>Feature sequence01 224 2374 gene locus_tag LOCUS_0010 gene lonB 224 2374 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250215.1 protein_id gnl|my_center|LOCUS_0010 2522 3211 gene locus_tag LOCUS_0020 2522 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0020 4566 3292 gene locus_tag LOCUS_0030 gene aspS 4566 3292 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_0030 4598 4750 gene locus_tag LOCUS_0040 4598 4750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0040 4978 5865 gene locus_tag LOCUS_0050 4978 5865 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 protein_id gnl|my_center|LOCUS_0050 5974 7446 gene locus_tag LOCUS_0060 5974 7446 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869603.1 protein_id gnl|my_center|LOCUS_0060 7459 8100 gene locus_tag LOCUS_0070 7459 8100 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966718.1 protein_id gnl|my_center|LOCUS_0070 8132 8296 gene locus_tag LOCUS_0080 8132 8296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 8289 9257 gene locus_tag LOCUS_0090 8289 9257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 10714 9599 gene locus_tag LOCUS_0100 10714 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0100 11000 13315 gene locus_tag LOCUS_0110 11000 13315 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_0110 13360 13432 gene locus_tag LOCUS_t0010 13360 13432 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 13489 13564 gene locus_tag LOCUS_t0020 13489 13564 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 14284 13823 gene locus_tag LOCUS_0120 14284 13823 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064326.1 protein_id gnl|my_center|LOCUS_0120 14517 15122 gene locus_tag LOCUS_0130 gene rpoE 14517 15122 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_0130 15230 16231 gene locus_tag LOCUS_0140 15230 16231 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_0140 16312 17133 gene locus_tag LOCUS_0150 16312 17133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0150 17318 18016 gene locus_tag LOCUS_0160 17318 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0160 18018 18692 gene locus_tag LOCUS_0170 18018 18692 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250487.1 protein_id gnl|my_center|LOCUS_0170 18857 19459 gene locus_tag LOCUS_0180 18857 19459 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_0180 19459 19698 gene locus_tag LOCUS_0190 19459 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0190 20371 20120 gene locus_tag LOCUS_0200 20371 20120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0200 20694 20371 gene locus_tag LOCUS_0210 20694 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0210 20933 21706 gene locus_tag LOCUS_0220 20933 21706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0220 23335 22154 gene locus_tag LOCUS_0230 23335 22154 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_0230 23555 24367 gene locus_tag LOCUS_0240 23555 24367 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_0240 24412 24801 gene locus_tag LOCUS_0250 24412 24801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0250 24805 25089 gene locus_tag LOCUS_0260 24805 25089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0260 25086 25733 gene locus_tag LOCUS_0270 25086 25733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0270 25804 26781 gene locus_tag LOCUS_0280 25804 26781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 26774 26941 gene locus_tag LOCUS_0290 26774 26941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0290 27163 27882 gene locus_tag LOCUS_0300 27163 27882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 28012 28314 gene locus_tag LOCUS_0310 28012 28314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_0310 28330 28644 gene locus_tag LOCUS_0320 28330 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0320 29542 28760 gene locus_tag LOCUS_0330 29542 28760 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_0330 31292 29583 gene locus_tag LOCUS_0340 31292 29583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0340 31438 31511 gene locus_tag LOCUS_t0030 31438 31511 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 32064 31672 gene locus_tag LOCUS_0350 32064 31672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0350 32575 32051 gene locus_tag LOCUS_0360 32575 32051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0360 33195 32698 gene locus_tag LOCUS_0370 33195 32698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0370 36002 33333 gene locus_tag LOCUS_0380 36002 33333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0380 36101 36739 gene locus_tag LOCUS_0390 36101 36739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 36779 36804 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 36948 37610 gene locus_tag LOCUS_0400 36948 37610 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173343.1 protein_id gnl|my_center|LOCUS_0400 38316 37714 gene locus_tag LOCUS_0410 38316 37714 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869674.1 protein_id gnl|my_center|LOCUS_0410 38447 38962 gene locus_tag LOCUS_0420 gene idi 38447 38962 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_0420 >Feature sequence02 1893 277 gene locus_tag LOCUS_0430 1893 277 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877505.1 protein_id gnl|my_center|LOCUS_0430 3109 2066 gene locus_tag LOCUS_0440 3109 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0440 3401 3330 gene locus_tag LOCUS_t0040 3401 3330 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 3356 3919 gene locus_tag LOCUS_0450 gene ndk 3356 3919 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770040.1 protein_id gnl|my_center|LOCUS_0450 3987 4856 gene locus_tag LOCUS_0460 3987 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0460 