>Feature sequence001 <1 845 gene locus_tag LOCUS_00010 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964591.1:radical SAM family heme chaperone HemW 932 1627 gene locus_tag LOCUS_00020 932 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1483 1491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2034 1702 gene locus_tag LOCUS_00030 2034 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2292 2633 gene locus_tag LOCUS_00040 2292 2633 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546430.1 protein_id gnl|my_center|LOCUS_00040 3873 2635 gene locus_tag LOCUS_00050 3873 2635 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546821.1 protein_id gnl|my_center|LOCUS_00050 4379 4609 gene locus_tag LOCUS_00060 4379 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4590 4940 gene locus_tag LOCUS_00070 4590 4940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 4953 5687 gene locus_tag LOCUS_00080 4953 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842884.1 protein_id gnl|my_center|LOCUS_00080 5701 5931 gene locus_tag LOCUS_00090 5701 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6318 6482 gene locus_tag LOCUS_00100 6318 6482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 6709 6909 gene locus_tag LOCUS_00110 6709 6909 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_00110 7259 7008 gene locus_tag LOCUS_00120 7259 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 7697 7272 gene locus_tag LOCUS_00130 7697 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 7960 7724 gene locus_tag LOCUS_00140 7960 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 8399 7881 gene locus_tag LOCUS_00150 8399 7881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 8681 8523 gene locus_tag LOCUS_00160 8681 8523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 9157 8807 gene locus_tag LOCUS_00170 9157 8807 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993678.1 protein_id gnl|my_center|LOCUS_00170 9416 9159 gene locus_tag LOCUS_00180 9416 9159 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_00180 9522 10643 gene locus_tag LOCUS_00190 9522 10643 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584144.1 protein_id gnl|my_center|LOCUS_00190 11012 10671 gene locus_tag LOCUS_00200 11012 10671 CDS product DMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104394.1 protein_id gnl|my_center|LOCUS_00200 11104 12348 gene locus_tag LOCUS_00210 gene ilvA 11104 12348 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083156.1 protein_id gnl|my_center|LOCUS_00210 12512 13261 gene locus_tag LOCUS_00220 12512 13261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 13456 16956 gene locus_tag LOCUS_00230 gene smc 13456 16956 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_00230 17321 17542 gene locus_tag LOCUS_00240 gene yidD 17321 17542 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048456.1 protein_id gnl|my_center|LOCUS_00240 17551 19158 gene locus_tag LOCUS_00250 gene yidC 17551 19158 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545913.1 protein_id gnl|my_center|LOCUS_00250 19274 20677 gene locus_tag LOCUS_00260 gene mnmE 19274 20677 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546495.1 protein_id gnl|my_center|LOCUS_00260 21516 20887 gene locus_tag LOCUS_00270 21516 20887 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545229.1 protein_id gnl|my_center|LOCUS_00270 22795 21482 gene locus_tag LOCUS_00280 22795 21482 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546863.1 protein_id gnl|my_center|LOCUS_00280 23077 22799 gene locus_tag LOCUS_00290 23077 22799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 23886 23224 gene locus_tag LOCUS_00300 gene nadD 23886 23224 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_00300 24244 23921 gene locus_tag LOCUS_00310 24244 23921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 24525 24235 gene locus_tag LOCUS_00320 24525 24235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 25020 24649 gene locus_tag LOCUS_00330 25020 24649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 25244 25020 gene locus_tag LOCUS_00340 25244 25020 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_00340 25740 25477 gene locus_tag LOCUS_00350 25740 25477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 25924 26844 gene locus_tag LOCUS_00360 25924 26844 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_00360 26847 27938 gene locus_tag LOCUS_00370 26847 27938 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_00370 27954 29117 gene locus_tag LOCUS_00380 gene lpxB 27954 29117 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545666.1 protein_id gnl|my_center|LOCUS_00380 29114 30874 gene locus_tag LOCUS_00390 29114 30874 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_00390 31053 32219 gene locus_tag LOCUS_00400 31053 32219 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545427.1 protein_id gnl|my_center|LOCUS_00400 32257 32658 gene locus_tag LOCUS_00410 32257 32658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 32706 33017 gene locus_tag LOCUS_00420 32706 33017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 33014 33865 gene locus_tag LOCUS_00430 33014 33865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00430 33880 35241 gene locus_tag LOCUS_00440 33880 35241 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065307.1 protein_id gnl|my_center|LOCUS_00440 35489 37549 gene locus_tag LOCUS_00450 35489 37549 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_00450 37592 38467 gene locus_tag LOCUS_00460 gene dinD 37592 38467 CDS product DNA damage-inducible protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687842.1 protein_id gnl|my_center|LOCUS_00460 38464 41106 gene locus_tag LOCUS_00470 38464 41106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence002 <1 1002 gene locus_tag LOCUS_00480 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948146.1:RnfABCDGE type electron transport complex subunit D 999 1592 gene locus_tag LOCUS_00490 999 1592 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_00490 1570 2208 gene locus_tag LOCUS_00500 1570 2208 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_00500 2231 2824 gene locus_tag LOCUS_00510 gene rsxA 2231 2824 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_00510 2911 4092 gene locus_tag LOCUS_00520 2911 4092 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_00520 4259 4349 gene locus_tag LOCUS_t00010 4259 4349 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4596 4814 gene locus_tag LOCUS_00530 4596 4814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 4820 5656 gene locus_tag LOCUS_00540 4820 5656 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_00540 5665 6252 gene locus_tag LOCUS_00550 5665 6252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 6259 6561 gene locus_tag LOCUS_00560 6259 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 7195 7782 gene locus_tag LOCUS_00570 gene ruvA 7195 7782 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545070.1 protein_id gnl|my_center|LOCUS_00570 7891 8916 gene locus_tag LOCUS_00580 gene ruvB 7891 8916 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546115.1 protein_id gnl|my_center|LOCUS_00580 8921 10006 gene locus_tag LOCUS_00590 gene ychF 8921 10006 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242727.1 protein_id gnl|my_center|LOCUS_00590 11467 10007 gene locus_tag LOCUS_00600 gene guaB 11467 10007 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_00600 12067 11723 gene locus_tag LOCUS_00610 12067 11723 CDS product SWIB/MDM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814592.1 protein_id gnl|my_center|LOCUS_00610 12847 12182 gene locus_tag LOCUS_00620 12847 12182 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_00620 14005 12896 gene locus_tag LOCUS_00630 14005 12896 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545027.1 protein_id gnl|my_center|LOCUS_00630 14220 15920 gene locus_tag LOCUS_00640 14220 15920 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_00640 15994 16881 gene locus_tag LOCUS_00650 gene ispE 15994 16881 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_00650 16908 16980 gene locus_tag LOCUS_t00020 16908 16980 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17084 18025 gene locus_tag LOCUS_00660 17084 18025 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_00660 18062 18751 gene locus_tag LOCUS_00670 18062 18751 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_00670 18752 19303 gene locus_tag LOCUS_00680 gene pth 18752 19303 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545410.1 protein_id gnl|my_center|LOCUS_00680 19369 19596 gene locus_tag LOCUS_00690 19369 19596 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_00690 19593 19958 gene locus_tag LOCUS_00700 19593 19958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 20353 20277 gene locus_tag LOCUS_t00030 20353 20277 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21561 20440 gene locus_tag LOCUS_00710 gene rodA 21561 20440 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_00710 23377 21602 gene locus_tag LOCUS_00720 gene mrdA 23377 21602 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545126.1 protein_id gnl|my_center|LOCUS_00720 23831 23367 gene locus_tag LOCUS_00730 23831 23367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 24610 23828 gene locus_tag LOCUS_00740 gene mreC 24610 23828 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546337.1 protein_id gnl|my_center|LOCUS_00740 25644 24610 gene locus_tag LOCUS_00750 25644 24610 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545439.1 protein_id gnl|my_center|LOCUS_00750 26158 25688 gene locus_tag LOCUS_00760 26158 25688 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545996.1 protein_id gnl|my_center|LOCUS_00760 26178 28031 gene locus_tag LOCUS_00770 26178 28031 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_00770 28890 27985 gene locus_tag LOCUS_00780 gene ftsY 28890 27985 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546073.1 protein_id gnl|my_center|LOCUS_00780 29141 30694 gene locus_tag LOCUS_00790 29141 30694 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546580.1 protein_id gnl|my_center|LOCUS_00790 30844 31185 gene locus_tag LOCUS_00800 30844 31185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 31243 31584 gene locus_tag LOCUS_00810 31243 31584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 31815 31603 gene locus_tag LOCUS_00820 31815 31603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 32372 33424 gene locus_tag LOCUS_00830 32372 33424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 33660 34757 gene locus_tag LOCUS_00840 gene dnaJ 33660 34757 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546226.1 protein_id gnl|my_center|LOCUS_00840 34795 35142 gene locus_tag LOCUS_00850 34795 35142 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545092.1 protein_id gnl|my_center|LOCUS_00850 35228 37903 gene locus_tag LOCUS_00860 gene clpB 35228 37903 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_00860 37925 39019 gene locus_tag LOCUS_00870 37925 39019 CDS product radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546289.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence003 1415 174 gene locus_tag LOCUS_00880 1415 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 1689 2195 gene locus_tag LOCUS_00890 1689 2195 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_00890 2200 2388 gene locus_tag LOCUS_00900 gene rpmF 2200 2388 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_00900 2385 3407 gene locus_tag LOCUS_00910 gene plsX 2385 3407 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_00910 3394 4374 gene locus_tag LOCUS_00920 3394 4374 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_00920 4446 5435 gene locus_tag LOCUS_00930 4446 5435 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545485.1 protein_id gnl|my_center|LOCUS_00930 5445 6182 gene locus_tag LOCUS_00940 gene larB 5445 6182 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_00940 6391 6597 gene locus_tag LOCUS_00950 gene thiS 6391 6597 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546191.1 protein_id gnl|my_center|LOCUS_00950 6820 7590 gene locus_tag LOCUS_00960 6820 7590 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_00960 7609 8310 gene locus_tag LOCUS_00970 gene thiE 7609 8310 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545604.1 protein_id gnl|my_center|LOCUS_00970 8383 9669 gene locus_tag LOCUS_00980 gene thiC 8383 9669 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546777.1 protein_id gnl|my_center|LOCUS_00980 10266 9718 gene locus_tag LOCUS_00990 10266 9718 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546058.1 protein_id gnl|my_center|LOCUS_00990 10379 11305 gene locus_tag LOCUS_01000 10379 11305 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_01000 11292 11798 gene locus_tag LOCUS_01010 gene def 11292 11798 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_01010 11842 12762 gene locus_tag LOCUS_01020 gene fmt 11842 12762 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_01020 12759 13286 gene locus_tag LOCUS_01030 12759 13286 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545747.1 protein_id gnl|my_center|LOCUS_01030 13434 14660 gene locus_tag LOCUS_01040 gene dsrA 13434 14660 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545539.1 protein_id gnl|my_center|LOCUS_01040 14691 15761 gene locus_tag LOCUS_01050 gene dsrB 14691 15761 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546493.1 protein_id gnl|my_center|LOCUS_01050 15839 16087 gene locus_tag LOCUS_01060 15839 16087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 17264 16251 gene locus_tag LOCUS_01070 gene pheS 17264 16251 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546774.1 protein_id gnl|my_center|LOCUS_01070 17689 17330 gene locus_tag LOCUS_01080 gene rplT 17689 17330 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545766.1 protein_id gnl|my_center|LOCUS_01080 17995 17798 gene locus_tag LOCUS_01090 gene rpmI 17995 17798 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942164.1 protein_id gnl|my_center|LOCUS_01090 18494 18069 gene locus_tag LOCUS_01100 gene infC 18494 18069 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446215.1 protein_id gnl|my_center|LOCUS_01100 20301 18625 gene locus_tag LOCUS_01110 gene thrS 20301 18625 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_01110 20750 20565 gene locus_tag LOCUS_01120 20750 20565 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_01120 21230 20922 gene locus_tag LOCUS_01130 21230 20922 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971035.1 protein_id gnl|my_center|LOCUS_01130 21403 21215 gene locus_tag LOCUS_01140 21403 21215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 23427 22255 gene locus_tag LOCUS_01150 gene nrfD 23427 22255 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_01150 24300 23464 gene locus_tag LOCUS_01160 24300 23464 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459005.1 protein_id gnl|my_center|LOCUS_01160 24713 24297 gene locus_tag LOCUS_01170 gene dsrJ 24713 24297 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546711.1 protein_id gnl|my_center|LOCUS_01170 26329 24713 gene locus_tag LOCUS_01180 26329 24713 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459004.1 protein_id gnl|my_center|LOCUS_01180 27322 26333 gene locus_tag LOCUS_01190 gene dsrM 27322 26333 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_01190 27903 27319 gene locus_tag LOCUS_01200 27903 27319 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810499.1 protein_id gnl|my_center|LOCUS_01200 28372 28037 gene locus_tag LOCUS_01210 28372 28037 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_01210 29114 28632 gene locus_tag LOCUS_01220 29114 28632 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941845.1 protein_id gnl|my_center|LOCUS_01220 29327 29845 gene locus_tag LOCUS_01230 29327 29845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 29842 31881 gene locus_tag LOCUS_01240 29842 31881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545337.1 protein_id gnl|my_center|LOCUS_01240 31901 33247 gene locus_tag LOCUS_01250 31901 33247 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_01250 34665 33244 gene locus_tag LOCUS_01260 gene pyk 34665 33244 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546708.1 protein_id gnl|my_center|LOCUS_01260 35079 34849 gene locus_tag LOCUS_01270 35079 34849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 35369 35064 gene locus_tag LOCUS_01280 35369 35064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_01280 35976 35575 gene locus_tag LOCUS_01290 35976 35575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 36194 35973 gene locus_tag LOCUS_01300 36194 35973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 38084 36492 gene locus_tag LOCUS_01310 gene nadB 38084 36492 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence004 148 585 gene locus_tag LOCUS_01320 gene rplM 148 585 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544931.1 protein_id gnl|my_center|LOCUS_01320 586 978 gene locus_tag LOCUS_01330 gene rpsI 586 978 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_01330 1087 2127 gene locus_tag LOCUS_01340 gene argC 1087 2127 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_01340 2251 2475 gene locus_tag LOCUS_01350 2251 2475 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_01350 2510 2668 gene locus_tag LOCUS_01360 2510 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2784 3788 gene locus_tag LOCUS_01370 2784 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 4218 4018 gene locus_tag LOCUS_01380 4218 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 4460 4215 gene locus_tag LOCUS_01390 4460 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4761 4450 gene locus_tag LOCUS_01400 4761 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5216 4875 gene locus_tag LOCUS_01410 5216 4875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 5886 5488 gene locus_tag LOCUS_01420 5886 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 6101 5883 gene locus_tag LOCUS_01430 6101 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 7038 6196 gene locus_tag LOCUS_01440 gene nadC 7038 6196 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545113.1 protein_id gnl|my_center|LOCUS_01440 7527 7042 gene locus_tag LOCUS_01450 7527 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546000.1 protein_id gnl|my_center|LOCUS_01450 10264 7544 gene locus_tag LOCUS_01460 10264 7544 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_01460 11315 10266 gene locus_tag LOCUS_01470 11315 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 11608 12072 gene locus_tag LOCUS_01480 gene nuoE 11608 12072 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_01480 12069 13841 gene locus_tag LOCUS_01490 gene nuoF 12069 13841 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941011.1 protein_id gnl|my_center|LOCUS_01490 13849 16701 gene locus_tag LOCUS_01500 gene fdhF 13849 16701 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:15058..15060,aa:Sec) note codon on position 404 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01500 16793 17248 gene locus_tag LOCUS_01510 16793 17248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 17354 19117 gene locus_tag LOCUS_01520 17354 19117 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546634.1 protein_id gnl|my_center|LOCUS_01520 19415 19591 gene locus_tag LOCUS_01530 19415 19591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 19578 19853 gene locus_tag LOCUS_01540 19578 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 20508 20026 gene locus_tag LOCUS_01550 20508 20026 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198805.1 protein_id gnl|my_center|LOCUS_01550 21859 20567 gene locus_tag LOCUS_01560 21859 20567 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_01560 21953 22921 gene locus_tag LOCUS_01570 21953 22921 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545634.1 protein_id gnl|my_center|LOCUS_01570 24172 22928 gene locus_tag LOCUS_01580 gene fabF 24172 22928 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_01580 24402 24172 gene locus_tag LOCUS_01590 gene acpP 24402 24172 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545237.1 protein_id gnl|my_center|LOCUS_01590 25255 24515 gene locus_tag LOCUS_01600 gene fabG 25255 24515 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546317.1 protein_id gnl|my_center|LOCUS_01600 25478 26371 gene locus_tag LOCUS_01610 gene galU 25478 26371 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546586.1 protein_id gnl|my_center|LOCUS_01610 26374 28746 gene locus_tag LOCUS_01620 gene lon 26374 28746 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_01620 28803 29864 gene locus_tag LOCUS_01630 gene thiL 28803 29864 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546377.1 protein_id gnl|my_center|LOCUS_01630 29848 30285 gene locus_tag LOCUS_01640 29848 30285 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583738.1 protein_id gnl|my_center|LOCUS_01640 30275 31888 gene locus_tag LOCUS_01650 gene rimO 30275 31888 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546475.1 protein_id gnl|my_center|LOCUS_01650 31885 32727 gene locus_tag LOCUS_01660 31885 32727 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_01660 32858 33301 gene locus_tag LOCUS_01670 gene rplI 32858 33301 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_01670 33301 34671 gene locus_tag LOCUS_01680 gene dnaB 33301 34671 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_01680 34674 35513 gene locus_tag LOCUS_01690 gene amrB 34674 35513 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_01690 36682 35525 gene locus_tag LOCUS_01700 36682 35525 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926104.1 protein_id gnl|my_center|LOCUS_01700 36909 36833 gene locus_tag LOCUS_t00040 36909 36833 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 37131 37056 gene locus_tag LOCUS_t00050 37131 37056 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 616 113 gene locus_tag LOCUS_01710 616 113 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545294.1 protein_id gnl|my_center|LOCUS_01710 1836 625 gene locus_tag LOCUS_01720 gene tyrS 1836 625 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546544.1 protein_id gnl|my_center|LOCUS_01720 1938 2519 gene locus_tag LOCUS_01730 1938 2519 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022274.1 protein_id gnl|my_center|LOCUS_01730 2554 3957 gene locus_tag LOCUS_01740 gene purF 2554 3957 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_01740 8218 3959 gene locus_tag LOCUS_01750 gene purL 8218 3959 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544968.1 protein_id gnl|my_center|LOCUS_01750 9012 9482 gene locus_tag LOCUS_01760 9012 9482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 12146 9486 gene locus_tag LOCUS_01770 12146 9486 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681132.1 protein_id gnl|my_center|LOCUS_01770 12574 12302 gene locus_tag LOCUS_01780 12574 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 12921 12682 gene locus_tag LOCUS_01790 12921 12682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 14302 13010 gene locus_tag LOCUS_01800 gene purB 14302 13010 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545083.1 protein_id gnl|my_center|LOCUS_01800 14848 14426 gene locus_tag LOCUS_01810 gene nusB 14848 14426 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_01810 15472 15011 gene locus_tag LOCUS_01820 gene ribE 15472 15011 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_01820 15624 16322 gene locus_tag LOCUS_01830 15624 16322 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039648148.1 protein_id gnl|my_center|LOCUS_01830 19814 16485 gene locus_tag LOCUS_01840 19814 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 20915 19956 gene locus_tag LOCUS_01850 20915 19956 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_01850 22279 21065 gene locus_tag LOCUS_01860 22279 21065 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933267.1 protein_id gnl|my_center|LOCUS_01860 22556 23251 gene locus_tag LOCUS_01870 22556 23251 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_01870 23322 24968 gene locus_tag LOCUS_01880 gene recN 23322 24968 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546310.1 protein_id gnl|my_center|LOCUS_01880 24965 25195 gene locus_tag LOCUS_01890 24965 25195 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545602.1 protein_id gnl|my_center|LOCUS_01890 25308 25595 gene locus_tag LOCUS_01900 25308 25595 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_01900 25714 26121 gene locus_tag LOCUS_01910 25714 26121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 26125 26535 gene locus_tag LOCUS_01920 gene ssb 26125 26535 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_01920 26855 27136 gene locus_tag LOCUS_01930 26855 27136 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013194.1 protein_id gnl|my_center|LOCUS_01930 27133 27417 gene locus_tag LOCUS_01940 27133 27417 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546416.1 protein_id gnl|my_center|LOCUS_01940 27484 28920 gene locus_tag LOCUS_01950 27484 28920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 28922 29221 gene locus_tag LOCUS_01960 28922 29221 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545366.1 protein_id gnl|my_center|LOCUS_01960 29853 29242 gene locus_tag LOCUS_01970 29853 29242 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461972.1 protein_id gnl|my_center|LOCUS_01970 32774 29928 gene locus_tag LOCUS_01980 32774 29928 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461973.1 protein_id gnl|my_center|LOCUS_01980 33196 32786 gene locus_tag LOCUS_01990 33196 32786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 33238 33299 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <34327 33691 gene locus_tag LOCUS_02000 <34327 33691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:sigma-54 dependent transcriptional regulator >Feature sequence006 129 581 gene locus_tag LOCUS_02010 129 581 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927167.1 protein_id gnl|my_center|LOCUS_02010 631 3348 gene locus_tag LOCUS_02020 631 3348 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_02020 3333 4250 gene locus_tag LOCUS_02030 3333 4250 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_02030 4452 4255 gene locus_tag LOCUS_02040 4452 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 5619 4666 gene locus_tag LOCUS_02050 5619 4666 CDS product CfrBI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546529.1 protein_id gnl|my_center|LOCUS_02050 7026 5623 gene locus_tag LOCUS_02060 7026 5623 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_02060 7481 7266 gene locus_tag LOCUS_02070 7481 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 7798 7481 gene locus_tag LOCUS_02080 7798 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8488 7841 gene locus_tag LOCUS_02090 8488 7841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 9450 8695 gene locus_tag LOCUS_02100 9450 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9523 10626 gene locus_tag LOCUS_02110 gene tsaD 9523 10626 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_02110 11409 10645 gene locus_tag LOCUS_02120 gene lgt 11409 10645 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_02120 11888 11433 gene locus_tag LOCUS_02130 gene lspA 11888 11433 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546319.1 protein_id gnl|my_center|LOCUS_02130 14788 11885 gene locus_tag LOCUS_02140 gene ileS 14788 11885 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546193.1 protein_id gnl|my_center|LOCUS_02140 16934 14811 gene locus_tag LOCUS_02150 gene fusA 16934 14811 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_02150 17453 17028 gene locus_tag LOCUS_02160 17453 17028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18089 17547 gene locus_tag LOCUS_02170 18089 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 18427 18059 gene locus_tag LOCUS_02180 18427 18059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 18580 19164 gene locus_tag LOCUS_02190 18580 19164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 19363 21498 gene locus_tag LOCUS_02200 19363 21498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 