2055 4985 gene locus_tag LOCUS_28700 2055 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 5001 5420 gene locus_tag LOCUS_28710 5001 5420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 5617 6243 gene locus_tag LOCUS_28720 5617 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 6277 6765 gene locus_tag LOCUS_28730 6277 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 >Feature sequence238 97 606 gene locus_tag LOCUS_28740 97 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 608 2692 gene locus_tag LOCUS_28750 gene extM 608 2692 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_28750 2689 3675 gene locus_tag LOCUS_28760 2689 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 3675 4646 gene locus_tag LOCUS_28770 3675 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 4650 5324 gene locus_tag LOCUS_28780 4650 5324 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_28780 6478 5321 gene locus_tag LOCUS_28790 6478 5321 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_28790 6777 6475 gene locus_tag LOCUS_28800 6777 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 7658 6804 gene locus_tag LOCUS_28810 7658 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence239 63 163 gene locus_tag LOCUS_t00210 63 163 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 301 933 gene locus_tag LOCUS_28820 301 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 1125 1997 gene locus_tag LOCUS_28830 1125 1997 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020228.1 protein_id gnl|my_center|LOCUS_28830 2470 3279 gene locus_tag LOCUS_28840 2470 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 3746 3976 gene locus_tag LOCUS_28850 3746 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 5118 4051 gene locus_tag LOCUS_28860 5118 4051 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929840.1 protein_id gnl|my_center|LOCUS_28860 5166 6020 gene locus_tag LOCUS_28870 gene hchA 5166 6020 CDS product protein deglycase HchA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000218228.1 protein_id gnl|my_center|LOCUS_28870 6215 7717 gene locus_tag LOCUS_28880 6215 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 >Feature sequence240 <1 1123 gene locus_tag LOCUS_28890 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226839.1:aminotransferase class V-fold PLP-dependent enzyme 1120 2643 gene locus_tag LOCUS_28900 1120 2643 CDS product M81 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391662.1 protein_id gnl|my_center|LOCUS_28900 2887 2645 gene locus_tag LOCUS_28910 2887 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 3130 2900 gene locus_tag LOCUS_28920 3130 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 3365 5740 gene locus_tag LOCUS_28930 3365 5740 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383620.1 protein_id gnl|my_center|LOCUS_28930 6207 5956 gene locus_tag LOCUS_28940 6207 5956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 6546 6208 gene locus_tag LOCUS_28950 6546 6208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 <7718 6607 gene locus_tag LOCUS_28960 <7718 6607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112888.1:molybdopterin oxidoreductase family protein >Feature sequence241 640 1557 gene locus_tag LOCUS_28970 640 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122051.1 protein_id gnl|my_center|LOCUS_28970 1554 2402 gene locus_tag LOCUS_28980 1554 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_28980 2993 2403 gene locus_tag LOCUS_28990 2993 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 2956 3261 gene locus_tag LOCUS_29000 2956 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 3274 5193 gene locus_tag LOCUS_29010 3274 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 6762 5203 gene locus_tag LOCUS_29020 6762 5203 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_29020 7464 6952 gene locus_tag LOCUS_29030 7464 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence242 680 817 gene locus_tag LOCUS_29040 680 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 1682 777 gene locus_tag LOCUS_29050 1682 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2615 1710 gene locus_tag LOCUS_29060 2615 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2699 3151 gene locus_tag LOCUS_29070 2699 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 4970 3141 gene locus_tag LOCUS_29080 4970 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 7267 5660 gene locus_tag LOCUS_29090 7267 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence243 3001 1688 gene locus_tag LOCUS_29100 3001 1688 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418921.1 protein_id gnl|my_center|LOCUS_29100 3828 3124 gene locus_tag LOCUS_29110 3828 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 3894 5294 gene locus_tag LOCUS_29120 3894 5294 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766760.1 protein_id gnl|my_center|LOCUS_29120 5342 6403 gene locus_tag LOCUS_29130 5342 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 6449 7669 gene locus_tag LOCUS_29140 6449 7669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 >Feature sequence244 737 3367 gene locus_tag LOCUS_29150 gene alaS 737 3367 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_29150 3462 4229 gene locus_tag LOCUS_29160 3462 4229 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094072.1 protein_id gnl|my_center|LOCUS_29160 6117 4231 gene locus_tag LOCUS_29170 6117 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 6644 6114 gene locus_tag LOCUS_29180 6644 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29180 >Feature sequence245 1221 2864 gene locus_tag LOCUS_29190 1221 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 2861 4078 gene locus_tag LOCUS_29200 gene xseA 2861 4078 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393024.1 protein_id gnl|my_center|LOCUS_29200 >Feature sequence246 2 493 gene locus_tag LOCUS_29210 2 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29210 4042 497 gene locus_tag LOCUS_29220 4042 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 4973 4035 gene locus_tag LOCUS_29230 4973 4035 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703804.1 protein_id gnl|my_center|LOCUS_29230 5878 5135 gene locus_tag LOCUS_29240 5878 5135 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813226.1 protein_id gnl|my_center|LOCUS_29240 5980 6055 gene locus_tag LOCUS_t00220 5980 6055 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6215 6850 gene locus_tag LOCUS_29250 6215 6850 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_29250 6843 7316 gene locus_tag LOCUS_29260 6843 7316 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence247 1997 21 gene locus_tag LOCUS_29270 1997 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 3124 2117 gene locus_tag LOCUS_29280 gene mltB 3124 2117 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041216677.1 protein_id gnl|my_center|LOCUS_29280 3707 3267 gene locus_tag LOCUS_29290 3707 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 3908 5233 gene locus_tag LOCUS_29300 3908 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 6578 5217 gene locus_tag LOCUS_29310 6578 5217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 <7513 6876 gene locus_tag LOCUS_29320 <7513 6876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528582.1:DMT family transporter >Feature sequence248 1972 1388 gene locus_tag LOCUS_29330 1972 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 2520 2023 gene locus_tag LOCUS_29340 2520 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 3301 2564 gene locus_tag LOCUS_29350 3301 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 3638 4702 gene locus_tag LOCUS_29360 3638 4702 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062314.1 protein_id gnl|my_center|LOCUS_29360 5547 4738 gene locus_tag LOCUS_29370 5547 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 6388 5771 gene locus_tag LOCUS_29380 6388 5771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 7431 6475 gene locus_tag LOCUS_29390 7431 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence249 1501 1429 gene locus_tag LOCUS_t00230 1501 1429 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2447 1548 gene locus_tag LOCUS_29400 2447 1548 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229925.1 protein_id gnl|my_center|LOCUS_29400 3757 2447 gene locus_tag LOCUS_29410 gene tolB 3757 2447 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_29410 4661 3873 gene locus_tag LOCUS_29420 4661 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29420 5092 4658 gene locus_tag LOCUS_29430 gene tolR 5092 4658 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_29430 5809 5324 gene locus_tag LOCUS_29440 5809 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_29440 <7422 5840 gene locus_tag LOCUS_29450 <7422 5840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268224.1:VRR-NUC domain-containing protein >Feature sequence250 1764 1546 gene locus_tag LOCUS_29460 1764 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2112 3449 gene locus_tag LOCUS_29470 gene hflX 2112 3449 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261607.1 protein_id gnl|my_center|LOCUS_29470 3880 3554 gene locus_tag LOCUS_29480 3880 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 4834 4049 gene locus_tag LOCUS_29490 4834 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 4718 4954 gene locus_tag LOCUS_29500 4718 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 5397 4951 gene locus_tag LOCUS_29510 5397 4951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 7322 5433 gene locus_tag LOCUS_29520 7322 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 >Feature sequence251 319 918 gene locus_tag LOCUS_29530 319 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 918 2381 gene locus_tag LOCUS_29540 918 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 2378 3574 gene locus_tag LOCUS_29550 2378 3574 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969409.1 protein_id gnl|my_center|LOCUS_29550 3574 6759 gene locus_tag LOCUS_29560 3574 6759 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123110.1 protein_id gnl|my_center|LOCUS_29560 7306 6830 gene locus_tag LOCUS_29570 7306 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 >Feature sequence252 10 252 gene locus_tag LOCUS_29580 10 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 923 189 gene locus_tag LOCUS_29590 923 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29590 2134 929 gene locus_tag LOCUS_29600 2134 929 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_29600 3530 2127 gene locus_tag LOCUS_29610 3530 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 3803 3543 gene locus_tag LOCUS_29620 3803 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 4600 3800 gene locus_tag LOCUS_29630 4600 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 5283 4603 gene locus_tag LOCUS_29640 5283 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 5242 5406 gene locus_tag LOCUS_29650 5242 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 6474 5524 gene locus_tag LOCUS_29660 6474 5524 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927209.1 protein_id gnl|my_center|LOCUS_29660 <7314 6476 gene locus_tag LOCUS_29670 <7314 6476 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294683.1:CpaF family protein >Feature sequence253 202 2223 gene locus_tag LOCUS_29680 202 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 2220 3647 gene locus_tag LOCUS_29690 2220 3647 CDS product coniferyl aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529049.1 protein_id gnl|my_center|LOCUS_29690 3767 5299 gene locus_tag LOCUS_29700 3767 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 5318 5881 gene locus_tag LOCUS_29710 5318 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 6160 6489 gene locus_tag LOCUS_29720 6160 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 >Feature sequence254 2398 3393 gene locus_tag LOCUS_29730 2398 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 4307 3390 gene locus_tag LOCUS_29740 4307 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 5062 4358 gene locus_tag LOCUS_29750 5062 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 5062 5748 gene locus_tag LOCUS_29760 5062 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 5797 7233 gene locus_tag LOCUS_29770 5797 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29770 >Feature sequence255 42 779 gene locus_tag LOCUS_29780 gene ubiE 42 779 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_29780 >Feature sequence256 1823 846 gene locus_tag LOCUS_29790 1823 846 CDS product cupin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207486.1 protein_id gnl|my_center|LOCUS_29790 2200 1820 gene locus_tag LOCUS_29800 2200 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 4765 2309 gene locus_tag LOCUS_29810 4765 2309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 4915 6270 gene locus_tag LOCUS_29820 gene hisS 4915 6270 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805006.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence257 2655 58 gene locus_tag LOCUS_29830 2655 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 5555 2652 gene locus_tag LOCUS_29840 5555 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 5988 5605 gene locus_tag LOCUS_29850 5988 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 6714 5998 gene locus_tag LOCUS_29860 6714 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 >Feature sequence258 2363 1080 gene locus_tag LOCUS_29870 2363 1080 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_29870 3224 2478 gene locus_tag LOCUS_29880 3224 2478 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031368.1 protein_id gnl|my_center|LOCUS_29880 3956 4141 gene locus_tag LOCUS_29890 3956 4141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 4792 4262 gene locus_tag LOCUS_29900 4792 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 5005 5442 gene locus_tag LOCUS_29910 5005 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 5634 5876 gene locus_tag LOCUS_29920 5634 5876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 7075 6176 gene locus_tag LOCUS_29930 7075 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 >Feature sequence259 <1 937 gene locus_tag LOCUS_29940 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036281.1:GH92 family glycosyl hydrolase 962 2356 gene locus_tag LOCUS_29950 962 2356 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257411.1 protein_id gnl|my_center|LOCUS_29950 2629 3948 gene locus_tag LOCUS_29960 2629 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 4003 5094 gene locus_tag LOCUS_29970 4003 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 5094 6311 gene locus_tag LOCUS_29980 5094 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 >Feature sequence260 313 53 gene locus_tag LOCUS_29990 313 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 703 350 gene locus_tag LOCUS_30000 703 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 1201 2316 gene locus_tag LOCUS_30010 1201 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 2492 3451 gene locus_tag LOCUS_30020 2492 3451 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_30020 3448 4374 gene locus_tag LOCUS_30030 3448 4374 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967250.1 protein_id gnl|my_center|LOCUS_30030 4470 4748 gene locus_tag LOCUS_30040 4470 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 5608 4685 gene locus_tag LOCUS_30050 5608 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 5910 6479 gene locus_tag LOCUS_30060 5910 6479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 >Feature sequence261 1494 52 gene locus_tag LOCUS_30070 1494 52 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196385.1 protein_id gnl|my_center|LOCUS_30070 2718 1663 gene locus_tag LOCUS_30080 2718 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 4776 2719 gene locus_tag LOCUS_30090 4776 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 5031 6968 gene locus_tag LOCUS_30100 5031 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence262 1143 2936 gene locus_tag LOCUS_30110 1143 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 4250 2880 gene locus_tag LOCUS_30120 4250 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 5138 4569 gene locus_tag LOCUS_30130 5138 4569 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036287.1 protein_id gnl|my_center|LOCUS_30130 5249 5596 gene locus_tag LOCUS_30140 5249 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 >Feature sequence263 3 152 gene locus_tag LOCUS_30150 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 146 1222 gene locus_tag LOCUS_30160 146 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 1562 2467 gene locus_tag LOCUS_30170 1562 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 2978 2529 gene locus_tag LOCUS_30180 2978 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 3319 4134 gene locus_tag LOCUS_30190 3319 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 6240 4207 gene locus_tag LOCUS_30200 6240 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 >Feature sequence264 323 1192 gene locus_tag LOCUS_30210 gene mvk 323 1192 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774950.1 protein_id gnl|my_center|LOCUS_30210 1189 2157 gene locus_tag LOCUS_30220 gene mvaD 1189 2157 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_30220 2147 3028 gene locus_tag LOCUS_30230 2147 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 3021 4055 gene locus_tag LOCUS_30240 gene fni 3021 4055 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875688.1 protein_id gnl|my_center|LOCUS_30240 4140 5204 gene locus_tag LOCUS_30250 4140 5204 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868467.1 protein_id gnl|my_center|LOCUS_30250 5223 6419 gene locus_tag LOCUS_30260 5223 6419 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390637.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence265 <1 546 gene locus_tag LOCUS_30270 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921582.1:methyltransferase domain-containing protein 585 1232 gene locus_tag LOCUS_30280 585 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 2767 1229 gene locus_tag LOCUS_30290 2767 1229 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_30290 2839 3960 gene locus_tag LOCUS_30300 2839 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 3994 4560 gene locus_tag LOCUS_30310 3994 4560 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225958345.1 protein_id gnl|my_center|LOCUS_30310 4557 5699 gene locus_tag LOCUS_30320 4557 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 7024 5894 gene locus_tag LOCUS_30330 7024 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence266 <1 2153 gene locus_tag LOCUS_30340 <1 2153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119870.1:choice-of-anchor Q domain-containing protein 2647 2150 gene locus_tag LOCUS_30350 2647 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 2758 3159 gene locus_tag LOCUS_30360 2758 3159 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_30360 3220 3489 gene locus_tag LOCUS_30370 3220 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 4003 3512 gene locus_tag LOCUS_30380 4003 3512 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_30380 4057 5799 gene locus_tag LOCUS_30390 4057 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 6935 5796 gene locus_tag LOCUS_30400 6935 5796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 >Feature sequence267 1684 752 gene locus_tag LOCUS_30410 gene gshB 1684 752 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383077.1 protein_id gnl|my_center|LOCUS_30410 2973 1699 gene locus_tag LOCUS_30420 2973 1699 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921570.1 protein_id gnl|my_center|LOCUS_30420 4320 2989 gene locus_tag LOCUS_30430 gene mnmE 4320 2989 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082971.1 protein_id gnl|my_center|LOCUS_30430 5431 4325 gene locus_tag LOCUS_30440 5431 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 <7000 5453 gene locus_tag LOCUS_30450 <7000 5453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944075.1:membrane protein insertase YidC >Feature sequence268 808 227 gene locus_tag LOCUS_30460 808 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 960 1036 gene locus_tag LOCUS_t00240 960 1036 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1057 1130 gene locus_tag LOCUS_t00250 1057 1130 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1182 1263 gene locus_tag LOCUS_t00260 1182 1263 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1293 2870 gene locus_tag LOCUS_30470 gene tig 1293 2870 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127573.1 protein_id gnl|my_center|LOCUS_30470 3149 3775 gene locus_tag LOCUS_30480 gene clpP 3149 3775 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925383.1 protein_id gnl|my_center|LOCUS_30480 3785 5038 gene locus_tag LOCUS_30490 gene clpX 3785 5038 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_30490 >Feature sequence269 408 7 gene locus_tag LOCUS_30500 408 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 671 1369 gene locus_tag LOCUS_30510 671 1369 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044922.1 protein_id gnl|my_center|LOCUS_30510 1354 1836 gene locus_tag LOCUS_30520 1354 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 1857 2858 gene locus_tag LOCUS_30530 1857 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30530 3093 4052 gene locus_tag LOCUS_30540 3093 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 4049 4807 gene locus_tag LOCUS_30550 4049 4807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 >Feature sequence270 209 1471 gene locus_tag LOCUS_30560 209 1471 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932061.1 protein_id gnl|my_center|LOCUS_30560 1812 1468 gene locus_tag LOCUS_30570 1812 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2101 2625 gene locus_tag LOCUS_30580 2101 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 2763 3236 gene locus_tag LOCUS_30590 2763 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 4980 3325 gene locus_tag LOCUS_30600 gene lysS 4980 3325 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975532.1 protein_id gnl|my_center|LOCUS_30600 >Feature sequence271 417 2981 gene locus_tag LOCUS_30610 417 2981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 3634 2978 gene locus_tag LOCUS_30620 3634 2978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 3855 4529 gene locus_tag LOCUS_30630 3855 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 6809 4524 gene locus_tag LOCUS_30640 6809 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 >Feature sequence272 1121 99 gene locus_tag LOCUS_30650 1121 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 1977 1243 gene locus_tag LOCUS_30660 1977 1243 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226668.1 protein_id gnl|my_center|LOCUS_30660 2272 1955 gene locus_tag LOCUS_30670 2272 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 3335 3640 gene locus_tag LOCUS_30680 3335 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence273 1941 2564 gene locus_tag LOCUS_30690 1941 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 2824 5418 gene locus_tag LOCUS_30700 gene hacB 2824 5418 CDS product N-acylhomoserine lactone acylase HacB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112940.