4856 5218 gene locus_tag LOCUS_0470 4856 5218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0470 5494 6894 gene locus_tag LOCUS_0480 gene gatB 5494 6894 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583528.1 protein_id gnl|my_center|LOCUS_0480 7470 7012 gene locus_tag LOCUS_0490 7470 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0490 7856 7515 gene locus_tag LOCUS_0500 7856 7515 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_0500 8001 8549 gene locus_tag LOCUS_0510 8001 8549 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870902.1 protein_id gnl|my_center|LOCUS_0510 9425 10579 gene locus_tag LOCUS_0520 gene ftsZ 9425 10579 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_0520 11126 11199 gene locus_tag LOCUS_t0050 11126 11199 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11353 11532 gene locus_tag LOCUS_0530 11353 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0530 11615 11533 gene locus_tag LOCUS_t0060 11615 11533 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 11928 12395 gene locus_tag LOCUS_0540 11928 12395 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_0540 12395 12583 gene locus_tag LOCUS_0550 12395 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 13346 12654 gene locus_tag LOCUS_0560 13346 12654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0560 14578 13334 gene locus_tag LOCUS_0570 14578 13334 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246697.1 protein_id gnl|my_center|LOCUS_0570 14928 14856 gene locus_tag LOCUS_t0070 14928 14856 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 14971 16635 gene locus_tag LOCUS_0580 gene pyrG 14971 16635 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_0580 16647 17405 gene locus_tag LOCUS_0590 16647 17405 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250051.1 protein_id gnl|my_center|LOCUS_0590 17399 18436 gene locus_tag LOCUS_0600 17399 18436 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_0600 20837 18699 gene locus_tag LOCUS_0610 gene topA 20837 18699 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_0610 20967 21626 gene locus_tag LOCUS_0620 20967 21626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0620 22487 21840 gene locus_tag LOCUS_0630 22487 21840 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869667.1 protein_id gnl|my_center|LOCUS_0630 23944 22655 gene locus_tag LOCUS_0640 gene tuf 23944 22655 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_0640 24106 25104 gene locus_tag LOCUS_0650 24106 25104 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 protein_id gnl|my_center|LOCUS_0650 25748 25176 gene locus_tag LOCUS_0660 25748 25176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0660 25818 26399 gene locus_tag LOCUS_0670 25818 26399 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250405.1 protein_id gnl|my_center|LOCUS_0670 26712 28223 gene locus_tag LOCUS_0680 gene glyS 26712 28223 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874710.1 protein_id gnl|my_center|LOCUS_0680 28259 29335 gene locus_tag LOCUS_0690 gene prf1 28259 29335 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250190.1 protein_id gnl|my_center|LOCUS_0690 >Feature sequence03 1652 417 gene locus_tag LOCUS_0700 1652 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 1761 2462 gene locus_tag LOCUS_0710 1761 2462 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867875.1 protein_id gnl|my_center|LOCUS_0710 2584 4287 gene locus_tag LOCUS_0720 gene infB 2584 4287 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875898.1 protein_id gnl|my_center|LOCUS_0720 6566 4395 gene locus_tag LOCUS_0730 6566 4395 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_0730 7067 6609 gene locus_tag LOCUS_0740 7067 6609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 6678 6693 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8443 7343 gene locus_tag LOCUS_0750 gene radA 8443 7343 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_0750 8884 10047 gene locus_tag LOCUS_0760 8884 10047 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146504.1 protein_id gnl|my_center|LOCUS_0760 10254 10066 gene locus_tag LOCUS_0770 10254 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 10960 10412 gene locus_tag LOCUS_0780 10960 10412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 11041 11122 gene locus_tag LOCUS_t0080 11041 11122 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13232 11598 gene locus_tag LOCUS_0790 13232 11598 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254617.1 protein_id gnl|my_center|LOCUS_0790 13316 14437 gene locus_tag LOCUS_0800 gene wecB 13316 14437 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867673.1 protein_id gnl|my_center|LOCUS_0800 14623 15033 gene locus_tag LOCUS_0810 14623 15033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 15356 16300 gene locus_tag LOCUS_0820 15356 16300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0820 16357 16971 gene locus_tag LOCUS_0830 16357 16971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0830 17123 17830 gene locus_tag LOCUS_0840 17123 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0840 17827 18702 gene locus_tag LOCUS_0850 17827 18702 CDS product benzoate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101762936.1 protein_id gnl|my_center|LOCUS_0850 19048 21489 gene locus_tag LOCUS_0860 19048 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0860 21640 22947 gene locus_tag LOCUS_0870 21640 22947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0870 23638 23045 gene locus_tag LOCUS_0880 23638 23045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 23832 23650 gene locus_tag LOCUS_0890 23832 23650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0890 24763 