21953 21519 gene locus_tag LOCUS_02210 21953 21519 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941718.1 protein_id gnl|my_center|LOCUS_02210 23551 21974 gene locus_tag LOCUS_02220 gene cimA 23551 21974 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546272.1 protein_id gnl|my_center|LOCUS_02220 24900 23641 gene locus_tag LOCUS_02230 gene ahcY 24900 23641 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_02230 26092 24941 gene locus_tag LOCUS_02240 gene metK 26092 24941 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_02240 26196 27098 gene locus_tag LOCUS_02250 26196 27098 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937854.1 protein_id gnl|my_center|LOCUS_02250 27317 27350 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 27436 28329 gene locus_tag LOCUS_02260 27436 28329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 28310 29071 gene locus_tag LOCUS_02270 28310 29071 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142277.1 protein_id gnl|my_center|LOCUS_02270 29104 29853 gene locus_tag LOCUS_02280 29104 29853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815204.1 protein_id gnl|my_center|LOCUS_02280 30199 29879 gene locus_tag LOCUS_02290 30199 29879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 30383 30192 gene locus_tag LOCUS_02300 30383 30192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 30658 30942 gene locus_tag LOCUS_02310 30658 30942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 30929 31198 gene locus_tag LOCUS_02320 30929 31198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 >Feature sequence007 1967 570 gene locus_tag LOCUS_02330 1967 570 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545326.1 protein_id gnl|my_center|LOCUS_02330 2328 1957 gene locus_tag LOCUS_02340 gene queD 2328 1957 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_02340 2944 2411 gene locus_tag LOCUS_02350 gene hpt 2944 2411 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546262.1 protein_id gnl|my_center|LOCUS_02350 3976 2960 gene locus_tag LOCUS_02360 3976 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 4094 4651 gene locus_tag LOCUS_02370 4094 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5471 4665 gene locus_tag LOCUS_02380 5471 4665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867268.1 protein_id gnl|my_center|LOCUS_02380 6489 5455 gene locus_tag LOCUS_02390 6489 5455 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_02390 7791 6577 gene locus_tag LOCUS_02400 7791 6577 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545891.1 protein_id gnl|my_center|LOCUS_02400 7930 9177 gene locus_tag LOCUS_02410 gene glgC 7930 9177 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329623.1 protein_id gnl|my_center|LOCUS_02410 9174 10322 gene locus_tag LOCUS_02420 9174 10322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 10405 10773 gene locus_tag LOCUS_02430 10405 10773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942863.1 protein_id gnl|my_center|LOCUS_02430 10770 12761 gene locus_tag LOCUS_02440 10770 12761 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942862.1 protein_id gnl|my_center|LOCUS_02440 12780 13610 gene locus_tag LOCUS_02450 12780 13610 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_02450 13591 14385 gene locus_tag LOCUS_02460 13591 14385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 14612 17461 gene locus_tag LOCUS_02470 14612 17461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 17458 17667 gene locus_tag LOCUS_02480 17458 17667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 17664 19721 gene locus_tag LOCUS_02490 17664 19721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 19785 20255 gene locus_tag LOCUS_02500 19785 20255 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_02500 20282 22261 gene locus_tag LOCUS_02510 20282 22261 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942856.1 protein_id gnl|my_center|LOCUS_02510 22254 23159 gene locus_tag LOCUS_02520 22254 23159 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_02520 23162 24250 gene locus_tag LOCUS_02530 23162 24250 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942854.1 protein_id gnl|my_center|LOCUS_02530 24250 25074 gene locus_tag LOCUS_02540 24250 25074 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942853.1 protein_id gnl|my_center|LOCUS_02540 25083 25451 gene locus_tag LOCUS_02550 25083 25451 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942852.1 protein_id gnl|my_center|LOCUS_02550 25672 26022 gene locus_tag LOCUS_02560 25672 26022 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461083.1 protein_id gnl|my_center|LOCUS_02560 26019 26303 gene locus_tag LOCUS_02570 26019 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 26342 27409 gene locus_tag LOCUS_02580 26342 27409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 27668 28300 gene locus_tag LOCUS_02590 27668 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 28297 28527 gene locus_tag LOCUS_02600 28297 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 28646 28559 gene locus_tag LOCUS_t00060 28646 28559 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29456 28743 gene locus_tag LOCUS_02610 29456 28743 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545462.1 protein_id gnl|my_center|LOCUS_02610 29965 29453 gene locus_tag LOCUS_02620 29965 29453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 30033 30269 gene locus_tag LOCUS_02630 30033 30269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 31149 30295 gene locus_tag LOCUS_02640 31149 30295 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545230.1 protein_id gnl|my_center|LOCUS_02640 >Feature sequence008 137 334 gene locus_tag LOCUS_02650 137 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 504 830 gene locus_tag LOCUS_02660 504 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 949 2298 gene locus_tag LOCUS_02670 949 2298 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_02670 2340 3059 gene locus_tag LOCUS_02680 2340 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 3066 4046 gene locus_tag LOCUS_02690 3066 4046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618802.1 protein_id gnl|my_center|LOCUS_02690 4034 5044 gene locus_tag LOCUS_02700 4034 5044 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_02700 6374 5112 gene locus_tag LOCUS_02710 6374 5112 CDS product BPL-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294597.1 protein_id gnl|my_center|LOCUS_02710 8442 6469 gene locus_tag LOCUS_02720 gene cobJ 8442 6469 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_02720 9181 8426 gene locus_tag LOCUS_02730 gene cobM 9181 8426 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_02730 9909 9181 gene locus_tag LOCUS_02740 gene cobI 9909 9181 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914028.1 protein_id gnl|my_center|LOCUS_02740 10010 11956 gene locus_tag LOCUS_02750 10010 11956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 11953 13284 gene locus_tag LOCUS_02760 11953 13284 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_02760 13789 13421 gene locus_tag LOCUS_02770 13789 13421 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 protein_id gnl|my_center|LOCUS_02770 14850 13825 gene locus_tag LOCUS_02780 14850 13825 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_02780 15809 14841 gene locus_tag LOCUS_02790 15809 14841 CDS product HindVP family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038499775.1 protein_id gnl|my_center|LOCUS_02790 16395 16685 gene locus_tag LOCUS_02800 16395 16685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 16703 17731 gene locus_tag LOCUS_02810 16703 17731 CDS product MtaA/CmuA family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020204.1 protein_id gnl|my_center|LOCUS_02810 17780 18295 gene locus_tag LOCUS_02820 17780 18295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 18417 19364 gene locus_tag LOCUS_02830 gene mtrH 18417 19364 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876780.1 protein_id gnl|my_center|LOCUS_02830 19469 20497 gene locus_tag LOCUS_02840 gene mtaA 19469 20497 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023521.1 protein_id gnl|my_center|LOCUS_02840 20502 21197 gene locus_tag LOCUS_02850 20502 21197 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949054.1 protein_id gnl|my_center|LOCUS_02850 21187 21846 gene locus_tag LOCUS_02860 21187 21846 CDS product 4Fe-4S double cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860330.1 protein_id gnl|my_center|LOCUS_02860 21880 23889 gene locus_tag LOCUS_02870 21880 23889 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531166.1 protein_id gnl|my_center|LOCUS_02870 23886 24209 gene locus_tag LOCUS_02880 23886 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809368.1 protein_id gnl|my_center|LOCUS_02880 24222 24917 gene locus_tag LOCUS_02890 24222 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 24907 26115 gene locus_tag LOCUS_02900 24907 26115 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020733.1 protein_id gnl|my_center|LOCUS_02900 26117 27376 gene locus_tag LOCUS_02910 26117 27376 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_02910 27352 28506 gene locus_tag LOCUS_02920 gene comE 27352 28506 CDS product sulfopyruvate decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023231.1 protein_id gnl|my_center|LOCUS_02920 29048 28503 gene locus_tag LOCUS_02930 29048 28503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence009 1544 2728 gene locus_tag LOCUS_02940 gene nifS 1544 2728 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_02940 4160 2685 gene locus_tag LOCUS_02950 4160 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 4915 4157 gene locus_tag LOCUS_02960 4915 4157 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388166.1 protein_id gnl|my_center|LOCUS_02960 5756 4950 gene locus_tag LOCUS_02970 5756 4950 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_02970 6951 5749 gene locus_tag LOCUS_02980 gene alr 6951 5749 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_02980 7225 7010 gene locus_tag LOCUS_02990 7225 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 7968 7213 gene locus_tag LOCUS_03000 7968 7213 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_03000 8658 10223 gene locus_tag LOCUS_03010 gene rny 8658 10223 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546866.1 protein_id gnl|my_center|LOCUS_03010 10303 11085 gene locus_tag LOCUS_03020 10303 11085 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545500.1 protein_id gnl|my_center|LOCUS_03020 11292 11065 gene locus_tag LOCUS_03030 11292 11065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 11542 11336 gene locus_tag LOCUS_03040 11542 11336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 11835 11530 gene locus_tag LOCUS_03050 11835 11530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 13147 11912 gene locus_tag LOCUS_03060 13147 11912 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_03060 13633 13205 gene locus_tag LOCUS_03070 13633 13205 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_03070 15157 13646 gene locus_tag LOCUS_03080 15157 13646 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_03080 16673 15174 gene locus_tag LOCUS_03090 16673 15174 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_03090 18743 16686 gene locus_tag LOCUS_03100 gene nuoL 18743 16686 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_03100 19057 18746 gene locus_tag LOCUS_03110 gene nuoK 19057 18746 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_03110 19586 19059 gene locus_tag LOCUS_03120 19586 19059 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932454.1 protein_id gnl|my_center|LOCUS_03120 20088 19576 gene locus_tag LOCUS_03130 20088 19576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 21191 20088 gene locus_tag LOCUS_03140 gene nuoH 21191 20088 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_03140 22319 21195 gene locus_tag LOCUS_03150 gene nuoD 22319 21195 CDS product NADH-quinone oxidoreductase subunit NuoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621434.1 protein_id gnl|my_center|LOCUS_03150 22834 22343 gene locus_tag LOCUS_03160 22834 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 23342 22839 gene locus_tag LOCUS_03170 23342 22839 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215610.1 protein_id gnl|my_center|LOCUS_03170 23796 23335 gene locus_tag LOCUS_03180 gene ndhC 23796 23335 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_03180 24892 23996 gene locus_tag LOCUS_03190 gene fabD 24892 23996 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546099.1 protein_id gnl|my_center|LOCUS_03190 26178 24985 gene locus_tag LOCUS_03200 26178 24985 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_03200 26951 26169 gene locus_tag LOCUS_03210 26951 26169 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_03210 27169 27375 gene locus_tag LOCUS_03220 27169 27375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 27362 27688 gene locus_tag LOCUS_03230 27362 27688 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140130.1 protein_id gnl|my_center|LOCUS_03230 >Feature sequence010 1398 430 gene locus_tag LOCUS_03240 1398 430 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_03240 2219 1401 gene locus_tag LOCUS_03250 gene kdsA 2219 1401 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_03250 3917 2229 gene locus_tag LOCUS_03260 3917 2229 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_03260 4558 3896 gene locus_tag LOCUS_03270 gene kdsB 4558 3896 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_03270 4758 6710 gene locus_tag LOCUS_03280 4758 6710 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545897.1 protein_id gnl|my_center|LOCUS_03280 7346 6714 gene locus_tag LOCUS_03290 7346 6714 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262533.1 protein_id gnl|my_center|LOCUS_03290 8559 7351 gene locus_tag LOCUS_03300 8559 7351 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964994.1 protein_id gnl|my_center|LOCUS_03300 9587 8556 gene locus_tag LOCUS_03310 9587 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 10219 9692 gene locus_tag LOCUS_03320 10219 9692 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203468.1 protein_id gnl|my_center|LOCUS_03320 10367 10582 gene locus_tag LOCUS_03330 10367 10582 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074342.1 protein_id gnl|my_center|LOCUS_03330 10588 11391 gene locus_tag LOCUS_03340 10588 11391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 13271 11388 gene locus_tag LOCUS_03350 13271 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 13647 13393 gene locus_tag LOCUS_03360 13647 13393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 13726 16278 gene locus_tag LOCUS_03370 13726 16278 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545608.1 protein_id gnl|my_center|LOCUS_03370 16251 17786 gene locus_tag LOCUS_03380 16251 17786 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028844369.1 protein_id gnl|my_center|LOCUS_03380 17878 18741 gene locus_tag LOCUS_03390 gene larE 17878 18741 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_03390 18738 19922 gene locus_tag LOCUS_03400 18738 19922 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545281.1 protein_id gnl|my_center|LOCUS_03400 19984 20631 gene locus_tag LOCUS_03410 gene fsa 19984 20631 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_03410 20711 20926 gene locus_tag LOCUS_03420 20711 20926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 21489 21067 gene locus_tag LOCUS_03430 21489 21067 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546448.1 protein_id gnl|my_center|LOCUS_03430 21944 21507 gene locus_tag LOCUS_03440 21944 21507 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941300.1 protein_id gnl|my_center|LOCUS_03440 22148 21960 gene locus_tag LOCUS_03450 gene rpmB 22148 21960 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546135.1 protein_id gnl|my_center|LOCUS_03450 22282 24753 gene locus_tag LOCUS_03460 gene infB 22282 24753 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546130.1 protein_id gnl|my_center|LOCUS_03460 24835 25182 gene locus_tag LOCUS_03470 gene rbfA 24835 25182 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_03470 25210 26172 gene locus_tag LOCUS_03480 25210 26172 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546380.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence011 478 1200 gene locus_tag LOCUS_03490 478 1200 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941976.1 protein_id gnl|my_center|LOCUS_03490 1820 1197 gene locus_tag LOCUS_03500 1820 1197 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544944.1 protein_id gnl|my_center|LOCUS_03500 3294 1960 gene locus_tag LOCUS_03510 gene hisD 3294 1960 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546313.1 protein_id gnl|my_center|LOCUS_03510 3461 4741 gene locus_tag LOCUS_03520 3461 4741 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545054.1 protein_id gnl|my_center|LOCUS_03520 4805 5620 gene locus_tag LOCUS_03530 gene truA 4805 5620 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544911.1 protein_id gnl|my_center|LOCUS_03530 6060 5710 gene locus_tag LOCUS_03540 6060 5710 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924922.1 protein_id gnl|my_center|LOCUS_03540 6334 6173 gene locus_tag LOCUS_03550 6334 6173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 6989 6432 gene locus_tag LOCUS_03560 gene frr 6989 6432 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_03560 7704 6958 gene locus_tag LOCUS_03570 gene pyrH 7704 6958 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_03570 8332 7730 gene locus_tag LOCUS_03580 gene tsf 8332 7730 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545220.1 protein_id gnl|my_center|LOCUS_03580 9105 8329 gene locus_tag LOCUS_03590 gene rpsB 9105 8329 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546300.1 protein_id gnl|my_center|LOCUS_03590 10373 9294 gene locus_tag LOCUS_03600 10373 9294 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545175.1 protein_id gnl|my_center|LOCUS_03600 11455 10376 gene locus_tag LOCUS_03610 11455 10376 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546094.1 protein_id gnl|my_center|LOCUS_03610 11580 12143 gene locus_tag LOCUS_03620 gene folE 11580 12143 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545785.1 protein_id gnl|my_center|LOCUS_03620 12153 13019 gene locus_tag LOCUS_03630 gene folD 12153 13019 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545120.1 protein_id gnl|my_center|LOCUS_03630 13080 13400 gene locus_tag LOCUS_03640 13080 13400 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008664575.1 protein_id gnl|my_center|LOCUS_03640 13664 13882 gene locus_tag LOCUS_03650 13664 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 14502 14863 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccctgcgcgaggggcgac 14610 14628 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15337 15047 gene locus_tag LOCUS_03660 gene cas2 15337 15047 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_03660 16531 15500 gene locus_tag LOCUS_03670 gene cas1c 16531 15500 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_03670 17574 16528 gene locus_tag LOCUS_03680 17574 16528 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_03680 18245 17589 gene locus_tag LOCUS_03690 gene cas4 18245 17589 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932803.1 protein_id gnl|my_center|LOCUS_03690 18825 18253 gene locus_tag LOCUS_03700 18825 18253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 21065 18858 gene locus_tag LOCUS_03710 21065 18858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 22049 21072 gene locus_tag LOCUS_03720 gene cas7c 22049 21072 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263666.1 protein_id gnl|my_center|LOCUS_03720 24250 22052 gene locus_tag LOCUS_03730 24250 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 24887 24240 gene locus_tag LOCUS_03740 24887 24240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence012 5675 6316 gene locus_tag LOCUS_03750 5675 6316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 6379 7224 gene locus_tag LOCUS_03760 6379 7224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7355 8032 gene locus_tag LOCUS_03770 7355 8032 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_03770 8223 10079 gene locus_tag LOCUS_03780 8223 10079 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590871.1 protein_id gnl|my_center|LOCUS_03780 10940 10518 gene locus_tag LOCUS_03790 10940 10518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11184 10933 gene locus_tag LOCUS_03800 11184 10933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 11439 11720 gene locus_tag LOCUS_03810 11439 11720 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_03810 12180 11998 gene locus_tag LOCUS_03820 12180 11998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129052038.1 protein_id gnl|my_center|LOCUS_03820 13210 12323 gene locus_tag LOCUS_03830 13210 12323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 13163 13678 gene locus_tag LOCUS_03840 13163 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 13971 14171 gene locus_tag LOCUS_03850 13971 14171 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940882.1 protein_id gnl|my_center|LOCUS_03850 14231 14638 gene locus_tag LOCUS_03860 14231 14638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 16216 14684 gene locus_tag LOCUS_03870 16216 14684 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_03870 17522 16272 gene locus_tag LOCUS_03880 gene clpX 17522 16272 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_03880 18192 17587 gene locus_tag LOCUS_03890 gene clpP 18192 17587 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545892.1 protein_id gnl|my_center|LOCUS_03890 19444 18194 gene locus_tag LOCUS_03900 gene tig 19444 18194 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545152.1 protein_id gnl|my_center|LOCUS_03900 19596 19814 gene locus_tag LOCUS_03910 19596 19814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 20620 19979 gene locus_tag LOCUS_03920 20620 19979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 21007 20717 gene locus_tag LOCUS_03930 21007 20717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 21306 21031 gene locus_tag LOCUS_03940 21306 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 21461 24103 gene locus_tag LOCUS_03950 gene polA 21461 24103 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence013 138 602 gene locus_tag LOCUS_03960 138 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 612 1151 gene locus_tag LOCUS_03970 612 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 1148 1567 gene locus_tag LOCUS_03980 1148 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1712 2014 gene locus_tag LOCUS_03990 1712 2014 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_03990 2011 2280 gene locus_tag LOCUS_04000 2011 2280 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_04000 3406 2342 gene locus_tag LOCUS_04010 gene prfA 3406 2342 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_04010 4286 3396 gene locus_tag LOCUS_04020 4286 3396 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546693.1 protein_id gnl|my_center|LOCUS_04020 4793 4584 gene locus_tag LOCUS_04030 gene rpmE 4793 4584 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545159.1 protein_id gnl|my_center|LOCUS_04030 5277 4984 gene locus_tag LOCUS_04040 5277 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 6635 5274 gene locus_tag LOCUS_04050 gene accC 6635 5274 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_04050 7152 6721 gene locus_tag LOCUS_04060 gene accB 7152 6721 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545496.1 protein_id gnl|my_center|LOCUS_04060 7725 7162 gene locus_tag LOCUS_04070 gene efp 7725 7162 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545338.1 protein_id gnl|my_center|LOCUS_04070 8876 7803 gene locus_tag LOCUS_04080 8876 7803 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546421.1 protein_id gnl|my_center|LOCUS_04080 9383 8955 gene locus_tag LOCUS_04090 gene aroQ 9383 8955 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942665.1 protein_id gnl|my_center|LOCUS_04090 9975 9541 gene locus_tag LOCUS_04100 9975 9541 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545112.1 protein_id gnl|my_center|LOCUS_04100 10632 10195 gene locus_tag LOCUS_04110 gene rplQ 10632 10195 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545032.1 protein_id gnl|my_center|LOCUS_04110 11656 10622 gene locus_tag LOCUS_04120 11656 10622 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546042.1 protein_id gnl|my_center|LOCUS_04120 12319 11693 gene locus_tag LOCUS_04130 gene rpsD 12319 11693 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_04130 12708 12322 gene locus_tag LOCUS_04140 gene rpsK 12708 12322 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_04140 13086 12712 gene locus_tag LOCUS_04150 gene rpsM 13086 12712 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544955.1 protein_id gnl|my_center|LOCUS_04150 13540 13322 gene locus_tag LOCUS_04160 gene infA 13540 13322 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546095.1 protein_id gnl|my_center|LOCUS_04160 14312 13566 gene locus_tag LOCUS_04170 gene map 14312 13566 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_04170 15630 14320 gene locus_tag LOCUS_04180 gene secY 15630 14320 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_04180 16138 15698 gene locus_tag LOCUS_04190 gene rplO 16138 15698 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546521.1 protein_id gnl|my_center|LOCUS_04190 16653 16135 gene locus_tag LOCUS_04200 gene rpsE 16653 16135 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545629.1 protein_id gnl|my_center|LOCUS_04200 17095 16733 gene locus_tag LOCUS_04210 gene rplR 17095 16733 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545340.1 protein_id gnl|my_center|LOCUS_04210 17713 17171 gene locus_tag LOCUS_04220 gene rplF 17713 17171 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546082.1 protein_id gnl|my_center|LOCUS_04220 18199 17807 gene locus_tag LOCUS_04230 gene rpsH 18199 17807 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545222.1 protein_id gnl|my_center|LOCUS_04230 18397 18212 gene locus_tag LOCUS_04240 18397 18212 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938611.1 protein_id gnl|my_center|LOCUS_04240 19000 18401 gene locus_tag LOCUS_04250 gene rplE 19000 18401 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842801.1 protein_id gnl|my_center|LOCUS_04250 19296 18976 gene locus_tag LOCUS_04260 gene rplX 19296 18976 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_04260 19668 19300 gene locus_tag LOCUS_04270 gene rplN 19668 19300 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545550.1 protein_id gnl|my_center|LOCUS_04270 19924 19682 gene locus_tag LOCUS_04280 19924 19682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 20135 19938 gene locus_tag LOCUS_04290 gene rpmC 20135 19938 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544971.1 protein_id gnl|my_center|LOCUS_04290 20551 20132 gene locus_tag LOCUS_04300 gene rplP 20551 20132 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545254.1 protein_id gnl|my_center|LOCUS_04300 21202 20555 gene locus_tag LOCUS_04310 gene rpsC 21202 20555 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545204.1 protein_id gnl|my_center|LOCUS_04310 21644 21306 gene locus_tag LOCUS_04320 gene rplV 21644 21306 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546606.1 protein_id gnl|my_center|LOCUS_04320 21946 21647 gene locus_tag LOCUS_04330 gene rpsS 21946 21647 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_04330 22766 21948 gene locus_tag LOCUS_04340 gene rplB 22766 21948 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546860.1 protein_id gnl|my_center|LOCUS_04340 23056 22766 gene locus_tag LOCUS_04350 gene rplW 23056 22766 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546250.1 protein_id gnl|my_center|LOCUS_04350 23682 23053 gene locus_tag LOCUS_04360 gene rplD 23682 23053 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546805.1 protein_id gnl|my_center|LOCUS_04360 24298 23684 gene locus_tag LOCUS_04370 gene rplC 24298 23684 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_04370 24649 