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence274 <1 1401 gene locus_tag LOCUS_30710 <1 1401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193305.1:translation elongation factor 4 1401 1796 gene locus_tag LOCUS_30720 1401 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 1845 2753 gene locus_tag LOCUS_30730 1845 2753 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_30730 2750 4006 gene locus_tag LOCUS_30740 2750 4006 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880489.1 protein_id gnl|my_center|LOCUS_30740 4006 4482 gene locus_tag LOCUS_30750 gene greA 4006 4482 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390637.1 protein_id gnl|my_center|LOCUS_30750 >Feature sequence275 1895 426 gene locus_tag LOCUS_30760 1895 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 2794 1964 gene locus_tag LOCUS_30770 2794 1964 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963826.1 protein_id gnl|my_center|LOCUS_30770 3177 4202 gene locus_tag LOCUS_30780 3177 4202 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_30780 4234 6051 gene locus_tag LOCUS_30790 4234 6051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 6061 6756 gene locus_tag LOCUS_30800 6061 6756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 >Feature sequence276 1237 464 gene locus_tag LOCUS_30810 1237 464 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244958.1 protein_id gnl|my_center|LOCUS_30810 1385 2662 gene locus_tag LOCUS_30820 1385 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 2785 2579 gene locus_tag LOCUS_30830 2785 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 4393 2804 gene locus_tag LOCUS_30840 4393 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 4546 5367 gene locus_tag LOCUS_30850 4546 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30850 5392 5817 gene locus_tag LOCUS_30860 5392 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence277 3805 557 gene locus_tag LOCUS_30870 3805 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 <6814 3805 gene locus_tag LOCUS_30880 <6814 3805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256390.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence278 485 1327 gene locus_tag LOCUS_30890 485 1327 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480304.1 protein_id gnl|my_center|LOCUS_30890 1413 2255 gene locus_tag LOCUS_30900 1413 2255 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034812.1 protein_id gnl|my_center|LOCUS_30900 3424 2252 gene locus_tag LOCUS_30910 gene cyp142 3424 2252 CDS product steroid C26-monooxygenase Cyp142 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730892.1 protein_id gnl|my_center|LOCUS_30910 3630 3770 gene locus_tag LOCUS_30920 3630 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 5087 3858 gene locus_tag LOCUS_30930 5087 3858 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_30930 5995 6465 gene locus_tag LOCUS_30940 5995 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence279 <1 1090 gene locus_tag LOCUS_30950 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080518.1:signal peptide peptidase SppA 1063 2475 gene locus_tag LOCUS_30960 1063 2475 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_30960 2873 2798 gene locus_tag LOCUS_t00270 2873 2798 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3235 2960 gene locus_tag LOCUS_30970 3235 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3566 3243 gene locus_tag LOCUS_30980 gene iscA 3566 3243 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216984.1 protein_id gnl|my_center|LOCUS_30980 3958 3686 gene locus_tag LOCUS_30990 3958 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 4025 4312 gene locus_tag LOCUS_31000 4025 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 4598 4239 gene locus_tag LOCUS_31010 4598 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 5068 4595 gene locus_tag LOCUS_31020 gene nusB 5068 4595 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460271.1 protein_id gnl|my_center|LOCUS_31020 5543 5070 gene locus_tag LOCUS_31030 gene ribE 5543 5070 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_31030 6745 5603 gene locus_tag LOCUS_31040 6745 5603 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_31040 >Feature sequence280 1949 2686 gene locus_tag LOCUS_31050 1949 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2683 4188 gene locus_tag LOCUS_31060 2683 4188 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123134.1 protein_id gnl|my_center|LOCUS_31060 4363 5856 gene locus_tag LOCUS_31070 4363 5856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 >Feature sequence281 <1 1173 gene locus_tag LOCUS_31080 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004680467.1:error-prone DNA polymerase 1422 2762 gene locus_tag LOCUS_31090 1422 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 3514 4053 gene locus_tag LOCUS_31100 3514 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 4842 4039 gene locus_tag LOCUS_31110 4842 4039 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_31110 5501 4839 gene locus_tag LOCUS_31120 5501 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 >Feature sequence282 1889 186 gene locus_tag LOCUS_31130 1889 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2003 3013 gene locus_tag LOCUS_31140 2003 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 3032 3763 gene locus_tag LOCUS_31150 3032 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 4967 4017 gene locus_tag LOCUS_31160 4967 4017 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_31160 5745 4972 gene locus_tag LOCUS_31170 5745 4972 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_31170 >Feature sequence283 <1 2012 gene locus_tag LOCUS_31180 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261805.1:efflux RND transporter permease subunit 2392 2772 gene locus_tag LOCUS_31190 2392 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 2909 4399 gene locus_tag LOCUS_31200 2909 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence284 29 4720 gene locus_tag LOCUS_31210 29 4720 CDS product NAD-glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072543.1 protein_id gnl|my_center|LOCUS_31210 4724 5326 gene locus_tag LOCUS_31220 4724 5326 CDS product adenosylcobalamin/alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704735.1 protein_id gnl|my_center|LOCUS_31220 5335 5826 gene locus_tag LOCUS_31230 5335 5826 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770846.1 protein_id gnl|my_center|LOCUS_31230 5823 6368 gene locus_tag LOCUS_31240 5823 6368 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703625.1 protein_id gnl|my_center|LOCUS_31240 >Feature sequence285 2073 1165 gene locus_tag LOCUS_31250 2073 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 2257 2123 gene locus_tag LOCUS_31260 2257 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 2329 3327 gene locus_tag LOCUS_31270 gene hemB 2329 3327 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039028.1 protein_id gnl|my_center|LOCUS_31270 5433 3340 gene locus_tag LOCUS_31280 5433 3340 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421549.1 protein_id gnl|my_center|LOCUS_31280 6230 5757 gene locus_tag LOCUS_31290 6230 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 >Feature sequence286 180 482 gene locus_tag LOCUS_31300 180 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 1381 539 gene locus_tag LOCUS_31310 1381 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 2045 1383 gene locus_tag LOCUS_31320 2045 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2117 3682 gene locus_tag LOCUS_31330 2117 3682 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_31330 5736 3679 gene locus_tag LOCUS_31340 5736 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 5786 6625 gene locus_tag LOCUS_31350 5786 6625 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143535.1 protein_id gnl|my_center|LOCUS_31350 >Feature sequence287 343 693 gene locus_tag LOCUS_31360 343 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 2276 768 gene locus_tag LOCUS_31370 2276 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2973 2464 gene locus_tag LOCUS_31380 2973 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 3278 2970 gene locus_tag LOCUS_31390 3278 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 3763 3263 gene locus_tag LOCUS_31400 3763 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 4574 4296 gene locus_tag LOCUS_31410 4574 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 4703 6298 gene locus_tag LOCUS_31420 4703 6298 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_31420 >Feature sequence288 2 1288 gene locus_tag LOCUS_31430 2 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 1411 2046 gene locus_tag LOCUS_31440 1411 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 2115 3446 gene locus_tag LOCUS_31450 gene rimO 2115 3446 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_31450 4609 3434 gene locus_tag LOCUS_31460 4609 3434 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009565257.1 protein_id gnl|my_center|LOCUS_31460 4523 4720 gene locus_tag LOCUS_31470 4523 4720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 5605 4802 gene locus_tag LOCUS_31480 gene murI 5605 4802 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880160.1 protein_id gnl|my_center|LOCUS_31480 5639 6202 gene locus_tag LOCUS_31490 gene nadD 5639 6202 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228912.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence289 1054 188 gene locus_tag LOCUS_31500 1054 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 1166 1091 gene locus_tag LOCUS_t00280 1166 1091 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1255 1183 gene locus_tag LOCUS_t00290 1255 1183 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1852 1310 gene locus_tag LOCUS_31510 1852 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 1932 2438 gene locus_tag LOCUS_31520 1932 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2662 3660 gene locus_tag LOCUS_31530 gene plsX 2662 3660 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_31530 3763 4005 gene locus_tag LOCUS_31540 gene acpP 3763 4005 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813816.1 protein_id gnl|my_center|LOCUS_31540 4246 5295 gene locus_tag LOCUS_31550 gene fabF 4246 5295 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_31550 5299 5727 gene locus_tag LOCUS_31560 gene rpiB 5299 5727 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_31560 >Feature sequence290 1649 501 gene locus_tag LOCUS_31570 1649 501 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202093.1 protein_id gnl|my_center|LOCUS_31570 1776 4400 gene locus_tag LOCUS_31580 gene polA 1776 4400 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_31580 4515 5120 gene locus_tag LOCUS_31590 gene rpoE 4515 5120 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071551.1 protein_id gnl|my_center|LOCUS_31590 5148 6134 gene locus_tag LOCUS_31600 5148 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 6131 6637 gene locus_tag LOCUS_31610 6131 6637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence291 1338 1880 gene locus_tag LOCUS_31620 1338 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 2351 1890 gene locus_tag LOCUS_31630 2351 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 2464 3300 gene locus_tag LOCUS_31640 2464 3300 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378215.1 protein_id gnl|my_center|LOCUS_31640 4283 3312 gene locus_tag LOCUS_31650 4283 3312 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227723.1 protein_id gnl|my_center|LOCUS_31650 6053 4290 gene locus_tag LOCUS_31660 6053 4290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 <6657 6093 gene locus_tag LOCUS_31670 <6657 6093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213089170.1:3-oxoacyl-[acyl-carrier-protein] synthase III C-terminal domain-containing protein >Feature sequence292 935 510 gene locus_tag LOCUS_31680 935 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 2027 1095 gene locus_tag LOCUS_31690 2027 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 2332 2024 gene locus_tag LOCUS_31700 2332 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 2752 2396 gene locus_tag LOCUS_31710 2752 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 2793 3449 gene locus_tag LOCUS_31720 2793 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 4819 3515 gene locus_tag LOCUS_31730 4819 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 5005 5505 gene locus_tag LOCUS_31740 5005 5505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence293 <1 1735 gene locus_tag LOCUS_31750 <1 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein note possible pseudo, internal stop codon, frameshifted 1920 4736 gene locus_tag LOCUS_31760 1920 4736 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942970.1 protein_id gnl|my_center|LOCUS_31760 >Feature sequence294 557 1981 gene locus_tag LOCUS_31770 557 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 4218 1978 gene locus_tag LOCUS_31780 4218 1978 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537861.1 protein_id gnl|my_center|LOCUS_31780 4961 4215 gene locus_tag LOCUS_31790 4961 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 <6527 4958 gene locus_tag LOCUS_31800 <6527 4958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921453.1:BatA domain-containing protein >Feature sequence295 1792 1352 gene locus_tag LOCUS_31810 1792 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 3152 2157 gene locus_tag LOCUS_31820 3152 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 3503 3802 gene locus_tag LOCUS_31830 3503 3802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 4149 4769 gene locus_tag LOCUS_31840 4149 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 5765 4953 gene locus_tag LOCUS_31850 5765 4953 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135690060.1 protein_id gnl|my_center|LOCUS_31850 5812 6492 gene locus_tag LOCUS_31860 5812 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 >Feature sequence296 741 427 gene locus_tag LOCUS_31870 741 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 1249 782 gene locus_tag LOCUS_31880 gene sodN 1249 782 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125519.1 protein_id gnl|my_center|LOCUS_31880 1354 1833 gene locus_tag LOCUS_31890 1354 1833 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020195.1 protein_id gnl|my_center|LOCUS_31890 1852 3189 gene locus_tag LOCUS_31900 1852 3189 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839967.1 protein_id gnl|my_center|LOCUS_31900 4309 3191 gene locus_tag LOCUS_31910 4309 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 4303 5220 gene locus_tag LOCUS_31920 gene rsgA 4303 5220 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_31920 5463 6311 gene locus_tag LOCUS_31930 5463 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 >Feature sequence297 <1 593 gene locus_tag LOCUS_31940 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943766.1:class I SAM-dependent rRNA methyltransferase 593 1291 gene locus_tag LOCUS_31950 gene sfsA 593 1291 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_31950 2021 1296 gene locus_tag LOCUS_31960 2021 1296 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035270.1 protein_id gnl|my_center|LOCUS_31960 2253 3782 gene locus_tag LOCUS_31970 2253 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 5428 3827 gene locus_tag LOCUS_31980 gene thiC 5428 3827 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972278.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence298 <1 1043 gene locus_tag LOCUS_31990 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921964.1:YihY/virulence factor BrkB family protein 1063 1455 gene locus_tag LOCUS_32000 1063 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32000 3004 1535 gene locus_tag LOCUS_32010 3004 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 3231 4604 gene locus_tag LOCUS_32020 3231 4604 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257389.1 protein_id gnl|my_center|LOCUS_32020 4697 6070 gene locus_tag LOCUS_32030 4697 6070 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_32030 >Feature sequence299 804 94 gene locus_tag LOCUS_32040 804 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 769 1008 gene locus_tag LOCUS_32050 769 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 1414 3258 gene locus_tag LOCUS_32060 1414 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 4561 3842 gene locus_tag LOCUS_32070 4561 3842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 >Feature sequence300 609 394 gene locus_tag LOCUS_32080 609 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32080 1548 616 gene locus_tag LOCUS_32090 1548 616 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32090 2923 1541 gene locus_tag LOCUS_32100 2923 1541 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_32100 3210 4628 gene locus_tag LOCUS_32110 3210 4628 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902539.1 protein_id gnl|my_center|LOCUS_32110 4705 5421 gene locus_tag LOCUS_32120 4705 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 5667 5425 gene locus_tag LOCUS_32130 5667 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6406 6038 gene locus_tag LOCUS_32140 6406 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 >Feature sequence301 1662 535 gene locus_tag LOCUS_32150 1662 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 1763 2569 gene locus_tag LOCUS_32160 gene pssA 1763 2569 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073396.1 protein_id gnl|my_center|LOCUS_32160 5050 2576 gene locus_tag LOCUS_32170 5050 2576 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence302 2572 1775 gene locus_tag LOCUS_32180 2572 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 2634 3128 gene locus_tag LOCUS_32190 2634 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 3132 5639 gene locus_tag LOCUS_32200 3132 5639 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142782.1 protein_id gnl|my_center|LOCUS_32200 6330 5593 gene locus_tag LOCUS_32210 6330 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 >Feature sequence303 1845 385 gene locus_tag LOCUS_32220 1845 385 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083078.1 protein_id gnl|my_center|LOCUS_32220 2077 1865 gene locus_tag LOCUS_32230 2077 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2608 2120 gene locus_tag LOCUS_32240 2608 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 2952 2734 gene locus_tag LOCUS_32250 2952 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 3046 3122 gene locus_tag LOCUS_t00300 3046 3122 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3377 3195 gene locus_tag LOCUS_32260 3377 3195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 3514 4089 gene locus_tag LOCUS_32270 3514 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 4086 4994 gene locus_tag LOCUS_32280 4086 4994 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311772.1 protein_id gnl|my_center|LOCUS_32280 5052 5678 gene locus_tag LOCUS_32290 5052 5678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 5707 6153 gene locus_tag LOCUS_32300 5707 6153 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888662.1 protein_id gnl|my_center|LOCUS_32300 >Feature sequence304 <1 1006 gene locus_tag LOCUS_32310 <1 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000348045.1:acyl-CoA dehydrogenase family protein 1490 1008 gene locus_tag LOCUS_32320 1490 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 2191 1487 gene locus_tag LOCUS_32330 2191 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 3949 2588 gene locus_tag LOCUS_32340 3949 2588 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930426.1 protein_id gnl|my_center|LOCUS_32340 4596 4045 gene locus_tag LOCUS_32350 4596 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 5931 4930 gene locus_tag LOCUS_32360 gene recA 5931 4930 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_32360 6203 5928 gene locus_tag LOCUS_32370 6203 5928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence305 712 155 gene locus_tag LOCUS_32380 gene lspA 712 155 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565533.1 protein_id gnl|my_center|LOCUS_32380 2207 930 gene locus_tag LOCUS_32390 2207 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 2397 2624 gene locus_tag LOCUS_32400 2397 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 2628 4454 gene locus_tag LOCUS_32410 2628 4454 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_32410 4462 5595 gene locus_tag LOCUS_32420 4462 5595 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000348847.1 protein_id gnl|my_center|LOCUS_32420 6031 5642 gene locus_tag LOCUS_32430 6031 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 >Feature sequence306 463 3468 gene locus_tag LOCUS_32440 463 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 3478 4131 gene locus_tag LOCUS_32450 3478 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 6014 4338 gene locus_tag LOCUS_32460 gene groL 6014 4338 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_32460 >Feature sequence307 3235 755 gene locus_tag LOCUS_32470 3235 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 4392 3394 gene locus_tag LOCUS_32480 4392 3394 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122477.1 protein_id gnl|my_center|LOCUS_32480 5071 4421 gene locus_tag LOCUS_32490 gene tsaB 5071 4421 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221014.1 protein_id gnl|my_center|LOCUS_32490 <6280 5076 gene locus_tag LOCUS_32500 <6280 5076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816967.1:sigma E protease regulator RseP >Feature sequence308 461 1339 gene locus_tag LOCUS_32510 461 1339 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_32510 1336 2085 gene locus_tag LOCUS_32520 1336 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 5598 2089 gene locus_tag LOCUS_32530 5598 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 >Feature sequence309 3334 3259 gene locus_tag LOCUS_t00310 3334 3259 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4179 3370 gene locus_tag LOCUS_32540 gene uppP 4179 3370 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681055.1 protein_id gnl|my_center|LOCUS_32540 4566 4234 gene locus_tag LOCUS_32550 4566 4234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 5052 4621 gene locus_tag LOCUS_32560 5052 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 5238 5162 gene locus_tag LOCUS_t00320 5238 5162 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5335 5264 gene locus_tag LOCUS_t00330 5335 5264 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5789 5502 gene locus_tag LOCUS_32570 5789 5502 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_32570 >Feature sequence310 1158 103 gene locus_tag