23834 gene locus_tag LOCUS_0900 gene ftsY 24763 23834 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867626.1 protein_id gnl|my_center|LOCUS_0900 24896 24814 gene locus_tag LOCUS_t0090 24896 24814 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24966 25040 gene locus_tag LOCUS_t0100 24966 25040 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 25326 25399 gene locus_tag LOCUS_t0110 25326 25399 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 25561 25644 gene locus_tag LOCUS_t0120 25561 25644 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 25711 26475 gene locus_tag LOCUS_0910 25711 26475 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496413.1 protein_id gnl|my_center|LOCUS_0910 27385 26651 gene locus_tag LOCUS_0920 27385 26651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0920 29033 27831 gene locus_tag LOCUS_0930 29033 27831 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_0930 29436 29026 gene locus_tag LOCUS_0940 29436 29026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 >Feature sequence04 300 833 gene locus_tag LOCUS_0950 300 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0950 1195 920 gene locus_tag LOCUS_0960 1195 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0960 1239 2138 gene locus_tag LOCUS_0970 gene map 1239 2138 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_0970 2195 2941 gene locus_tag LOCUS_0980 2195 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 2941 3630 gene locus_tag LOCUS_0990 2941 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 3685 3757 gene locus_tag LOCUS_t0130 3685 3757 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 4373 3900 gene locus_tag LOCUS_1000 4373 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 6518 4425 gene locus_tag LOCUS_1010 6518 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1010 6873 8087 gene locus_tag LOCUS_1020 6873 8087 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_1020 8347 10242 gene locus_tag LOCUS_1030 8347 10242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1030 10232 13606 gene locus_tag LOCUS_1040 10232 13606 CDS product DNA-directed DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496881.1 protein_id gnl|my_center|LOCUS_1040 13640 13999 gene locus_tag LOCUS_1050 13640 13999 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_1050 14103 14648 gene locus_tag LOCUS_1060 14103 14648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1060 14718 15296 gene locus_tag LOCUS_1070 14718 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1070 17844 15337 gene locus_tag LOCUS_1080 17844 15337 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876179.1 protein_id gnl|my_center|LOCUS_1080 17982 20393 gene locus_tag LOCUS_1090 17982 20393 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_1090 20408 20806 gene locus_tag LOCUS_1100 20408 20806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1100 22366 20918 gene locus_tag LOCUS_1110 22366 20918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1110 22969 22427 gene locus_tag LOCUS_1120 22969 22427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1120 23752 23414 gene locus_tag LOCUS_1130 23752 23414 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762194.1 protein_id gnl|my_center|LOCUS_1130 24067 26004 gene locus_tag LOCUS_1140 24067 26004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1140 >Feature sequence05 753 1187 gene locus_tag LOCUS_1150 753 1187 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963907.1 protein_id gnl|my_center|LOCUS_1150 1642 1887 gene locus_tag LOCUS_1160 1642 1887 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_1160 3457 1877 gene locus_tag LOCUS_1170 3457 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1170 3641 3444 gene locus_tag LOCUS_1180 3641 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1180 4309 3638 gene locus_tag LOCUS_1190 gene radB 4309 3638 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869752.1 protein_id gnl|my_center|LOCUS_1190 4356 4808 gene locus_tag LOCUS_1200 4356 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1200 5448 5134 gene locus_tag LOCUS_1210 5448 5134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 6332 5556 gene locus_tag LOCUS_1220 gene rrp42 6332 5556 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876321.1 protein_id gnl|my_center|LOCUS_1220 7060 6332 gene locus_tag LOCUS_1230 gene rrp41 7060 6332 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_1230 7866 7063 gene locus_tag LOCUS_1240 gene rrp4 7866 7063 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_1240 9494 8094 gene locus_tag LOCUS_1250 gene cca 9494 8094 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_1250 9524 10114 gene locus_tag LOCUS_1260 9524 10114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1260 10982 11710 gene locus_tag LOCUS_1270 10982 11710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1270 11712 12572 gene locus_tag LOCUS_1280 11712 12572 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583860.1 protein_id gnl|my_center|LOCUS_1280 14025 12928 gene locus_tag LOCUS_1290 14025 12928 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065828.1 protein_id gnl|my_center|LOCUS_1290 14348 14106 gene locus_tag LOCUS_1300 14348 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1300 14659 16179 gene locus_tag LOCUS_1310 14659 16179 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869988.1 protein_id gnl|my_center|LOCUS_1310 16223 17902 gene locus_tag LOCUS_1320 gene pheT 16223 17902 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_1320 18090 17905 gene locus_tag LOCUS_1330 18090 17905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 18271 19290 gene locus_tag LOCUS_1340 gene amrS 18271 19290 