24344 gene locus_tag LOCUS_04380 gene rpsJ 24649 24344 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390499.1 protein_id gnl|my_center|LOCUS_04380 >Feature sequence014 498 713 gene locus_tag LOCUS_04390 498 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 1558 722 gene locus_tag LOCUS_04400 1558 722 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_04400 2309 1530 gene locus_tag LOCUS_04410 2309 1530 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546810.1 protein_id gnl|my_center|LOCUS_04410 2460 3785 gene locus_tag LOCUS_04420 2460 3785 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546425.1 protein_id gnl|my_center|LOCUS_04420 4505 3813 gene locus_tag LOCUS_04430 4505 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5089 4505 gene locus_tag LOCUS_04440 5089 4505 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545579.1 protein_id gnl|my_center|LOCUS_04440 5605 5180 gene locus_tag LOCUS_04450 5605 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 7228 5942 gene locus_tag LOCUS_04460 7228 5942 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_04460 8828 7251 gene locus_tag LOCUS_04470 gene serA 8828 7251 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_04470 10031 8913 gene locus_tag LOCUS_04480 10031 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 10483 10091 gene locus_tag LOCUS_04490 10483 10091 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392906.1 protein_id gnl|my_center|LOCUS_04490 10797 10480 gene locus_tag LOCUS_04500 10797 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 11774 11070 gene locus_tag LOCUS_04510 11774 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 12268 11789 gene locus_tag LOCUS_04520 12268 11789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 12869 12222 gene locus_tag LOCUS_04530 12869 12222 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390294.1 protein_id gnl|my_center|LOCUS_04530 13859 12927 gene locus_tag LOCUS_04540 13859 12927 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938287.1 protein_id gnl|my_center|LOCUS_04540 14298 13879 gene locus_tag LOCUS_04550 14298 13879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 16070 14295 gene locus_tag LOCUS_04560 gene uvrC 16070 14295 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545436.1 protein_id gnl|my_center|LOCUS_04560 17209 16211 gene locus_tag LOCUS_04570 17209 16211 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975792.1 protein_id gnl|my_center|LOCUS_04570 18577 17234 gene locus_tag LOCUS_04580 18577 17234 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_04580 19163 18558 gene locus_tag LOCUS_04590 19163 18558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 21646 19382 gene locus_tag LOCUS_04600 21646 19382 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942973.1 protein_id gnl|my_center|LOCUS_04600 22907 21660 gene locus_tag LOCUS_04610 22907 21660 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978370.1 protein_id gnl|my_center|LOCUS_04610 <24273 22918 gene locus_tag LOCUS_04620 <24273 22918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942993.1:mechanosensitive ion channel family protein >Feature sequence015 160 1506 gene locus_tag LOCUS_04630 160 1506 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_04630 1508 2536 gene locus_tag LOCUS_04640 gene cydB 1508 2536 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_04640 3506 2655 gene locus_tag LOCUS_04650 3506 2655 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_04650 3950 3507 gene locus_tag LOCUS_04660 3950 3507 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021853.1 protein_id gnl|my_center|LOCUS_04660 4371 3925 gene locus_tag LOCUS_04670 4371 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 6095 4506 gene locus_tag LOCUS_04680 6095 4506 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_04680 6999 6097 gene locus_tag LOCUS_04690 6999 6097 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_04690 7247 7014 gene locus_tag LOCUS_04700 7247 7014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04700 8826 7207 gene locus_tag LOCUS_04710 8826 7207 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_04710 9466 8993 gene locus_tag LOCUS_04720 9466 8993 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939670.1 protein_id gnl|my_center|LOCUS_04720 9887 9540 gene locus_tag LOCUS_04730 9887 9540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545893.1 protein_id gnl|my_center|LOCUS_04730 11172 9895 gene locus_tag LOCUS_04740 11172 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 11660 11271 gene locus_tag LOCUS_04750 11660 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 12238 11693 gene locus_tag LOCUS_04760 12238 11693 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943176.1 protein_id gnl|my_center|LOCUS_04760 13107 12358 gene locus_tag LOCUS_04770 13107 12358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 13395 13204 gene locus_tag LOCUS_04780 13395 13204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 13648 14475 gene locus_tag LOCUS_04790 13648 14475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 16236 14533 gene locus_tag LOCUS_04800 16236 14533 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545510.1 protein_id gnl|my_center|LOCUS_04800 16563 16240 gene locus_tag LOCUS_04810 16563 16240 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460053.1 protein_id gnl|my_center|LOCUS_04810 19266 16618 gene locus_tag LOCUS_04820 gene alaS 19266 16618 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545089.1 protein_id gnl|my_center|LOCUS_04820 19649 19302 gene locus_tag LOCUS_04830 19649 19302 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546204.1 protein_id gnl|my_center|LOCUS_04830 20130 19654 gene locus_tag LOCUS_04840 20130 19654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 21328 20183 gene locus_tag LOCUS_04850 21328 20183 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_04850 22454 21435 gene locus_tag LOCUS_04860 gene recA 22454 21435 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546028.1 protein_id gnl|my_center|LOCUS_04860 23042 22473 gene locus_tag LOCUS_04870 gene thpR 23042 22473 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_04870 23527 23072 gene locus_tag LOCUS_04880 23527 23072 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546233.1 protein_id gnl|my_center|LOCUS_04880 23936 23517 gene locus_tag LOCUS_04890 23936 23517 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_04890 24076 24150 gene locus_tag LOCUS_t00070 24076 24150 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence016 2622 1960 gene locus_tag LOCUS_04900 2622 1960 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100859.1 protein_id gnl|my_center|LOCUS_04900 3343 2636 gene locus_tag LOCUS_04910 gene rnc 3343 2636 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428341.1 protein_id gnl|my_center|LOCUS_04910 3381 4109 gene locus_tag LOCUS_04920 3381 4109 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546351.1 protein_id gnl|my_center|LOCUS_04920 4109 4909 gene locus_tag LOCUS_04930 gene proC 4109 4909 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546562.1 protein_id gnl|my_center|LOCUS_04930 4909 5214 gene locus_tag LOCUS_04940 4909 5214 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_04940 5216 5701 gene locus_tag LOCUS_04950 5216 5701 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_04950 5712 6971 gene locus_tag LOCUS_04960 gene hisS 5712 6971 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_04960 7015 7197 gene locus_tag LOCUS_04970 7015 7197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7206 7583 gene locus_tag LOCUS_04980 7206 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 9790 7673 gene locus_tag LOCUS_04990 gene rnr 9790 7673 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545022.1 protein_id gnl|my_center|LOCUS_04990 10155 9925 gene locus_tag LOCUS_05000 10155 9925 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_05000 10443 10207 gene locus_tag LOCUS_05010 gene rpsP 10443 10207 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545141.1 protein_id gnl|my_center|LOCUS_05010 11834 10515 gene locus_tag LOCUS_05020 gene ffh 11834 10515 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546620.1 protein_id gnl|my_center|LOCUS_05020 12342 11839 gene locus_tag LOCUS_05030 12342 11839 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_05030 12725 12393 gene locus_tag LOCUS_05040 gene trxA 12725 12393 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_05040 13351 12995 gene locus_tag LOCUS_05050 13351 12995 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942019.1 protein_id gnl|my_center|LOCUS_05050 14457 13627 gene locus_tag LOCUS_05060 14457 13627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 14748 14503 gene locus_tag LOCUS_05070 14748 14503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 15022 14735 gene locus_tag LOCUS_05080 15022 14735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 15588 15034 gene locus_tag LOCUS_05090 15588 15034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 17289 15661 gene locus_tag LOCUS_05100 17289 15661 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867265.1 protein_id gnl|my_center|LOCUS_05100 17422 18753 gene locus_tag LOCUS_05110 17422 18753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 19166 18810 gene locus_tag LOCUS_05120 19166 18810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 19303 19530 gene locus_tag LOCUS_05130 19303 19530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 20617 19460 gene locus_tag LOCUS_05140 20617 19460 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_05140 20838 20614 gene locus_tag LOCUS_05150 20838 20614 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545802.1 protein_id gnl|my_center|LOCUS_05150 21134 22681 gene locus_tag LOCUS_05160 21134 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence017 137 445 gene locus_tag LOCUS_05170 137 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 837 1289 gene locus_tag LOCUS_05180 gene mraZ 837 1289 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545651.1 protein_id gnl|my_center|LOCUS_05180 1344 2174 gene locus_tag LOCUS_05190 gene rsmH 1344 2174 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545268.1 protein_id gnl|my_center|LOCUS_05190 2171 2524 gene locus_tag LOCUS_05200 2171 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 2617 4317 gene locus_tag LOCUS_05210 2617 4317 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_05210 4330 5955 gene locus_tag LOCUS_05220 4330 5955 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546153.1 protein_id gnl|my_center|LOCUS_05220 5991 7370 gene locus_tag LOCUS_05230 5991 7370 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545266.1 protein_id gnl|my_center|LOCUS_05230 7360 8442 gene locus_tag LOCUS_05240 gene mraY 7360 8442 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545877.1 protein_id gnl|my_center|LOCUS_05240 8589 9551 gene locus_tag LOCUS_05250 8589 9551 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546749.1 protein_id gnl|my_center|LOCUS_05250 9535 11037 gene locus_tag LOCUS_05260 gene murD 9535 11037 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545218.1 protein_id gnl|my_center|LOCUS_05260 11039 12205 gene locus_tag LOCUS_05270 gene ftsW 11039 12205 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545997.1 protein_id gnl|my_center|LOCUS_05270 12296 13399 gene locus_tag LOCUS_05280 gene murG 12296 13399 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_05280 13414 14829 gene locus_tag LOCUS_05290 gene murC 13414 14829 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546590.1 protein_id gnl|my_center|LOCUS_05290 14837 15790 gene locus_tag LOCUS_05300 gene murB 14837 15790 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546287.1 protein_id gnl|my_center|LOCUS_05300 15777 16721 gene locus_tag LOCUS_05310 15777 16721 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_05310 16711 17490 gene locus_tag LOCUS_05320 16711 17490 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545598.1 protein_id gnl|my_center|LOCUS_05320 17487 18839 gene locus_tag LOCUS_05330 gene ftsA 17487 18839 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_05330 18946 20121 gene locus_tag LOCUS_05340 gene ftsZ 18946 20121 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545914.1 protein_id gnl|my_center|LOCUS_05340 20287 20430 gene locus_tag LOCUS_05350 20287 20430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 20427 20654 gene locus_tag LOCUS_05360 20427 20654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 21151 22173 gene locus_tag LOCUS_05370 gene lpxD 21151 22173 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_05370 22170 22601 gene locus_tag LOCUS_05380 gene fabZ 22170 22601 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545346.1 protein_id gnl|my_center|LOCUS_05380 22601 23380 gene locus_tag LOCUS_05390 gene lpxA 22601 23380 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence018 110 448 gene locus_tag LOCUS_05400 110 448 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941607.1 protein_id gnl|my_center|LOCUS_05400 802 2109 gene locus_tag LOCUS_05410 802 2109 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_05410 2339 2974 gene locus_tag LOCUS_05420 2339 2974 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_05420 3426 2998 gene locus_tag LOCUS_05430 gene queF 3426 2998 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546535.1 protein_id gnl|my_center|LOCUS_05430 3601 4860 gene locus_tag LOCUS_05440 gene rho 3601 4860 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545880.1 protein_id gnl|my_center|LOCUS_05440 4972 7026 gene locus_tag LOCUS_05450 gene pheT 4972 7026 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_05450 7034 7714 gene locus_tag LOCUS_05460 7034 7714 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545256.1 protein_id gnl|my_center|LOCUS_05460 7787 8902 gene locus_tag LOCUS_05470 7787 8902 CDS product Vms1/Ankzf1 family peptidyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546631.1 protein_id gnl|my_center|LOCUS_05470 8914 10869 gene locus_tag LOCUS_05480 8914 10869 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545932.1 protein_id gnl|my_center|LOCUS_05480 11723 10872 gene locus_tag LOCUS_05490 11723 10872 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546752.1 protein_id gnl|my_center|LOCUS_05490 12270 11740 gene locus_tag LOCUS_05500 gene scpB 12270 11740 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_05500 13317 12316 gene locus_tag LOCUS_05510 13317 12316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_05510 14026 13340 gene locus_tag LOCUS_05520 14026 13340 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_05520 15207 14029 gene locus_tag LOCUS_05530 15207 14029 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_05530 15514 15197 gene locus_tag LOCUS_05540 15514 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941914.1 protein_id gnl|my_center|LOCUS_05540 16006 15515 gene locus_tag LOCUS_05550 16006 15515 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941913.1 protein_id gnl|my_center|LOCUS_05550 16625 16113 gene locus_tag LOCUS_05560 16625 16113 CDS product nitrous oxide reductase accessory protein NosL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941458.1 protein_id gnl|my_center|LOCUS_05560 16766 17203 gene locus_tag LOCUS_05570 16766 17203 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545568.1 protein_id gnl|my_center|LOCUS_05570 17367 18464 gene locus_tag LOCUS_05580 17367 18464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 18565 19770 gene locus_tag LOCUS_05590 18565 19770 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679166.1 protein_id gnl|my_center|LOCUS_05590 19776 20432 gene locus_tag LOCUS_05600 19776 20432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 20429 21094 gene locus_tag LOCUS_05610 20429 21094 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722723.1 protein_id gnl|my_center|LOCUS_05610 21426 21674 gene locus_tag LOCUS_05620 21426 21674 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015106.1 protein_id gnl|my_center|LOCUS_05620 21671 22477 gene locus_tag LOCUS_05630 gene thiF 21671 22477 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880850.1 protein_id gnl|my_center|LOCUS_05630 22707 23009 gene locus_tag LOCUS_05640 22707 23009 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence019 347 423 gene locus_tag LOCUS_t00080 347 423 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 501 686 gene locus_tag LOCUS_05650 gene secE 501 686 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545907.1 protein_id gnl|my_center|LOCUS_05650 689 1213 gene locus_tag LOCUS_05660 gene nusG 689 1213 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_05660 1264 1695 gene locus_tag LOCUS_05670 gene rplK 1264 1695 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546433.1 protein_id gnl|my_center|LOCUS_05670 1788 2480 gene locus_tag LOCUS_05680 gene rplA 1788 2480 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545797.1 protein_id gnl|my_center|LOCUS_05680 2758 3216 gene locus_tag LOCUS_05690 gene rplJ 2758 3216 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_05690 3286 3669 gene locus_tag LOCUS_05700 gene rplL 3286 3669 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546672.1 protein_id gnl|my_center|LOCUS_05700 3774 7715 gene locus_tag LOCUS_05710 gene rpoB 3774 7715 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_05710 7717 11832 gene locus_tag LOCUS_05720 gene rpoC 7717 11832 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546248.1 protein_id gnl|my_center|LOCUS_05720 12055 12552 gene locus_tag LOCUS_05730 12055 12552 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944407.1 protein_id gnl|my_center|LOCUS_05730 12769 13434 gene locus_tag LOCUS_05740 12769 13434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 13431 14012 gene locus_tag LOCUS_05750 13431 14012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 14079 15527 gene locus_tag LOCUS_05760 gene cobB 14079 15527 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545628.1 protein_id gnl|my_center|LOCUS_05760 15754 15524 gene locus_tag LOCUS_05770 15754 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 17652 15841 gene locus_tag LOCUS_05780 17652 15841 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545274.1 protein_id gnl|my_center|LOCUS_05780 18038 17652 gene locus_tag LOCUS_05790 18038 17652 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_05790 19792 18200 gene locus_tag LOCUS_05800 19792 18200 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545977.1 protein_id gnl|my_center|LOCUS_05800 19938 20210 gene locus_tag LOCUS_05810 gene ihfA 19938 20210 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419121.1 protein_id gnl|my_center|LOCUS_05810 20214 20615 gene locus_tag LOCUS_05820 20214 20615 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546816.1 protein_id gnl|my_center|LOCUS_05820 20657 20733 gene locus_tag LOCUS_t00090 20657 20733 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 20749 21879 gene locus_tag LOCUS_05830 20749 21879 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545936.1 protein_id gnl|my_center|LOCUS_05830 21876 22445 gene locus_tag LOCUS_05840 21876 22445 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545889.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence020 1257 904 gene locus_tag LOCUS_05850 1257 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1731 1264 gene locus_tag LOCUS_05860 1731 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 2436 2068 gene locus_tag LOCUS_05870 2436 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 4484 2508 gene locus_tag LOCUS_05880 gene acs 4484 2508 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546141.1 protein_id gnl|my_center|LOCUS_05880 6125 4707 gene locus_tag LOCUS_05890 6125 4707 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940959.1 protein_id gnl|my_center|LOCUS_05890 7758 6115 gene locus_tag LOCUS_05900 7758 6115 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940958.1 protein_id gnl|my_center|LOCUS_05900 8044 7760 gene locus_tag LOCUS_05910 8044 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546054.1 protein_id gnl|my_center|LOCUS_05910 8837 8034 gene locus_tag LOCUS_05920 gene tatC 8837 8034 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_05920 9194 8838 gene locus_tag LOCUS_05930 9194 8838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10576 9194 gene locus_tag LOCUS_05940 10576 9194 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_05940 11364 10573 gene locus_tag LOCUS_05950 11364 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842557.1 protein_id gnl|my_center|LOCUS_05950 12628 11594 gene locus_tag LOCUS_05960 12628 11594 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269667.1 protein_id gnl|my_center|LOCUS_05960 12898 13290 gene locus_tag LOCUS_05970 12898 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 13290 13601 gene locus_tag LOCUS_05980 13290 13601 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_05980 13610 13954 gene locus_tag LOCUS_05990 gene hypA 13610 13954 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546565.1 protein_id gnl|my_center|LOCUS_05990 14056 14703 gene locus_tag LOCUS_06000 gene hypB 14056 14703 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_06000 14731 15339 gene locus_tag LOCUS_06010 14731 15339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06010 15264 17264 gene locus_tag LOCUS_06020 15264 17264 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546251.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06020 17277 18347 gene locus_tag LOCUS_06030 gene hypD 17277 18347 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545661.1 protein_id gnl|my_center|LOCUS_06030 18344 18547 gene locus_tag LOCUS_06040 18344 18547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 18540 19562 gene locus_tag LOCUS_06050 gene hypE 18540 19562 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_06050 19659 20534 gene locus_tag LOCUS_06060 19659 20534 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035416.1 protein_id gnl|my_center|LOCUS_06060 21525 20683 gene locus_tag LOCUS_06070 21525 20683 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_06070 21731 21655 gene locus_tag LOCUS_t00100 21731 21655 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21839 22123 gene locus_tag LOCUS_06080 21839 22123 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence021 934 143 gene locus_tag LOCUS_06090 934 143 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_06090 2596 1193 gene locus_tag LOCUS_06100 2596 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 2838 3947 gene locus_tag LOCUS_06110 2838 3947 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546465.1 protein_id gnl|my_center|LOCUS_06110 4024 4935 gene locus_tag LOCUS_06120 gene argF 4024 4935 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545574.1 protein_id gnl|my_center|LOCUS_06120 6278 4995 gene locus_tag LOCUS_06130 gene larC 6278 4995 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_06130 6620 6297 gene locus_tag LOCUS_06140 gene mazF9 6620 6297 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_06140 6837 6607 gene locus_tag LOCUS_06150 6837 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 6994 7767 gene locus_tag LOCUS_06160 6994 7767 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_06160 7767 8777 gene locus_tag LOCUS_06170 gene galT 7767 8777 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_06170 8779 9237 gene locus_tag LOCUS_06180 8779 9237 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_06180 9234 9740 gene locus_tag LOCUS_06190 9234 9740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 9868 10962 gene locus_tag LOCUS_06200 9868 10962 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546404.1 protein_id gnl|my_center|LOCUS_06200 11331 11813 gene locus_tag LOCUS_06210 11331 11813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 11844 12662 gene locus_tag LOCUS_06220 gene rsmA 11844 12662 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546868.1 protein_id gnl|my_center|LOCUS_06220 12659 13087 gene locus_tag LOCUS_06230 12659 13087 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545771.1 protein_id gnl|my_center|LOCUS_06230 13152 13439 gene locus_tag LOCUS_06240 13152 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13436 13861 gene locus_tag LOCUS_06250 13436 13861 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_06250 13901 15346 gene locus_tag LOCUS_06260 13901 15346 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_06260 15410 15658 gene locus_tag LOCUS_06270 15410 15658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 15655 16071 gene locus_tag LOCUS_06280 15655 16071 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666459.1 protein_id gnl|my_center|LOCUS_06280 16092 17747 gene locus_tag LOCUS_06290 16092 17747 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_06290 17772 18197 gene locus_tag LOCUS_06300 17772 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 18208 19023 gene locus_tag LOCUS_06310 18208 19023 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_06310 19113 21158 gene locus_tag LOCUS_06320 19113 21158 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546688.1 protein_id gnl|my_center|LOCUS_06320 21155 21823 gene locus_tag LOCUS_06330 21155 21823 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546180.1 protein_id gnl|my_center|LOCUS_06330 21807 22574 gene locus_tag LOCUS_06340 21807 22574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence022 777 190 gene locus_tag LOCUS_06350 gene hisB 777 190 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943719.1 protein_id gnl|my_center|LOCUS_06350 1832 774 gene locus_tag LOCUS_06360 gene hisC 1832 774 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545615.1 protein_id gnl|my_center|LOCUS_06360 2710 1835 gene locus_tag LOCUS_06370 gene hisG 2710 1835 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545705.1 protein_id gnl|my_center|LOCUS_06370 2811 3311 gene locus_tag LOCUS_06380 2811 3311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546023.1 protein_id gnl|my_center|LOCUS_06380 5218 3323 gene locus_tag LOCUS_06390 5218 3323 CDS product carbon starvation CstA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941238.1 protein_id gnl|my_center|LOCUS_06390 5961 5350 gene locus_tag LOCUS_06400 5961 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 6716 5964 gene locus_tag LOCUS_06410 6716 5964 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545194.1 protein_id gnl|my_center|LOCUS_06410 9934 6728 gene locus_tag LOCUS_06420 gene fdnG 9934 6728 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_except (pos:complement(9320..9322),aa:Sec) note codon on position 205 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_06420 10297 11793 gene locus_tag LOCUS_06430 10297 11793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 12883 11948 gene locus_tag LOCUS_06440 12883 11948 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_06440 13508 12876 gene locus_tag LOCUS_06450 13508 12876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 13636 14880 gene locus_tag LOCUS_06460 13636 14880 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940986.1 protein_id gnl|my_center|LOCUS_06460 14877 15596 gene locus_tag LOCUS_06470 14877 15596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_06470 15781 17412 gene locus_tag LOCUS_06480 15781 17412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 18007 17426 gene locus_tag LOCUS_06490 18007 17426 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_06490 18090 19304 gene locus_tag LOCUS_06500 18090 19304 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_06500 19354 20121 gene locus_tag LOCUS_06510 19354 20121 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546761.1 protein_id gnl|my_center|LOCUS_06510 20273 20875 gene locus_tag LOCUS_06520 20273 20875 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545867.1 protein_id gnl|my_center|LOCUS_06520 21623 20892 gene locus_tag LOCUS_06530 21623 20892 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544975.1 protein_id gnl|my_center|LOCUS_06530 22298 21645 gene locus_tag LOCUS_06540 22298 21645 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence023 <1 990 gene locus_tag LOCUS_06550 <1 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545808.1:DUF814 domain-containing protein 1895 987 gene locus_tag LOCUS_06560 gene hisF 1895 987 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545004.1 protein_id gnl|my_center|LOCUS_06560 2239 1895 gene locus_tag LOCUS_06570 2239 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3833 2313 gene locus_tag LOCUS_06580 3833 2313 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546232.1 protein_id gnl|my_center|LOCUS_06580 4641 3808 gene locus_tag LOCUS_06590 4641 3808 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_06590 5465 4767 gene locus_tag LOCUS_06600 5465 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 6603 5467 gene locus_tag LOCUS_06610 gene queA 6603 5467 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090135.1 protein_id gnl|my_center|LOCUS_06610 7624 6587 gene locus_tag LOCUS_06620 7624 6587 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546594.1 protein_id gnl|my_center|LOCUS_06620 8177 7644 gene locus_tag LOCUS_06630 8177 7644 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546830.1 protein_id gnl|my_center|LOCUS_06630 10044 8191 gene locus_tag LOCUS_06640 10044 8191 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_06640 11172 10129 gene locus_tag LOCUS_06650 11172 10129 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_06650 11294 11524 gene locus_tag LOCUS_06660 11294 11524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 11521 11925 gene locus_tag LOCUS_06670 11521 11925 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094558.1 protein_id gnl|my_center|LOCUS_06670 11935 12360 gene locus_tag LOCUS_06680 11935 12360 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545843.1 protein_id gnl|my_center|LOCUS_06680 12892 12434 gene locus_tag LOCUS_06690 12892 12434 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_06690 14032 12968 gene locus_tag LOCUS_06700 14032 12968 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_06700 15278 14064 gene locus_tag LOCUS_06710 15278 14064 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_06710 15997 15347 gene locus_tag LOCUS_06720 15997 15347 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544953.1 protein_id gnl|my_center|LOCUS_06720 16358 15999 gene locus_tag LOCUS_06730 16358 15999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 16966 16355 gene locus_tag LOCUS_06740 gene lepB 16966 16355 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_06740 17979 17026 gene locus_tag LOCUS_06750 17979 17026 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545468.1 protein_id gnl|my_center|LOCUS_06750 18146 20089 gene locus_tag LOCUS_06760 gene feoB 18146 20089 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045027.1 protein_id gnl|my_center|LOCUS_06760 20093 20536 gene locus_tag LOCUS_06770 20093 20536 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930868.1 protein_id gnl|my_center|LOCUS_06770 20684 20574 gene locus_tag LOCUS_r00010 20684 20574 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 20816 20743 gene locus_tag LOCUS_t00110 20816 20743 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 20894 20818 gene locus_tag LOCUS_t00120 20894 20818 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 2459 921 gene locus_tag LOCUS_06780 2459 921 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943636.1 protein_id gnl|my_center|LOCUS_06780 3724 2480 gene locus_tag LOCUS_06790 gene cobD 3724 2480 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009926914.1 protein_id gnl|my_center|LOCUS_06790 4764 3724 gene locus_tag LOCUS_06800 gene cbiB 4764 3724 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392613.1 protein_id gnl|my_center|LOCUS_06800 5093 4761 gene locus_tag LOCUS_06810 5093 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06810 6372 5101 gene locus_tag LOCUS_06820 6372 5101 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544966.