LOCUS_32580 gene pheS 1158 103 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388219.1 protein_id gnl|my_center|LOCUS_32580 1240 2484 gene locus_tag LOCUS_32590 1240 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 2532 5678 gene locus_tag LOCUS_32600 gene ileS 2532 5678 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_32600 >Feature sequence311 3 563 gene locus_tag LOCUS_32610 3 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 1473 1847 gene locus_tag LOCUS_32620 1473 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 2519 2728 gene locus_tag LOCUS_32630 2519 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3522 5039 gene locus_tag LOCUS_32640 3522 5039 CDS product CRTAC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090058733.1 protein_id gnl|my_center|LOCUS_32640 >Feature sequence312 <1 2060 gene locus_tag LOCUS_32650 <1 2060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530052.1:thioredoxin family protein 2118 3560 gene locus_tag LOCUS_32660 gene xdhA 2118 3560 CDS product xanthine dehydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267258.1 protein_id gnl|my_center|LOCUS_32660 3553 5826 gene locus_tag LOCUS_32670 gene xdhB 3553 5826 CDS product xanthine dehydrogenase molybdopterin binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329191.1 protein_id gnl|my_center|LOCUS_32670 >Feature sequence313 8 565 gene locus_tag LOCUS_32680 8 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 599 1183 gene locus_tag LOCUS_32690 599 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 2369 1173 gene locus_tag LOCUS_32700 2369 1173 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119555905.1 protein_id gnl|my_center|LOCUS_32700 2731 2372 gene locus_tag LOCUS_32710 2731 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 4907 2823 gene locus_tag LOCUS_32720 4907 2823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 5575 5024 gene locus_tag LOCUS_32730 5575 5024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 5852 5622 gene locus_tag LOCUS_32740 5852 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 >Feature sequence314 3450 952 gene locus_tag LOCUS_32750 3450 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 3491 4789 gene locus_tag LOCUS_32760 3491 4789 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875787.1 protein_id gnl|my_center|LOCUS_32760 5761 4793 gene locus_tag LOCUS_32770 5761 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence315 1517 2176 gene locus_tag LOCUS_32780 1517 2176 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971055.1 protein_id gnl|my_center|LOCUS_32780 2746 2204 gene locus_tag LOCUS_32790 2746 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 2993 4018 gene locus_tag LOCUS_32800 2993 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 4447 4046 gene locus_tag LOCUS_32810 4447 4046 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762309.1 protein_id gnl|my_center|LOCUS_32810 4878 4675 gene locus_tag LOCUS_32820 4878 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 4766 5575 gene locus_tag LOCUS_32830 4766 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 6104 5601 gene locus_tag LOCUS_32840 6104 5601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 >Feature sequence316 915 73 gene locus_tag LOCUS_32850 915 73 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_32850 1976 912 gene locus_tag LOCUS_32860 1976 912 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088177.1 protein_id gnl|my_center|LOCUS_32860 2734 1973 gene locus_tag LOCUS_32870 2734 1973 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_32870 3639 2731 gene locus_tag LOCUS_32880 3639 2731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539779.1 protein_id gnl|my_center|LOCUS_32880 4166 3636 gene locus_tag LOCUS_32890 4166 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32890 5110 4439 gene locus_tag LOCUS_32900 5110 4439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 5259 5942 gene locus_tag LOCUS_32910 5259 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32910 >Feature sequence317 <1 1248 gene locus_tag LOCUS_32920 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000086941.1:amidophosphoribosyltransferase 2139 1258 gene locus_tag LOCUS_32930 2139 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 2216 2941 gene locus_tag LOCUS_32940 gene fabG 2216 2941 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_32940 3812 2898 gene locus_tag LOCUS_32950 gene epmA 3812 2898 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918606.1 protein_id gnl|my_center|LOCUS_32950 4375 3812 gene locus_tag LOCUS_32960 gene efp 4375 3812 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_32960 4489 5397 gene locus_tag LOCUS_32970 4489 5397 CDS product lysine-2,3-aminomutase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918602.1 protein_id gnl|my_center|LOCUS_32970 >Feature sequence318 3 827 gene locus_tag LOCUS_32980 3 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 827 2533 gene locus_tag LOCUS_32990 827 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 2530 3699 gene locus_tag LOCUS_33000 2530 3699 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_33000 3696 4538 gene locus_tag LOCUS_33010 3696 4538 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_33010 4614 5705 gene locus_tag LOCUS_33020 4614 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence319 525 1655 gene locus_tag LOCUS_33030 525 1655 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083535.1 protein_id gnl|my_center|LOCUS_33030 1895 3178 gene locus_tag LOCUS_33040 1895 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33040 3182 3628 gene locus_tag LOCUS_33050 3182 3628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 3625 4059 gene locus_tag LOCUS_33060 3625 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 5622 4060 gene locus_tag LOCUS_33070 5622 4060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 >Feature sequence320 2054 1761 gene locus_tag LOCUS_33080 2054 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 2123 2542 gene locus_tag LOCUS_33090 2123 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 3139 2591 gene locus_tag LOCUS_33100 3139 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3356 3123 gene locus_tag LOCUS_33110 3356 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 3444 4139 gene locus_tag LOCUS_33120 3444 4139 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480573.1 protein_id gnl|my_center|LOCUS_33120 5620 4175 gene locus_tag LOCUS_33130 5620 4175 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_33130 >Feature sequence321 291 3053 gene locus_tag LOCUS_33140 291 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 >Feature sequence322 2247 1315 gene locus_tag LOCUS_33150 2247 1315 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840510.1 protein_id gnl|my_center|LOCUS_33150 4477 2345 gene locus_tag LOCUS_33160 gene fusA 4477 2345 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_33160 4722 5888 gene locus_tag LOCUS_33170 4722 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 >Feature sequence323 2 190 gene locus_tag LOCUS_33180 2 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 2371 263 gene locus_tag LOCUS_33190 2371 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2682 2392 gene locus_tag LOCUS_33200 2682 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 5151 2713 gene locus_tag LOCUS_33210 5151 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence324 <1 738 gene locus_tag LOCUS_33220 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000756756.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) VpsA 735 1928 gene locus_tag LOCUS_33230 735 1928 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036689.1 protein_id gnl|my_center|LOCUS_33230 1925 3241 gene locus_tag LOCUS_33240 1925 3241 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902371.1 protein_id gnl|my_center|LOCUS_33240 3217 4227 gene locus_tag LOCUS_33250 gene galE 3217 4227 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_33250 5342 4224 gene locus_tag LOCUS_33260 5342 4224 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_33260 <6022 5350 gene locus_tag LOCUS_33270 <6022 5350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272023.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence325 137 1795 gene locus_tag LOCUS_33280 137 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 1870 2829 gene locus_tag LOCUS_33290 1870 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 2880 3866 gene locus_tag LOCUS_33300 gene ugpC 2880 3866 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339524.1 protein_id gnl|my_center|LOCUS_33300 3863 6013 gene locus_tag LOCUS_33310 3863 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 >Feature sequence326 3123 2071 gene locus_tag LOCUS_33320 3123 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 4019 3306 gene locus_tag LOCUS_33330 4019 3306 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416253.1 protein_id gnl|my_center|LOCUS_33330 >Feature sequence327 1322 204 gene locus_tag LOCUS_33340 1322 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1876 1331 gene locus_tag LOCUS_33350 1876 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 2772 1768 gene locus_tag LOCUS_33360 2772 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 3346 2849 gene locus_tag LOCUS_33370 3346 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 3481 3834 gene locus_tag LOCUS_33380 3481 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 4727 3831 gene locus_tag LOCUS_33390 4727 3831 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_33390 4875 5807 gene locus_tag LOCUS_33400 4875 5807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence328 1238 501 gene locus_tag LOCUS_33410 1238 501 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121009277.1 protein_id gnl|my_center|LOCUS_33410 1518 1354 gene locus_tag LOCUS_33420 1518 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 1501 2154 gene locus_tag LOCUS_33430 1501 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33430 2158 3771 gene locus_tag LOCUS_33440 2158 3771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33440 <5988 3768 gene locus_tag LOCUS_33450 <5988 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256934.1:ABC transporter substrate-binding protein >Feature sequence329 983 66 gene locus_tag LOCUS_33460 983 66 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_33460 1803 1075 gene locus_tag LOCUS_33470 1803 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 1884 2960 gene locus_tag LOCUS_33480 1884 2960 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_33480 3228 3761 gene locus_tag LOCUS_33490 gene folE 3228 3761 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804895.1 protein_id gnl|my_center|LOCUS_33490 4645 3758 gene locus_tag LOCUS_33500 4645 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 >Feature sequence330 216 1277 gene locus_tag LOCUS_33510 216 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 1934 3904 gene locus_tag LOCUS_33520 1934 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3901 5304 gene locus_tag LOCUS_33530 3901 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_33530 <5951 5311 gene locus_tag LOCUS_33540 <5951 5311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205052.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted >Feature sequence331 1879 977 gene locus_tag LOCUS_33550 1879 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 2777 2559 gene locus_tag LOCUS_33560 2777 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 3667 2783 gene locus_tag LOCUS_33570 3667 2783 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_33570 3978 3667 gene locus_tag LOCUS_33580 3978 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 5160 3994 gene locus_tag LOCUS_33590 5160 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33590 <5940 5157 gene locus_tag LOCUS_33600 <5940 5157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003417940.1:SDR family oxidoreductase >Feature sequence332 1995 217 gene locus_tag LOCUS_33610 1995 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 3002 1992 gene locus_tag LOCUS_33620 3002 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 3626 3291 gene locus_tag LOCUS_33630 3626 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 4094 3873 gene locus_tag LOCUS_33640 4094 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 3984 5006 gene locus_tag LOCUS_33650 3984 5006 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_33650 5122 5355 gene locus_tag LOCUS_33660 5122 5355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 5622 5846 gene locus_tag LOCUS_33670 5622 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 >Feature sequence333 853 1518 gene locus_tag LOCUS_33680 853 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 1515 2210 gene locus_tag LOCUS_33690 1515 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 3010 2303 gene locus_tag LOCUS_33700 3010 2303 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925202.1 protein_id gnl|my_center|LOCUS_33700 3151 5781 gene locus_tag LOCUS_33710 3151 5781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence334 <1 1124 gene locus_tag LOCUS_33720 <1 1124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544993.1:DUF3488 and transglutaminase-like domain-containing protein 1127 1975 gene locus_tag LOCUS_33730 1127 1975 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837921.1 protein_id gnl|my_center|LOCUS_33730 3021 2257 gene locus_tag LOCUS_33740 3021 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 3288 4670 gene locus_tag LOCUS_33750 3288 4670 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412946.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence335 457 2778 gene locus_tag LOCUS_33760 457 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 2775 3275 gene locus_tag LOCUS_33770 2775 3275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 4058 3279 gene locus_tag LOCUS_33780 4058 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 <5902 4105 gene locus_tag LOCUS_33790 <5902 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000510008.1:ferrous iron transport protein B >Feature sequence336 2733 1945 gene locus_tag LOCUS_33800 2733 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 3024 2794 gene locus_tag LOCUS_33810 3024 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence337 984 2642 gene locus_tag LOCUS_33820 gene boxC 984 2642 CDS product 2,3-epoxybenzoyl-CoA dihydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230334.1 protein_id gnl|my_center|LOCUS_33820 2658 3044 gene locus_tag LOCUS_33830 2658 3044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3887 3048 gene locus_tag LOCUS_33840 3887 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 4098 5825 gene locus_tag LOCUS_33850 4098 5825 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_33850 >Feature sequence338 642 10 gene locus_tag LOCUS_33860 642 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 859 2169 gene locus_tag LOCUS_33870 859 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 2987 2166 gene locus_tag LOCUS_33880 2987 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 4489 2984 gene locus_tag LOCUS_33890 4489 2984 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_33890 5364 4489 gene locus_tag LOCUS_33900 5364 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 5838 5425 gene locus_tag LOCUS_33910 5838 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33910 >Feature sequence339 2322 184 gene locus_tag LOCUS_33920 2322 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 3016 3303 gene locus_tag LOCUS_33930 3016 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 3646 3452 gene locus_tag LOCUS_33940 3646 3452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33940 3666 5015 gene locus_tag LOCUS_33950 3666 5015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 >Feature sequence340 2046 19 gene locus_tag LOCUS_33960 2046 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2584 2105 gene locus_tag LOCUS_33970 2584 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 2739 3716 gene locus_tag LOCUS_33980 2739 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 <5868 3720 gene locus_tag LOCUS_33990 <5868 3720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123208.1:protein kinase >Feature sequence341 1995 562 gene locus_tag LOCUS_34000 1995 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 2323 1985 gene locus_tag LOCUS_34010 2323 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 2382 3614 gene locus_tag LOCUS_34020 gene hutI 2382 3614 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918844.1 protein_id gnl|my_center|LOCUS_34020 3847 3602 gene locus_tag LOCUS_34030 3847 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 4851 3904 gene locus_tag LOCUS_34040 gene mtnA 4851 3904 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140199.1 protein_id gnl|my_center|LOCUS_34040 5289 5636 gene locus_tag LOCUS_34050 5289 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence342 1280 624 gene locus_tag LOCUS_34060 1280 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1339 1674 gene locus_tag LOCUS_34070 1339 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 1684 2244 gene locus_tag LOCUS_34080 1684 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 2330 2875 gene locus_tag LOCUS_34090 2330 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34090 4053 2869 gene locus_tag LOCUS_34100 4053 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 4123 5319 gene locus_tag LOCUS_34110 4123 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 >Feature sequence343 <1 2731 gene locus_tag LOCUS_34120 <1 2731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266965.1:glycerol-3-phosphate 1-O-acyltransferase PlsB 2731 3099 gene locus_tag LOCUS_34130 2731 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 3854 3096 gene locus_tag LOCUS_34140 3854 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34140 4723 3860 gene locus_tag LOCUS_34150 4723 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 4843 5553 gene locus_tag LOCUS_34160 4843 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 >Feature sequence344 3236 1596 gene locus_tag LOCUS_34170 3236 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 3377 4246 gene locus_tag LOCUS_34180 3377 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 4248 5234 gene locus_tag LOCUS_34190 4248 5234 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141616.1 protein_id gnl|my_center|LOCUS_34190 >Feature sequence345 12 506 gene locus_tag LOCUS_34200 12 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 1799 516 gene locus_tag LOCUS_34210 1799 516 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566866.1 protein_id gnl|my_center|LOCUS_34210 3142 1799 gene locus_tag LOCUS_34220 3142 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 3229 3408 gene locus_tag LOCUS_34230 3229 3408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3717 3388 gene locus_tag LOCUS_34240 3717 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4090 3734 gene locus_tag LOCUS_34250 4090 3734 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_34250 4149 5003 gene locus_tag LOCUS_34260 gene bpsC 4149 5003 CDS product UTP--glucose-1-phosphate uridylyltransferase BpsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757832.1 protein_id gnl|my_center|LOCUS_34260 5593 5036 gene locus_tag LOCUS_34270 5593 5036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence346 <1 588 gene locus_tag LOCUS_34280 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942471.1:L-aspartate oxidase 1756 761 gene locus_tag LOCUS_34290 1756 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 2259 1831 gene locus_tag LOCUS_34300 2259 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 3641 2241 gene locus_tag LOCUS_34310 3641 2241 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140097.1 protein_id gnl|my_center|LOCUS_34310 4159 3695 gene locus_tag LOCUS_34320 4159 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 4806 4261 gene locus_tag LOCUS_34330 gene pyrE 4806 4261 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_34330 >Feature sequence347 1722 2441 gene locus_tag LOCUS_34340 1722 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 2603 3253 gene locus_tag LOCUS_34350 gene rplC 2603 3253 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055632.1 protein_id gnl|my_center|LOCUS_34350 3340 5280 gene locus_tag LOCUS_34360 3340 5280 CDS product acetoacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704166.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence348 747 1022 gene locus_tag LOCUS_34370 747 1022 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421415.1 protein_id gnl|my_center|LOCUS_34370 1800 1123 gene locus_tag LOCUS_34380 1800 1123 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_34380 2651 1797 gene locus_tag LOCUS_34390 gene prmA 2651 1797 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003594607.1 protein_id gnl|my_center|LOCUS_34390 4042 2651 gene locus_tag LOCUS_34400 4042 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 4510 4055 gene locus_tag LOCUS_34410 gene smpB 4510 4055 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_34410 4763 5209 gene locus_tag LOCUS_34420 gene mraZ 4763 5209 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830185.