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_1340 19308 19892 gene locus_tag LOCUS_1350 19308 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 21280 20381 gene locus_tag LOCUS_1360 21280 20381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1360 21435 21361 gene locus_tag LOCUS_t0140 21435 21361 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 22241 21645 gene locus_tag LOCUS_1370 22241 21645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 22878 22306 gene locus_tag LOCUS_1380 gene rplJ 22878 22306 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_1380 22988 23869 gene locus_tag LOCUS_1390 22988 23869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 23904 24068 gene locus_tag LOCUS_1400 23904 24068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1400 >Feature sequence06 340 140 gene locus_tag LOCUS_1410 340 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1410 1581 3692 gene locus_tag LOCUS_1420 1581 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064516.1 protein_id gnl|my_center|LOCUS_1420 3685 4488 gene locus_tag LOCUS_1430 3685 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 6571 4709 gene locus_tag LOCUS_1440 6571 4709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1440 6650 8194 gene locus_tag LOCUS_1450 6650 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 8358 9230 gene locus_tag LOCUS_1460 8358 9230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1460 9246 9890 gene locus_tag LOCUS_1470 9246 9890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1470 10052 10645 gene locus_tag LOCUS_1480 10052 10645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1480 10835 11374 gene locus_tag LOCUS_1490 10835 11374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1490 11371 11799 gene locus_tag LOCUS_1500 11371 11799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1500 11842 12840 gene locus_tag LOCUS_1510 11842 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1510 12842 13399 gene locus_tag LOCUS_1520 12842 13399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1520 13568 13383 gene locus_tag LOCUS_1530 13568 13383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1530 13664 13768 gene locus_tag LOCUS_r0010 13664 13768 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 13981 14736 gene locus_tag LOCUS_1540 gene pcn 13981 14736 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876925.1 protein_id gnl|my_center|LOCUS_1540 14904 15239 gene locus_tag LOCUS_1550 14904 15239 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868223.1 protein_id gnl|my_center|LOCUS_1550 15269 15592 gene locus_tag LOCUS_1560 15269 15592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 15595 16158 gene locus_tag LOCUS_1570 15595 16158 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867500.1 protein_id gnl|my_center|LOCUS_1570 16207 16758 gene locus_tag LOCUS_1580 gene thpR 16207 16758 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_1580 17519 16869 gene locus_tag LOCUS_1590 17519 16869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1590 17802 18302 gene locus_tag LOCUS_1600 17802 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 19686 18343 gene locus_tag LOCUS_1610 19686 18343 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_1610 20065 20553 gene locus_tag LOCUS_1620 20065 20553 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674498.1 protein_id gnl|my_center|LOCUS_1620 21358 20570 gene locus_tag LOCUS_1630 21358 20570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 22182 21358 gene locus_tag LOCUS_1640 22182 21358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1640 22203 22619 gene locus_tag LOCUS_1650 22203 22619 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875899.1 protein_id gnl|my_center|LOCUS_1650 22687 23175 gene locus_tag LOCUS_1660 22687 23175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 23609 23373 gene locus_tag LOCUS_1670 23609 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 23491 23892 gene locus_tag LOCUS_1680 23491 23892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 24139 24064 gene locus_tag LOCUS_t0150 24139 24064 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence07 1870 1451 gene locus_tag LOCUS_1690 1870 1451 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_1690 2127 3776 gene locus_tag LOCUS_1700 2127 3776 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_1700 3958 4761 gene locus_tag LOCUS_1710 3958 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1710 4853 6055 gene locus_tag LOCUS_1720 4853 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1720 6052 6657 gene locus_tag LOCUS_1730 6052 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1730 6769 6698 gene locus_tag LOCUS_t0160 6769 6698 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6912 8636 gene locus_tag LOCUS_1740 6912 8636 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867806.1 protein_id gnl|my_center|LOCUS_1740 9627 8752 gene locus_tag LOCUS_1750 9627 8752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1750 10029 9655 gene locus_tag LOCUS_1760 gene hjc 10029 9655 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876892.1 protein_id gnl|my_center|LOCUS_1760 10083 10157 gene locus_tag LOCUS_t0170 10083 10157 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11616 10288 gene locus_tag LOCUS_1770 gene secY 11616 10288 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_1770 12037 11621 gene locus_tag LOCUS_1780 12037 11621 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867441.1 protein_id gnl|my_center|LOCUS_1780 13433 12195 gene locus_tag LOCUS_1790 13433 12195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1790 13985 13437 gene locus_tag LOCUS_1800 13985 13437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1800 