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06820 7084 6365 gene locus_tag LOCUS_06830 7084 6365 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_06830 7950 7063 gene locus_tag LOCUS_06840 gene cobS 7950 7063 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545455.1 protein_id gnl|my_center|LOCUS_06840 9079 7934 gene locus_tag LOCUS_06850 gene cobT 9079 7934 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_06850 9607 9089 gene locus_tag LOCUS_06860 gene cobU 9607 9089 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546718.1 protein_id gnl|my_center|LOCUS_06860 10089 10706 gene locus_tag LOCUS_06870 10089 10706 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_06870 10699 11691 gene locus_tag LOCUS_06880 10699 11691 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887570.1 protein_id gnl|my_center|LOCUS_06880 11763 12254 gene locus_tag LOCUS_06890 11763 12254 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_06890 12296 12724 gene locus_tag LOCUS_06900 12296 12724 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941051.1 protein_id gnl|my_center|LOCUS_06900 12807 13097 gene locus_tag LOCUS_06910 12807 13097 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_06910 13094 13459 gene locus_tag LOCUS_06920 13094 13459 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051076796.1 protein_id gnl|my_center|LOCUS_06920 15338 13605 gene locus_tag LOCUS_06930 gene glgP 15338 13605 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_06930 16243 15335 gene locus_tag LOCUS_06940 gene queC 16243 15335 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_06940 17312 16230 gene locus_tag LOCUS_06950 17312 16230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 19016 17316 gene locus_tag LOCUS_06960 19016 17316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 19692 19033 gene locus_tag LOCUS_06970 gene plsY 19692 19033 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545962.1 protein_id gnl|my_center|LOCUS_06970 20234 19689 gene locus_tag LOCUS_06980 gene pgsA 20234 19689 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546842.1 protein_id gnl|my_center|LOCUS_06980 20754 20215 gene locus_tag LOCUS_06990 20754 20215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 20907 20832 gene locus_tag LOCUS_t00130 20907 20832 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 1383 310 gene locus_tag LOCUS_07000 gene hgcA 1383 310 CDS product mercury methylation corrinoid protein HgcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942086.1 protein_id gnl|my_center|LOCUS_07000 1634 2374 gene locus_tag LOCUS_07010 1634 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2646 2867 gene locus_tag LOCUS_07020 2646 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2979 5453 gene locus_tag LOCUS_07030 2979 5453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4613 4710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5510 6976 gene locus_tag LOCUS_07040 5510 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 6978 7991 gene locus_tag LOCUS_07050 6978 7991 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202085.1 protein_id gnl|my_center|LOCUS_07050 8023 8280 gene locus_tag LOCUS_07060 8023 8280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8290 8853 gene locus_tag LOCUS_07070 8290 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8930 11521 gene locus_tag LOCUS_07080 gene mutS 8930 11521 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545203.1 protein_id gnl|my_center|LOCUS_07080 12493 11765 gene locus_tag LOCUS_07090 12493 11765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 13938 12583 gene locus_tag LOCUS_07100 gene phnD 13938 12583 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545055.1 protein_id gnl|my_center|LOCUS_07100 14275 15705 gene locus_tag LOCUS_07110 14275 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 15729 15983 gene locus_tag LOCUS_07120 gene tusA 15729 15983 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_07120 16012 16203 gene locus_tag LOCUS_07130 16012 16203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 16227 16436 gene locus_tag LOCUS_07140 16227 16436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 16452 16913 gene locus_tag LOCUS_07150 16452 16913 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544986.1 protein_id gnl|my_center|LOCUS_07150 17043 18059 gene locus_tag LOCUS_07160 17043 18059 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_07160 18369 20111 gene locus_tag LOCUS_07170 18369 20111 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546525.1 protein_id gnl|my_center|LOCUS_07170 20142 20303 gene locus_tag LOCUS_07180 20142 20303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546079.1 protein_id gnl|my_center|LOCUS_07180 20401 20679 gene locus_tag LOCUS_07190 20401 20679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 20700 21428 gene locus_tag LOCUS_07200 20700 21428 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460083.1 protein_id gnl|my_center|LOCUS_07200 21490 21532 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence026 3 404 gene locus_tag LOCUS_07210 3 404 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_07210 415 1233 gene locus_tag LOCUS_07220 415 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583157.1 protein_id gnl|my_center|LOCUS_07220 1248 1406 gene locus_tag LOCUS_07230 1248 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1403 2941 gene locus_tag LOCUS_07240 1403 2941 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942184.1 protein_id gnl|my_center|LOCUS_07240 3129 4490 gene locus_tag LOCUS_07250 3129 4490 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546190.1 protein_id gnl|my_center|LOCUS_07250 4487 5722 gene locus_tag LOCUS_07260 gene pfp 4487 5722 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546508.1 protein_id gnl|my_center|LOCUS_07260 5813 6160 gene locus_tag LOCUS_07270 5813 6160 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_07270 6153 6509 gene locus_tag LOCUS_07280 6153 6509 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_07280 6522 7559 gene locus_tag LOCUS_07290 6522 7559 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_07290 7644 8195 gene locus_tag LOCUS_07300 7644 8195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8290 10716 gene locus_tag LOCUS_07310 8290 10716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 10951 11970 gene locus_tag LOCUS_07320 10951 11970 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946960.1 protein_id gnl|my_center|LOCUS_07320 13398 12130 gene locus_tag LOCUS_07330 gene hemA 13398 12130 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_07330 14210 13395 gene locus_tag LOCUS_07340 gene ccsB 14210 13395 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_07340 14380 14210 gene locus_tag LOCUS_07350 14380 14210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07350 14981 14388 gene locus_tag LOCUS_07360 14981 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07360 17568 15061 gene locus_tag LOCUS_07370 gene topA 17568 15061 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_07370 18779 17694 gene locus_tag LOCUS_07380 gene dprA 18779 17694 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_07380 20077 18890 gene locus_tag LOCUS_07390 20077 18890 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545761.1 protein_id gnl|my_center|LOCUS_07390 20385 20134 gene locus_tag LOCUS_07400 20385 20134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence027 55 453 gene locus_tag LOCUS_07410 55 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 1525 506 gene locus_tag LOCUS_07420 1525 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1639 2817 gene locus_tag LOCUS_07430 1639 2817 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546563.1 protein_id gnl|my_center|LOCUS_07430 2866 3324 gene locus_tag LOCUS_07440 gene folK 2866 3324 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103756.1 protein_id gnl|my_center|LOCUS_07440 3460 3678 gene locus_tag LOCUS_07450 3460 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 5554 4256 gene locus_tag LOCUS_07460 5554 4256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5736 5963 gene locus_tag LOCUS_07470 5736 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 5977 6315 gene locus_tag LOCUS_07480 5977 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 6321 6920 gene locus_tag LOCUS_07490 6321 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6917 7507 gene locus_tag LOCUS_07500 6917 7507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 8197 7583 gene locus_tag LOCUS_07510 gene hisH 8197 7583 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_07510 8288 9373 gene locus_tag LOCUS_07520 8288 9373 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545013.1 protein_id gnl|my_center|LOCUS_07520 9980 9351 gene locus_tag LOCUS_07530 9980 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10768 9977 gene locus_tag LOCUS_07540 10768 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 11514 11047 gene locus_tag LOCUS_07550 11514 11047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 12248 11949 gene locus_tag LOCUS_07560 12248 11949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 13351 12311 gene locus_tag LOCUS_07570 13351 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 14133 13372 gene locus_tag LOCUS_07580 14133 13372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 14686 14348 gene locus_tag LOCUS_07590 14686 14348 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142420.1 protein_id gnl|my_center|LOCUS_07590 14895 14683 gene locus_tag LOCUS_07600 14895 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 17044 14948 gene locus_tag LOCUS_07610 17044 14948 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_07610 18149 17088 gene locus_tag LOCUS_07620 18149 17088 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546851.1 protein_id gnl|my_center|LOCUS_07620 19403 18300 gene locus_tag LOCUS_07630 19403 18300 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545833.1 protein_id gnl|my_center|LOCUS_07630 19479 20354 gene locus_tag LOCUS_07640 gene glyQ 19479 20354 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence028 1987 275 gene locus_tag LOCUS_07650 1987 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2764 1997 gene locus_tag LOCUS_07660 2764 1997 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_07660 2799 3539 gene locus_tag LOCUS_07670 gene pssA 2799 3539 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_07670 3605 5113 gene locus_tag LOCUS_07680 3605 5113 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_07680 5110 6606 gene locus_tag LOCUS_07690 5110 6606 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941216.1 protein_id gnl|my_center|LOCUS_07690 6716 7975 gene locus_tag LOCUS_07700 gene leuC 6716 7975 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545762.1 protein_id gnl|my_center|LOCUS_07700 8082 9329 gene locus_tag LOCUS_07710 8082 9329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_07710 9412 9870 gene locus_tag LOCUS_07720 9412 9870 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546787.1 protein_id gnl|my_center|LOCUS_07720 9925 11232 gene locus_tag LOCUS_07730 gene der 9925 11232 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546282.1 protein_id gnl|my_center|LOCUS_07730 11246 11410 gene locus_tag LOCUS_07740 11246 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11789 11451 gene locus_tag LOCUS_07750 11789 11451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 12294 11695 gene locus_tag LOCUS_07760 12294 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 13393 12296 gene locus_tag LOCUS_07770 gene dnaJ 13393 12296 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545807.1 protein_id gnl|my_center|LOCUS_07770 15449 13494 gene locus_tag LOCUS_07780 gene dnaK 15449 13494 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_07780 16147 15473 gene locus_tag LOCUS_07790 16147 15473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 17182 16148 gene locus_tag LOCUS_07800 gene hrcA 17182 16148 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545755.1 protein_id gnl|my_center|LOCUS_07800 18110 17274 gene locus_tag LOCUS_07810 gene speE 18110 17274 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546389.1 protein_id gnl|my_center|LOCUS_07810 19331 18168 gene locus_tag LOCUS_07820 19331 18168 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545474.1 protein_id gnl|my_center|LOCUS_07820 <20443 19429 gene locus_tag LOCUS_07830 <20443 19429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044997.1:ATP-binding protein >Feature sequence029 1541 198 gene locus_tag LOCUS_07840 gene rseP 1541 198 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_07840 2784 1636 gene locus_tag LOCUS_07850 2784 1636 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546435.1 protein_id gnl|my_center|LOCUS_07850 3578 2781 gene locus_tag LOCUS_07860 3578 2781 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545594.1 protein_id gnl|my_center|LOCUS_07860 4296 3580 gene locus_tag LOCUS_07870 4296 3580 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545912.1 protein_id gnl|my_center|LOCUS_07870 5906 4296 gene locus_tag LOCUS_07880 5906 4296 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545024.1 protein_id gnl|my_center|LOCUS_07880 8242 6110 gene locus_tag LOCUS_07890 8242 6110 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118691.1 protein_id gnl|my_center|LOCUS_07890 8400 9620 gene locus_tag LOCUS_07900 8400 9620 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_07900 9943 9770 gene locus_tag LOCUS_07910 9943 9770 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942897.1 protein_id gnl|my_center|LOCUS_07910 10590 9982 gene locus_tag LOCUS_07920 10590 9982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 11492 10641 gene locus_tag LOCUS_07930 gene rapZ 11492 10641 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545545.1 protein_id gnl|my_center|LOCUS_07930 12111 11590 gene locus_tag LOCUS_07940 gene raiA 12111 11590 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_07940 13578 12124 gene locus_tag LOCUS_07950 gene rpoN 13578 12124 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546561.1 protein_id gnl|my_center|LOCUS_07950 14396 13674 gene locus_tag LOCUS_07960 gene lptB 14396 13674 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546539.1 protein_id gnl|my_center|LOCUS_07960 14882 14397 gene locus_tag LOCUS_07970 gene lptA 14882 14397 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545095.1 protein_id gnl|my_center|LOCUS_07970 15411 14902 gene locus_tag LOCUS_07980 15411 14902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 15569 15495 gene locus_tag LOCUS_t00140 15569 15495 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 16690 15845 gene locus_tag LOCUS_07990 gene aroE 16690 15845 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_07990 17991 16684 gene locus_tag LOCUS_08000 17991 16684 CDS product DUF512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545290.1 protein_id gnl|my_center|LOCUS_08000 18520 17981 gene locus_tag LOCUS_08010 18520 17981 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_08010 19563 18616 gene locus_tag LOCUS_08020 19563 18616 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546019.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence030 93 371 gene locus_tag LOCUS_08030 93 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 407 622 gene locus_tag LOCUS_08040 407 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 779 1975 gene locus_tag LOCUS_08050 779 1975 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_08050 4426 1997 gene locus_tag LOCUS_08060 gene mrfA 4426 1997 CDS product ATP-dependent helicase MrfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246149.1 protein_id gnl|my_center|LOCUS_08060 5099 4443 gene locus_tag LOCUS_08070 5099 4443 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545748.1 protein_id gnl|my_center|LOCUS_08070 6555 5176 gene locus_tag LOCUS_08080 6555 5176 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924859.1 protein_id gnl|my_center|LOCUS_08080 7379 6597 gene locus_tag LOCUS_08090 gene surE 7379 6597 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_08090 7906 9087 gene locus_tag LOCUS_08100 7906 9087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 9291 9755 gene locus_tag LOCUS_08110 9291 9755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 9755 10270 gene locus_tag LOCUS_08120 9755 10270 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_08120 11668 10400 gene locus_tag LOCUS_08130 gene nrfD 11668 10400 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_08130 12456 11671 gene locus_tag LOCUS_08140 12456 11671 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_08140 12926 12453 gene locus_tag LOCUS_08150 12926 12453 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_08150 13981 12980 gene locus_tag LOCUS_08160 13981 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 14210 15253 gene locus_tag LOCUS_08170 gene purM 14210 15253 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545739.1 protein_id gnl|my_center|LOCUS_08170 15246 16082 gene locus_tag LOCUS_08180 15246 16082 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545938.1 protein_id gnl|my_center|LOCUS_08180 16086 16490 gene locus_tag LOCUS_08190 16086 16490 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544962.1 protein_id gnl|my_center|LOCUS_08190 16687 16511 gene locus_tag LOCUS_08200 16687 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 17414 16695 gene locus_tag LOCUS_08210 17414 16695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08210 17904 17590 gene locus_tag LOCUS_08220 gene cutA 17904 17590 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_08220 18374 17919 gene locus_tag LOCUS_08230 18374 17919 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545150.1 protein_id gnl|my_center|LOCUS_08230 18786 18337 gene locus_tag LOCUS_08240 18786 18337 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546607.1 protein_id gnl|my_center|LOCUS_08240 >Feature sequence031 2263 713 gene locus_tag LOCUS_08250 2263 713 CDS product CDC27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546669.1 protein_id gnl|my_center|LOCUS_08250 2407 3303 gene locus_tag LOCUS_08260 gene holA 2407 3303 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545757.1 protein_id gnl|my_center|LOCUS_08260 3580 3284 gene locus_tag LOCUS_08270 gene rpsT 3580 3284 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545489.1 protein_id gnl|my_center|LOCUS_08270 3663 4622 gene locus_tag LOCUS_08280 3663 4622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_08280 5224 4673 gene locus_tag LOCUS_08290 5224 4673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 6032 5205 gene locus_tag LOCUS_08300 6032 5205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8540 6468 gene locus_tag LOCUS_08310 8540 6468 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_08310 9133 8702 gene locus_tag LOCUS_08320 9133 8702 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000275600.1 protein_id gnl|my_center|LOCUS_08320 10274 9147 gene locus_tag LOCUS_08330 gene qmoC 10274 9147 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932549.1 protein_id gnl|my_center|LOCUS_08330 12573 10369 gene locus_tag LOCUS_08340 12573 10369 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932548.1 protein_id gnl|my_center|LOCUS_08340 13843 12578 gene locus_tag LOCUS_08350 13843 12578 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932547.1 protein_id gnl|my_center|LOCUS_08350 14428 13892 gene locus_tag LOCUS_08360 14428 13892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 15216 14431 gene locus_tag LOCUS_08370 15216 14431 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_08370 15852 15220 gene locus_tag LOCUS_08380 15852 15220 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_08380 18029 16104 gene locus_tag LOCUS_08390 gene aprA 18029 16104 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_08390 18488 18045 gene locus_tag LOCUS_08400 gene aprB 18488 18045 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence032 353 580 gene locus_tag LOCUS_08410 353 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 537 851 gene locus_tag LOCUS_08420 537 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1205 987 gene locus_tag LOCUS_08430 1205 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1649 1326 gene locus_tag LOCUS_08440 1649 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2014 1622 gene locus_tag LOCUS_08450 2014 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2860 2450 gene locus_tag LOCUS_08460 2860 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3105 2836 gene locus_tag LOCUS_08470 3105 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3489 3187 gene locus_tag LOCUS_08480 3489 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3966 4424 gene locus_tag LOCUS_08490 3966 4424 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112686.1 protein_id gnl|my_center|LOCUS_08490 4584 4669 gene locus_tag LOCUS_t00150 4584 4669 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5368 4670 gene locus_tag LOCUS_08500 5368 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5480 6268 gene locus_tag LOCUS_08510 5480 6268 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_08510 6290 8461 gene locus_tag LOCUS_08520 6290 8461 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679762.1 protein_id gnl|my_center|LOCUS_08520 8434 9024 gene locus_tag LOCUS_08530 8434 9024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 9012 10391 gene locus_tag LOCUS_08540 9012 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 11805 10441 gene locus_tag LOCUS_08550 11805 10441 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023105.1 protein_id gnl|my_center|LOCUS_08550 11903 12151 gene locus_tag LOCUS_08560 11903 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 12156 12365 gene locus_tag LOCUS_08570 12156 12365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 12362 12643 gene locus_tag LOCUS_08580 12362 12643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 13911 12646 gene locus_tag LOCUS_08590 13911 12646 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546576.1 protein_id gnl|my_center|LOCUS_08590 15167 13992 gene locus_tag LOCUS_08600 15167 13992 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943295.1 protein_id gnl|my_center|LOCUS_08600 15412 15188 gene locus_tag LOCUS_08610 15412 15188 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545805.1 protein_id gnl|my_center|LOCUS_08610 15621 15412 gene locus_tag LOCUS_08620 15621 15412 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546684.1 protein_id gnl|my_center|LOCUS_08620 17195 15732 gene locus_tag LOCUS_08630 17195 15732 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_08630 <18762 17302 gene locus_tag LOCUS_08640 <18762 17302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545185.1:NADH-quinone oxidoreductase subunit M >Feature sequence033 450 190 gene locus_tag LOCUS_08650 450 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 628 3447 gene locus_tag LOCUS_08660 gene uvrA 628 3447 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545482.1 protein_id gnl|my_center|LOCUS_08660 3548 3961 gene locus_tag LOCUS_08670 3548 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 3969 5627 gene locus_tag LOCUS_08680 3969 5627 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_08680 5628 6629 gene locus_tag LOCUS_08690 5628 6629 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_08690 6626 7483 gene locus_tag LOCUS_08700 6626 7483 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_08700 7487 7987 gene locus_tag LOCUS_08710 gene leuD 7487 7987 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_08710 8158 8889 gene locus_tag LOCUS_08720 8158 8889 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_08720 8895 9569 gene locus_tag LOCUS_08730 8895 9569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 9654 10280 gene locus_tag LOCUS_08740 gene tolQ 9654 10280 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_08740 10277 10684 gene locus_tag LOCUS_08750 gene tolR 10277 10684 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_08750 10681 11352 gene locus_tag LOCUS_08760 10681 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 11349 12701 gene locus_tag LOCUS_08770 gene tolB 11349 12701 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_08770 12780 13346 gene locus_tag LOCUS_08780 gene pal 12780 13346 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_08780 13347 14246 gene locus_tag LOCUS_08790 gene ybgF 13347 14246 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545231.1 protein_id gnl|my_center|LOCUS_08790 14247 15233 gene locus_tag LOCUS_08800 gene moaA 14247 15233 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_08800 15803 15495 gene locus_tag LOCUS_08810 15803 15495 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_08810 16080 16006 gene locus_tag LOCUS_t00160 16080 16006 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17366 16125 gene locus_tag LOCUS_08820 17366 16125 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545367.1 protein_id gnl|my_center|LOCUS_08820 18377 17373 gene locus_tag LOCUS_08830 gene gap 18377 17373 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546818.