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence349 793 1782 gene locus_tag LOCUS_34430 793 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 1779 1994 gene locus_tag LOCUS_34440 1779 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2046 2570 gene locus_tag LOCUS_34450 2046 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 3504 2575 gene locus_tag LOCUS_34460 3504 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 4010 3633 gene locus_tag LOCUS_34470 4010 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 4158 4490 gene locus_tag LOCUS_34480 4158 4490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 <5735 4497 gene locus_tag LOCUS_34490 <5735 4497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence350 1410 1048 gene locus_tag LOCUS_34500 1410 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226671.1 protein_id gnl|my_center|LOCUS_34500 3442 1658 gene locus_tag LOCUS_34510 3442 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 4312 3449 gene locus_tag LOCUS_34520 4312 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 4629 4309 gene locus_tag LOCUS_34530 4629 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 4917 5615 gene locus_tag LOCUS_34540 4917 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 >Feature sequence351 2099 588 gene locus_tag LOCUS_34550 2099 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 2788 2099 gene locus_tag LOCUS_34560 2788 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 4090 2801 gene locus_tag LOCUS_34570 4090 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 5112 4198 gene locus_tag LOCUS_34580 5112 4198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 >Feature sequence352 <1 750 gene locus_tag LOCUS_34590 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249166.1:amidophosphoribosyltransferase 793 1680 gene locus_tag LOCUS_34600 793 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 2023 1787 gene locus_tag LOCUS_34610 2023 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34610 1923 2354 gene locus_tag LOCUS_34620 1923 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34620 2364 2639 gene locus_tag LOCUS_34630 2364 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 3558 2803 gene locus_tag LOCUS_34640 3558 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 3710 4747 gene locus_tag LOCUS_34650 3710 4747 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037866.1 protein_id gnl|my_center|LOCUS_34650 4744 5340 gene locus_tag LOCUS_34660 4744 5340 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_34660 >Feature sequence353 2348 3238 gene locus_tag LOCUS_34670 2348 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 3330 5051 gene locus_tag LOCUS_34680 3330 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence354 2945 3967 gene locus_tag LOCUS_34690 2945 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 5517 4144 gene locus_tag LOCUS_34700 5517 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence355 1040 964 gene locus_tag LOCUS_t00340 1040 964 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2210 1086 gene locus_tag LOCUS_34710 2210 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 2428 4440 gene locus_tag LOCUS_34720 2428 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 4560 5342 gene locus_tag LOCUS_34730 gene pyrF 4560 5342 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_34730 >Feature sequence356 2565 973 gene locus_tag LOCUS_34740 2565 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 5360 2568 gene locus_tag LOCUS_34750 gene cphA 5360 2568 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021315.1 protein_id gnl|my_center|LOCUS_34750 >Feature sequence357 477 881 gene locus_tag LOCUS_34760 477 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 881 1771 gene locus_tag LOCUS_34770 881 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 2023 2571 gene locus_tag LOCUS_34780 2023 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 3316 2735 gene locus_tag LOCUS_34790 gene rdgB 3316 2735 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957197.1 protein_id gnl|my_center|LOCUS_34790 3383 3868 gene locus_tag LOCUS_34800 3383 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34800 <5567 3870 gene locus_tag LOCUS_34810 <5567 3870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007335531.1:fused MFS/spermidine synthase >Feature sequence358 1653 889 gene locus_tag LOCUS_34820 1653 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3257 1650 gene locus_tag LOCUS_34830 3257 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3372 4823 gene locus_tag LOCUS_34840 3372 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence359 828 292 gene locus_tag LOCUS_34850 828 292 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000228316.1 protein_id gnl|my_center|LOCUS_34850 1757 825 gene locus_tag LOCUS_34860 1757 825 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532778.1 protein_id gnl|my_center|LOCUS_34860 2710 1754 gene locus_tag LOCUS_34870 2710 1754 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001087694.1 protein_id gnl|my_center|LOCUS_34870 3820 2792 gene locus_tag LOCUS_34880 3820 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 3939 5339 gene locus_tag LOCUS_34890 3939 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34890 >Feature sequence360 405 1088 gene locus_tag LOCUS_34900 405 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 1241 1759 gene locus_tag LOCUS_34910 1241 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 1804 2265 gene locus_tag LOCUS_34920 1804 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence361 <1 867 gene locus_tag LOCUS_34930 <1 867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein 2287 1091 gene locus_tag LOCUS_34940 2287 1091 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479723.1 protein_id gnl|my_center|LOCUS_34940 2389 3234 gene locus_tag LOCUS_34950 2389 3234 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229041.1 protein_id gnl|my_center|LOCUS_34950 5287 3479 gene locus_tag LOCUS_34960 5287 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 >Feature sequence362 <1 2969 gene locus_tag LOCUS_34970 <1 2969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence363 <1 645 gene locus_tag LOCUS_34980 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804263.1:MATE family efflux transporter 698 1060 gene locus_tag LOCUS_34990 698 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 1104 1871 gene locus_tag LOCUS_35000 1104 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 2557 1877 gene locus_tag LOCUS_35010 gene mutH 2557 1877 CDS product DNA mismatch repair endonuclease MutH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071539.1 protein_id gnl|my_center|LOCUS_35010 3684 2554 gene locus_tag LOCUS_35020 3684 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 4541 3681 gene locus_tag LOCUS_35030 4541 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 <5442 4538 gene locus_tag LOCUS_35040 <5442 4538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007332180.1:SpoIIE family protein phosphatase >Feature sequence364 974 720 gene locus_tag LOCUS_35050 974 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1000 2190 gene locus_tag LOCUS_35060 1000 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 2346 3284 gene locus_tag LOCUS_35070 2346 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 >Feature sequence365 2826 562 gene locus_tag LOCUS_35080 2826 562 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_35080 3572 2901 gene locus_tag LOCUS_35090 3572 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 5049 3634 gene locus_tag LOCUS_35100 gene boxB 5049 3634 CDS product benzoyl-CoA 2,3-epoxidase subunit BoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083901.1 protein_id gnl|my_center|LOCUS_35100 >Feature sequence366 2547 469 gene locus_tag LOCUS_35110 2547 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35110 3329 2544 gene locus_tag LOCUS_35120 3329 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 4171 3326 gene locus_tag LOCUS_35130 4171 3326 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192762.1 protein_id gnl|my_center|LOCUS_35130 4878 4189 gene locus_tag LOCUS_35140 4878 4189 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence367 807 5234 gene locus_tag LOCUS_35150 807 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35150 >Feature sequence368 <1 1076 gene locus_tag LOCUS_35160 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403246.1:acetyl-CoA carboxylase biotin carboxylase subunit 1073 1573 gene locus_tag LOCUS_35170 1073 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 1570 3213 gene locus_tag LOCUS_35180 1570 3213 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943914.1 protein_id gnl|my_center|LOCUS_35180 4088 3189 gene locus_tag LOCUS_35190 4088 3189 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405474.1 protein_id gnl|my_center|LOCUS_35190 4181 4573 gene locus_tag LOCUS_35200 gene tatB 4181 4573 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459768.1 protein_id gnl|my_center|LOCUS_35200 4570 4746 gene locus_tag LOCUS_35210 4570 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35210 >Feature sequence369 574 2508 gene locus_tag LOCUS_35220 574 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 3088 2477 gene locus_tag LOCUS_35230 3088 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 3813 3085 gene locus_tag LOCUS_35240 3813 3085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 5037 3868 gene locus_tag LOCUS_35250 5037 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 >Feature sequence370 981 349 gene locus_tag LOCUS_35260 981 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 2601 1012 gene locus_tag LOCUS_35270 2601 1012 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048268.1 protein_id gnl|my_center|LOCUS_35270 2637 3773 gene locus_tag LOCUS_35280 2637 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35280 3777 4721 gene locus_tag LOCUS_35290 3777 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence371 1824 1081 gene locus_tag LOCUS_35300 1824 1081 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074690.1 protein_id gnl|my_center|LOCUS_35300 1970 2356 gene locus_tag LOCUS_35310 gene dksA 1970 2356 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_35310 3702 2353 gene locus_tag LOCUS_35320 3702 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 4738 3707 gene locus_tag LOCUS_35330 gene moaA 4738 3707 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393625.1 protein_id gnl|my_center|LOCUS_35330 5286 4735 gene locus_tag LOCUS_35340 5286 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence372 1731 1117 gene locus_tag LOCUS_35350 1731 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 2372 1728 gene locus_tag LOCUS_35360 2372 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 3082 2369 gene locus_tag LOCUS_35370 3082 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence373 2001 886 gene locus_tag LOCUS_35380 2001 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 2624 1998 gene locus_tag LOCUS_35390 2624 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 <5243 2621 gene locus_tag LOCUS_35400 <5243 2621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256934.1:ABC transporter substrate-binding protein >Feature sequence374 326 1459 gene locus_tag LOCUS_35410 326 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1353 1574 gene locus_tag LOCUS_35420 1353 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 2005 2964 gene locus_tag LOCUS_35430 2005 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35430 >Feature sequence375 363 184 gene locus_tag LOCUS_35440 363 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35440 401 658 gene locus_tag LOCUS_35450 401 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35450 721 1167 gene locus_tag LOCUS_35460 721 1167 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807613.1 protein_id gnl|my_center|LOCUS_35460 1615 1376 gene locus_tag LOCUS_35470 1615 1376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 2001 2357 gene locus_tag LOCUS_35480 2001 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 3385 3891 gene locus_tag LOCUS_35490 3385 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 4858 3863 gene locus_tag LOCUS_35500 4858 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 >Feature sequence376 <1 979 gene locus_tag LOCUS_35510 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943205.1:tRNA 2-thiouridine(34) synthase MnmA 976 1680 gene locus_tag LOCUS_35520 gene rnc 976 1680 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942868.1 protein_id gnl|my_center|LOCUS_35520 1677 2654 gene locus_tag LOCUS_35530 1677 2654 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080334.1 protein_id gnl|my_center|LOCUS_35530 2651 3583 gene locus_tag LOCUS_35540 gene era 2651 3583 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_35540 3634 4074 gene locus_tag LOCUS_35550 3634 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35550 >Feature sequence377 394 2166 gene locus_tag LOCUS_35560 394 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 3671 2163 gene locus_tag LOCUS_35570 3671 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 4063 3668 gene locus_tag LOCUS_35580 4063 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 5043 4117 gene locus_tag LOCUS_35590 5043 4117 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295861.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence378 <1 1281 gene locus_tag LOCUS_35600 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein 1317 2582 gene locus_tag LOCUS_35610 1317 2582 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110845.1 protein_id gnl|my_center|LOCUS_35610 2579 3598 gene locus_tag LOCUS_35620 2579 3598 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068525.1 protein_id gnl|my_center|LOCUS_35620 3595 4617 gene locus_tag LOCUS_35630 3595 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 <5218 4630 gene locus_tag LOCUS_35640 <5218 4630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014752.1:sigma-70 family RNA polymerase sigma factor >Feature sequence379 100 1500 gene locus_tag LOCUS_35650 gene lpdA 100 1500 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260104.1 protein_id gnl|my_center|LOCUS_35650 1528 2817 gene locus_tag LOCUS_35660 1528 2817 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250239.1 protein_id gnl|my_center|LOCUS_35660 3412 4038 gene locus_tag LOCUS_35670 3412 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 4035 5081 gene locus_tag LOCUS_35680 4035 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 >Feature sequence380 4930 2636 gene locus_tag LOCUS_35690 4930 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35690 4865 5065 gene locus_tag LOCUS_35700 4865 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence381 <1 572 gene locus_tag LOCUS_35710 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056086.1:quinolinate synthase NadA 615 1019 gene locus_tag LOCUS_35720 615 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2752 1400 gene locus_tag LOCUS_35730 2752 1400 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068542.1 protein_id gnl|my_center|LOCUS_35730 4093 2927 gene locus_tag LOCUS_35740 gene bamB 4093 2927 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356919.1 protein_id gnl|my_center|LOCUS_35740 4821 4093 gene locus_tag LOCUS_35750 4821 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence382 2914 1433 gene locus_tag LOCUS_35760 2914 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 4716 2917 gene locus_tag LOCUS_35770 4716 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 >Feature sequence383 934 107 gene locus_tag LOCUS_35780 934 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 3834 931 gene locus_tag LOCUS_35790 3834 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 <5193 3972 gene locus_tag LOCUS_35800 <5193 3972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence384 <1 1122 gene locus_tag LOCUS_35810 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_200858940.1:ATP-dependent zinc metalloprotease FtsH 1122 1934 gene locus_tag LOCUS_35820 gene folP 1122 1934 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275372.1 protein_id gnl|my_center|LOCUS_35820 1931 2761 gene locus_tag LOCUS_35830 gene cdaA 1931 2761 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_35830 2751 3695 gene locus_tag LOCUS_35840 2751 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 3692 5005 gene locus_tag LOCUS_35850 gene glmM 3692 5005 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418304.1 protein_id gnl|my_center|LOCUS_35850 >Feature sequence385 <1 1347 gene locus_tag LOCUS_35860 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249997.1:DNRLRE domain-containing protein 2903 1515 gene locus_tag LOCUS_35870 2903 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 3239 3021 gene locus_tag LOCUS_35880 3239 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 3127 3645 gene locus_tag LOCUS_35890 3127 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 4155 4811 gene locus_tag LOCUS_35900 4155 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 >Feature sequence386 148 1836 gene locus_tag LOCUS_35910 148 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 2656 1826 gene locus_tag LOCUS_35920 2656 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 4082 2685 gene locus_tag LOCUS_35930 4082 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence387 2099 693 gene locus_tag LOCUS_35940 2099 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 2285 2896 gene locus_tag LOCUS_35950 2285 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2900 3499 gene locus_tag LOCUS_35960 2900 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 >Feature sequence388 236 658 gene locus_tag LOCUS_35970 gene gloA 236 658 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_35970 658 1206 gene locus_tag LOCUS_35980 658 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 2053 1223 gene locus_tag LOCUS_35990 2053 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 2598 2056 gene locus_tag LOCUS_36000 2598 2056 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229095.1 protein_id gnl|my_center|LOCUS_36000 <5113 2595 gene locus_tag LOCUS_36010 <5113 2595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010908844.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence389 448 245 gene locus_tag LOCUS_36020 448 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 632 414 gene locus_tag LOCUS_36030 632 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 1979 840 gene locus_tag LOCUS_36040 1979 840 CDS product NADH-dependent flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398691.1 protein_id gnl|my_center|LOCUS_36040 2762 2058 gene locus_tag LOCUS_36050 2762 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 3076 3405 gene locus_tag LOCUS_36060 3076 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 3725 3495 gene locus_tag LOCUS_36070 3725 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 4215 3835 gene locus_tag LOCUS_36080 4215 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 >Feature sequence390 699 2642 gene locus_tag LOCUS_36090 699 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 2673 2921 gene locus_tag LOCUS_36100 2673 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence391 913 62 gene locus_tag LOCUS_36110 913 62 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640607.1 protein_id gnl|my_center|LOCUS_36110 1362 910 gene locus_tag LOCUS_36120 1362 910 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479357.1 protein_id gnl|my_center|LOCUS_36120 1814 1359 gene locus_tag LOCUS_36130 1814 1359 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184577.1 protein_id gnl|my_center|LOCUS_36130 1978 3306 gene locus_tag LOCUS_36140 1978 3306 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028749.1 protein_id gnl|my_center|LOCUS_36140 3350 4051 gene locus_tag LOCUS_36150 3350 4051 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence392 2189 348 gene locus_tag LOCUS_36160 2189 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 2384 3415 gene locus_tag LOCUS_36170 gene pdhA 2384 3415 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328145.1 protein_id gnl|my_center|LOCUS_36170 3421 4398 gene locus_tag LOCUS_36180 3421 4398 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279894.1 protein_id gnl|my_center|LOCUS_36180 >Feature sequence393 2223 649 gene locus_tag LOCUS_36190 2223 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 3901 2372 gene locus_tag LOCUS_36200 3901 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 <5027 4185 gene locus_tag LOCUS_36210 <5027 4185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118837921.1:SCO family protein >Feature sequence394 2410 1448 gene locus_tag LOCUS_36220 gene accD 2410 1448 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943005.1 protein_id gnl|my_center|LOCUS_36220 3485 2481 gene locus_tag LOCUS_36230 3485 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 3525 4316 gene locus_tag LOCUS_36240 3525 4316 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111854.1 protein_id gnl|my_center|LOCUS_36240 >Feature sequence395 323 4219 gene locus_tag LOCUS_36250 gene purL 323 4219 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221777.1 protein_id gnl|my_center|LOCUS_36250 <5000 4273 gene locus_tag LOCUS_36260 <5000 4273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002220499.1:formylglycine-generating enzyme family protein >Feature sequence396 2 1723 gene locus_tag LOCUS_36270 2 1723 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146578646.1 protein_id gnl|my_center|LOCUS_36270 1756 3219 gene locus_tag LOCUS_36280 1756 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 <4976 3216 gene locus_tag LOCUS_36290 <4976 3216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000498183.1:phenylalanine--tRNA ligase subunit beta >Feature sequence397 >Feature sequence398 2302 488 gene locus_tag LOCUS_36300 2302 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36300 3194 2346 gene locus_tag LOCUS_36310 3194 2346 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_36310 3278 3625 gene locus_tag LOCUS_36320 3278 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 3637 3804 gene locus_tag LOCUS_36330 3637 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence399 1506 67 gene locus_tag LOCUS_36340 1506 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 1880 1557 gene locus_tag LOCUS_36350 1880 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36350 4285 2090 gene locus_tag LOCUS_36360 4285 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 4896 4315 gene locus_tag LOCUS_36370 4896 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36370 >Feature sequence400 1066 602 gene locus_tag LOCUS_36380 1066 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 1237 1161 gene locus_tag LOCUS_t00350 1237 1161 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2201 1356 gene locus_tag LOCUS_36390 gene rluB 2201 1356 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398815.1 protein_id gnl|my_center|LOCUS_36390 2894 2313 gene locus_tag LOCUS_36400 gene scpB 2894 2313 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942475.1 protein_id gnl|my_center|LOCUS_36400 3699 2875 gene locus_tag LOCUS_36410 3699 2875 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003124353.1 protein_id gnl|my_center|LOCUS_36410 4769 3702 gene locus_tag LOCUS_36420 gene bcd 4769 3702 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence401 <1 1740 gene locus_tag LOCUS_36430 <1 1740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962333.1:OmpA family protein 1740 3878 gene locus_tag LOCUS_36440 1740 3878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 4061 3840 gene locus_tag LOCUS_36450 4061 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4639 4058 gene locus_tag LOCUS_36460 4639 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 >Feature sequence402 1582 359 gene locus_tag LOCUS_36470 1582 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 3351 1525 gene locus_tag LOCUS_36480 3351 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3379 4242 gene locus_tag LOCUS_36490 3379 4242 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_36490 >Feature sequence403 <1 695 gene locus_tag LOCUS_36500 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811442.1:(deoxy)nucleoside triphosphate pyrophosphohydrolase 2424 679 gene locus_tag LOCUS_36510 2424 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 2580 3296 gene locus_tag LOCUS_36520 2580 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 3645 3265 gene locus_tag LOCUS_36530 3645 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36530 3834 4577 gene locus_tag LOCUS_36540 3834 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 >Feature