14958 13999 gene locus_tag LOCUS_1810 14958 13999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1810 15772 14960 gene locus_tag LOCUS_1820 gene speB 15772 14960 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_1820 16976 15843 gene locus_tag LOCUS_1830 16976 15843 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_1830 17218 17000 gene locus_tag LOCUS_1840 17218 17000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1840 17824 17450 gene locus_tag LOCUS_1850 17824 17450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1850 18208 17897 gene locus_tag LOCUS_1860 gene yciH 18208 17897 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_1860 18446 18201 gene locus_tag LOCUS_1870 18446 18201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1870 19308 18436 gene locus_tag LOCUS_1880 19308 18436 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_1880 20003 19359 gene locus_tag LOCUS_1890 20003 19359 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147206.1 protein_id gnl|my_center|LOCUS_1890 20166 20438 gene locus_tag LOCUS_1900 20166 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 >Feature sequence08 442 140 gene locus_tag LOCUS_1910 442 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1910 1328 432 gene locus_tag LOCUS_1920 gene rpl4p 1328 432 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875645.1 protein_id gnl|my_center|LOCUS_1920 2031 1321 gene locus_tag LOCUS_1930 2031 1321 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867451.1 protein_id gnl|my_center|LOCUS_1930 2588 2028 gene locus_tag LOCUS_1940 2588 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1940 2671 3819 gene locus_tag LOCUS_1950 2671 3819 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875879.1 protein_id gnl|my_center|LOCUS_1950 4307 3828 gene locus_tag LOCUS_1960 4307 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 6953 4563 gene locus_tag LOCUS_1970 6953 4563 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_1970 7538 7197 gene locus_tag LOCUS_1980 gene eif1A 7538 7197 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869944.1 protein_id gnl|my_center|LOCUS_1980 7872 7651 gene locus_tag LOCUS_1990 7872 7651 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867792.1 protein_id gnl|my_center|LOCUS_1990 7956 8549 gene locus_tag LOCUS_2000 gene rpsG 7956 8549 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_2000 8599 9555 gene locus_tag LOCUS_2010 gene rpl3p 8599 9555 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875644.1 protein_id gnl|my_center|LOCUS_2010 9670 9879 gene locus_tag LOCUS_2020 9670 9879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2020 9881 10414 gene locus_tag LOCUS_2030 9881 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 10521 12227 gene locus_tag LOCUS_2040 10521 12227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2040 12799 12726 gene locus_tag LOCUS_t0180 12799 12726 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14649 13195 gene locus_tag LOCUS_r0020 14649 13195 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14983 15159 gene locus_tag LOCUS_2050 14983 15159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2050 15754 15524 gene locus_tag LOCUS_2060 15754 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2060 16324 15761 gene locus_tag LOCUS_2070 16324 15761 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979414.1 protein_id gnl|my_center|LOCUS_2070 17209 16679 gene locus_tag LOCUS_2080 17209 16679 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709451.1 protein_id gnl|my_center|LOCUS_2080 17275 17751 gene locus_tag LOCUS_2090 17275 17751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2090 17992 19290 gene locus_tag LOCUS_2100 17992 19290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2100 19327 19608 gene locus_tag LOCUS_2110 19327 19608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2110 19767 19694 gene locus_tag LOCUS_t0190 19767 19694 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence09 2321 2635 gene locus_tag LOCUS_2120 gene trxA 2321 2635 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_2120 2779 3732 gene locus_tag LOCUS_2130 2779 3732 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_2130 4220 3912 gene locus_tag LOCUS_2140 4220 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2140 4668 4976 gene locus_tag LOCUS_2150 gene rpsJ 4668 4976 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249262.1 protein_id gnl|my_center|LOCUS_2150 5098 5181 gene locus_tag LOCUS_t0200 5098 5181 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5238 5310 gene locus_tag LOCUS_t0210 5238 5310 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5323 5395 gene locus_tag LOCUS_t0220 5323 5395 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5478 5738 gene locus_tag LOCUS_2160 5478 5738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2160 6505 6065 gene locus_tag LOCUS_2170 6505 6065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2170 8159 6624 gene locus_tag LOCUS_2180 8159 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2180 8535 8164 gene locus_tag LOCUS_2190 8535 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 9120 9791 gene locus_tag LOCUS_2200 gene rnhB 9120 9791 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_2200 9922 11289 gene locus_tag LOCUS_2210 9922 11289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2210 11566 11330 gene locus_tag LOCUS_2220 11566 11330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2220 11919 11563 gene locus_tag LOCUS_2230 11919 11563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2230 13388 12051 gene locus_tag LOCUS_2240 13388 12051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2240 13556 15232 gene locus_tag LOCUS_2250 13556 15232 