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence034 1412 225 gene locus_tag LOCUS_08840 1412 225 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881436.1 protein_id gnl|my_center|LOCUS_08840 1762 1481 gene locus_tag LOCUS_08850 1762 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2126 1773 gene locus_tag LOCUS_08860 2126 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2464 2261 gene locus_tag LOCUS_08870 2464 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3550 2579 gene locus_tag LOCUS_08880 gene selD 3550 2579 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011344950.1 protein_id gnl|my_center|LOCUS_08880 3986 3645 gene locus_tag LOCUS_08890 3986 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 4170 5753 gene locus_tag LOCUS_08900 gene guaA 4170 5753 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_08900 5757 6644 gene locus_tag LOCUS_08910 5757 6644 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_08910 6680 8596 gene locus_tag LOCUS_08920 gene dxs 6680 8596 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_08920 8604 10040 gene locus_tag LOCUS_08930 8604 10040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 10229 10933 gene locus_tag LOCUS_08940 gene radC 10229 10933 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545736.1 protein_id gnl|my_center|LOCUS_08940 10973 11581 gene locus_tag LOCUS_08950 10973 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 11650 12948 gene locus_tag LOCUS_08960 gene purD 11650 12948 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_08960 13031 13525 gene locus_tag LOCUS_08970 gene purE 13031 13525 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_08970 14226 13897 gene locus_tag LOCUS_08980 14226 13897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 14447 16201 gene locus_tag LOCUS_08990 14447 16201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 16230 17690 gene locus_tag LOCUS_09000 16230 17690 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence035 2010 2198 gene locus_tag LOCUS_09010 2010 2198 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546194.1 protein_id gnl|my_center|LOCUS_09010 2210 2788 gene locus_tag LOCUS_09020 2210 2788 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546460.1 protein_id gnl|my_center|LOCUS_09020 3647 2778 gene locus_tag LOCUS_09030 3647 2778 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944030.1 protein_id gnl|my_center|LOCUS_09030 6076 3644 gene locus_tag LOCUS_09040 6076 3644 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_09040 7040 6162 gene locus_tag LOCUS_09050 gene xerD 7040 6162 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_09050 7264 8373 gene locus_tag LOCUS_09060 7264 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545929.1 protein_id gnl|my_center|LOCUS_09060 8352 10019 gene locus_tag LOCUS_09070 8352 10019 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545407.1 protein_id gnl|my_center|LOCUS_09070 10009 12411 gene locus_tag LOCUS_09080 10009 12411 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546258.1 protein_id gnl|my_center|LOCUS_09080 12526 12963 gene locus_tag LOCUS_09090 12526 12963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14135 13047 gene locus_tag LOCUS_09100 14135 13047 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583578.1 protein_id gnl|my_center|LOCUS_09100 14490 14122 gene locus_tag LOCUS_09110 14490 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 16507 14483 gene locus_tag LOCUS_09120 16507 14483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 17453 16500 gene locus_tag LOCUS_09130 17453 16500 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461666.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence036 954 145 gene locus_tag LOCUS_09140 954 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2330 954 gene locus_tag LOCUS_09150 gene hslU 2330 954 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_09150 2960 2430 gene locus_tag LOCUS_09160 gene hslV 2960 2430 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546241.1 protein_id gnl|my_center|LOCUS_09160 3949 3062 gene locus_tag LOCUS_09170 gene xerC 3949 3062 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_09170 3969 4898 gene locus_tag LOCUS_09180 3969 4898 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_09180 4909 5655 gene locus_tag LOCUS_09190 4909 5655 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546413.1 protein_id gnl|my_center|LOCUS_09190 5665 6222 gene locus_tag LOCUS_09200 5665 6222 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545226.1 protein_id gnl|my_center|LOCUS_09200 6194 6646 gene locus_tag LOCUS_09210 6194 6646 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546022.1 protein_id gnl|my_center|LOCUS_09210 6803 7222 gene locus_tag LOCUS_09220 6803 7222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7219 7572 gene locus_tag LOCUS_09230 7219 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 8386 7658 gene locus_tag LOCUS_09240 8386 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8543 8887 gene locus_tag LOCUS_09250 8543 8887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 9710 8898 gene locus_tag LOCUS_09260 9710 8898 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_09260 10632 9724 gene locus_tag LOCUS_09270 10632 9724 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545671.1 protein_id gnl|my_center|LOCUS_09270 11450 10623 gene locus_tag LOCUS_09280 11450 10623 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546654.1 protein_id gnl|my_center|LOCUS_09280 11916 11443 gene locus_tag LOCUS_09290 gene greA 11916 11443 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_09290 12035 12787 gene locus_tag LOCUS_09300 gene mqnB 12035 12787 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_09300 13220 13008 gene locus_tag LOCUS_09310 13220 13008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 13734 13252 gene locus_tag LOCUS_09320 13734 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 14139 13825 gene locus_tag LOCUS_09330 14139 13825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 15039 14233 gene locus_tag LOCUS_09340 15039 14233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 15297 15148 gene locus_tag LOCUS_09350 15297 15148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 15717 15379 gene locus_tag LOCUS_09360 15717 15379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 16064 16432 gene locus_tag LOCUS_09370 16064 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 <17494 16521 gene locus_tag LOCUS_09380 <17494 16521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098476.1:formate hydrogenlyase transcriptional activator FlhA >Feature sequence037 1126 50 gene locus_tag LOCUS_09390 1126 50 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939787.1 protein_id gnl|my_center|LOCUS_09390 2243 1350 gene locus_tag LOCUS_09400 2243 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3443 2472 gene locus_tag LOCUS_09410 3443 2472 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940727.1 protein_id gnl|my_center|LOCUS_09410 4493 3579 gene locus_tag LOCUS_09420 gene hemB 4493 3579 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_09420 4875 4555 gene locus_tag LOCUS_09430 4875 4555 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545650.1 protein_id gnl|my_center|LOCUS_09430 5049 6137 gene locus_tag LOCUS_09440 gene rlmN 5049 6137 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_09440 6311 7243 gene locus_tag LOCUS_09450 gene miaA 6311 7243 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546758.1 protein_id gnl|my_center|LOCUS_09450 7323 9257 gene locus_tag LOCUS_09460 7323 9257 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545950.1 protein_id gnl|my_center|LOCUS_09460 9282 10430 gene locus_tag LOCUS_09470 gene ribD 9282 10430 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038059103.1 protein_id gnl|my_center|LOCUS_09470 11882 10431 gene locus_tag LOCUS_09480 11882 10431 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941000.1 protein_id gnl|my_center|LOCUS_09480 12255 11890 gene locus_tag LOCUS_09490 12255 11890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 12425 12341 gene locus_tag LOCUS_t00170 12425 12341 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 12610 14016 gene locus_tag LOCUS_09500 12610 14016 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546123.1 protein_id gnl|my_center|LOCUS_09500 14894 14013 gene locus_tag LOCUS_09510 14894 14013 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436920.1 protein_id gnl|my_center|LOCUS_09510 15556 14891 gene locus_tag LOCUS_09520 15556 14891 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546331.1 protein_id gnl|my_center|LOCUS_09520 16937 15705 gene locus_tag LOCUS_09530 16937 15705 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence038 649 1776 gene locus_tag LOCUS_09540 gene tgt 649 1776 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546567.1 protein_id gnl|my_center|LOCUS_09540 1755 2642 gene locus_tag LOCUS_09550 1755 2642 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546222.1 protein_id gnl|my_center|LOCUS_09550 2728 4032 gene locus_tag LOCUS_09560 2728 4032 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383523.1 protein_id gnl|my_center|LOCUS_09560 4081 5073 gene locus_tag LOCUS_09570 4081 5073 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_09570 6503 5133 gene locus_tag LOCUS_09580 6503 5133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 6705 6836 gene locus_tag LOCUS_09590 6705 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 6992 8500 gene locus_tag LOCUS_09600 6992 8500 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_09600 8571 9146 gene locus_tag LOCUS_09610 8571 9146 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_09610 9073 9423 gene locus_tag LOCUS_09620 9073 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 10100 9762 gene locus_tag LOCUS_09630 10100 9762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 10972 10124 gene locus_tag LOCUS_09640 gene panC 10972 10124 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546748.1 protein_id gnl|my_center|LOCUS_09640 12023 10974 gene locus_tag LOCUS_09650 gene ispG 12023 10974 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546314.1 protein_id gnl|my_center|LOCUS_09650 13092 12010 gene locus_tag LOCUS_09660 gene mltG 13092 12010 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_09660 14876 13245 gene locus_tag LOCUS_09670 gene groL 14876 13245 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_09670 15205 14915 gene locus_tag LOCUS_09680 gene groES 15205 14915 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056041.1 protein_id gnl|my_center|LOCUS_09680 16378 15395 gene locus_tag LOCUS_09690 16378 15395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 17046 16369 gene locus_tag LOCUS_09700 17046 16369 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_09700 >Feature sequence039 1676 435 gene locus_tag LOCUS_09710 1676 435 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_09710 2935 1673 gene locus_tag LOCUS_09720 2935 1673 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_09720 3265 3789 gene locus_tag LOCUS_09730 3265 3789 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942571.1 protein_id gnl|my_center|LOCUS_09730 4650 3784 gene locus_tag LOCUS_09740 4650 3784 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_09740 5279 4647 gene locus_tag LOCUS_09750 5279 4647 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_09750 7359 5317 gene locus_tag LOCUS_09760 gene ligA 7359 5317 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_09760 7841 7359 gene locus_tag LOCUS_09770 7841 7359 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546719.1 protein_id gnl|my_center|LOCUS_09770 7913 8653 gene locus_tag LOCUS_09780 7913 8653 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544927.1 protein_id gnl|my_center|LOCUS_09780 8628 10454 gene locus_tag LOCUS_09790 gene aspS 8628 10454 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546812.1 protein_id gnl|my_center|LOCUS_09790 10466 10777 gene locus_tag LOCUS_09800 10466 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 10939 13581 gene locus_tag LOCUS_09810 gene leuS 10939 13581 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015646.1 protein_id gnl|my_center|LOCUS_09810 13578 14081 gene locus_tag LOCUS_09820 13578 14081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 14078 16045 gene locus_tag LOCUS_09830 14078 16045 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545101.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence040 239 916 gene locus_tag LOCUS_09840 239 916 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_09840 980 1729 gene locus_tag LOCUS_09850 980 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 2510 1746 gene locus_tag LOCUS_09860 gene thiD 2510 1746 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546315.1 protein_id gnl|my_center|LOCUS_09860 2749 3606 gene locus_tag LOCUS_09870 2749 3606 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546439.1 protein_id gnl|my_center|LOCUS_09870 3699 4640 gene locus_tag LOCUS_09880 3699 4640 CDS product acetyl-CoA decarbonylase/synthase complex subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545620.1 protein_id gnl|my_center|LOCUS_09880 4735 6078 gene locus_tag LOCUS_09890 gene acsC 4735 6078 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_09890 6177 8390 gene locus_tag LOCUS_09900 gene acsB 6177 8390 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546472.1 protein_id gnl|my_center|LOCUS_09900 8521 10521 gene locus_tag LOCUS_09910 gene cooS 8521 10521 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_09910 12030 10582 gene locus_tag LOCUS_09920 gene gltA 12030 10582 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_09920 12890 12030 gene locus_tag LOCUS_09930 12890 12030 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393027.1 protein_id gnl|my_center|LOCUS_09930 13011 13262 gene locus_tag LOCUS_09940 13011 13262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 13379 13597 gene locus_tag LOCUS_09950 13379 13597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 13603 13842 gene locus_tag LOCUS_09960 13603 13842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 14252 14668 gene locus_tag LOCUS_09970 14252 14668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 15201 14893 gene locus_tag LOCUS_09980 15201 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 15357 15521 gene locus_tag LOCUS_09990 15357 15521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 15999 15634 gene locus_tag LOCUS_10000 15999 15634 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_10000 <17053 16024 gene locus_tag LOCUS_10010 <17053 16024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence041 2 250 gene locus_tag LOCUS_10020 2 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 278 2767 gene locus_tag LOCUS_10030 278 2767 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514554.1 protein_id gnl|my_center|LOCUS_10030 3070 2789 gene locus_tag LOCUS_10040 3070 2789 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_10040 3134 3703 gene locus_tag LOCUS_10050 3134 3703 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_10050 3709 5451 gene locus_tag LOCUS_10060 3709 5451 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968865.1 protein_id gnl|my_center|LOCUS_10060 5553 7178 gene locus_tag LOCUS_10070 5553 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 7219 8412 gene locus_tag LOCUS_10080 7219 8412 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_10080 8473 8925 gene locus_tag LOCUS_10090 8473 8925 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_10090 8925 9659 gene locus_tag LOCUS_10100 gene recO 8925 9659 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545948.1 protein_id gnl|my_center|LOCUS_10100 10182 9976 gene locus_tag LOCUS_10110 10182 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 13318 10280 gene locus_tag LOCUS_10120 13318 10280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 13482 14699 gene locus_tag LOCUS_10130 13482 14699 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943906.1 protein_id gnl|my_center|LOCUS_10130 14709 14846 gene locus_tag LOCUS_10140 14709 14846 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_10140 14856 15350 gene locus_tag LOCUS_10150 14856 15350 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545398.1 protein_id gnl|my_center|LOCUS_10150 15363 16946 gene locus_tag LOCUS_10160 15363 16946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence042 1259 348 gene locus_tag LOCUS_10170 1259 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 1740 1393 gene locus_tag LOCUS_10180 1740 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3550 1730 gene locus_tag LOCUS_10190 3550 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 4472 3528 gene locus_tag LOCUS_10200 4472 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 5152 4454 gene locus_tag LOCUS_10210 5152 4454 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_10210 6337 5162 gene locus_tag LOCUS_10220 6337 5162 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510947.1 protein_id gnl|my_center|LOCUS_10220 6816 6469 gene locus_tag LOCUS_10230 6816 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10230 7095 6832 gene locus_tag LOCUS_10240 7095 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10240 10122 7123 gene locus_tag LOCUS_10250 10122 7123 CDS product tetrathionate reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462223.1 protein_id gnl|my_center|LOCUS_10250 11379 10138 gene locus_tag LOCUS_10260 gene nrfD 11379 10138 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_10260 12336 11404 gene locus_tag LOCUS_10270 12336 11404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 12850 12350 gene locus_tag LOCUS_10280 12850 12350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14470 13025 gene locus_tag LOCUS_10290 14470 13025 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_10290 15999 14512 gene locus_tag LOCUS_10300 15999 14512 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_10300 16998 16093 gene locus_tag LOCUS_10310 16998 16093 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254057.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence043 1142 231 gene locus_tag LOCUS_10320 gene secF 1142 231 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943254.1 protein_id gnl|my_center|LOCUS_10320 2811 1183 gene locus_tag LOCUS_10330 gene secD 2811 1183 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546364.1 protein_id gnl|my_center|LOCUS_10330 3561 2899 gene locus_tag LOCUS_10340 3561 2899 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_10340 3910 3563 gene locus_tag LOCUS_10350 gene yajC 3910 3563 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545404.1 protein_id gnl|my_center|LOCUS_10350 5192 4002 gene locus_tag LOCUS_10360 5192 4002 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545901.1 protein_id gnl|my_center|LOCUS_10360 5739 5194 gene locus_tag LOCUS_10370 5739 5194 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545109.1 protein_id gnl|my_center|LOCUS_10370 5915 5840 gene locus_tag LOCUS_t00180 5915 5840 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6033 7616 gene locus_tag LOCUS_10380 gene lnt 6033 7616 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_10380 7751 8704 gene locus_tag LOCUS_10390 gene prfB 7751 8704 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205591.1 protein_id gnl|my_center|LOCUS_10390 8998 10326 gene locus_tag LOCUS_10400 gene dnaA 8998 10326 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545093.1 protein_id gnl|my_center|LOCUS_10400 10336 11439 gene locus_tag LOCUS_10410 gene dnaN 10336 11439 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_10410 11534 13936 gene locus_tag LOCUS_10420 gene gyrB 11534 13936 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_10420 13974 14186 gene locus_tag LOCUS_10430 13974 14186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 14871 14437 gene locus_tag LOCUS_10440 14871 14437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 15798 14944 gene locus_tag LOCUS_10450 15798 14944 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546601.1 protein_id gnl|my_center|LOCUS_10450 16050 16304 gene locus_tag LOCUS_10460 16050 16304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 16301 16561 gene locus_tag LOCUS_10470 16301 16561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence044 334 1269 gene locus_tag LOCUS_10480 334 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 1402 1533 gene locus_tag LOCUS_10490 1402 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1534 2757 gene locus_tag LOCUS_10500 1534 2757 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986828.1 protein_id gnl|my_center|LOCUS_10500 2836 3114 gene locus_tag LOCUS_10510 2836 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 3114 3554 gene locus_tag LOCUS_10520 3114 3554 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_10520 4866 3532 gene locus_tag LOCUS_10530 4866 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5100 6947 gene locus_tag LOCUS_10540 gene pilB 5100 6947 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_10540 7066 8160 gene locus_tag LOCUS_10550 7066 8160 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_10550 8182 9399 gene locus_tag LOCUS_10560 8182 9399 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_10560 9551 11170 gene locus_tag LOCUS_10570 9551 11170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 11167 12540 gene locus_tag LOCUS_10580 11167 12540 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_10580 12545 13516 gene locus_tag LOCUS_10590 12545 13516 CDS product general secretion pathway protein GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940982.1 protein_id gnl|my_center|LOCUS_10590 13640 13912 gene locus_tag LOCUS_10600 13640 13912 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_10600 <16771 14040 gene locus_tag LOCUS_10610 <16771 14040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546426.1:CBS domain-containing protein >Feature sequence045 1319 378 gene locus_tag LOCUS_10620 1319 378 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546588.1 protein_id gnl|my_center|LOCUS_10620 1811 1356 gene locus_tag LOCUS_10630 1811 1356 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_10630 3245 1863 gene locus_tag LOCUS_10640 3245 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 4900 3371 gene locus_tag LOCUS_10650 4900 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 6731 5799 gene locus_tag LOCUS_10660 6731 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 7379 6771 gene locus_tag LOCUS_10670 7379 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 7894 7376 gene locus_tag LOCUS_10680 7894 7376 CDS product Gx transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399375.1 protein_id gnl|my_center|LOCUS_10680 8291 7878 gene locus_tag LOCUS_10690 8291 7878 CDS product NusG domain II-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015709088.1 protein_id gnl|my_center|LOCUS_10690 9180 8248 gene locus_tag LOCUS_10700 9180 8248 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_10700 11921 9366 gene locus_tag LOCUS_10710 gene uvrA 11921 9366 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_10710 12667 12215 gene locus_tag LOCUS_10720 12667 12215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 12911 13099 gene locus_tag LOCUS_10730 12911 13099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 13114 14697 gene locus_tag LOCUS_10740 13114 14697 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272339.1 protein_id gnl|my_center|LOCUS_10740 14941 15231 gene locus_tag LOCUS_10750 14941 15231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 15321 16184 gene locus_tag LOCUS_10760 15321 16184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 16277 16624 gene locus_tag LOCUS_10770 16277 16624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence046 3582 3286 gene locus_tag LOCUS_10780 3582 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 4324 3773 gene locus_tag LOCUS_10790 4324 3773 CDS product ORF6N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958442.1 protein_id gnl|my_center|LOCUS_10790 4494 5888 gene locus_tag LOCUS_10800 4494 5888 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941561.1 protein_id gnl|my_center|LOCUS_10800 6033 6923 gene locus_tag LOCUS_10810 gene lpxC 6033 6923 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546610.1 protein_id gnl|my_center|LOCUS_10810 7780 7184 gene locus_tag LOCUS_10820 7780 7184 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_10820 8066 8593 gene locus_tag LOCUS_10830 8066 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8687 9643 gene locus_tag LOCUS_10840 8687 9643 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546060.1 protein_id gnl|my_center|LOCUS_10840 9696 10355 gene locus_tag LOCUS_10850 gene purN 9696 10355 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_10850 10450 11022 gene locus_tag LOCUS_10860 gene rsmD 10450 11022 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266972.1 protein_id gnl|my_center|LOCUS_10860 11077 11559 gene locus_tag LOCUS_10870 gene coaD 11077 11559 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_10870 11556 11876 gene locus_tag LOCUS_10880 11556 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 13290 12076 gene locus_tag LOCUS_10890 13290 12076 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941893.1 protein_id gnl|my_center|LOCUS_10890 15194 13293 gene locus_tag LOCUS_10900 gene cooS 15194 13293 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272665.1 protein_id gnl|my_center|LOCUS_10900 15771 15196 gene locus_tag LOCUS_10910 15771 15196 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_10910 16493 15858 gene locus_tag LOCUS_10920 16493 15858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence047 <1 1639 gene locus_tag LOCUS_10930 <1 1639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545622.1:GTPase HflX 1735 4197 gene locus_tag LOCUS_10940 gene glnD 1735 4197 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_10940 4176 8135 gene locus_tag LOCUS_10950 4176 8135 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545562.1 protein_id gnl|my_center|LOCUS_10950 8283 10913 gene locus_tag LOCUS_10960 8283 10913 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_10960 11573 10932 gene locus_tag LOCUS_10970 11573 10932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_10970 12376 11573 gene locus_tag LOCUS_10980 12376 11573 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942124.1 protein_id gnl|my_center|LOCUS_10980 13204 12620 gene locus_tag LOCUS_10990 13204 12620 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_10990 13810 13451 gene locus_tag LOCUS_11000 13810 13451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence048 1333 434 gene locus_tag LOCUS_11010 1333 434 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545040.1 protein_id gnl|my_center|LOCUS_11010 2261 1314 gene locus_tag LOCUS_11020 2261 1314 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546047.1 protein_id gnl|my_center|LOCUS_11020 4489 2261 gene locus_tag LOCUS_11030 4489 2261 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545854.1 protein_id gnl|my_center|LOCUS_11030 4649 6121 gene locus_tag LOCUS_11040 4649 6121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 6390 7370 gene locus_tag LOCUS_11050 gene trpS 6390 7370 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_11050 7682 8419 gene locus_tag LOCUS_11060 7682 8419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 13476 8827 gene locus_tag LOCUS_11070 13476 8827 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924811.1 protein_id gnl|my_center|LOCUS_11070 13564 14127 gene locus_tag LOCUS_11080 13564 14127 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392680.1 protein_id gnl|my_center|LOCUS_11080 14174 14404 gene locus_tag LOCUS_11090 14174 14404 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_11090 14406 14771 gene locus_tag LOCUS_11100 14406 14771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence049 2010 103 gene locus_tag LOCUS_11110 2010 103 CDS product DUF3488 and transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544993.1 protein_id gnl|my_center|LOCUS_11110 3001 1994 gene locus_tag LOCUS_11120 3001 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 3980 3057 gene locus_tag LOCUS_11130 3980 3057 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_11130 5097 4030 gene locus_tag LOCUS_11140 5097 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 5305 5598 gene locus_tag LOCUS_11150 5305 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 5585 5971 gene locus_tag LOCUS_11160 5585 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 6445 6086 gene locus_tag LOCUS_11170 6445 6086 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_11170 6690 6442 gene locus_tag LOCUS_11180 6690 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 6998 8596 gene locus_tag LOCUS_11190 6998 8596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 8600 9196 gene locus_tag LOCUS_11200 8600 9196 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_11200 9574 12681 gene locus_tag LOCUS_11210 gene cas9 9574 12681 CDS product type II CRISPR RNA-guided endonuclease Cas9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864485.1 protein_id gnl|my_center|LOCUS_11210 12668 13561 gene locus_tag LOCUS_11220 gene cas1 12668 13561 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_11220 13563 13904 gene locus_tag LOCUS_11230 13563 13904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 13955 >14248 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attgtacttgagccgcagttcctgtcaagccccaac >Feature sequence050 795 181 gene locus_tag LOCUS_11240 795 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 998 840 gene locus_tag LOCUS_11250 998 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 1600 1286 gene locus_tag LOCUS_11260 1600 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1999 2232 gene locus_tag LOCUS_11270 1999 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2229 2522 gene locus_tag LOCUS_11280 2229 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2760 2569 gene locus_tag LOCUS_11290 2760 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3071 3619 gene locus_tag LOCUS_11300 3071 3619 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_11300 3609 4340 gene locus_tag LOCUS_11310 3609 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 4353 4826 gene locus_tag LOCUS_11320 4353 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 4826 5512 gene locus_tag LOCUS_11330 4826 5512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 5509 5691 gene locus_tag LOCUS_11340 5509 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5719 5991 gene locus_tag LOCUS_11350 5719 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6007 7944 gene locus_tag LOCUS_11360 gene extM 6007 7944 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_11360 8065 10116 gene locus_tag LOCUS_11370 gene tkt 8065 10116 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142294.1 protein_id gnl|my_center|LOCUS_11370 10250 11935 gene locus_tag LOCUS_11380 10250 11935 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545176.1 protein_id gnl|my_center|LOCUS_11380 11932 12702 gene locus_tag LOCUS_11390 11932 12702 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545335.1 protein_id gnl|my_center|LOCUS_11390 12817 13587 gene locus_tag LOCUS_11400 12817 13587 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_11400 13597 14130 gene locus_tag LOCUS_11410 13597 14130 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931985.