sequence404 2107 3594 gene locus_tag LOCUS_36550 2107 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 >Feature sequence405 666 55 gene locus_tag LOCUS_36560 666 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 1545 673 gene locus_tag LOCUS_36570 1545 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 2729 1992 gene locus_tag LOCUS_36580 2729 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 2779 2855 gene locus_tag LOCUS_t00360 2779 2855 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3819 2857 gene locus_tag LOCUS_36590 3819 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36590 3973 4728 gene locus_tag LOCUS_36600 3973 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 >Feature sequence406 25 984 gene locus_tag LOCUS_36610 25 984 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727553.1 protein_id gnl|my_center|LOCUS_36610 1171 2334 gene locus_tag LOCUS_36620 1171 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 >Feature sequence407 <1 513 gene locus_tag LOCUS_36630 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943695.1:putative lipid II flippase FtsW 517 1905 gene locus_tag LOCUS_36640 gene murC 517 1905 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_36640 1902 2783 gene locus_tag LOCUS_36650 gene murB 1902 2783 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111588.1 protein_id gnl|my_center|LOCUS_36650 2810 3712 gene locus_tag LOCUS_36660 2810 3712 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943691.1 protein_id gnl|my_center|LOCUS_36660 4109 4798 gene locus_tag LOCUS_36670 4109 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence408 3233 1818 gene locus_tag LOCUS_36680 3233 1818 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_36680 4663 3311 gene locus_tag LOCUS_36690 gene trkA 4663 3311 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_36690 >Feature sequence409 373 864 gene locus_tag LOCUS_36700 373 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 972 1565 gene locus_tag LOCUS_36710 972 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36710 4135 1502 gene locus_tag LOCUS_36720 4135 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36720 >Feature sequence410 456 58 gene locus_tag LOCUS_36730 456 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 751 494 gene locus_tag LOCUS_36740 751 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 1517 1819 gene locus_tag LOCUS_36750 1517 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 1816 2136 gene locus_tag LOCUS_36760 1816 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 2825 2670 gene locus_tag LOCUS_36770 2825 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 2951 3115 gene locus_tag LOCUS_36780 2951 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 3120 3530 gene locus_tag LOCUS_36790 3120 3530 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037389967.1 protein_id gnl|my_center|LOCUS_36790 3627 3767 gene locus_tag LOCUS_36800 3627 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 3928 4596 gene locus_tag LOCUS_36810 3928 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 >Feature sequence411 1082 501 gene locus_tag LOCUS_36820 1082 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 1285 1770 gene locus_tag LOCUS_36830 1285 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36830 2252 3784 gene locus_tag LOCUS_36840 2252 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence412 1717 1196 gene locus_tag LOCUS_36850 1717 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 3123 1825 gene locus_tag LOCUS_36860 3123 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 3845 3114 gene locus_tag LOCUS_36870 3845 3114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_36870 4762 3842 gene locus_tag LOCUS_36880 gene gldA 4762 3842 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_36880 >Feature sequence413 4410 2455 gene locus_tag LOCUS_36890 4410 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 >Feature sequence414 <1 1260 gene locus_tag LOCUS_36900 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051300116.1:fatty acyl-AMP ligase 1284 1571 gene locus_tag LOCUS_36910 1284 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 >Feature sequence415 177 710 gene locus_tag LOCUS_36920 177 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 933 2366 gene locus_tag LOCUS_36930 933 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 3245 2367 gene locus_tag LOCUS_36940 3245 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36940 3388 3639 gene locus_tag LOCUS_36950 3388 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36950 >Feature sequence416 1722 466 gene locus_tag LOCUS_36960 1722 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 2365 1796 gene locus_tag LOCUS_36970 2365 1796 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257601.1 protein_id gnl|my_center|LOCUS_36970 3771 2365 gene locus_tag LOCUS_36980 gene trpE 3771 2365 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_36980 >Feature sequence417 2825 1761 gene locus_tag LOCUS_36990 gene dnaJ 2825 1761 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_36990 3963 2854 gene locus_tag LOCUS_37000 gene hemW 3963 2854 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_37000 <4757 3984 gene locus_tag LOCUS_37010 <4757 3984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973289.1:pitrilysin family protein >Feature sequence418 329 1264 gene locus_tag LOCUS_37020 329 1264 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020817.1 protein_id gnl|my_center|LOCUS_37020 1541 1813 gene locus_tag LOCUS_37030 1541 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 3045 2017 gene locus_tag LOCUS_37040 3045 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 3578 3895 gene locus_tag LOCUS_37050 3578 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37050 3932 4405 gene locus_tag LOCUS_37060 3932 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 4412 4570 gene locus_tag LOCUS_37070 4412 4570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence419 <1 1315 gene locus_tag LOCUS_37080 <1 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 2407 1271 gene locus_tag LOCUS_37090 2407 1271 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_37090 3423 2404 gene locus_tag LOCUS_37100 3423 2404 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224427.1 protein_id gnl|my_center|LOCUS_37100 3908 3429 gene locus_tag LOCUS_37110 3908 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37110 4342 3905 gene locus_tag LOCUS_37120 4342 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37120 4676 4344 gene locus_tag LOCUS_37130 4676 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence420 712 227 gene locus_tag LOCUS_37140 712 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 1002 709 gene locus_tag LOCUS_37150 1002 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 2373 1054 gene locus_tag LOCUS_37160 gene ftsY 2373 1054 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074184.1 protein_id gnl|my_center|LOCUS_37160 <4739 2406 gene locus_tag LOCUS_37170 <4739 2406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941791.1:chromosome segregation protein SMC >Feature sequence421 109 1278 gene locus_tag LOCUS_37180 109 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1278 2210 gene locus_tag LOCUS_37190 1278 2210 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_37190 2950 2207 gene locus_tag LOCUS_37200 2950 2207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37200 3878 2955 gene locus_tag LOCUS_37210 gene ldeG 3878 2955 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_37210 4065 3990 gene locus_tag LOCUS_t00370 4065 3990 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4150 4078 gene locus_tag LOCUS_t00380 4150 4078 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 <4739 4200 gene locus_tag LOCUS_37220 <4739 4200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393792.1:adenylosuccinate synthase >Feature sequence422 1486 536 gene locus_tag LOCUS_37230 1486 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 4161 1477 gene locus_tag LOCUS_37240 4161 1477 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_37240 >Feature sequence423 1472 822 gene locus_tag LOCUS_37250 gene gmk 1472 822 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008153.1 protein_id gnl|my_center|LOCUS_37250 2353 1475 gene locus_tag LOCUS_37260 2353 1475 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_37260 3322 2399 gene locus_tag LOCUS_37270 3322 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37270 4720 3422 gene locus_tag LOCUS_37280 4720 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37280 >Feature sequence424 815 609 gene locus_tag LOCUS_37290 815 609 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383180.1 protein_id gnl|my_center|LOCUS_37290 3196 827 gene locus_tag LOCUS_37300 gene copA1 3196 827 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_37300 4327 3245 gene locus_tag LOCUS_37310 4327 3245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 >Feature sequence425 859 608 gene locus_tag LOCUS_37320 859 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 919 1140 gene locus_tag LOCUS_37330 919 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 1707 2012 gene locus_tag LOCUS_37340 gene rpsN 1707 2012 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919140.1 protein_id gnl|my_center|LOCUS_37340 3623 2127 gene locus_tag LOCUS_37350 3623 2127 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338958.1 protein_id gnl|my_center|LOCUS_37350 <4706 3763 gene locus_tag LOCUS_37360 <4706 3763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383016.1:FAD-dependent thymidylate synthase >Feature sequence426 1640 288 gene locus_tag LOCUS_37370 1640 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 2513 1986 gene locus_tag LOCUS_37380 2513 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 3125 2568 gene locus_tag LOCUS_37390 3125 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 3939 3277 gene locus_tag LOCUS_37400 3939 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 4368 4132 gene locus_tag LOCUS_37410 4368 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 >Feature sequence427 1053 2513 gene locus_tag LOCUS_37420 1053 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 3868 2510 gene locus_tag LOCUS_37430 3868 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_37430 >Feature sequence428 1681 1217 gene locus_tag LOCUS_37440 1681 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 4359 1678 gene locus_tag LOCUS_37450 4359 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 >Feature sequence429 1633 56 gene locus_tag LOCUS_37460 1633 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 2137 4182 gene locus_tag LOCUS_37470 2137 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 >Feature sequence430 78 593 gene locus_tag LOCUS_37480 78 593 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330816.1 protein_id gnl|my_center|LOCUS_37480 590 3271 gene locus_tag LOCUS_37490 590 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 3381 4388 gene locus_tag LOCUS_37500 3381 4388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011026838.1 protein_id gnl|my_center|LOCUS_37500 >Feature sequence431 888 61 gene locus_tag LOCUS_37510 888 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 2632 881 gene locus_tag LOCUS_37520 2632 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 4456 2780 gene locus_tag LOCUS_37530 4456 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence432 567 115 gene locus_tag LOCUS_37540 567 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 794 564 gene locus_tag LOCUS_37550 794 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 1066 812 gene locus_tag LOCUS_37560 1066 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 1360 1088 gene locus_tag LOCUS_37570 1360 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 2381 1446 gene locus_tag LOCUS_37580 2381 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 4417 2378 gene locus_tag LOCUS_37590 4417 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 >Feature sequence433 2025 688 gene locus_tag LOCUS_37600 2025 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022222.1 protein_id gnl|my_center|LOCUS_37600 2113 2289 gene locus_tag LOCUS_37610 2113 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 4410 3133 gene locus_tag LOCUS_37620 4410 3133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 >Feature sequence434 222 749 gene locus_tag LOCUS_37630 gene nusG 222 749 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806885.1 protein_id gnl|my_center|LOCUS_37630 802 1230 gene locus_tag LOCUS_37640 gene rplK 802 1230 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003718336.1 protein_id gnl|my_center|LOCUS_37640 1478 2095 gene locus_tag LOCUS_37650 gene rplA 1478 2095 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357362.1 protein_id gnl|my_center|LOCUS_37650 2104 2628 gene locus_tag LOCUS_37660 gene rplJ 2104 2628 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385333.1 protein_id gnl|my_center|LOCUS_37660 2716 3084 gene locus_tag LOCUS_37670 gene rplL 2716 3084 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650892.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence435 248 982 gene locus_tag LOCUS_37680 248 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1494 979 gene locus_tag LOCUS_37690 1494 979 CDS product DUF1993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192577.1 protein_id gnl|my_center|LOCUS_37690 1670 2602 gene locus_tag LOCUS_37700 1670 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 3505 3056 gene locus_tag LOCUS_37710 3505 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 >Feature sequence436 1759 197 gene locus_tag LOCUS_37720 1759 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 3465 1843 gene locus_tag LOCUS_37730 3465 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 4456 3803 gene locus_tag LOCUS_37740 4456 3803 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324308.1 protein_id gnl|my_center|LOCUS_37740 >Feature sequence437 <1 1438 gene locus_tag LOCUS_37750 <1 1438 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393064.1:3-dehydroquinate synthase 1435 1959 gene locus_tag LOCUS_37760 1435 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 1963 2853 gene locus_tag LOCUS_37770 1963 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 2853 3305 gene locus_tag LOCUS_37780 gene aroQ 2853 3305 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369457.1 protein_id gnl|my_center|LOCUS_37780 3396 3860 gene locus_tag LOCUS_37790 3396 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 >Feature sequence438 535 918 gene locus_tag LOCUS_37800 535 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 953 1486 gene locus_tag LOCUS_37810 gene nusG 953 1486 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_37810 1514 1942 gene locus_tag LOCUS_37820 gene rplK 1514 1942 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085872.1 protein_id gnl|my_center|LOCUS_37820 2035 2754 gene locus_tag LOCUS_37830 gene rplA 2035 2754 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_37830 2764 3306 gene locus_tag LOCUS_37840 gene rplJ 2764 3306 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_37840 3391 3768 gene locus_tag LOCUS_37850 gene rplL 3391 3768 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_37850 >Feature sequence439 861 1550 gene locus_tag LOCUS_37860 861 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37860 2392 2523 gene locus_tag LOCUS_37870 2392 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 3142 2747 gene locus_tag LOCUS_37880 3142 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37880 3397 3831 gene locus_tag LOCUS_37890 3397 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence440 4024 3359 gene locus_tag LOCUS_37900 4024 3359 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479964.1 protein_id gnl|my_center|LOCUS_37900 >Feature sequence441 2808 958 gene locus_tag LOCUS_37910 2808 958 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_37910 3795 2818 gene locus_tag LOCUS_37920 gene dusA 3795 2818 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_37920 4388 3873 gene locus_tag LOCUS_37930 4388 3873 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439149.1 protein_id gnl|my_center|LOCUS_37930 >Feature sequence442 1338 13 gene locus_tag LOCUS_37940 gene serS 1338 13 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391570.1 protein_id gnl|my_center|LOCUS_37940 3060 1366 gene locus_tag LOCUS_37950 3060 1366 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071688.1 protein_id gnl|my_center|LOCUS_37950 3767 3057 gene locus_tag LOCUS_37960 gene lipB 3767 3057 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943071.1 protein_id gnl|my_center|LOCUS_37960 4406 3774 gene locus_tag LOCUS_37970 gene tmk 4406 3774 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762936.1 protein_id gnl|my_center|LOCUS_37970 >Feature sequence443 1202 2266 gene locus_tag LOCUS_37980 gene fbp 1202 2266 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_37980 3174 2263 gene locus_tag LOCUS_37990 3174 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence444 860 1144 gene locus_tag LOCUS_38000 860 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 1924 1148 gene locus_tag LOCUS_38010 1924 1148 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056496.1 protein_id gnl|my_center|LOCUS_38010 2726 1878 gene locus_tag LOCUS_38020 2726 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence445 2 526 gene locus_tag LOCUS_38030 2 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38030 567 704 gene locus_tag LOCUS_38040 567 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2695 845 gene locus_tag LOCUS_38050 2695 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4074 3388 gene locus_tag LOCUS_38060 4074 3388 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_38060 4300 4052 gene locus_tag LOCUS_38070 4300 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence446 887 414 gene locus_tag LOCUS_38080 887 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 4241 1020 gene locus_tag LOCUS_38090 4241 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence447 267 1412 gene locus_tag LOCUS_38100 267 1412 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_38100 1505 2740 gene locus_tag LOCUS_38110 gene sucC 1505 2740 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388966.1 protein_id gnl|my_center|LOCUS_38110 2744 3622 gene locus_tag LOCUS_38120 gene sucD 2744 3622 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003238566.1 protein_id gnl|my_center|LOCUS_38120 3862 4293 gene locus_tag LOCUS_38130 gene ndk 3862 4293 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531616.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence448 60 1772 gene locus_tag LOCUS_38140 60 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 1769 2815 gene locus_tag LOCUS_38150 1769 2815 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338853.1 protein_id gnl|my_center|LOCUS_38150 2812 3321 gene locus_tag LOCUS_38160 2812 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 3662 3318 gene locus_tag LOCUS_38170 3662 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4079 3741 gene locus_tag LOCUS_38180 4079 3741 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_38180 4411 4088 gene locus_tag LOCUS_38190 4411 4088 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888922.1 protein_id gnl|my_center|LOCUS_38190 >Feature sequence449 847 398 gene locus_tag LOCUS_38200 847 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1661 1137 gene locus_tag LOCUS_38210 1661 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 3094 1661 gene locus_tag LOCUS_38220 gene rlmD 3094 1661 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_38220 3201 4037 gene locus_tag LOCUS_38230 3201 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 4034 4216 gene locus_tag LOCUS_38240 4034 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 >Feature sequence450 230 1504 gene locus_tag LOCUS_38250 230 1504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 1504 3009 gene locus_tag LOCUS_38260 1504 3009 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_38260 3060 3935 gene locus_tag LOCUS_38270 3060 3935 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973851.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence451 595 1962 gene locus_tag LOCUS_38280 595 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 2492 2181 gene locus_tag LOCUS_38290 2492 2181 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092272.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence452 970 14 gene locus_tag LOCUS_38300 970 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1908 1132 gene locus_tag LOCUS_38310 1908 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 2562 3206 gene locus_tag LOCUS_38320 2562 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 3154 3666 gene locus_tag LOCUS_38330 3154 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 4217 3705 gene locus_tag LOCUS_38340 4217 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence453 409 777 gene locus_tag LOCUS_38350 gene rplS 409 777 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583883.1 protein_id gnl|my_center|LOCUS_38350 905 1165 gene locus_tag LOCUS_38360 905 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 2157 1168 gene locus_tag LOCUS_38370 2157 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 3697 2333 gene locus_tag LOCUS_38380 3697 2333 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938712.1 protein_id gnl|my_center|LOCUS_38380 3812 4309 gene locus_tag LOCUS_38390 3812 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 >Feature sequence454 1012 80 gene locus_tag LOCUS_38400 1012 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 1200 1009 gene locus_tag LOCUS_38410 1200 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 3494 1539 gene locus_tag LOCUS_38420 3494 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 <4351 3491 gene locus_tag LOCUS_38430 <4351 3491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920957.