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_2250 16499 15216 gene locus_tag LOCUS_2260 gene ftsZ 16499 15216 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867128.1 protein_id gnl|my_center|LOCUS_2260 16535 16756 gene locus_tag LOCUS_2270 16535 16756 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249927.1 protein_id gnl|my_center|LOCUS_2270 16753 16938 gene locus_tag LOCUS_2280 16753 16938 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876286.1 protein_id gnl|my_center|LOCUS_2280 17591 17067 gene locus_tag LOCUS_2290 17591 17067 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420437.1 protein_id gnl|my_center|LOCUS_2290 17911 18624 gene locus_tag LOCUS_2300 17911 18624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2300 >Feature sequence10 1679 180 gene locus_tag LOCUS_2310 1679 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2310 3062 1884 gene locus_tag LOCUS_2320 3062 1884 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_2320 3081 5045 gene locus_tag LOCUS_2330 gene pheA 3081 5045 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683139.1 protein_id gnl|my_center|LOCUS_2330 5080 6207 gene locus_tag LOCUS_2340 5080 6207 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922132.1 protein_id gnl|my_center|LOCUS_2340 6775 6374 gene locus_tag LOCUS_2350 6775 6374 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_2350 6997 9135 gene locus_tag LOCUS_2360 gene nrdD 6997 9135 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_2360 9368 9114 gene locus_tag LOCUS_2370 9368 9114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2370 10708 9383 gene locus_tag LOCUS_2380 10708 9383 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868782.1 protein_id gnl|my_center|LOCUS_2380 11459 12358 gene locus_tag LOCUS_2390 gene rnz 11459 12358 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398681.1 protein_id gnl|my_center|LOCUS_2390 12499 13596 gene locus_tag LOCUS_2400 12499 13596 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_2400 13698 13626 gene locus_tag LOCUS_t0230 13698 13626 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13827 14111 gene locus_tag LOCUS_2410 13827 14111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2410 14108 14506 gene locus_tag LOCUS_2420 14108 14506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 14508 14780 gene locus_tag LOCUS_2430 14508 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2430 15081 15155 gene locus_tag LOCUS_t0240 15081 15155 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 15168 15389 gene locus_tag LOCUS_2440 15168 15389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2440 15405 16295 gene locus_tag LOCUS_2450 15405 16295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2450 17212 16649 gene locus_tag LOCUS_2460 17212 16649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 17381 17214 gene locus_tag LOCUS_2470 17381 17214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 18070 17633 gene locus_tag LOCUS_2480 18070 17633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2480 >Feature sequence11 1036 569 gene locus_tag LOCUS_2490 1036 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 1069 1260 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1930 1448 gene locus_tag LOCUS_2500 1930 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2500 2280 2056 gene locus_tag LOCUS_2510 2280 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 2445 2287 gene locus_tag LOCUS_2520 2445 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2520 2849 2562 gene locus_tag LOCUS_2530 2849 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2530 3550 2903 gene locus_tag LOCUS_2540 3550 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2540 6051 3718 gene locus_tag LOCUS_2550 gene gyrA 6051 3718 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_2550 3729 3745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6104 6298 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tattttgcagaattctaattaaa 8853 6262 gene locus_tag LOCUS_2560 8853 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 10463 9036 gene locus_tag LOCUS_2570 10463 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2570 10654 10466 gene locus_tag LOCUS_2580 10654 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2580 11962 11006 gene locus_tag LOCUS_2590 11962 11006 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870112.1 protein_id gnl|my_center|LOCUS_2590 11994 13127 gene locus_tag LOCUS_2600 11994 13127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2600 13129 13770 gene locus_tag LOCUS_2610 13129 13770 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_2610 13820 13894 gene locus_tag LOCUS_t0250 13820 13894 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 14071 14153 gene locus_tag LOCUS_t0260 14071 14153 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 161 1180 gene locus_tag LOCUS_2620 161 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2620 1257 2474 gene locus_tag LOCUS_2630 1257 2474 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_2630 2671 4062 gene locus_tag LOCUS_2640 2671 4062 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871007.1 protein_id gnl|my_center|LOCUS_2640 4091 4735 gene locus_tag LOCUS_2650 4091 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2650 5032 6225 gene locus_tag LOCUS_2660 gene dnaG 5032 6225 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_2660 6215 6946 gene locus_tag LOCUS_2670 6215 6946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 6975 7595 gene locus_tag LOCUS_2680 6975 7595 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877499.1 protein_id gnl|my_center|LOCUS_2680 7592 7969 gene locus_tag LOCUS_2690 7592 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2690 