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence051 <1 646 gene locus_tag LOCUS_11420 <1 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545700.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit 646 1575 gene locus_tag LOCUS_11430 gene yhdJ 646 1575 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 protein_id gnl|my_center|LOCUS_11430 1572 2843 gene locus_tag LOCUS_11440 1572 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 3051 6368 gene locus_tag LOCUS_11450 gene carB 3051 6368 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546879.1 protein_id gnl|my_center|LOCUS_11450 6670 9078 gene locus_tag LOCUS_11460 gene gyrA 6670 9078 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545423.1 protein_id gnl|my_center|LOCUS_11460 9075 9782 gene locus_tag LOCUS_11470 9075 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 9905 10198 gene locus_tag LOCUS_11480 9905 10198 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_11480 10195 10563 gene locus_tag LOCUS_11490 10195 10563 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_11490 10652 13666 gene locus_tag LOCUS_11500 10652 13666 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036267.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence052 487 257 gene locus_tag LOCUS_11510 487 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 655 2538 gene locus_tag LOCUS_11520 gene mnmG 655 2538 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_11520 2541 4538 gene locus_tag LOCUS_11530 2541 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 4581 5336 gene locus_tag LOCUS_11540 4581 5336 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546017.1 protein_id gnl|my_center|LOCUS_11540 5357 6007 gene locus_tag LOCUS_11550 5357 6007 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546750.1 protein_id gnl|my_center|LOCUS_11550 7595 6030 gene locus_tag LOCUS_11560 gene rpoD 7595 6030 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_11560 9280 7592 gene locus_tag LOCUS_11570 gene dnaG 9280 7592 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546187.1 protein_id gnl|my_center|LOCUS_11570 10353 9397 gene locus_tag LOCUS_11580 10353 9397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545019.1 protein_id gnl|my_center|LOCUS_11580 10485 10937 gene locus_tag LOCUS_11590 10485 10937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 10965 11282 gene locus_tag LOCUS_11600 10965 11282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 12033 11764 gene locus_tag LOCUS_11610 12033 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 12469 12116 gene locus_tag LOCUS_11620 12469 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 13392 13231 gene locus_tag LOCUS_11630 13392 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence053 1539 820 gene locus_tag LOCUS_11640 1539 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2363 1554 gene locus_tag LOCUS_11650 gene prpC 2363 1554 CDS product protein-serine/threonine phosphatase PrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232064.1 protein_id gnl|my_center|LOCUS_11650 4850 2367 gene locus_tag LOCUS_11660 4850 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 6173 4926 gene locus_tag LOCUS_11670 6173 4926 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460386.1 protein_id gnl|my_center|LOCUS_11670 8475 6379 gene locus_tag LOCUS_11680 gene pnp 8475 6379 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_11680 8759 8490 gene locus_tag LOCUS_11690 gene rpsO 8759 8490 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546801.1 protein_id gnl|my_center|LOCUS_11690 9056 9730 gene locus_tag LOCUS_11700 9056 9730 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_11700 9867 10145 gene locus_tag LOCUS_11710 9867 10145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 10142 10426 gene locus_tag LOCUS_11720 10142 10426 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_11720 10594 11967 gene locus_tag LOCUS_11730 gene argH 10594 11967 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546455.1 protein_id gnl|my_center|LOCUS_11730 12096 12998 gene locus_tag LOCUS_11740 12096 12998 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546291.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence054 771 118 gene locus_tag LOCUS_11750 771 118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545462.1 protein_id gnl|my_center|LOCUS_11750 1463 768 gene locus_tag LOCUS_11760 1463 768 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_11760 2287 1460 gene locus_tag LOCUS_11770 2287 1460 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545230.1 protein_id gnl|my_center|LOCUS_11770 4457 2364 gene locus_tag LOCUS_11780 gene glyS 4457 2364 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544914.1 protein_id gnl|my_center|LOCUS_11780 4662 5834 gene locus_tag LOCUS_11790 4662 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 5943 6887 gene locus_tag LOCUS_11800 5943 6887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6892 7896 gene locus_tag LOCUS_11810 gene obgE 6892 7896 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_11810 8877 7909 gene locus_tag LOCUS_11820 8877 7909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 10040 9021 gene locus_tag LOCUS_11830 10040 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 10872 10069 gene locus_tag LOCUS_11840 gene dapB 10872 10069 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_11840 12422 10890 gene locus_tag LOCUS_11850 gene waaF 12422 10890 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544960.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence055 1088 309 gene locus_tag LOCUS_11860 gene trpA 1088 309 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546593.1 protein_id gnl|my_center|LOCUS_11860 2260 1085 gene locus_tag LOCUS_11870 gene trpB 2260 1085 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546381.1 protein_id gnl|my_center|LOCUS_11870 2922 2575 gene locus_tag LOCUS_11880 2922 2575 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546712.1 protein_id gnl|my_center|LOCUS_11880 3331 2903 gene locus_tag LOCUS_11890 3331 2903 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545605.1 protein_id gnl|my_center|LOCUS_11890 3416 4000 gene locus_tag LOCUS_11900 3416 4000 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546496.1 protein_id gnl|my_center|LOCUS_11900 3978 4520 gene locus_tag LOCUS_11910 gene ruvC 3978 4520 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_11910 4522 5907 gene locus_tag LOCUS_11920 4522 5907 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545680.1 protein_id gnl|my_center|LOCUS_11920 5992 6450 gene locus_tag LOCUS_11930 5992 6450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 8788 6431 gene locus_tag LOCUS_11940 8788 6431 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_11940 9513 8785 gene locus_tag LOCUS_11950 gene hisA 9513 8785 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545163.1 protein_id gnl|my_center|LOCUS_11950 9677 10363 gene locus_tag LOCUS_11960 9677 10363 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941333.1 protein_id gnl|my_center|LOCUS_11960 10360 11106 gene locus_tag LOCUS_11970 10360 11106 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_11970 11559 11137 gene locus_tag LOCUS_11980 gene speD 11559 11137 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545906.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence056 485 560 gene locus_tag LOCUS_t00190 485 560 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 656 1369 gene locus_tag LOCUS_11990 656 1369 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_11990 1366 1776 gene locus_tag LOCUS_12000 1366 1776 CDS product ribonuclease HI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546858.1 protein_id gnl|my_center|LOCUS_12000 1814 2737 gene locus_tag LOCUS_12010 1814 2737 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_12010 4365 2701 gene locus_tag LOCUS_12020 4365 2701 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393415.1 protein_id gnl|my_center|LOCUS_12020 4878 4462 gene locus_tag LOCUS_12030 4878 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5148 4888 gene locus_tag LOCUS_12040 5148 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 6982 5222 gene locus_tag LOCUS_12050 6982 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 7077 9359 gene locus_tag LOCUS_12060 7077 9359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 9651 9421 gene locus_tag LOCUS_12070 9651 9421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_12070 11978 10188 gene locus_tag LOCUS_12080 11978 10188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 12160 12381 gene locus_tag LOCUS_12090 12160 12381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence057 453 97 gene locus_tag LOCUS_12100 453 97 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546573.1 protein_id gnl|my_center|LOCUS_12100 742 464 gene locus_tag LOCUS_12110 gene gatC 742 464 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_12110 2844 739 gene locus_tag LOCUS_12120 2844 739 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546392.1 protein_id gnl|my_center|LOCUS_12120 4768 2912 gene locus_tag LOCUS_12130 gene glmS 4768 2912 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545099.1 protein_id gnl|my_center|LOCUS_12130 6325 4850 gene locus_tag LOCUS_12140 gene glmU 6325 4850 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545497.1 protein_id gnl|my_center|LOCUS_12140 6996 6322 gene locus_tag LOCUS_12150 6996 6322 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546603.1 protein_id gnl|my_center|LOCUS_12150 7833 7078 gene locus_tag LOCUS_12160 7833 7078 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_12160 9233 7848 gene locus_tag LOCUS_12170 gene atoC 9233 7848 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389139.1 protein_id gnl|my_center|LOCUS_12170 10137 9358 gene locus_tag LOCUS_12180 gene mtnP 10137 9358 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546405.1 protein_id gnl|my_center|LOCUS_12180 10541 10332 gene locus_tag LOCUS_12190 10541 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 10782 10570 gene locus_tag LOCUS_12200 10782 10570 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546825.1 protein_id gnl|my_center|LOCUS_12200 11081 10770 gene locus_tag LOCUS_12210 11081 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083794109.1 protein_id gnl|my_center|LOCUS_12210 11553 11170 gene locus_tag LOCUS_12220 11553 11170 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_12220 11761 11573 gene locus_tag LOCUS_12230 11761 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 12138 11941 gene locus_tag LOCUS_12240 12138 11941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence058 66 479 gene locus_tag LOCUS_12250 66 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 476 1864 gene locus_tag LOCUS_12260 476 1864 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942788.1 protein_id gnl|my_center|LOCUS_12260 2178 2504 gene locus_tag LOCUS_12270 2178 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 2519 2821 gene locus_tag LOCUS_12280 2519 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3017 3406 gene locus_tag LOCUS_12290 gene crdA 3017 3406 CDS product copper resistance determinant CrdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731617.1 protein_id gnl|my_center|LOCUS_12290 3390 4817 gene locus_tag LOCUS_12300 3390 4817 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_12300 4814 6049 gene locus_tag LOCUS_12310 4814 6049 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946754.1 protein_id gnl|my_center|LOCUS_12310 6084 6482 gene locus_tag LOCUS_12320 6084 6482 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_12320 6479 9733 gene locus_tag LOCUS_12330 6479 9733 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444632.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence059 1386 1979 gene locus_tag LOCUS_12340 gene cysC 1386 1979 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245829.1 protein_id gnl|my_center|LOCUS_12340 3158 2034 gene locus_tag LOCUS_12350 3158 2034 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_12350 3482 3838 gene locus_tag LOCUS_12360 3482 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3838 4200 gene locus_tag LOCUS_12370 3838 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4704 8081 gene locus_tag LOCUS_12380 4704 8081 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_12380 8085 9104 gene locus_tag LOCUS_12390 8085 9104 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014498593.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence060 1752 1558 gene locus_tag LOCUS_12400 1752 1558 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_12400 1818 2288 gene locus_tag LOCUS_12410 1818 2288 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546757.1 protein_id gnl|my_center|LOCUS_12410 2389 3915 gene locus_tag LOCUS_12420 2389 3915 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546737.1 protein_id gnl|my_center|LOCUS_12420 3915 5030 gene locus_tag LOCUS_12430 gene ccsB 3915 5030 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544936.1 protein_id gnl|my_center|LOCUS_12430 5104 5943 gene locus_tag LOCUS_12440 gene htpX 5104 5943 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_12440 5964 6950 gene locus_tag LOCUS_12450 5964 6950 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_12450 6911 8140 gene locus_tag LOCUS_12460 6911 8140 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_12460 8155 9267 gene locus_tag LOCUS_12470 8155 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_12470 9444 10031 gene locus_tag LOCUS_12480 9444 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 10414 10863 gene locus_tag LOCUS_12490 10414 10863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 10826 11518 gene locus_tag LOCUS_12500 10826 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence061 34 2280 gene locus_tag LOCUS_12510 gene glgB 34 2280 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_12510 2270 3343 gene locus_tag LOCUS_12520 gene hemH 2270 3343 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880584.1 protein_id gnl|my_center|LOCUS_12520 3331 4737 gene locus_tag LOCUS_12530 gene hemG 3331 4737 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_12530 4739 4969 gene locus_tag LOCUS_12540 4739 4969 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_12540 5110 6762 gene locus_tag LOCUS_12550 gene ilvD 5110 6762 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546643.1 protein_id gnl|my_center|LOCUS_12550 7244 6882 gene locus_tag LOCUS_12560 7244 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 7470 7246 gene locus_tag LOCUS_12570 7470 7246 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149266694.1 protein_id gnl|my_center|LOCUS_12570 7662 9395 gene locus_tag LOCUS_12580 gene ilvB 7662 9395 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_12580 9492 9977 gene locus_tag LOCUS_12590 gene ilvN 9492 9977 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545180.1 protein_id gnl|my_center|LOCUS_12590 9999 10388 gene locus_tag LOCUS_12600 9999 10388 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545038.1 protein_id gnl|my_center|LOCUS_12600 10601 10969 gene locus_tag LOCUS_12610 10601 10969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 10924 11436 gene locus_tag LOCUS_12620 10924 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 11784 11488 gene locus_tag LOCUS_12630 11784 11488 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869995.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence062 414 800 gene locus_tag LOCUS_12640 414 800 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545438.1 protein_id gnl|my_center|LOCUS_12640 1267 797 gene locus_tag LOCUS_12650 gene rimI 1267 797 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942401.1 protein_id gnl|my_center|LOCUS_12650 2031 1249 gene locus_tag LOCUS_12660 gene tsaB 2031 1249 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393646.1 protein_id gnl|my_center|LOCUS_12660 3268 2066 gene locus_tag LOCUS_12670 3268 2066 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924850.1 protein_id gnl|my_center|LOCUS_12670 3342 4244 gene locus_tag LOCUS_12680 3342 4244 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_12680 4241 5011 gene locus_tag LOCUS_12690 4241 5011 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059649.1 protein_id gnl|my_center|LOCUS_12690 5011 5805 gene locus_tag LOCUS_12700 5011 5805 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172542.1 protein_id gnl|my_center|LOCUS_12700 6005 6484 gene locus_tag LOCUS_12710 6005 6484 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_12710 6486 7274 gene locus_tag LOCUS_12720 gene cdaA 6486 7274 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_12720 7271 7912 gene locus_tag LOCUS_12730 7271 7912 CDS product CdaR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545937.1 protein_id gnl|my_center|LOCUS_12730 8048 9391 gene locus_tag LOCUS_12740 gene glmM 8048 9391 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546798.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence063 710 522 gene locus_tag LOCUS_12750 710 522 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546194.1 protein_id gnl|my_center|LOCUS_12750 2276 897 gene locus_tag LOCUS_12760 gene norB 2276 897 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_12760 2962 2273 gene locus_tag LOCUS_12770 2962 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3917 3090 gene locus_tag LOCUS_12780 3917 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4388 3918 gene locus_tag LOCUS_12790 4388 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 4608 4381 gene locus_tag LOCUS_12800 4608 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 6911 4608 gene locus_tag LOCUS_12810 6911 4608 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_12810 7283 6912 gene locus_tag LOCUS_12820 7283 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 8706 7351 gene locus_tag LOCUS_12830 8706 7351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 9706 9023 gene locus_tag LOCUS_12840 9706 9023 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542425.1 protein_id gnl|my_center|LOCUS_12840 11315 9678 gene locus_tag LOCUS_12850 11315 9678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808106.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence064 2509 1334 gene locus_tag LOCUS_12860 gene alaC 2509 1334 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_12860 3291 2599 gene locus_tag LOCUS_12870 gene lipA 3291 2599 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_12870 3610 4446 gene locus_tag LOCUS_12880 3610 4446 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 protein_id gnl|my_center|LOCUS_12880 5243 4494 gene locus_tag LOCUS_12890 5243 4494 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_12890 6158 5331 gene locus_tag LOCUS_12900 6158 5331 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_12900 6703 6358 gene locus_tag LOCUS_tm00010 6703 6358 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 7171 6728 gene locus_tag LOCUS_12910 gene smpB 7171 6728 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_12910 7582 7238 gene locus_tag LOCUS_12920 7582 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 8220 7642 gene locus_tag LOCUS_12930 8220 7642 CDS product Fe-Mn family superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941819.1 protein_id gnl|my_center|LOCUS_12930 9263 8226 gene locus_tag LOCUS_12940 gene hemE 9263 8226 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944063.1 protein_id gnl|my_center|LOCUS_12940 10333 9260 gene locus_tag LOCUS_12950 10333 9260 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_12950 <11412 10777 gene locus_tag LOCUS_12960 <11412 10777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:caspase family protein >Feature sequence065 437 249 gene locus_tag LOCUS_12970 437 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 760 434 gene locus_tag LOCUS_12980 760 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 981 906 gene locus_tag LOCUS_t00200 981 906 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1139 1065 gene locus_tag LOCUS_t00210 1139 1065 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1307 2794 gene locus_tag LOCUS_12990 gene trpE 1307 2794 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546555.1 protein_id gnl|my_center|LOCUS_12990 2798 3367 gene locus_tag LOCUS_13000 2798 3367 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_13000 3382 4638 gene locus_tag LOCUS_13010 3382 4638 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545857.1 protein_id gnl|my_center|LOCUS_13010 4639 5160 gene locus_tag LOCUS_13020 4639 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 6189 5179 gene locus_tag LOCUS_13030 gene trpD 6189 5179 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943017.1 protein_id gnl|my_center|LOCUS_13030 6478 6284 gene locus_tag LOCUS_13040 6478 6284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 7503 6478 gene locus_tag LOCUS_13050 7503 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 8710 7517 gene locus_tag LOCUS_13060 8710 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 9810 8773 gene locus_tag LOCUS_13070 9810 8773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 9968 9807 gene locus_tag LOCUS_13080 9968 9807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence066 819 953 gene locus_tag LOCUS_13090 819 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 1046 1327 gene locus_tag LOCUS_13100 1046 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1314 1655 gene locus_tag LOCUS_13110 1314 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545064.1 protein_id gnl|my_center|LOCUS_13110 1665 2165 gene locus_tag LOCUS_13120 1665 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 2124 2147 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2365 2559 gene locus_tag LOCUS_13130 2365 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2563 3333 gene locus_tag LOCUS_13140 2563 3333 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545061.1 protein_id gnl|my_center|LOCUS_13140 3414 3986 gene locus_tag LOCUS_13150 3414 3986 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546346.1 protein_id gnl|my_center|LOCUS_13150 3973 4890 gene locus_tag LOCUS_13160 3973 4890 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546869.1 protein_id gnl|my_center|LOCUS_13160 4883 5872 gene locus_tag LOCUS_13170 4883 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5896 6645 gene locus_tag LOCUS_13180 gene trmD 5896 6645 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545349.1 protein_id gnl|my_center|LOCUS_13180 6632 6994 gene locus_tag LOCUS_13190 gene rplS 6632 6994 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_13190 6994 7614 gene locus_tag LOCUS_13200 6994 7614 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546482.1 protein_id gnl|my_center|LOCUS_13200 7689 8339 gene locus_tag LOCUS_13210 7689 8339 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274356.1 protein_id gnl|my_center|LOCUS_13210 8380 9636 gene locus_tag LOCUS_13220 gene miaB 8380 9636 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_13220 <11207 10223 gene locus_tag LOCUS_13230 <11207 10223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023369.1:DUF362 domain-containing protein >Feature sequence067 116 1885 gene locus_tag LOCUS_13240 116 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1929 3338 gene locus_tag LOCUS_13250 1929 3338 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_13250 3325 4158 gene locus_tag LOCUS_13260 3325 4158 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546049.1 protein_id gnl|my_center|LOCUS_13260 6221 4248 gene locus_tag LOCUS_13270 6221 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 7378 6218 gene locus_tag LOCUS_13280 7378 6218 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807655.1 protein_id gnl|my_center|LOCUS_13280 7597 8121 gene locus_tag LOCUS_13290 gene pyrR 7597 8121 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_13290 8141 9064 gene locus_tag LOCUS_13300 8141 9064 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545982.1 protein_id gnl|my_center|LOCUS_13300 