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence455 858 145 gene locus_tag LOCUS_38440 858 145 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226852.1 protein_id gnl|my_center|LOCUS_38440 1068 1340 gene locus_tag LOCUS_38450 1068 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 1365 2669 gene locus_tag LOCUS_38460 gene asnS 1365 2669 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941817.1 protein_id gnl|my_center|LOCUS_38460 2798 3916 gene locus_tag LOCUS_38470 2798 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence456 1009 404 gene locus_tag LOCUS_38480 1009 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 1830 1006 gene locus_tag LOCUS_38490 1830 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2429 1854 gene locus_tag LOCUS_38500 2429 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38500 2956 2426 gene locus_tag LOCUS_38510 2956 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058286.1 protein_id gnl|my_center|LOCUS_38510 3115 3732 gene locus_tag LOCUS_38520 3115 3732 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225434.1 protein_id gnl|my_center|LOCUS_38520 >Feature sequence457 808 1149 gene locus_tag LOCUS_38530 808 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 2099 1146 gene locus_tag LOCUS_38540 2099 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 2068 3783 gene locus_tag LOCUS_38550 2068 3783 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_38550 >Feature sequence458 472 3576 gene locus_tag LOCUS_38560 472 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence459 <1 1080 gene locus_tag LOCUS_38570 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461820.1:radical SAM protein 1077 1943 gene locus_tag LOCUS_38580 1077 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38580 2490 2275 gene locus_tag LOCUS_38590 2490 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 >Feature sequence460 533 1195 gene locus_tag LOCUS_38600 533 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence461 855 367 gene locus_tag LOCUS_38610 855 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 950 2830 gene locus_tag LOCUS_38620 950 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 3196 2837 gene locus_tag LOCUS_38630 3196 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 >Feature sequence462 147 3311 gene locus_tag LOCUS_38640 147 3311 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265500.1 protein_id gnl|my_center|LOCUS_38640 3316 3501 gene locus_tag LOCUS_38650 3316 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 <4238 3498 gene locus_tag LOCUS_38660 <4238 3498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022878.1:alpha/beta fold hydrolase >Feature sequence463 525 927 gene locus_tag LOCUS_tm00010 525 927 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1705 1007 gene locus_tag LOCUS_38670 1705 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 1825 2715 gene locus_tag LOCUS_38680 1825 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38680 2824 3759 gene locus_tag LOCUS_38690 2824 3759 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_38690 3756 4208 gene locus_tag LOCUS_38700 3756 4208 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226310.1 protein_id gnl|my_center|LOCUS_38700 >Feature sequence464 584 1783 gene locus_tag LOCUS_38710 gene kbl 584 1783 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213834.1 protein_id gnl|my_center|LOCUS_38710 2544 1780 gene locus_tag LOCUS_38720 2544 1780 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003900432.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence465 1546 458 gene locus_tag LOCUS_38730 gene murG 1546 458 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_38730 2830 1550 gene locus_tag LOCUS_38740 2830 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 3597 2893 gene locus_tag LOCUS_38750 3597 2893 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227903.1 protein_id gnl|my_center|LOCUS_38750 3657 4157 gene locus_tag LOCUS_38760 3657 4157 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403468.1 protein_id gnl|my_center|LOCUS_38760 >Feature sequence466 >Feature sequence467 <1 645 gene locus_tag LOCUS_38770 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter 734 1963 gene locus_tag LOCUS_38780 734 1963 CDS product 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791484.1 protein_id gnl|my_center|LOCUS_38780 2368 1970 gene locus_tag LOCUS_38790 2368 1970 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071479.1 protein_id gnl|my_center|LOCUS_38790 2424 3233 gene locus_tag LOCUS_38800 2424 3233 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_38800 3255 4112 gene locus_tag LOCUS_38810 3255 4112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence468 507 2231 gene locus_tag LOCUS_38820 507 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 2609 2187 gene locus_tag LOCUS_38830 2609 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence469 1 750 gene locus_tag LOCUS_38840 1 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 1400 747 gene locus_tag LOCUS_38850 1400 747 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940552.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence470 389 1897 gene locus_tag LOCUS_38860 389 1897 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010950408.1 protein_id gnl|my_center|LOCUS_38860 2496 1894 gene locus_tag LOCUS_38870 gene cysC 2496 1894 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468764.1 protein_id gnl|my_center|LOCUS_38870 2572 3615 gene locus_tag LOCUS_38880 gene plsX 2572 3615 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272448.1 protein_id gnl|my_center|LOCUS_38880 >Feature sequence471 119 697 gene locus_tag LOCUS_38890 119 697 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067285.1 protein_id gnl|my_center|LOCUS_38890 694 2727 gene locus_tag LOCUS_38900 694 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 >Feature sequence472 3857 444 gene locus_tag LOCUS_38910 3857 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 >Feature sequence473 <1 2044 gene locus_tag LOCUS_38920 <1 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921689.1:ATP-dependent helicase HrpB 2058 2134 gene locus_tag LOCUS_t00390 2058 2134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2857 4080 gene locus_tag LOCUS_38930 2857 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence474 260 1420 gene locus_tag LOCUS_38940 gene ahcY 260 1420 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143175.1 protein_id gnl|my_center|LOCUS_38940 1422 2177 gene locus_tag LOCUS_38950 1422 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2307 3968 gene locus_tag LOCUS_38960 2307 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 >Feature sequence475 1608 1036 gene locus_tag LOCUS_38970 1608 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38970 1825 1619 gene locus_tag LOCUS_38980 1825 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38980 2254 1847 gene locus_tag LOCUS_38990 2254 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 >Feature sequence476 <1 509 gene locus_tag LOCUS_39000 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546134.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 1552 506 gene locus_tag LOCUS_39010 1552 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 2295 1633 gene locus_tag LOCUS_39020 gene purN 2295 1633 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938037.1 protein_id gnl|my_center|LOCUS_39020 3299 2292 gene locus_tag LOCUS_39030 gene purM 3299 2292 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_39030 4008 3322 gene locus_tag LOCUS_39040 4008 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39040 >Feature sequence477 246 1127 gene locus_tag LOCUS_39050 246 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 1124 2107 gene locus_tag LOCUS_39060 1124 2107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 2112 3185 gene locus_tag LOCUS_39070 2112 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39070 >Feature sequence478 530 1771 gene locus_tag LOCUS_39080 530 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence479 398 1771 gene locus_tag LOCUS_39090 gene mgtE 398 1771 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404919.1 protein_id gnl|my_center|LOCUS_39090 1771 2514 gene locus_tag LOCUS_39100 gene recO 1771 2514 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941240.1 protein_id gnl|my_center|LOCUS_39100 2535 3269 gene locus_tag LOCUS_39110 2535 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 3470 3778 gene locus_tag LOCUS_39120 3470 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 3788 4036 gene locus_tag LOCUS_39130 3788 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 >Feature sequence480 360 905 gene locus_tag LOCUS_39140 360 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39140 902 1489 gene locus_tag LOCUS_39150 902 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 1913 2575 gene locus_tag LOCUS_39160 1913 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 2572 2979 gene locus_tag LOCUS_39170 2572 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 2976 4016 gene locus_tag LOCUS_39180 2976 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence481 635 264 gene locus_tag LOCUS_39190 635 264 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331456.1 protein_id gnl|my_center|LOCUS_39190 1630 632 gene locus_tag LOCUS_39200 1630 632 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229964.1 protein_id gnl|my_center|LOCUS_39200 1847 2227 gene locus_tag LOCUS_39210 gene trxA 1847 2227 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_39210 3361 2228 gene locus_tag LOCUS_39220 3361 2228 CDS product M14-type cytosolic carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244116.1 protein_id gnl|my_center|LOCUS_39220 >Feature sequence482 833 1036 gene locus_tag LOCUS_39230 833 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39230 1776 1114 gene locus_tag LOCUS_39240 1776 1114 CDS product GAP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727149.1 protein_id gnl|my_center|LOCUS_39240 1921 2685 gene locus_tag LOCUS_39250 1921 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 2669 3079 gene locus_tag LOCUS_39260 2669 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 3144 3773 gene locus_tag LOCUS_39270 3144 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 >Feature sequence483 106 480 gene locus_tag LOCUS_39280 106 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 570 1163 gene locus_tag LOCUS_39290 570 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 1940 1248 gene locus_tag LOCUS_39300 1940 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 2074 2544 gene locus_tag LOCUS_39310 2074 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 3437 2553 gene locus_tag LOCUS_39320 3437 2553 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941650.1 protein_id gnl|my_center|LOCUS_39320 3548 3922 gene locus_tag LOCUS_39330 3548 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 >Feature sequence484 2788 32 gene locus_tag LOCUS_39340 gene secA 2788 32 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_39340 3699 2923 gene locus_tag LOCUS_39350 3699 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 >Feature sequence485 <1 1575 gene locus_tag LOCUS_39360 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter 1572 2075 gene locus_tag LOCUS_39370 1572 2075 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805188.1 protein_id gnl|my_center|LOCUS_39370 2950 2102 gene locus_tag LOCUS_39380 2950 2102 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_39380 >Feature sequence486 <1 2608 gene locus_tag LOCUS_39390 <1 2608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS 2612 3505 gene locus_tag LOCUS_39400 gene xerD 2612 3505 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_39400 >Feature sequence487 654 881 gene locus_tag LOCUS_39410 654 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 1006 1836 gene locus_tag LOCUS_39420 1006 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 2371 1859 gene locus_tag LOCUS_39430 2371 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 3854 2382 gene locus_tag LOCUS_39440 3854 2382 CDS product ATPase with chaperone activity inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615735.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence488 1491 145 gene locus_tag LOCUS_39450 1491 145 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405201.1 protein_id gnl|my_center|LOCUS_39450 1585 2511 gene locus_tag LOCUS_39460 1585 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence489 <1 870 gene locus_tag LOCUS_39470 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258670.1:ATP-binding protein 919 1434 gene locus_tag LOCUS_39480 919 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 1961 1440 gene locus_tag LOCUS_39490 1961 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 2487 3167 gene locus_tag LOCUS_39500 2487 3167 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965007.1 protein_id gnl|my_center|LOCUS_39500 >Feature sequence490 1141 389 gene locus_tag LOCUS_39510 gene rlmB 1141 389 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887855.1 protein_id gnl|my_center|LOCUS_39510 2509 1154 gene locus_tag LOCUS_39520 2509 1154 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_39520 3317 2601 gene locus_tag LOCUS_39530 3317 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 >Feature sequence491 >Feature sequence492 1258 2253 gene locus_tag LOCUS_39540 1258 2253 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099262600.1 protein_id gnl|my_center|LOCUS_39540 3225 2254 gene locus_tag LOCUS_39550 3225 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 <3904 3289 gene locus_tag LOCUS_39560 <3904 3289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258358.1:TlpA disulfide reductase family protein >Feature sequence493 46 3021 gene locus_tag LOCUS_39570 46 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 3566 3027 gene locus_tag LOCUS_39580 3566 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 >Feature sequence494 1019 2962 gene locus_tag LOCUS_39590 gene acs 1019 2962 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_39590 >Feature sequence495 <1 2109 gene locus_tag LOCUS_39600 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932772.1:DUF87 domain-containing protein 2173 3480 gene locus_tag LOCUS_39610 gene miaB 2173 3480 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992205.1 protein_id gnl|my_center|LOCUS_39610 >Feature sequence496 1597 776 gene locus_tag LOCUS_39620 1597 776 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894135.1 protein_id gnl|my_center|LOCUS_39620 2171 2800 gene locus_tag LOCUS_39630 2171 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39630 >Feature sequence497 191 1750 gene locus_tag LOCUS_39640 191 1750 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680223.1 protein_id gnl|my_center|LOCUS_39640 1810 3804 gene locus_tag LOCUS_39650 gene htpG 1810 3804 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 protein_id gnl|my_center|LOCUS_39650 >Feature sequence498 <1 1690 gene locus_tag LOCUS_39660 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890715.1:PAS domain-containing sensor histidine kinase >Feature sequence499 360 1592 gene locus_tag LOCUS_39670 360 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 2250 1594 gene locus_tag LOCUS_39680 2250 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 3440 2253 gene locus_tag LOCUS_39690 3440 2253 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_39690 >Feature sequence500 212 1198 gene locus_tag LOCUS_39700 212 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 1215 2579 gene locus_tag LOCUS_39710 1215 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2656 2979 gene locus_tag LOCUS_39720 2656 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 >Feature sequence501 <1 1560 gene locus_tag LOCUS_39730 <1 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262523.1:cytochrome-c peroxidase 2929 1562 gene locus_tag LOCUS_39740 2929 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence502 2533 3639 gene locus_tag LOCUS_39750 2533 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 >Feature sequence503 2268 712 gene locus_tag LOCUS_39760 2268 712 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_39760 2392 3825 gene locus_tag LOCUS_39770 2392 3825 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence504 236 1309 gene locus_tag LOCUS_39780 236 1309 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_39780 1511 1681 gene locus_tag LOCUS_39790 1511 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39790 1697 3724 gene locus_tag LOCUS_39800 1697 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence505 2030 102 gene locus_tag LOCUS_39810 2030 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 2273 3301 gene locus_tag LOCUS_39820 2273 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39820 >Feature sequence506 143 598 gene locus_tag LOCUS_39830 gene tsaE 143 598 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966123.1 protein_id gnl|my_center|LOCUS_39830 660 1238 gene locus_tag LOCUS_39840 660 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_39840 1334 2410 gene locus_tag LOCUS_39850 gene nifS 1334 2410 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_39850 3274 2378 gene locus_tag LOCUS_39860 3274 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence507 720 2414 gene locus_tag LOCUS_39870 720 2414 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_39870 3409 2411 gene locus_tag LOCUS_39880 3409 2411 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 protein_id gnl|my_center|LOCUS_39880 >Feature sequence508 <1 1284 gene locus_tag LOCUS_39890 <1 1284 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946754.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence509 986 249 gene locus_tag LOCUS_39900 986 249 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887572.1 protein_id gnl|my_center|LOCUS_39900 1075 1725 gene locus_tag LOCUS_39910 gene mexL 1075 1725 CDS product efflux system transcriptional repressor MexL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092468.1 protein_id gnl|my_center|LOCUS_39910 1728 3338 gene locus_tag LOCUS_39920 gene atuC 1728 3338 CDS product geranyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114738.1 protein_id gnl|my_center|LOCUS_39920 >Feature sequence510 >Feature sequence511 776 2047 gene locus_tag LOCUS_39930 gene thrC 776 2047 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_39930 >Feature sequence512 220 450 gene locus_tag LOCUS_39940 220 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 1429 599 gene locus_tag LOCUS_39950 1429 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39950 1728 1934 gene locus_tag LOCUS_39960 1728 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 1925 2938 gene locus_tag LOCUS_39970 gene holA 1925 2938 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228461.1 protein_id gnl|my_center|LOCUS_39970 3339 3061 gene locus_tag LOCUS_39980 3339 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39980 >Feature sequence513 1956 898 gene locus_tag LOCUS_39990 1956 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 2501 1944 gene locus_tag LOCUS_40000 2501 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence514 269 1234 gene locus_tag LOCUS_40010 269 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 1222 3072 gene locus_tag LOCUS_40020 1222 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 >Feature sequence515 1516 362 gene locus_tag LOCUS_40030 1516 362 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228752.1 protein_id gnl|my_center|LOCUS_40030 1949 1509 gene locus_tag LOCUS_40040 1949 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 1948 2448 gene locus_tag LOCUS_40050 1948 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 2507 3334 gene locus_tag LOCUS_40060 2507 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 >Feature sequence516 654 505 gene locus_tag LOCUS_40070 654 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 1204 698 gene locus_tag LOCUS_40080 1204 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 1635 1201 gene locus_tag LOCUS_40090 1635 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 2238 1915 gene locus_tag LOCUS_40100 2238 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 2828 2346 gene locus_tag LOCUS_40110 2828 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 3205 2879 gene locus_tag LOCUS_40120 3205 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 3678 3376 gene locus_tag LOCUS_40130 3678 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 >Feature sequence517 1093 281 gene locus_tag LOCUS_40140 1093 281 CDS product DUF5718 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706245.1 protein_id gnl|my_center|LOCUS_40140 2452 1148 gene locus_tag LOCUS_40150 2452 1148 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932712.1 protein_id gnl|my_center|LOCUS_40150 >Feature sequence518 1369 2043 gene locus_tag LOCUS_40160 1369 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 <3659 2183 gene locus_tag LOCUS_40170 <3659 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144121.1:ABC transporter ATP-binding protein >Feature sequence519 1061 2272 gene locus_tag LOCUS_40180 1061 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40180 >Feature sequence520 <1 1229 gene locus_tag LOCUS_40190 <1 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012437413.1:amidohydrolase 1226 2452 gene locus_tag LOCUS_40200 1226 2452 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275272.1 protein_id gnl|my_center|LOCUS_40200 2449 3633 gene locus_tag LOCUS_40210 2449 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 >Feature sequence521 279 1967 gene locus_tag LOCUS_40220 279 1967 CDS product solute carrier family 26 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256139.1 protein_id gnl|my_center|LOCUS_40220 2135 3169 gene locus_tag LOCUS_40230 2135 3169 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_40230 >Feature sequence522 1113 1700 gene locus_tag LOCUS_40240 1113 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 1697 2266 gene locus_tag LOCUS_40250 1697 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence523 1944 448 gene locus_tag LOCUS_40260 1944 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 2765 2034 gene locus_tag LOCUS_40270 2765 2034 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388151.1 protein_id gnl|my_center|LOCUS_40270 3515 2775 gene locus_tag LOCUS_40280 3515 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40280 >Feature sequence524 101 1315 gene locus_tag LOCUS_40290 101 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 1305 2945 gene locus_tag LOCUS_40300 1305 2945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 <3572 2952 gene locus_tag LOCUS_40310 <3572 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922522.1:sulfatase-like hydrolase/transferase >Feature sequence525 886 209 gene locus_tag LOCUS_40320 886 209 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_40320 962 1822 gene locus_tag LOCUS_40330 gene hslO 962 1822 CDS product redox-regulated molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226695.1 protein_id gnl|my_center|LOCUS_40330 2626 1823 gene locus_tag LOCUS_40340 2626 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 2719 3354 gene locus_tag LOCUS_40350 2719 3354 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869658.1 protein_id gnl|my_center|LOCUS_40350 3566 3312 gene locus_tag LOCUS_40360 3566 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 >Feature sequence526 2939 1590 gene locus_tag LOCUS_40370 gene accC 2939 1590 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393033.1 protein_id gnl|my_center|LOCUS_40370 3360 2953 gene locus_tag LOCUS_40380 3360 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence527 <1 548 gene locus_tag LOCUS_40390 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390226.1:PAS-domain containing protein 802 1005 gene locus_tag LOCUS_40400 802 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 2585 1059 gene locus_tag LOCUS_40410 2585 1059 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812086.1 protein_id gnl|my_center|LOCUS_40410 3263 3466 gene locus_tag LOCUS_40420 3263 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 >Feature sequence528 295 483 gene locus_tag LOCUS_40430 gene rpmG 295 483 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_40430 592 1164 gene locus_tag LOCUS_40440 gene rpsD 592 1164 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124564.1 protein_id gnl|my_center|LOCUS_40440 2477 1488 gene locus_tag LOCUS_40450 2477 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3301 2474 gene locus_tag LOCUS_40460 3301 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence529 <1 613 gene locus_tag LOCUS_40470 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004529278.1:acyl-CoA dehydrogenase family protein 623 2560 gene locus_tag LOCUS_40480 623 2560 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207705.1 protein_id gnl|my_center|LOCUS_40480 2550 3407 gene locus_tag LOCUS_40490 2550 3407 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083805.1 protein_id gnl|my_center|LOCUS_40490 >Feature sequence530 423 812 gene locus_tag LOCUS_40500 423 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 820 1710 gene locus_tag LOCUS_40510 820 1710 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085244.1 protein_id gnl|my_center|LOCUS_40510 >Feature sequence531 <1 3106 gene locus_tag LOCUS_40520 <1 3106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117884.