8153 8674 gene locus_tag LOCUS_2700 8153 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 8855 9616 gene locus_tag LOCUS_2710 8855 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2710 9701 9913 gene locus_tag LOCUS_2720 9701 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 10146 11129 gene locus_tag LOCUS_2730 10146 11129 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_2730 11203 12336 gene locus_tag LOCUS_2740 11203 12336 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_2740 >Feature sequence13 493 705 gene locus_tag LOCUS_2750 493 705 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183891.1 protein_id gnl|my_center|LOCUS_2750 710 2686 gene locus_tag LOCUS_2760 710 2686 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944118.1 protein_id gnl|my_center|LOCUS_2760 2688 3434 gene locus_tag LOCUS_2770 2688 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2770 3440 3838 gene locus_tag LOCUS_2780 3440 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2780 3845 4327 gene locus_tag LOCUS_2790 3845 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_2790 4738 4664 gene locus_tag LOCUS_t0270 4738 4664 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4775 6703 gene locus_tag LOCUS_2800 gene gyrB 4775 6703 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963335.1 protein_id gnl|my_center|LOCUS_2800 6978 7973 gene locus_tag LOCUS_2810 6978 7973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 8230 10101 gene locus_tag LOCUS_2820 8230 10101 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_2820 11679 10165 gene locus_tag LOCUS_2830 11679 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 11750 13012 gene locus_tag LOCUS_2840 11750 13012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 12986 12995 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence14 1230 229 gene locus_tag LOCUS_2850 gene fen 1230 229 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877241.1 protein_id gnl|my_center|LOCUS_2850 1615 1325 gene locus_tag LOCUS_2860 1615 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2860 2111 3472 gene locus_tag LOCUS_2870 2111 3472 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_2870 3516 4421 gene locus_tag LOCUS_2880 gene trxB 3516 4421 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251050.1 protein_id gnl|my_center|LOCUS_2880 6414 4501 gene locus_tag LOCUS_2890 6414 4501 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876827.1 protein_id gnl|my_center|LOCUS_2890 7108 6416 gene locus_tag LOCUS_2900 gene psmB 7108 6416 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250380.1 protein_id gnl|my_center|LOCUS_2900 7281 7553 gene locus_tag LOCUS_2910 7281 7553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2910 7560 7931 gene locus_tag LOCUS_2920 7560 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 8521 9288 gene locus_tag LOCUS_2930 8521 9288 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061096.1 protein_id gnl|my_center|LOCUS_2930 11060 9759 gene locus_tag LOCUS_2940 11060 9759 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061033.1 protein_id gnl|my_center|LOCUS_2940 >Feature sequence15 765 1199 gene locus_tag LOCUS_2950 765 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2950 1860 1450 gene locus_tag LOCUS_2960 1860 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 2498 2055 gene locus_tag LOCUS_2970 2498 2055 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_2970 3068 2631 gene locus_tag LOCUS_2980 3068 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2980 3265 3065 gene locus_tag LOCUS_2990 3265 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 3647 3258 gene locus_tag LOCUS_3000 3647 3258 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_3000 4077 3655 gene locus_tag LOCUS_3010 4077 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3010 4332 5888 gene locus_tag LOCUS_3020 4332 5888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3020 6897 6028 gene locus_tag LOCUS_3030 6897 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 >Feature sequence16 697 2931 gene locus_tag LOCUS_3040 697 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 3177 3371 gene locus_tag LOCUS_3050 3177 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 4482 3487 gene locus_tag LOCUS_3060 4482 3487 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870691.1 protein_id gnl|my_center|LOCUS_3060 5390 4848 gene locus_tag LOCUS_3070 5390 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3070 6244 5555 gene locus_tag LOCUS_3080 6244 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 6725 6246 gene locus_tag LOCUS_3090 6725 6246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 7627 6761 gene locus_tag LOCUS_3100 7627 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3100 7636 7730 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence17 780 241 gene locus_tag LOCUS_3110 780 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 1317 784 gene locus_tag LOCUS_3120 1317 784 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867368.1 protein_id gnl|my_center|LOCUS_3120 1629 2453 gene locus_tag LOCUS_3130 1629 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3130 2661 2891 gene locus_tag LOCUS_3140 2661 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3140 2919 2989 gene locus_tag LOCUS_t0280 2919 2989 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3008 5380 gene locus_tag LOCUS_3150 3008 5380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3150 6170 5727 gene locus_tag LOCUS_3160 6170 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3160 6432 6731 gene locus_tag LOCUS_3170 gene rpl12p 6432 6731 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877289.1 protein_id gnl|my_center|LOCUS_3170 7124 6909 gene