9196 10530 gene locus_tag LOCUS_13310 9196 10530 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence068 585 460 gene locus_tag LOCUS_13320 585 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2371 845 gene locus_tag LOCUS_13330 2371 845 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546159.1 protein_id gnl|my_center|LOCUS_13330 2515 2712 gene locus_tag LOCUS_13340 2515 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2965 2606 gene locus_tag LOCUS_13350 2965 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3681 2962 gene locus_tag LOCUS_13360 gene tpiA 3681 2962 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_13360 5606 3738 gene locus_tag LOCUS_13370 5606 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545003.1 protein_id gnl|my_center|LOCUS_13370 5869 6795 gene locus_tag LOCUS_13380 gene mdh 5869 6795 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545039.1 protein_id gnl|my_center|LOCUS_13380 6811 7224 gene locus_tag LOCUS_13390 gene ndk 6811 7224 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_13390 7309 9753 gene locus_tag LOCUS_13400 7309 9753 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545172.1 protein_id gnl|my_center|LOCUS_13400 9797 10330 gene locus_tag LOCUS_13410 9797 10330 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546342.1 protein_id gnl|my_center|LOCUS_13410 10345 10794 gene locus_tag LOCUS_13420 10345 10794 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_13420 10745 10784 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence069 <1 1137 gene locus_tag LOCUS_13430 <1 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546845.1:prephenate dehydratase 1137 2273 gene locus_tag LOCUS_13440 gene hisC 1137 2273 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546009.1 protein_id gnl|my_center|LOCUS_13440 2345 3370 gene locus_tag LOCUS_13450 gene aroF 2345 3370 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_13450 3422 4354 gene locus_tag LOCUS_13460 3422 4354 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545810.1 protein_id gnl|my_center|LOCUS_13460 4344 5693 gene locus_tag LOCUS_13470 gene aroA 4344 5693 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_13470 5834 6550 gene locus_tag LOCUS_13480 gene cmk 5834 6550 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546614.1 protein_id gnl|my_center|LOCUS_13480 6547 7170 gene locus_tag LOCUS_13490 6547 7170 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_13490 7236 8069 gene locus_tag LOCUS_13500 gene ispH 7236 8069 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544912.1 protein_id gnl|my_center|LOCUS_13500 8074 9648 gene locus_tag LOCUS_13510 8074 9648 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546647.1 protein_id gnl|my_center|LOCUS_13510 9645 10493 gene locus_tag LOCUS_13520 gene sppA 9645 10493 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_13520 >Feature sequence070 99 797 gene locus_tag LOCUS_13530 99 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142339.1 protein_id gnl|my_center|LOCUS_13530 1228 3213 gene locus_tag LOCUS_13540 1228 3213 CDS product monovalent cation:proton antiporter-2 (CPA2) family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546696.1 protein_id gnl|my_center|LOCUS_13540 3849 4430 gene locus_tag LOCUS_13550 3849 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4502 5734 gene locus_tag LOCUS_13560 4502 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5766 6809 gene locus_tag LOCUS_13570 5766 6809 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_13570 6880 7737 gene locus_tag LOCUS_13580 6880 7737 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_13580 7761 8042 gene locus_tag LOCUS_13590 7761 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 8989 8129 gene locus_tag LOCUS_13600 gene mpgP 8989 8129 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_13600 9807 9073 gene locus_tag LOCUS_13610 9807 9073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 10207 9911 gene locus_tag LOCUS_13620 10207 9911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence071 359 162 gene locus_tag LOCUS_13630 359 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 691 479 gene locus_tag LOCUS_13640 691 479 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_13640 945 691 gene locus_tag LOCUS_13650 945 691 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_13650 1567 1064 gene locus_tag LOCUS_13660 1567 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1558 1725 gene locus_tag LOCUS_13670 1558 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 2069 2836 gene locus_tag LOCUS_13680 2069 2836 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_13680 3952 2954 gene locus_tag LOCUS_13690 3952 2954 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546734.1 protein_id gnl|my_center|LOCUS_13690 5113 3965 gene locus_tag LOCUS_13700 gene bioF 5113 3965 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545441.1 protein_id gnl|my_center|LOCUS_13700 5280 5699 gene locus_tag LOCUS_13710 5280 5699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 5696 6340 gene locus_tag LOCUS_13720 gene atpF 5696 6340 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_13720 6337 6876 gene locus_tag LOCUS_13730 gene atpH 6337 6876 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546284.1 protein_id gnl|my_center|LOCUS_13730 6881 8389 gene locus_tag LOCUS_13740 gene atpA 6881 8389 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_13740 8476 9345 gene locus_tag LOCUS_13750 gene atpG 8476 9345 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544924.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence072 1451 669 gene locus_tag LOCUS_13760 1451 669 CDS product 6-carboxyhexanoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051345777.1 protein_id gnl|my_center|LOCUS_13760 2415 1453 gene locus_tag LOCUS_13770 gene bioB 2415 1453 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546730.1 protein_id gnl|my_center|LOCUS_13770 2693 3247 gene locus_tag LOCUS_13780 2693 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 3271 3570 gene locus_tag LOCUS_13790 3271 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3555 3797 gene locus_tag LOCUS_13800 3555 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 4029 4496 gene locus_tag LOCUS_13810 4029 4496 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_13810 4549 5583 gene locus_tag LOCUS_13820 4549 5583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5552 6664 gene locus_tag LOCUS_13830 5552 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6767 7630 gene locus_tag LOCUS_13840 6767 7630 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948171.1 protein_id gnl|my_center|LOCUS_13840 7634 8404 gene locus_tag LOCUS_13850 7634 8404 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003895384.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence073 148 159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 682 702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1803 703 gene locus_tag LOCUS_13860 gene ald 1803 703 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942929.1 protein_id gnl|my_center|LOCUS_13860 1952 2479 gene locus_tag LOCUS_13870 1952 2479 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_13870 2728 3777 gene locus_tag LOCUS_13880 2728 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 4551 3769 gene locus_tag LOCUS_13890 gene lgt 4551 3769 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_13890 5069 4704 gene locus_tag LOCUS_13900 5069 4704 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545111.1 protein_id gnl|my_center|LOCUS_13900 5377 5066 gene locus_tag LOCUS_13910 5377 5066 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_13910 6695 5709 gene locus_tag LOCUS_13920 6695 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 7845 6811 gene locus_tag LOCUS_13930 7845 6811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 8879 8202 gene locus_tag LOCUS_13940 8879 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 9047 9283 gene locus_tag LOCUS_13950 9047 9283 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence074 774 160 gene locus_tag LOCUS_13960 774 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13960 1662 817 gene locus_tag LOCUS_13970 1662 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13970 2453 1776 gene locus_tag LOCUS_13980 2453 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3100 2513 gene locus_tag LOCUS_13990 3100 2513 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_13990 3610 3113 gene locus_tag LOCUS_14000 3610 3113 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_14000 4655 3705 gene locus_tag LOCUS_14010 4655 3705 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_14010 5926 4733 gene locus_tag LOCUS_14020 5926 4733 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_14020 6222 5926 gene locus_tag LOCUS_14030 6222 5926 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_14030 6794 6219 gene locus_tag LOCUS_14040 6794 6219 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545865.1 protein_id gnl|my_center|LOCUS_14040 7000 7329 gene locus_tag LOCUS_14050 7000 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 7335 7646 gene locus_tag LOCUS_14060 7335 7646 CDS product addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127482.1 protein_id gnl|my_center|LOCUS_14060 7860 8201 gene locus_tag LOCUS_14070 7860 8201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 8204 8476 gene locus_tag LOCUS_14080 8204 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331494.1 protein_id gnl|my_center|LOCUS_14080 8882 8601 gene locus_tag LOCUS_14090 8882 8601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 9243 8983 gene locus_tag LOCUS_14100 9243 8983 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence075 208 594 gene locus_tag LOCUS_14110 gene gcvH 208 594 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545115.1 protein_id gnl|my_center|LOCUS_14110 591 1979 gene locus_tag LOCUS_14120 gene lpdA 591 1979 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436922.1 protein_id gnl|my_center|LOCUS_14120 1982 3370 gene locus_tag LOCUS_14130 1982 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3383 4660 gene locus_tag LOCUS_14140 gene eno 3383 4660 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546738.1 protein_id gnl|my_center|LOCUS_14140 4657 4983 gene locus_tag LOCUS_14150 4657 4983 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546062.1 protein_id gnl|my_center|LOCUS_14150 5014 7215 gene locus_tag LOCUS_14160 5014 7215 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence076 183 1436 gene locus_tag LOCUS_14170 183 1436 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525115.1 protein_id gnl|my_center|LOCUS_14170 2814 1447 gene locus_tag LOCUS_14180 2814 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 4001 2784 gene locus_tag LOCUS_14190 4001 2784 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_14190 5680 4004 gene locus_tag LOCUS_14200 5680 4004 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_14200 7551 5683 gene locus_tag LOCUS_14210 7551 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 <9282 7794 gene locus_tag LOCUS_14220 <9282 7794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272524.1:folylpolyglutamate synthase/dihydrofolate synthase family protein >Feature sequence077 228 440 gene locus_tag LOCUS_14230 228 440 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119262.1 protein_id gnl|my_center|LOCUS_14230 750 1340 gene locus_tag LOCUS_14240 750 1340 CDS product disulfide bond formation protein D, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546591.1 transl_except (pos:900..902,aa:Sec) note codon on position 51 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_14240 1327 2598 gene locus_tag LOCUS_14250 1327 2598 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_14250 3806 2595 gene locus_tag LOCUS_14260 3806 2595 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_14260 3951 3877 gene locus_tag LOCUS_t00220 3951 3877 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5245 3992 gene locus_tag LOCUS_14270 5245 3992 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545855.1 protein_id gnl|my_center|LOCUS_14270 6109 5288 gene locus_tag LOCUS_14280 6109 5288 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842806.1 protein_id gnl|my_center|LOCUS_14280 6238 6360 gene locus_tag LOCUS_14290 6238 6360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 7211 6396 gene locus_tag LOCUS_14300 gene mtgA 7211 6396 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842177.1 protein_id gnl|my_center|LOCUS_14300 7368 7772 gene locus_tag LOCUS_14310 7368 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 7928 8425 gene locus_tag LOCUS_14320 7928 8425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8422 8868 gene locus_tag LOCUS_14330 8422 8868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence078 1535 300 gene locus_tag LOCUS_14340 gene hemL 1535 300 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_14340 1764 2018 gene locus_tag LOCUS_14350 1764 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941301.1 protein_id gnl|my_center|LOCUS_14350 2015 3085 gene locus_tag LOCUS_14360 2015 3085 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_14360 3069 4541 gene locus_tag LOCUS_14370 3069 4541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4743 4931 gene locus_tag LOCUS_14380 4743 4931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 4931 5197 gene locus_tag LOCUS_14390 4931 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226987603.1 protein_id gnl|my_center|LOCUS_14390 5227 6252 gene locus_tag LOCUS_14400 5227 6252 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_14400 6375 6704 gene locus_tag LOCUS_14410 6375 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 7742 7044 gene locus_tag LOCUS_14420 7742 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence079 2924 3112 gene locus_tag LOCUS_14430 2924 3112 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_14430 3388 3161 gene locus_tag LOCUS_14440 3388 3161 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941148.1 protein_id gnl|my_center|LOCUS_14440 3539 4006 gene locus_tag LOCUS_14450 3539 4006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 5352 4225 gene locus_tag LOCUS_14460 gene mnmA 5352 4225 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545186.1 protein_id gnl|my_center|LOCUS_14460 5486 5758 gene locus_tag LOCUS_14470 5486 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 5758 6024 gene locus_tag LOCUS_14480 5758 6024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 6522 6100 gene locus_tag LOCUS_14490 6522 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 8696 6519 gene locus_tag LOCUS_14500 8696 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence080 1719 343 gene locus_tag LOCUS_14510 1719 343 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546113.1 protein_id gnl|my_center|LOCUS_14510 3185 1758 gene locus_tag LOCUS_14520 3185 1758 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545017.1 protein_id gnl|my_center|LOCUS_14520 3291 3941 gene locus_tag LOCUS_14530 3291 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 6675 4006 gene locus_tag LOCUS_14540 gene ppdK 6675 4006 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546740.1 protein_id gnl|my_center|LOCUS_14540 6942 7550 gene locus_tag LOCUS_14550 6942 7550 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_14550 <8800 7560 gene locus_tag LOCUS_14560 <8800 7560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545178.1:radical SAM protein >Feature sequence081 320 30 gene locus_tag LOCUS_14570 320 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 609 956 gene locus_tag LOCUS_14580 gene rplU 609 956 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419082.1 protein_id gnl|my_center|LOCUS_14580 946 1230 gene locus_tag LOCUS_14590 gene rpmA 946 1230 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_14590 2146 1277 gene locus_tag LOCUS_14600 2146 1277 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948584.1 protein_id gnl|my_center|LOCUS_14600 2194 2592 gene locus_tag LOCUS_14610 2194 2592 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582920.1 protein_id gnl|my_center|LOCUS_14610 2579 3046 gene locus_tag LOCUS_14620 2579 3046 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582921.1 protein_id gnl|my_center|LOCUS_14620 3043 3342 gene locus_tag LOCUS_14630 3043 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 3799 3374 gene locus_tag LOCUS_14640 3799 3374 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053094555.1 protein_id gnl|my_center|LOCUS_14640 4218 3796 gene locus_tag LOCUS_14650 4218 3796 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876047.1 protein_id gnl|my_center|LOCUS_14650 4344 4718 gene locus_tag LOCUS_14660 4344 4718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 4690 5169 gene locus_tag LOCUS_14670 4690 5169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_14670 5601 5359 gene locus_tag LOCUS_14680 5601 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 5863 5615 gene locus_tag LOCUS_14690 5863 5615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 6233 5967 gene locus_tag LOCUS_14700 6233 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 6739 6389 gene locus_tag LOCUS_14710 6739 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 6991 6746 gene locus_tag LOCUS_14720 6991 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7130 7155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7564 7667 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7913 8218 gene locus_tag LOCUS_14730 7913 8218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence082 1017 46 gene locus_tag LOCUS_14740 1017 46 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546428.1 protein_id gnl|my_center|LOCUS_14740 1149 2144 gene locus_tag LOCUS_14750 gene galT 1149 2144 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_14750 2295 3755 gene locus_tag LOCUS_14760 gene glgA 2295 3755 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546609.1 protein_id gnl|my_center|LOCUS_14760 3766 6987 gene locus_tag LOCUS_14770 3766 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 7056 7406 gene locus_tag LOCUS_14780 7056 7406 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_14780 7406 8635 gene locus_tag LOCUS_14790 7406 8635 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880115.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence083 118 1452 gene locus_tag LOCUS_14800 118 1452 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545993.1 protein_id gnl|my_center|LOCUS_14800 1649 2641 gene locus_tag LOCUS_14810 1649 2641 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_14810 2735 5860 gene locus_tag LOCUS_14820 2735 5860 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942256.1 protein_id gnl|my_center|LOCUS_14820 5880 6980 gene locus_tag LOCUS_14830 5880 6980 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942127.1 protein_id gnl|my_center|LOCUS_14830 6977 8509 gene locus_tag LOCUS_14840 6977 8509 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546639.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence084 1980 652 gene locus_tag LOCUS_14850 1980 652 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545828.1 protein_id gnl|my_center|LOCUS_14850 3188 2022 gene locus_tag LOCUS_14860 3188 2022 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546667.1 protein_id gnl|my_center|LOCUS_14860 4154 3276 gene locus_tag LOCUS_14870 gene ftsX 4154 3276 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942418.1 protein_id gnl|my_center|LOCUS_14870 4816 4154 gene locus_tag LOCUS_14880 gene ftsE 4816 4154 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544942.1 protein_id gnl|my_center|LOCUS_14880 5943 4927 gene locus_tag LOCUS_14890 5943 4927 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545386.1 protein_id gnl|my_center|LOCUS_14890 6775 5936 gene locus_tag LOCUS_14900 6775 5936 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_14900 7158 6772 gene locus_tag LOCUS_14910 7158 6772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 <8432 7360 gene locus_tag LOCUS_14920 <8432 7360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_178371597.1:molybdopterin-dependent oxidoreductase >Feature sequence085 1959 13 gene locus_tag LOCUS_14930 1959 13 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546396.1 protein_id gnl|my_center|LOCUS_14930 2170 4026 gene locus_tag LOCUS_14940 2170 4026 CDS product TIGR04442 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943104.1 protein_id gnl|my_center|LOCUS_14940 4096 5025 gene locus_tag LOCUS_14950 gene cysK 4096 5025 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_14950 6188 5079 gene locus_tag LOCUS_14960 6188 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 7044 6196 gene locus_tag LOCUS_14970 7044 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 7447 7112 gene locus_tag LOCUS_14980 7447 7112 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584113.1 protein_id gnl|my_center|LOCUS_14980 8135 7449 gene locus_tag LOCUS_14990 gene cbiM 8135 7449 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584114.1 protein_id gnl|my_center|LOCUS_14990 >Feature sequence086 268 525 gene locus_tag LOCUS_15000 gene hfq 268 525 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965139.1 protein_id gnl|my_center|LOCUS_15000 571 1236 gene locus_tag LOCUS_15010 571 1236 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546615.1 protein_id gnl|my_center|LOCUS_15010 1368 2603 gene locus_tag LOCUS_15020 1368 2603 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545541.1 protein_id gnl|my_center|LOCUS_15020 2711 3844 gene locus_tag LOCUS_15030 2711 3844 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_15030 3854 5116 gene locus_tag LOCUS_15040 3854 5116 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_15040 5213 5605 gene locus_tag LOCUS_15050 5213 5605 CDS product Lpp/OprI family alanine-zipper lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545357.1 protein_id gnl|my_center|LOCUS_15050 6566 5670 gene locus_tag LOCUS_15060 6566 5670 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545473.1 protein_id gnl|my_center|LOCUS_15060 6707 8089 gene locus_tag LOCUS_15070 6707 8089 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924851.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence087 1963 941 gene locus_tag LOCUS_15080 1963 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2111 2872 gene locus_tag LOCUS_15090 gene fdhD 2111 2872 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_15090 2964 3998 gene locus_tag LOCUS_15100 gene gnfL 2964 3998 CDS product nitrogen fixation sensor histidine kinase GnfL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941669.1 protein_id gnl|my_center|LOCUS_15100 4008 5393 gene locus_tag LOCUS_15110 gene gnfM 4008 5393 CDS product nitrogen fixation sigma-54 dependent transcriptional regulator GnfM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941668.1 protein_id gnl|my_center|LOCUS_15110 5810 5421 gene locus_tag LOCUS_15120 5810 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 6010 5816 gene locus_tag LOCUS_15130 6010 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 6395 7078 gene locus_tag LOCUS_15140 6395 7078 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948714.1 protein_id gnl|my_center|LOCUS_15140 7162 7374 gene locus_tag LOCUS_15150 7162 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 7353 7835 gene locus_tag LOCUS_15160 7353 7835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence088 681 55 gene locus_tag LOCUS_15170 681 55 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545244.1 protein_id gnl|my_center|LOCUS_15170 1590 856 gene locus_tag LOCUS_15180 1590 856 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545862.1 protein_id gnl|my_center|LOCUS_15180 2482 1631 gene locus_tag LOCUS_15190 2482 1631 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_15190 2894 2457 gene locus_tag LOCUS_15200 2894 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 3631 2924 gene locus_tag LOCUS_15210 gene pgeF 3631 2924 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545414.1 protein_id gnl|my_center|LOCUS_15210 5350 3743 gene locus_tag LOCUS_15220 5350 3743 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_15220 5842 5522 gene locus_tag LOCUS_15230 5842 5522 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392910.1 protein_id gnl|my_center|LOCUS_15230 6201 5809 gene locus_tag LOCUS_15240 6201 5809 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545820.1 protein_id gnl|my_center|LOCUS_15240 7176 6268 gene locus_tag LOCUS_15250 7176 6268 CDS product DUF4384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545313.1 protein_id gnl|my_center|LOCUS_15250 <7898 7177 gene locus_tag LOCUS_15260 <7898 7177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545144.1:caspase family protein >Feature sequence089 310 14 gene locus_tag LOCUS_15270 310 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1003 545 gene locus_tag LOCUS_15280 1003 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2518 1040 gene locus_tag LOCUS_15290 gene lysS 2518 1040 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_15290 5293 2576 gene locus_tag LOCUS_15300 5293 2576 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545171.1 protein_id gnl|my_center|LOCUS_15300 6309 5470 gene locus_tag LOCUS_15310 6309 5470 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545587.1 protein_id gnl|my_center|LOCUS_15310 6704 6453 gene locus_tag LOCUS_15320 6704 6453 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978877.1 protein_id gnl|my_center|LOCUS_15320 7134 6724 gene locus_tag LOCUS_15330 7134 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 7495 7136 gene locus_tag LOCUS_15340 7495 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 7802 7506 gene locus_tag LOCUS_15350 7802 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence090 576 52 gene locus_tag LOCUS_15360 576 52 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924863.1 protein_id gnl|my_center|LOCUS_15360 781 1275 gene locus_tag LOCUS_15370 781 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 1481 1969 gene locus_tag LOCUS_15380 1481 1969 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546005.1 protein_id gnl|my_center|LOCUS_15380 2023 2277 gene locus_tag LOCUS_15390 2023 2277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 2342 3424 gene locus_tag LOCUS_15400 gene waaC 2342 3424 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_15400 3492 3761 gene locus_tag LOCUS_15410 3492 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 3825 4127 gene locus_tag LOCUS_15420 3825 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4215 4385 gene locus_tag LOCUS_15430 4215 4385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4398 6170 gene locus_tag LOCUS_15440 4398 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 6234 7319 gene locus_tag LOCUS_15450 6234 7319 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829995.1 protein_id gnl|my_center|LOCUS_15450 7446 7673 gene locus_tag LOCUS_15460 7446 7673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence091 338 676 gene locus_tag LOCUS_15470 gene arsD 338 676 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948467.1 protein_id gnl|my_center|LOCUS_15470 678 2528 gene locus_tag LOCUS_15480 gene arsA 678 2528 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890458.1 protein_id gnl|my_center|LOCUS_15480 3178 2537 gene locus_tag LOCUS_15490 3178 2537 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942478.1 protein_id gnl|my_center|LOCUS_15490 4873 3212 gene locus_tag LOCUS_15500 4873 3212 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262712.1 protein_id gnl|my_center|LOCUS_15500 5835 4990 gene locus_tag LOCUS_15510 gene folP 5835 4990 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545277.1 protein_id gnl|my_center|LOCUS_15510 7640 5832 gene locus_tag LOCUS_15520 gene ftsH 7640 5832 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545429.