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence532 558 1574 gene locus_tag LOCUS_40530 558 1574 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903481.1 protein_id gnl|my_center|LOCUS_40530 1667 2794 gene locus_tag LOCUS_40540 1667 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40540 2972 3045 gene locus_tag LOCUS_t00400 2972 3045 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3092 3174 gene locus_tag LOCUS_t00410 3092 3174 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3200 3275 gene locus_tag LOCUS_t00420 3200 3275 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3303 3377 gene locus_tag LOCUS_t00430 3303 3377 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence533 >Feature sequence534 7 543 gene locus_tag LOCUS_40550 7 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 2334 571 gene locus_tag LOCUS_40560 2334 571 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083824.1 protein_id gnl|my_center|LOCUS_40560 2424 3191 gene locus_tag LOCUS_40570 2424 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence535 1473 244 gene locus_tag LOCUS_40580 1473 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 1601 2260 gene locus_tag LOCUS_40590 1601 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 2257 3294 gene locus_tag LOCUS_40600 2257 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40600 >Feature sequence536 656 1117 gene locus_tag LOCUS_40610 656 1117 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903120.1 protein_id gnl|my_center|LOCUS_40610 3154 1172 gene locus_tag LOCUS_40620 3154 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 >Feature sequence537 536 3106 gene locus_tag LOCUS_40630 536 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence538 1 2007 gene locus_tag LOCUS_40640 1 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 3067 2153 gene locus_tag LOCUS_40650 3067 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 >Feature sequence539 3 194 gene locus_tag LOCUS_40660 3 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 761 1009 gene locus_tag LOCUS_40670 761 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 1183 2526 gene locus_tag LOCUS_40680 gene fliD 1183 2526 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530401.1 protein_id gnl|my_center|LOCUS_40680 2570 2944 gene locus_tag LOCUS_40690 2570 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 2941 3237 gene locus_tag LOCUS_40700 2941 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence540 326 2863 gene locus_tag LOCUS_40710 326 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 >Feature sequence541 2150 135 gene locus_tag LOCUS_40720 2150 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40720 2996 2313 gene locus_tag LOCUS_40730 2996 2313 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328012.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence542 325 1131 gene locus_tag LOCUS_40740 gene ccsB 325 1131 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_40740 1121 2353 gene locus_tag LOCUS_40750 gene hemA 1121 2353 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_40750 2353 3228 gene locus_tag LOCUS_40760 gene hemC 2353 3228 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_40760 >Feature sequence543 1519 572 gene locus_tag LOCUS_40770 1519 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 2638 3369 gene locus_tag LOCUS_40780 2638 3369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 >Feature sequence544 474 2459 gene locus_tag LOCUS_40790 474 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 2459 3154 gene locus_tag LOCUS_40800 2459 3154 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062678.1 protein_id gnl|my_center|LOCUS_40800 >Feature sequence545 377 610 gene locus_tag LOCUS_40810 377 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 2528 828 gene locus_tag LOCUS_40820 2528 828 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392558.1 protein_id gnl|my_center|LOCUS_40820 2624 2902 gene locus_tag LOCUS_40830 2624 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40830 >Feature sequence546 >Feature sequence547 1219 2376 gene locus_tag LOCUS_40840 gene iadA 1219 2376 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459897.1 protein_id gnl|my_center|LOCUS_40840 2443 3261 gene locus_tag LOCUS_40850 2443 3261 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016692.1 protein_id gnl|my_center|LOCUS_40850 >Feature sequence548 >Feature sequence549 >Feature sequence550 <1 807 gene locus_tag LOCUS_40860 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943428.1:cytochrome c family protein 913 2118 gene locus_tag LOCUS_40870 913 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 2124 2975 gene locus_tag LOCUS_40880 2124 2975 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_40880 >Feature sequence551 1331 414 gene locus_tag LOCUS_40890 gene selD 1331 414 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_40890 1526 1981 gene locus_tag LOCUS_40900 1526 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 2064 2345 gene locus_tag LOCUS_40910 2064 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 >Feature sequence552 726 292 gene locus_tag LOCUS_40920 726 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 1304 1125 gene locus_tag LOCUS_40930 1304 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 1649 2377 gene locus_tag LOCUS_40940 1649 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 2374 3045 gene locus_tag LOCUS_40950 2374 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 >Feature sequence553 <1 994 gene locus_tag LOCUS_40960 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015490.1:quinone-dependent L-lactate dehydrogenase 991 2460 gene locus_tag LOCUS_40970 991 2460 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257031.1 protein_id gnl|my_center|LOCUS_40970 >Feature sequence554 <1 732 gene locus_tag LOCUS_40980 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141490.1:tetracycline resistance MFS efflux pump 874 1701 gene locus_tag LOCUS_40990 874 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 1728 2693 gene locus_tag LOCUS_41000 1728 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 >Feature sequence555 113 1822 gene locus_tag LOCUS_41010 gene hflX 113 1822 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 protein_id gnl|my_center|LOCUS_41010 1810 2289 gene locus_tag LOCUS_41020 1810 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41020 2286 3158 gene locus_tag LOCUS_41030 2286 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444439.1 protein_id gnl|my_center|LOCUS_41030 >Feature sequence556 193 810 gene locus_tag LOCUS_41040 193 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41040 1182 820 gene locus_tag LOCUS_41050 1182 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000626856.1 protein_id gnl|my_center|LOCUS_41050 1304 3232 gene locus_tag LOCUS_41060 1304 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence557 <1 528 gene locus_tag LOCUS_41070 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_130435197.1:ATP-binding protein 619 1458 gene locus_tag LOCUS_41080 619 1458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072059.1 protein_id gnl|my_center|LOCUS_41080 1525 2424 gene locus_tag LOCUS_41090 1525 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41090 >Feature sequence558 1191 412 gene locus_tag LOCUS_41100 gene mazG 1191 412 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_41100 1308 2759 gene locus_tag LOCUS_41110 1308 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41110 <3295 2756 gene locus_tag LOCUS_41120 <3295 2756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937579.1:PAS domain S-box protein >Feature sequence559 <3294 2649 gene locus_tag LOCUS_41130 <3294 2649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence560 415 1023 gene locus_tag LOCUS_41140 415 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 2307 1285 gene locus_tag LOCUS_41150 2307 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 2909 2304 gene locus_tag LOCUS_41160 2909 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 3270 3013 gene locus_tag LOCUS_41170 3270 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41170 >Feature sequence561 1621 623 gene locus_tag LOCUS_41180 1621 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 >Feature sequence562 1007 441 gene locus_tag LOCUS_41190 1007 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 1713 1375 gene locus_tag LOCUS_41200 1713 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41200 2158 2898 gene locus_tag LOCUS_41210 2158 2898 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_41210 >Feature sequence563 75 1811 gene locus_tag LOCUS_41220 75 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 2151 2876 gene locus_tag LOCUS_41230 2151 2876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence564 1418 744 gene locus_tag LOCUS_41240 1418 744 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485328.1 protein_id gnl|my_center|LOCUS_41240 2880 1477 gene locus_tag LOCUS_41250 2880 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence565 221 1351 gene locus_tag LOCUS_41260 gene dprA 221 1351 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266134.1 protein_id gnl|my_center|LOCUS_41260 1348 1602 gene locus_tag LOCUS_41270 1348 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 1755 2486 gene locus_tag LOCUS_41280 gene xerC 1755 2486 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460421.1 protein_id gnl|my_center|LOCUS_41280 >Feature sequence566 608 162 gene locus_tag LOCUS_41290 608 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 677 1849 gene locus_tag LOCUS_41300 677 1849 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943766.1 protein_id gnl|my_center|LOCUS_41300 >Feature sequence567 1177 917 gene locus_tag LOCUS_41310 1177 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 2380 1373 gene locus_tag LOCUS_41320 2380 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 3029 2601 gene locus_tag LOCUS_41330 3029 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 3172 3029 gene locus_tag LOCUS_41340 3172 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 >Feature sequence568 1159 482 gene locus_tag LOCUS_41350 1159 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 <3189 1421 gene locus_tag LOCUS_41360 <3189 1421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393356.1:glycoside hydrolase family 13 protein >Feature sequence569 237 506 gene locus_tag LOCUS_41370 237 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 506 883 gene locus_tag LOCUS_41380 506 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 887 2260 gene locus_tag LOCUS_41390 gene flgK 887 2260 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_41390 2257 3141 gene locus_tag LOCUS_41400 gene flgL 2257 3141 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981404.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence570 2705 1221 gene locus_tag LOCUS_41410 2705 1221 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920205.1 protein_id gnl|my_center|LOCUS_41410 >Feature sequence571 583 2088 gene locus_tag LOCUS_41420 583 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 >Feature sequence572 1073 501 gene locus_tag LOCUS_41430 1073 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 1438 1124 gene locus_tag LOCUS_41440 1438 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 1662 1435 gene locus_tag LOCUS_41450 1662 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 2049 1696 gene locus_tag LOCUS_41460 2049 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 2318 2046 gene locus_tag LOCUS_41470 2318 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2518 2315 gene locus_tag LOCUS_41480 2518 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence573 <1 1192 gene locus_tag LOCUS_41490 <1 1192 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682356.1:elongation factor G 1238 2464 gene locus_tag LOCUS_41500 1238 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 >Feature sequence574 1151 315 gene locus_tag LOCUS_41510 gene kynA 1151 315 CDS product tryptophan 2,3-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531744.1 protein_id gnl|my_center|LOCUS_41510 1286 1882 gene locus_tag LOCUS_41520 1286 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 >Feature sequence575 1014 2495 gene locus_tag LOCUS_41530 1014 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41530 >Feature sequence576 140 1453 gene locus_tag LOCUS_41540 140 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 1447 1947 gene locus_tag LOCUS_41550 1447 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 >Feature sequence577 >Feature sequence578 493 1257 gene locus_tag LOCUS_41560 493 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 1806 2141 gene locus_tag LOCUS_41570 1806 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2376 2519 gene locus_tag LOCUS_41580 2376 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41580 <3055 2544 gene locus_tag LOCUS_41590 <3055 2544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063171654.1:sterol desaturase family protein >Feature sequence579 586 188 gene locus_tag LOCUS_41600 gene rpsI 586 188 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 protein_id gnl|my_center|LOCUS_41600 1039 605 gene locus_tag LOCUS_41610 gene rplM 1039 605 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295975.1 protein_id gnl|my_center|LOCUS_41610 2614 1154 gene locus_tag LOCUS_41620 2614 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 >Feature sequence580 724 224 gene locus_tag LOCUS_41630 724 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 1464 733 gene locus_tag LOCUS_41640 1464 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1940 1461 gene locus_tag LOCUS_41650 1940 1461 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_41650 2497 2111 gene locus_tag LOCUS_41660 2497 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41660 2920 2516 gene locus_tag LOCUS_41670 2920 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 >Feature sequence581 841 1518 gene locus_tag LOCUS_41680 841 1518 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970193.1 protein_id gnl|my_center|LOCUS_41680 2971 1520 gene locus_tag LOCUS_41690 gene pyk 2971 1520 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence582 234 1721 gene locus_tag LOCUS_41700 234 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 1776 2651 gene locus_tag LOCUS_41710 1776 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence583 1348 1818 gene locus_tag LOCUS_41720 1348 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 >Feature sequence584 2202 607 gene locus_tag LOCUS_41730 2202 607 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966434.1 protein_id gnl|my_center|LOCUS_41730 <3032 2169 gene locus_tag LOCUS_41740 <3032 2169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973526.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence585 1252 170 gene locus_tag LOCUS_41750 1252 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 2201 1260 gene locus_tag LOCUS_41760 2201 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 2988 2230 gene locus_tag LOCUS_41770 2988 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 >Feature sequence586 <1 697 gene locus_tag LOCUS_41780 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920241.1:UDP-glucose 4-epimerase GalE 2234 792 gene locus_tag LOCUS_41790 2234 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 2917 2363 gene locus_tag LOCUS_41800 2917 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41800 >Feature sequence587 >Feature sequence588 >Feature sequence589 868 1563 gene locus_tag LOCUS_41810 868 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence590 >Feature sequence591 2696 1002 gene locus_tag LOCUS_41820 2696 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41820 >Feature sequence592 268 2976 gene locus_tag LOCUS_41830 268 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 >Feature sequence593 <1 629 gene locus_tag LOCUS_41840 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338826.1:alpha/beta fold hydrolase 748 1659 gene locus_tag LOCUS_41850 748 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 >Feature sequence594 1535 333 gene locus_tag LOCUS_41860 1535 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence595 1369 536 gene locus_tag LOCUS_41870 1369 536 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142937.1 protein_id gnl|my_center|LOCUS_41870 2371 1385 gene locus_tag LOCUS_41880 2371 1385 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence596 1347 748 gene locus_tag LOCUS_41890 1347 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 2087 1752 gene locus_tag LOCUS_41900 2087 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 2535 2077 gene locus_tag LOCUS_41910 2535 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 2883 2635 gene locus_tag LOCUS_41920 2883 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 >Feature sequence597 1143 1832 gene locus_tag LOCUS_41930 1143 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 1823 2704 gene locus_tag LOCUS_41940 1823 2704 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228713.1 protein_id gnl|my_center|LOCUS_41940 >Feature sequence598 221 559 gene locus_tag LOCUS_41950 221 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 560 796 gene locus_tag LOCUS_41960 560 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 1207 797 gene locus_tag LOCUS_41970 1207 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41970 2101 1307 gene locus_tag LOCUS_41980 2101 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 2758 2150 gene locus_tag LOCUS_41990 2758 2150 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275459.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence599 1534 563 gene locus_tag LOCUS_42000 1534 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 1598 2305 gene locus_tag LOCUS_42010 1598 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence600 1747 2820 gene locus_tag LOCUS_42020 1747 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 >Feature sequence601 1310 537 gene locus_tag LOCUS_42030 1310 537 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966315.1 protein_id gnl|my_center|LOCUS_42030 1415 2158 gene locus_tag LOCUS_42040 1415 2158 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403665.1 protein_id gnl|my_center|LOCUS_42040 2232 2393 gene locus_tag LOCUS_42050 2232 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 2749 2513 gene locus_tag LOCUS_42060 gene rpmB 2749 2513 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_42060 >Feature sequence602 1945 116 gene locus_tag LOCUS_42070 1945 116 CDS product DUF1549 and DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427755.1 protein_id gnl|my_center|LOCUS_42070 <2930 1942 gene locus_tag LOCUS_42080 <2930 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_145033984.1:DUF1501 domain-containing protein >Feature sequence603 2681 681 gene locus_tag LOCUS_42090 2681 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258466.1 protein_id gnl|my_center|LOCUS_42090 >Feature sequence604 <1 679 gene locus_tag LOCUS_42100 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643969.1:excinuclease ABC subunit UvrA 2253 868 gene locus_tag LOCUS_42110 gene lpdA 2253 868 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087546.1 protein_id gnl|my_center|LOCUS_42110 <2920 2293 gene locus_tag LOCUS_42120 <2920 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001062320.1:dihydrolipoamide acetyltransferase family protein >Feature sequence605 1612 851 gene locus_tag LOCUS_42130 1612 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 1991 1578 gene locus_tag LOCUS_42140 1991 1578 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232367.1 protein_id gnl|my_center|LOCUS_42140 2230 1991 gene locus_tag LOCUS_42150 gene moaD 2230 1991 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257741.1 protein_id gnl|my_center|LOCUS_42150 >Feature sequence606 2884 44 gene locus_tag LOCUS_42160 2884 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42160 >Feature sequence607 160 834 gene locus_tag LOCUS_42170 160 834 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_42170 831 2297 gene locus_tag LOCUS_42180 831 2297 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_42180 2725 2300 gene locus_tag LOCUS_42190 2725 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42190 >Feature sequence608 1444 605 gene locus_tag LOCUS_42200 1444 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 1724 2557 gene locus_tag LOCUS_42210 1724 2557 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028054418.1 protein_id gnl|my_center|LOCUS_42210 >Feature sequence609 1585 896 gene locus_tag LOCUS_42220 1585 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42220 2008 2517 gene locus_tag LOCUS_42230 2008 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42230 >Feature sequence610 <2878 1034 gene locus_tag LOCUS_42240 <2878 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125282.1:acetoacetate metabolism transcriptional regulator AtoC >Feature sequence611 451 287 gene locus_tag LOCUS_42250 451 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42250 1799 480 gene locus_tag LOCUS_42260 gene ltrA 1799 480 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145832239.1 protein_id gnl|my_center|LOCUS_42260 1944 1816 gene locus_tag LOCUS_42270 1944 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 2701 2558 gene locus_tag LOCUS_42280 2701 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence612 797 414 gene locus_tag LOCUS_42290 gene rpsL 797 414 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_42290 <2860 908 gene locus_tag LOCUS_42300 <2860 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' >Feature sequence613 1262 1438 gene locus_tag LOCUS_42310 1262 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 1920 1489 gene locus_tag LOCUS_42320 1920 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 <2855 1934 gene locus_tag LOCUS_42330 <2855 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227050.1:diaminopimelate decarboxylase >Feature sequence614 <1 782 gene locus_tag LOCUS_42340 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942870.1:DNA polymerase III subunit delta' 2099 786 gene locus_tag LOCUS_42350 2099 786 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141076.1 protein_id gnl|my_center|LOCUS_42350 >Feature sequence615 446 1414 gene locus_tag LOCUS_42360 gene tsaD 446 1414 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098775.1 protein_id gnl|my_center|LOCUS_42360 1411 2247 gene locus_tag LOCUS_42370 gene rsmA 1411 2247 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_42370 >Feature sequence616 1750 419 gene locus_tag LOCUS_42380 gene secY 1750 419 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_42380 2198 1752 gene locus_tag LOCUS_42390 gene rplO 2198 1752 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421135.1 protein_id gnl|my_center|LOCUS_42390 2407 2216 gene locus_tag LOCUS_42400 gene rpmD 2407 2216 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 protein_id gnl|my_center|LOCUS_42400 >Feature sequence617 <1 2409 gene locus_tag LOCUS_42410 <1 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083904.1:OmpA family protein >Feature sequence618 773 381 gene locus_tag LOCUS_42420 773 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 1163 954 gene locus_tag LOCUS_42430 1163 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42430 >Feature sequence619 1682 579 gene locus_tag LOCUS_42440 1682 579 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_42440 <2802 1767 gene locus_tag LOCUS_42450 <2802 1767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256854.1:serine protein kinase >Feature sequence620 2672 1458 gene locus_tag LOCUS_42460 2672 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 >Feature sequence621 573 220 gene locus_tag LOCUS_42470 573 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 590 2332 gene locus_tag LOCUS_42480 590 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42480 2376 2537 gene locus_tag LOCUS_42490 2376 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 >Feature sequence622 268 1230 gene locus_tag LOCUS_42500 268 1230 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127350626.1 protein_id gnl|my_center|LOCUS_42500 1288 1806 gene locus_tag LOCUS_42510 1288 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 2393 2716 gene locus_tag LOCUS_42520 2393 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence623 251 1039 gene locus_tag LOCUS_42530 251 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 1051 1134 gene locus_tag LOCUS_t00440 1051 1134 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2562 1180 gene locus_tag LOCUS_42540 2562 1180 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_234939668.1 protein_id gnl|my_center|LOCUS_42540 >Feature sequence624 633 1514 gene locus_tag LOCUS_42550 633 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42550 1779 1519 gene locus_tag LOCUS_42560 1779 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42560 2318 1785 gene locus_tag LOCUS_42570 2318 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42570 >Feature sequence625 1089 223 gene locus_tag LOCUS_42580 gene mtnP 1089 223 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_42580 2361 1135 gene locus_tag LOCUS_42590 gene rlmN 2361 1135 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_42590 >Feature sequence626 3 737 gene locus_tag LOCUS_42600 3 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 734 1489 gene locus_tag LOCUS_42610 734 1489 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223594.1 protein_id gnl|my_center|LOCUS_42610 2604 1486 gene locus_tag LOCUS_42620 2604 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence627 1876 296 gene locus_tag LOCUS_42630 1876 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42630 2631 1873 gene locus_tag LOCUS_42640 2631 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 >Feature sequence628 1303 1575 gene locus_tag LOCUS_42650 1303 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 >Feature sequence629 <1 1593 gene locus_tag LOCUS_42660 <1 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975685.1:urocanate hydratase 1722 2315 gene locus_tag LOCUS_42670 1722 2315 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_42670 >Feature sequence630 1 2544 gene locus_tag LOCUS_42680 1 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 >Feature sequence631 2136 514 gene locus_tag LOCUS_42690 2136 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 2685 2476 gene locus_tag LOCUS_42700 2685 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42700 >Feature sequence632 479 1204 gene locus_tag LOCUS_42710 479 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 1201 1377 gene locus_tag LOCUS_42720 1201 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42720 1377 2384 gene locus_tag LOCUS_42730 1377 2384 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_42730 >Feature sequence633 424 2607 gene locus_tag LOCUS_42740 424 2607 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_42740 >Feature sequence634 1174 242 gene locus_tag LOCUS_42750 1174 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 1887 1171 gene locus_tag LOCUS_42760 1887 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 <2670 1889 gene locus_tag LOCUS_42770 <2670 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976585.1:ABC transporter permease subunit >Feature sequence635 106 330 gene locus_tag LOCUS_42780 106 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42780 387 626 gene locus_tag LOCUS_42790 387 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 651 1514 gene locus_tag LOCUS_42800 651 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 2515 1625 gene locus_tag LOCUS_42810 2515 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42810 >Feature sequence636 1594 551 gene locus_tag LOCUS_42820 1594 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 1963 1616 gene locus_tag LOCUS_42830 1963 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42830 >Feature sequence637 122 709 gene locus_tag LOCUS_42840 122 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 1179 1640 gene locus_tag LOCUS_42850 1179 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 >Feature sequence638 <1 816 gene locus_tag LOCUS_42860 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001156916.1:bile acid:sodium symporter family protein 900 2264 gene locus_tag LOCUS_42870 900 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42870 >Feature sequence639 >Feature sequence640 577 1386 gene locus_tag LOCUS_42880 577 1386 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_42880 2532 1549 gene locus_tag LOCUS_42890 2532 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 >Feature sequence641 1673 543 gene locus_tag LOCUS_42900 1673 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 2392 1670 gene locus_tag LOCUS_42910 2392 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 >Feature sequence642 825 2048 gene locus_tag LOCUS_42920 825 2048 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704030.1 protein_id gnl|my_center|LOCUS_42920 >Feature sequence643 278 2539 gene locus_tag LOCUS_42930 278 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence644 <1 1410 gene locus_tag LOCUS_42940 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201786535.1:type IA DNA topoisomerase <2588 1416 gene locus_tag LOCUS_42950 <2588 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116269310.1:tetratricopeptide repeat protein >Feature sequence645 719 1123 gene locus_tag LOCUS_42960 gene flgB 719 1123 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_42960 1127 1549 gene locus_tag LOCUS_42970 gene flgC 1127 1549 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_42970 1552 1863 gene locus_tag LOCUS_42980 gene fliE 1552 1863 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088556.1 protein_id gnl|my_center|LOCUS_42980 >Feature sequence646 <2583 195 gene locus_tag LOCUS_42990 <2583 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486214.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence647 >Feature sequence648 398 1201 gene locus_tag LOCUS_43000 398 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43000 1215 2399 gene locus_tag LOCUS_43010 1215 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 >Feature sequence649 1104 823 gene locus_tag LOCUS_43020 1104 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 1449 2417 gene locus_tag LOCUS_43030 1449 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 >Feature sequence650 1237 2001 gene locus_tag LOCUS_43040 1237 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 >Feature sequence651 >Feature sequence652 619 41 gene locus_tag LOCUS_43050 619 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43050 1194 715 gene locus_tag LOCUS_43060 1194 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43060 2250 1288 gene locus_tag LOCUS_43070 2250 1288 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114796.1 protein_id gnl|my_center|LOCUS_43070 >Feature sequence653 676 1938 gene locus_tag LOCUS_43080 676 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 2354 1935 gene locus_tag LOCUS_43090 2354 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 >Feature sequence654 >Feature sequence655 1115 846 gene locus_tag LOCUS_43100 1115 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 1890 2138 gene locus_tag LOCUS_43110 1890 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence656 <1 942 gene locus_tag LOCUS_43120 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003917171.1:IS21 family transposase 942 1679 gene locus_tag LOCUS_43130 gene istB 942 1679 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122401609.1 protein_id gnl|my_center|LOCUS_43130 >Feature sequence657 707 516 gene locus_tag LOCUS_43140 707 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 691 1095 gene locus_tag LOCUS_43150 691 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 2234 1287 gene locus_tag LOCUS_43160 2234 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 2495 2319 gene locus_tag LOCUS_43170 2495 2319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence658 1453 296 gene locus_tag LOCUS_43180 1453 296 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029790.1 protein_id gnl|my_center|LOCUS_43180 >Feature sequence659 334 903 gene locus_tag LOCUS_43190 334 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 900 2351 gene locus_tag LOCUS_43200 900 2351 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122925.1 protein_id gnl|my_center|LOCUS_43200 >Feature sequence660 >Feature sequence661 797 2038 gene locus_tag LOCUS_43210 797 2038 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_43210 >Feature sequence662 1439 918 gene locus_tag LOCUS_43220 1439 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 2317 1505 gene locus_tag LOCUS_43230 2317 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence663 <1 715 gene locus_tag LOCUS_43240 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458327.1:endonuclease 2216 801 gene locus_tag LOCUS_43250 2216 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43250 >Feature sequence664 573 1421 gene locus_tag LOCUS_43260 gene nadC 573 1421 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_43260 1418 1828 gene locus_tag LOCUS_43270 1418 1828 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256620.1 protein_id gnl|my_center|LOCUS_43270 >Feature sequence665 >Feature sequence666 1337 456 gene locus_tag LOCUS_43280 gene ylqF 1337 456 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706595.1 protein_id gnl|my_center|LOCUS_43280 >Feature sequence667 1299 664 gene locus_tag LOCUS_43290 gene lexA 1299 664 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001208755.1 protein_id gnl|my_center|LOCUS_43290 1329 1484 gene locus_tag LOCUS_43300 1329 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43300 1672 2385 gene locus_tag LOCUS_43310 1672 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 >Feature sequence668 611 1006 gene locus_tag LOCUS_43320 611 1006 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065467.1 protein_id gnl|my_center|LOCUS_43320 1231 1160 gene locus_tag LOCUS_t00450 1231 1160 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1393 2382 gene locus_tag LOCUS_43330 1393 2382 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975685.1 protein_id gnl|my_center|LOCUS_43330 >Feature sequence669 1786 233 gene locus_tag LOCUS_43340 1786 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 <2455 1904 gene locus_tag LOCUS_43350 <2455 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005081992.1:metal-dependent hydrolase >Feature sequence670 <1 873 gene locus_tag LOCUS_43360 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839326.1:aconitate hydratase AcnA 1496 876 gene locus_tag LOCUS_43370 1496 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43370 >Feature sequence671 >Feature sequence672 1809 925 gene locus_tag LOCUS_43380 1809 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 2357 1806 gene locus_tag LOCUS_43390 2357 1806 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230397.1 protein_id gnl|my_center|LOCUS_43390 >Feature sequence673 1302 1009 gene locus_tag LOCUS_43400 1302 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43400 >Feature sequence674 144 842 gene locus_tag LOCUS_43410 144 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 1711 929 gene locus_tag LOCUS_43420 1711 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 >Feature sequence675 1394 855 gene locus_tag LOCUS_43430 1394 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 1432 2307 gene locus_tag LOCUS_43440 1432 2307 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083434.1 protein_id gnl|my_center|LOCUS_43440 >Feature sequence676 1483 779 gene locus_tag LOCUS_43450 1483 779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029631.1 protein_id gnl|my_center|LOCUS_43450 >Feature sequence677 1229 345 gene locus_tag LOCUS_43460 1229 345 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_43460 1407 2276 gene locus_tag LOCUS_43470 1407 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 >Feature sequence678 >Feature sequence679 1861 1130 gene locus_tag LOCUS_43480 1861 1130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000841479.1 protein_id gnl|my_center|LOCUS_43480 >Feature sequence680 268 666 gene locus_tag LOCUS_43490 gene rpsK 268 666 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003948617.1 protein_id gnl|my_center|LOCUS_43490 698 1324 gene locus_tag LOCUS_43500 gene rpsD 698 1324 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892911.1 protein_id gnl|my_center|LOCUS_43500 >Feature sequence681 1584 2123 gene locus_tag LOCUS_43510 1584 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43510 >Feature sequence682 >Feature sequence683 3 362 gene locus_tag LOCUS_43520 3 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 363 2066 gene locus_tag LOCUS_43530 gene gspE 363 2066 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853744.1 protein_id gnl|my_center|LOCUS_43530 >Feature sequence684 1245 1078 gene locus_tag LOCUS_43540 1245 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 >Feature sequence685 2 790 gene locus_tag LOCUS_43550 2 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 1771 794 gene locus_tag LOCUS_43560 gene arsS 1771 794 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_43560 2046 1771 gene locus_tag LOCUS_43570 2046 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 >Feature sequence686 920 711 gene locus_tag LOCUS_43580 920 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 1771 983 gene locus_tag LOCUS_43590 1771 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43590 1871 2113 gene locus_tag LOCUS_43600 1871 2113 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence687 166 90 gene locus_tag LOCUS_t00460 166 90 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 337 927 gene locus_tag LOCUS_43610 337 927 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_43610 1130 1642 gene locus_tag LOCUS_43620 1130 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 1673 1951 gene locus_tag LOCUS_43630 1673 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 >Feature sequence688 968 660 gene locus_tag LOCUS_43640 968 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 1479 1042 gene locus_tag LOCUS_43650 1479 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43650 2128 1559 gene locus_tag LOCUS_43660 2128 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 >Feature sequence689 155 285 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtgtcgacgggcggtgcggtgtc 1554 844 gene locus_tag LOCUS_43670 1554 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 1890 1600 gene locus_tag LOCUS_43680 gene arsC 1890 1600 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072786.1 protein_id gnl|my_center|LOCUS_43680 2273 1992 gene locus_tag LOCUS_43690 2273 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 >Feature sequence690 >Feature sequence691 556 161 gene locus_tag LOCUS_43700 556 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 1600 560 gene locus_tag LOCUS_43710 1600 560 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000995968.1 protein_id gnl|my_center|LOCUS_43710 1701 1955 gene locus_tag LOCUS_43720 1701 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 >Feature sequence692 229 411 gene locus_tag LOCUS_43730 229 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 451 969 gene locus_tag LOCUS_43740 451 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43740 978 1217 gene locus_tag LOCUS_43750 978 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43750 >Feature sequence693 >Feature sequence694 <2211 313 gene locus_tag LOCUS_43760 <2211 313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_096580277.1:DUF4157 domain-containing protein >Feature sequence695 >Feature sequence696 651 878 gene locus_tag LOCUS_43770 651 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43770 >Feature sequence697 1158 109 gene locus_tag LOCUS_43780 1158 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 1848 1204 gene locus_tag LOCUS_43790 1848 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 >Feature sequence698 1890 922 gene locus_tag LOCUS_43800 1890 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 >Feature sequence699 60 479 gene locus_tag LOCUS_43810 60 479 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_43810 698 2068 gene locus_tag LOCUS_43820 698 2068 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_43820 >Feature sequence700 483 980 gene locus_tag LOCUS_43830 483 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 977 2002 gene locus_tag LOCUS_43840 977 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259759.1 protein_id gnl|my_center|LOCUS_43840 >Feature sequence701 458 1375 gene locus_tag LOCUS_43850 458 1375 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135338848.1 protein_id gnl|my_center|LOCUS_43850 >Feature sequence702 >Feature sequence703 2015 741 gene locus_tag LOCUS_43860 2015 741 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_43860 >Feature sequence704 808 359 gene locus_tag LOCUS_43870 808 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 1124 876 gene locus_tag LOCUS_43880 1124 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 1381 1124 gene locus_tag LOCUS_43890 gene rpsP 1381 1124 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_43890 <2142 1457 gene locus_tag LOCUS_43900 <2142 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258223.1:acyl-CoA carboxylase subunit beta >Feature sequence705 <2134 470 gene locus_tag LOCUS_43910 <2134 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257643.1:carbamoyl-phosphate synthase large subunit >Feature sequence706 <1 1611 gene locus_tag LOCUS_43920 <1 1611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein >Feature sequence707 >Feature sequence708 465 1304 gene locus_tag LOCUS_43930 465 1304 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168715428.1 protein_id gnl|my_center|LOCUS_43930 >Feature sequence709 52 1596 gene locus_tag LOCUS_43940 52 1596 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071171.1 protein_id gnl|my_center|LOCUS_43940 1754 1909 gene locus_tag LOCUS_43950 1754 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 >Feature sequence710 >Feature sequence711 <1 1412 gene locus_tag LOCUS_43960 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790264.1:TonB-dependent receptor plug domain-containing protein >Feature sequence712 <1 1349 gene locus_tag LOCUS_43970 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136932681.1:VCBS repeat-containing protein >Feature sequence713 275 445 gene locus_tag LOCUS_43980 275 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 930 442 gene locus_tag LOCUS_43990 930 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 1188 994 gene locus_tag LOCUS_44000 1188 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 2071 1208 gene locus_tag LOCUS_44010 2071 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 >Feature sequence714 <1 1612 gene locus_tag LOCUS_44020 <1 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036149.1:OmpA family protein >Feature sequence715 948 1631 gene locus_tag LOCUS_44030 948 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence716 1457 1906 gene locus_tag LOCUS_44040 1457 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence717 1668 109 gene locus_tag LOCUS_44050 1668 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 >Feature sequence718 1459 641 gene locus_tag LOCUS_44060 1459 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 >Feature sequence719 743 366 gene locus_tag LOCUS_44070 743 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 1627 1268 gene locus_tag LOCUS_44080 1627 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 1783 1634 gene locus_tag LOCUS_44090 1783 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44090 >Feature sequence720 289 678 gene locus_tag LOCUS_44100 289 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 >Feature sequence721 605 531 gene locus_tag LOCUS_t00470 605 531 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1268 651 gene locus_tag LOCUS_44110 gene lipB 1268 651 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_44110 >Feature sequence722 1352 468 gene locus_tag LOCUS_44120 1352 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 <2016 1468 gene locus_tag LOCUS_44130 <2016 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257905.1:hypoxanthine phosphoribosyltransferase >Feature sequence723 >Feature sequence724 1377 478 gene locus_tag LOCUS_44140 1377 478 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207203.1 protein_id gnl|my_center|LOCUS_44140