locus_tag LOCUS_3180 7124 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3180 7524 7126 gene locus_tag LOCUS_3190 gene rpl7ae 7524 7126 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878267.1 protein_id gnl|my_center|LOCUS_3190 >Feature sequence18 <1 6609 gene locus_tag LOCUS_3200 <1 6609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123087.1:DUF11 domain-containing protein 7401 6829 gene locus_tag LOCUS_3210 7401 6829 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762516.1 protein_id gnl|my_center|LOCUS_3210 >Feature sequence19 123 1841 gene locus_tag LOCUS_3220 gene lysS 123 1841 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002663481.1 protein_id gnl|my_center|LOCUS_3220 1976 2050 gene locus_tag LOCUS_t0290 1976 2050 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3372 2476 gene locus_tag LOCUS_3230 3372 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3230 3444 6626 gene locus_tag LOCUS_3240 gene ileS 3444 6626 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868042.1 protein_id gnl|my_center|LOCUS_3240 >Feature sequence20 6574 3341 gene locus_tag LOCUS_3250 6574 3341 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_3250 6860 6615 gene locus_tag LOCUS_3260 6860 6615 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 protein_id gnl|my_center|LOCUS_3260 >Feature sequence21 94 396 gene locus_tag LOCUS_3270 94 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3270 583 996 gene locus_tag LOCUS_3280 583 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3280 1004 2176 gene locus_tag LOCUS_3290 1004 2176 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913616.1 protein_id gnl|my_center|LOCUS_3290 2532 2284 gene locus_tag LOCUS_3300 2532 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3300 2576 2806 gene locus_tag LOCUS_3310 2576 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3310 4775 2904 gene locus_tag LOCUS_3320 4775 2904 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_3320 5309 5938 gene locus_tag LOCUS_3330 5309 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3330 >Feature sequence22 >Feature sequence23 435 241 gene locus_tag LOCUS_3340 435 241 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_3340 965 810 gene locus_tag LOCUS_3350 965 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3350 1679 1167 gene locus_tag LOCUS_3360 1679 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3360 1721 3433 gene locus_tag LOCUS_3370 gene gltX 1721 3433 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870894.1 protein_id gnl|my_center|LOCUS_3370 3686 3459 gene locus_tag LOCUS_3380 3686 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 3725 3798 gene locus_tag LOCUS_t0300 3725 3798 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3867 5399 gene locus_tag LOCUS_3390 3867 5399 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_3390 5470 5551 gene locus_tag LOCUS_t0310 5470 5551 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence24 1242 4109 gene locus_tag LOCUS_3400 gene leuS 1242 4109 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496564.1 protein_id gnl|my_center|LOCUS_3400 4370 4155 gene locus_tag LOCUS_3410 4370 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3410 4312 4533 gene locus_tag LOCUS_3420 4312 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3420 4678 4752 gene locus_tag LOCUS_t0320 4678 4752 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4938 4952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence25 975 1202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence26 1291 68 gene locus_tag LOCUS_3430 1291 68 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_3430 2936 1596 gene locus_tag LOCUS_3440 2936 1596 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_3440 >Feature sequence27 405 731 gene locus_tag LOCUS_3450 405 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3450 745 1008 gene locus_tag LOCUS_3460 745 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3460 1531 1355 gene locus_tag LOCUS_3470 1531 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 1581 2045 gene locus_tag LOCUS_3480 gene rplM 1581 2045 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_3480 2042 2680 gene locus_tag LOCUS_3490 2042 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3490 3270 2872 gene locus_tag LOCUS_3500 3270 2872 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_3500 >Feature sequence28 >Feature sequence29 151 2316 gene locus_tag LOCUS_3510 gene metG 151 2316 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889772.1 protein_id gnl|my_center|LOCUS_3510 2363 2932 gene locus_tag LOCUS_3520 2363 2932 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_3520 >Feature sequence30 1206 784 gene locus_tag LOCUS_3530 1206 784 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250482.1 protein_id gnl|my_center|LOCUS_3530 1664 1515 gene locus_tag LOCUS_3540 1664 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3540 1756 1686 gene locus_tag LOCUS_t0330 1756 1686 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 <2602 1757 gene locus_tag LOCUS_3550 <2602 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023463.1:deoxyribonuclease IV >Feature sequence31 >Feature sequence32 878 806 gene locus_tag LOCUS_t0340 878 806 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1007 1384 gene locus_tag LOCUS_3560 1007 1384 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877501.1 protein_id gnl|my_center|LOCUS_3560 1421 1573 gene locus_tag LOCUS_3570 1421 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3570 >Feature sequence33 1197 1249 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence34 >Feature sequence35 119 538 gene locus_tag LOCUS_3580 119 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3580