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence092 2787 2380 gene locus_tag LOCUS_15530 2787 2380 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392211.1 protein_id gnl|my_center|LOCUS_15530 3038 2784 gene locus_tag LOCUS_15540 3038 2784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3646 3200 gene locus_tag LOCUS_15550 3646 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 5253 3703 gene locus_tag LOCUS_15560 5253 3703 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546350.1 protein_id gnl|my_center|LOCUS_15560 6432 5425 gene locus_tag LOCUS_15570 6432 5425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546408.1 protein_id gnl|my_center|LOCUS_15570 7621 6530 gene locus_tag LOCUS_15580 7621 6530 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545470.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence093 1468 533 gene locus_tag LOCUS_15590 1468 533 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_15590 1688 3496 gene locus_tag LOCUS_15600 gene typA 1688 3496 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_15600 3508 4674 gene locus_tag LOCUS_15610 3508 4674 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819957.1 protein_id gnl|my_center|LOCUS_15610 4687 5262 gene locus_tag LOCUS_15620 4687 5262 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020793.1 protein_id gnl|my_center|LOCUS_15620 5666 5292 gene locus_tag LOCUS_15630 5666 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 7282 5996 gene locus_tag LOCUS_15640 7282 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence094 <1 1306 gene locus_tag LOCUS_15650 <1 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546293.1:F0F1 ATP synthase subunit beta 1383 1793 gene locus_tag LOCUS_15660 1383 1793 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545870.1 protein_id gnl|my_center|LOCUS_15660 2120 1803 gene locus_tag LOCUS_15670 2120 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 2293 2114 gene locus_tag LOCUS_15680 2293 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3374 2466 gene locus_tag LOCUS_15690 3374 2466 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_15690 3549 4166 gene locus_tag LOCUS_15700 3549 4166 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545344.1 protein_id gnl|my_center|LOCUS_15700 4341 4976 gene locus_tag LOCUS_15710 gene nth 4341 4976 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065874.1 protein_id gnl|my_center|LOCUS_15710 4973 5947 gene locus_tag LOCUS_15720 4973 5947 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545308.1 protein_id gnl|my_center|LOCUS_15720 7064 5991 gene locus_tag LOCUS_15730 7064 5991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942536.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence095 35 943 gene locus_tag LOCUS_15740 35 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 970 2571 gene locus_tag LOCUS_15750 gene metG 970 2571 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545288.1 protein_id gnl|my_center|LOCUS_15750 2655 3920 gene locus_tag LOCUS_15760 2655 3920 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_15760 4359 3940 gene locus_tag LOCUS_15770 4359 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 4954 4361 gene locus_tag LOCUS_15780 gene recR 4954 4361 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545737.1 protein_id gnl|my_center|LOCUS_15780 5895 5020 gene locus_tag LOCUS_15790 5895 5020 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546183.1 protein_id gnl|my_center|LOCUS_15790 6305 5892 gene locus_tag LOCUS_15800 6305 5892 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_15800 6502 6777 gene locus_tag LOCUS_15810 6502 6777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 6774 7133 gene locus_tag LOCUS_15820 6774 7133 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence096 1618 29 gene locus_tag LOCUS_15830 1618 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 2246 1728 gene locus_tag LOCUS_15840 gene amrA 2246 1728 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546745.1 protein_id gnl|my_center|LOCUS_15840 3228 2248 gene locus_tag LOCUS_15850 3228 2248 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546623.1 protein_id gnl|my_center|LOCUS_15850 4306 3248 gene locus_tag LOCUS_15860 gene mtnA 4306 3248 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546184.1 protein_id gnl|my_center|LOCUS_15860 5330 4350 gene locus_tag LOCUS_15870 5330 4350 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_15870 6301 5327 gene locus_tag LOCUS_15880 6301 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 <7171 6301 gene locus_tag LOCUS_15890 <7171 6301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545124.1:DNA methyltransferase C1 >Feature sequence097 609 175 gene locus_tag LOCUS_15900 609 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 698 624 gene locus_tag LOCUS_t00230 698 624 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2359 806 gene locus_tag LOCUS_15910 gene cobA 2359 806 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546266.1 protein_id gnl|my_center|LOCUS_15910 2581 2751 gene locus_tag LOCUS_15920 2581 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2779 5025 gene locus_tag LOCUS_15930 2779 5025 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_15930 4967 5134 gene locus_tag LOCUS_15940 4967 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 5152 6735 gene locus_tag LOCUS_15950 5152 6735 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence098 562 1809 gene locus_tag LOCUS_15960 562 1809 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583203.1 protein_id gnl|my_center|LOCUS_15960 1856 2527 gene locus_tag LOCUS_15970 1856 2527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_15970 2514 3722 gene locus_tag LOCUS_15980 2514 3722 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_15980 4016 3765 gene locus_tag LOCUS_15990 4016 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 4324 4013 gene locus_tag LOCUS_16000 4324 4013 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393078.1 protein_id gnl|my_center|LOCUS_16000 4752 4396 gene locus_tag LOCUS_16010 4752 4396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 5132 6112 gene locus_tag LOCUS_16020 5132 6112 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393780.1 protein_id gnl|my_center|LOCUS_16020 6105 6872 gene locus_tag LOCUS_16030 6105 6872 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393781.1 protein_id gnl|my_center|LOCUS_16030 6932 7007 gene locus_tag LOCUS_t00240 6932 7007 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence099 556 344 gene locus_tag LOCUS_16040 556 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 748 2310 gene locus_tag LOCUS_16050 748 2310 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546582.1 protein_id gnl|my_center|LOCUS_16050 2311 3678 gene locus_tag LOCUS_16060 2311 3678 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_16060 3902 4375 gene locus_tag LOCUS_16070 3902 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4400 5332 gene locus_tag LOCUS_16080 4400 5332 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_16080 5332 6132 gene locus_tag LOCUS_16090 5332 6132 CDS product TIGR02186 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440275.1 protein_id gnl|my_center|LOCUS_16090 6135 6992 gene locus_tag LOCUS_16100 6135 6992 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence100 1019 375 gene locus_tag LOCUS_16110 1019 375 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_16110 1804 1205 gene locus_tag LOCUS_16120 1804 1205 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_16120 2429 2151 gene locus_tag LOCUS_16130 2429 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249266.1 protein_id gnl|my_center|LOCUS_16130 2962 2630 gene locus_tag LOCUS_16140 2962 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 3201 4160 gene locus_tag LOCUS_16150 gene dusB 3201 4160 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_16150 4214 4393 gene locus_tag LOCUS_16160 4214 4393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 4419 4826 gene locus_tag LOCUS_16170 4419 4826 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064389.1 protein_id gnl|my_center|LOCUS_16170 5241 4888 gene locus_tag LOCUS_16180 gene atpE 5241 4888 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_16180 5954 5271 gene locus_tag LOCUS_16190 gene atpB 5954 5271 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546836.1 protein_id gnl|my_center|LOCUS_16190 <6819 6069 gene locus_tag LOCUS_16200 <6819 6069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546726.1:peptide chain release factor N(5)-glutamine methyltransferase >Feature sequence101 137 364 gene locus_tag LOCUS_16210 137 364 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_16210 361 738 gene locus_tag LOCUS_16220 361 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 742 1461 gene locus_tag LOCUS_16230 gene pyrF 742 1461 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545803.1 protein_id gnl|my_center|LOCUS_16230 1514 3046 gene locus_tag LOCUS_16240 gene pabB 1514 3046 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189724.1 protein_id gnl|my_center|LOCUS_16240 4062 3049 gene locus_tag LOCUS_16250 4062 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4653 4090 gene locus_tag LOCUS_16260 4653 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5465 4650 gene locus_tag LOCUS_16270 5465 4650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16270 <6625 5458 gene locus_tag LOCUS_16280 <6625 5458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545108.1:preprotein translocase subunit SecA >Feature sequence102 2257 290 gene locus_tag LOCUS_16290 2257 290 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879233.1 protein_id gnl|my_center|LOCUS_16290 2396 2265 gene locus_tag LOCUS_16300 2396 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 2529 3131 gene locus_tag LOCUS_16310 2529 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3113 3292 gene locus_tag LOCUS_16320 3113 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3295 4188 gene locus_tag LOCUS_16330 gene trxR 3295 4188 CDS product F420-dependent thioredoxin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871060.1 protein_id gnl|my_center|LOCUS_16330 4881 4198 gene locus_tag LOCUS_16340 4881 4198 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444597.1 protein_id gnl|my_center|LOCUS_16340 5103 4882 gene locus_tag LOCUS_16350 5103 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5734 5123 gene locus_tag LOCUS_16360 5734 5123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 6543 5707 gene locus_tag LOCUS_16370 6543 5707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence103 452 120 gene locus_tag LOCUS_16380 452 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 1023 427 gene locus_tag LOCUS_16390 1023 427 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889526.1 protein_id gnl|my_center|LOCUS_16390 2067 1033 gene locus_tag LOCUS_16400 2067 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2758 2093 gene locus_tag LOCUS_16410 2758 2093 CDS product molecular chaperone TorD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814882.1 protein_id gnl|my_center|LOCUS_16410 5341 2849 gene locus_tag LOCUS_16420 5341 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6201 5344 gene locus_tag LOCUS_16430 6201 5344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence104 2154 877 gene locus_tag LOCUS_16440 2154 877 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_16440 2656 2138 gene locus_tag LOCUS_16450 gene cobO 2656 2138 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_16450 3986 2649 gene locus_tag LOCUS_16460 gene cbpB 3986 2649 CDS product peptide-modifying radical SAM enzyme CbpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879693.1 protein_id gnl|my_center|LOCUS_16460 5155 4265 gene locus_tag LOCUS_16470 5155 4265 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943631.1 protein_id gnl|my_center|LOCUS_16470 5895 5143 gene locus_tag LOCUS_16480 gene cbiQ 5895 5143 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943632.1 protein_id gnl|my_center|LOCUS_16480 6298 5882 gene locus_tag LOCUS_16490 6298 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16490 >Feature sequence105 962 2158 gene locus_tag LOCUS_16500 gene mqnE 962 2158 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_16500 2177 3205 gene locus_tag LOCUS_16510 2177 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458925.1 protein_id gnl|my_center|LOCUS_16510 3216 4334 gene locus_tag LOCUS_16520 gene mqnC 3216 4334 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545015.1 protein_id gnl|my_center|LOCUS_16520 5322 4360 gene locus_tag LOCUS_16530 5322 4360 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943294.1 protein_id gnl|my_center|LOCUS_16530 <6244 5324 gene locus_tag LOCUS_16540 <6244 5324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943293.1:pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha >Feature sequence106 <1 791 gene locus_tag LOCUS_16550 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143227.1:glucose-1-phosphate thymidylyltransferase 822 1280 gene locus_tag LOCUS_16560 822 1280 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942724.1 protein_id gnl|my_center|LOCUS_16560 1450 2454 gene locus_tag LOCUS_16570 gene rfbB 1450 2454 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_16570 2470 3312 gene locus_tag LOCUS_16580 gene rfbD 2470 3312 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965612.1 protein_id gnl|my_center|LOCUS_16580 3368 3946 gene locus_tag LOCUS_16590 3368 3946 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545744.1 protein_id gnl|my_center|LOCUS_16590 3943 4491 gene locus_tag LOCUS_16600 3943 4491 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546650.1 protein_id gnl|my_center|LOCUS_16600 4510 4878 gene locus_tag LOCUS_16610 4510 4878 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_16610 5089 5406 gene locus_tag LOCUS_16620 5089 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 5408 5683 gene locus_tag LOCUS_16630 5408 5683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence107 <1 984 gene locus_tag LOCUS_16640 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546103.1:tetraacyldisaccharide 4'-kinase 1122 1442 gene locus_tag LOCUS_16650 1122 1442 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_16650 1556 2074 gene locus_tag LOCUS_16660 1556 2074 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_16660 2164 2697 gene locus_tag LOCUS_16670 2164 2697 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_16670 2767 3957 gene locus_tag LOCUS_16680 gene nuoD 2767 3957 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_16680 4030 4494 gene locus_tag LOCUS_16690 gene nuoE 4030 4494 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_16690 4686 5951 gene locus_tag LOCUS_16700 gene nuoF 4686 5951 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_16700 >Feature sequence108 2597 1176 gene locus_tag LOCUS_16710 2597 1176 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_16710 3942 2608 gene locus_tag LOCUS_16720 3942 2608 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_16720 4190 3999 gene locus_tag LOCUS_16730 4190 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 4349 5959 gene locus_tag LOCUS_16740 4349 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence109 559 750 gene locus_tag LOCUS_16750 559 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 738 1163 gene locus_tag LOCUS_16760 738 1163 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842896.1 protein_id gnl|my_center|LOCUS_16760 2311 1229 gene locus_tag LOCUS_16770 2311 1229 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546441.1 protein_id gnl|my_center|LOCUS_16770 2439 3674 gene locus_tag LOCUS_16780 gene thrC 2439 3674 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546459.1 protein_id gnl|my_center|LOCUS_16780 3806 4081 gene locus_tag LOCUS_16790 3806 4081 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545583.1 protein_id gnl|my_center|LOCUS_16790 4179 4415 gene locus_tag LOCUS_16800 4179 4415 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545388.1 protein_id gnl|my_center|LOCUS_16800 4526 5614 gene locus_tag LOCUS_16810 gene thrC 4526 5614 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546273.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence110 1464 226 gene locus_tag LOCUS_16820 1464 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 2670 1663 gene locus_tag LOCUS_16830 2670 1663 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_16830 3733 2675 gene locus_tag LOCUS_16840 3733 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 4552 3779 gene locus_tag LOCUS_16850 4552 3779 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_16850 4835 5065 gene locus_tag LOCUS_16860 4835 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence111 252 2273 gene locus_tag LOCUS_16870 gene uvrB 252 2273 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545956.1 protein_id gnl|my_center|LOCUS_16870 2446 2543 gene locus_tag LOCUS_t00250 2446 2543 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 3385 2552 gene locus_tag LOCUS_16880 3385 2552 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_16880 3434 3520 gene locus_tag LOCUS_t00260 3434 3520 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3774 5495 gene locus_tag LOCUS_16890 gene polX 3774 5495 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583948.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence112 704 213 gene locus_tag LOCUS_16900 704 213 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_16900 970 701 gene locus_tag LOCUS_16910 970 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1359 1919 gene locus_tag LOCUS_16920 1359 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1916 2173 gene locus_tag LOCUS_16930 1916 2173 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391974.1 protein_id gnl|my_center|LOCUS_16930 2170 3369 gene locus_tag LOCUS_16940 gene nifS 2170 3369 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_16940 3351 3719 gene locus_tag LOCUS_16950 gene nifU 3351 3719 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393153.1 protein_id gnl|my_center|LOCUS_16950 3722 4126 gene locus_tag LOCUS_16960 3722 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 4301 4395 gene locus_tag LOCUS_t00270 4301 4395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4496 5053 gene locus_tag LOCUS_16970 4496 5053 CDS product DUF2155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940716.1 protein_id gnl|my_center|LOCUS_16970 5063 5139 gene locus_tag LOCUS_t00280 5063 5139 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence113 111 356 gene locus_tag LOCUS_16980 111 356 CDS product CopG family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190259411.1 protein_id gnl|my_center|LOCUS_16980 343 768 gene locus_tag LOCUS_16990 343 768 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391721.1 protein_id gnl|my_center|LOCUS_16990 2676 805 gene locus_tag LOCUS_17000 2676 805 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013192.1 protein_id gnl|my_center|LOCUS_17000 3848 2679 gene locus_tag LOCUS_17010 3848 2679 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence114 1773 616 gene locus_tag LOCUS_17020 1773 616 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250510.1 protein_id gnl|my_center|LOCUS_17020 2725 1871 gene locus_tag LOCUS_17030 2725 1871 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545088.1 protein_id gnl|my_center|LOCUS_17030 3816 2728 gene locus_tag LOCUS_17040 3816 2728 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546163.1 protein_id gnl|my_center|LOCUS_17040 4078 3818 gene locus_tag LOCUS_17050 4078 3818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 4286 4101 gene locus_tag LOCUS_17060 4286 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4792 4304 gene locus_tag LOCUS_17070 4792 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence115 411 109 gene locus_tag LOCUS_17080 gene nuoK 411 109 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_17080 988 476 gene locus_tag LOCUS_17090 988 476 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546215.1 protein_id gnl|my_center|LOCUS_17090 1629 1078 gene locus_tag LOCUS_17100 1629 1078 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545900.1 protein_id gnl|my_center|LOCUS_17100 2672 1626 gene locus_tag LOCUS_17110 gene nuoH 2672 1626 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545198.1 protein_id gnl|my_center|LOCUS_17110 <5015 2669 gene locus_tag LOCUS_17120 <5015 2669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002371207.1:formate dehydrogenase subunit alpha >Feature sequence116 <1 1064 gene locus_tag LOCUS_17130 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545697.1:TolC family protein 1064 1885 gene locus_tag LOCUS_17140 1064 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17140 1906 2241 gene locus_tag LOCUS_17150 1906 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17150 2243 2935 gene locus_tag LOCUS_17160 2243 2935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546598.1 protein_id gnl|my_center|LOCUS_17160 3042 4271 gene locus_tag LOCUS_17170 3042 4271 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_17170 4588 4842 gene locus_tag LOCUS_17180 4588 4842 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_17180 >Feature sequence117 583 353 gene locus_tag LOCUS_17190 583 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 852 583 gene locus_tag LOCUS_17200 852 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 1048 830 gene locus_tag LOCUS_17210 1048 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 1709 1176 gene locus_tag LOCUS_17220 1709 1176 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_17220 2178 1858 gene locus_tag LOCUS_17230 2178 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 3177 2191 gene locus_tag LOCUS_17240 gene nadA 3177 2191 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546803.1 protein_id gnl|my_center|LOCUS_17240 3921 3178 gene locus_tag LOCUS_17250 3921 3178 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_17250 <4652 3961 gene locus_tag LOCUS_17260 <4652 3961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:radical SAM protein >Feature sequence118 362 1390 gene locus_tag LOCUS_17270 362 1390 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545846.1 protein_id gnl|my_center|LOCUS_17270 1521 1760 gene locus_tag LOCUS_17280 1521 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1753 2097 gene locus_tag LOCUS_17290 1753 2097 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214977.1 protein_id gnl|my_center|LOCUS_17290 2228 2764 gene locus_tag LOCUS_17300 2228 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3398 2889 gene locus_tag LOCUS_17310 3398 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3691 3888 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence119 44 1090 gene locus_tag LOCUS_17320 44 1090 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545382.1 protein_id gnl|my_center|LOCUS_17320 1443 1087 gene locus_tag LOCUS_17330 1443 1087 CDS product GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942666.1 protein_id gnl|my_center|LOCUS_17330 2524 1421 gene locus_tag LOCUS_17340 2524 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3571 2573 gene locus_tag LOCUS_17350 gene amrS 3571 2573 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_17350 3661 3879 gene locus_tag LOCUS_17360 3661 3879 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943901.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence120 451 257 gene locus_tag LOCUS_17370 451 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1101 508 gene locus_tag LOCUS_17380 1101 508 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545974.1 protein_id gnl|my_center|LOCUS_17380 2198 1182 gene locus_tag LOCUS_17390 gene ilvC 2198 1182 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_17390 2319 3167 gene locus_tag LOCUS_17400 2319 3167 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546368.1 protein_id gnl|my_center|LOCUS_17400 3240 3548 gene locus_tag LOCUS_17410 3240 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence121 1660 1361 gene locus_tag LOCUS_17420 1660 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 1925 1641 gene locus_tag LOCUS_17430 1925 1641 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_17430 3406 2000 gene locus_tag LOCUS_17440 gene tilS 3406 2000 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence122 167 445 gene locus_tag LOCUS_17450 167 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 502 1374 gene locus_tag LOCUS_17460 gene dapA 502 1374 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_17460 1576 1385 gene locus_tag LOCUS_17470 1576 1385 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877678.1 protein_id gnl|my_center|LOCUS_17470 1977 1603 gene locus_tag LOCUS_17480 1977 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3314 2148 gene locus_tag LOCUS_17490 3314 2148 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence123 <1 2333 gene locus_tag LOCUS_17500 <1 2333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546857.1:outer membrane protein assembly factor BamA 2401 2979 gene locus_tag LOCUS_17510 2401 2979 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545058.1 protein_id gnl|my_center|LOCUS_17510 3059 3259 gene locus_tag LOCUS_17520 3059 3259 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563620.1 protein_id gnl|my_center|LOCUS_17520 3452 3378 gene locus_tag LOCUS_t00290 3452 3378 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence124 774 1088 gene locus_tag LOCUS_17530 774 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 1203 2342 gene locus_tag LOCUS_17540 1203 2342 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_17540 2339 3295 gene locus_tag LOCUS_17550 2339 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence125 1479 670 gene locus_tag LOCUS_17560 gene murI 1479 670 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_17560 2093 1476 gene locus_tag LOCUS_17570 2093 1476 CDS product GerMN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546501.1 protein_id gnl|my_center|LOCUS_17570 3048 2083 gene locus_tag LOCUS_17580 3048 2083 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545910.1 protein_id gnl|my_center|LOCUS_17580 3235 3308 gene locus_tag LOCUS_t00300 3235 3308 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence126 198 2912 gene locus_tag LOCUS_17590 198 2912 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence127 984 436 gene locus_tag LOCUS_17600 984 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1255 1836 gene locus_tag LOCUS_17610 1255 1836 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_17610 2048 2425 gene locus_tag LOCUS_17620 2048 2425 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545390.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence128 2344 1226 gene locus_tag LOCUS_17630 gene nusA 2344 1226 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546178.1 protein_id gnl|my_center|LOCUS_17630 2811 2341 gene locus_tag LOCUS_17640 2811 2341 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545395.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence129 2252 849 gene locus_tag LOCUS_17650 gene selA 2252 849 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 protein_id gnl|my_center|LOCUS_17650 >Feature sequence130 <1 1077 gene locus_tag LOCUS_17660 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein 1074 1841 gene locus_tag LOCUS_17670 1074 1841 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence131 673 987 gene locus_tag LOCUS_17680 673 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence132 <1 1286 gene locus_tag LOCUS_17690 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141135.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence133 <1 1856 gene locus_tag LOCUS_17700 <1 1856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546379.1:NADH-quinone oxidoreductase subunit L >Feature sequence134 325 594 gene locus_tag LOCUS_17710 325 594 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546407.1 protein_id gnl|my_center|LOCUS_17710 <1949 617 gene locus_tag LOCUS_17720 <1949 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546410.1:sigma-54 dependent transcriptional regulator >Feature sequence135 <1560 501 gene locus_tag LOCUS_17730 <1560 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545292.1:diaminopimelate decarboxylase >Feature sequence136 765 115 gene locus_tag LOCUS_17740 765 115 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence137 1189 674 gene locus_tag LOCUS_17750 1189 674 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_17750