>Feature sequence001 348 2975 gene locus_tag LOCUS_00010 348 2975 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144168.1 protein_id gnl|my_center|LOCUS_00010 3364 2984 gene locus_tag LOCUS_00020 3364 2984 CDS product DUF1830 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057308.1 protein_id gnl|my_center|LOCUS_00020 5191 3890 gene locus_tag LOCUS_00030 gene hemL 5191 3890 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797681.1 protein_id gnl|my_center|LOCUS_00030 5596 6744 gene locus_tag LOCUS_00040 gene dnaN 5596 6744 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058182.1 protein_id gnl|my_center|LOCUS_00040 8022 7087 gene locus_tag LOCUS_00050 8022 7087 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005095959.1 protein_id gnl|my_center|LOCUS_00050 9112 8099 gene locus_tag LOCUS_00060 9112 8099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 10908 9151 gene locus_tag LOCUS_00070 10908 9151 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_00070 18853 10991 gene locus_tag LOCUS_00080 18853 10991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 19773 19018 gene locus_tag LOCUS_00090 19773 19018 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_00090 30202 19805 gene locus_tag LOCUS_00100 30202 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 42133 30428 gene locus_tag LOCUS_00110 42133 30428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 42883 51252 gene locus_tag LOCUS_00120 42883 51252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00120 51268 57648 gene locus_tag LOCUS_00130 51268 57648 CDS product non-ribosomal peptide synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000503026.1 protein_id gnl|my_center|LOCUS_00130 57645 61517 gene locus_tag LOCUS_00140 57645 61517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00140 >Feature sequence002 531 1118 gene locus_tag LOCUS_00150 531 1118 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_00150 1294 1887 gene locus_tag LOCUS_00160 gene ureG 1294 1887 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_00160 2632 1898 gene locus_tag LOCUS_00170 2632 1898 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_00170 4066 2639 gene locus_tag LOCUS_00180 4066 2639 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_00180 5860 4259 gene locus_tag LOCUS_00190 5860 4259 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_00190 6171 6419 gene locus_tag LOCUS_00200 6171 6419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 6416 7732 gene locus_tag LOCUS_00210 6416 7732 CDS product AtzE family amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965237.1 protein_id gnl|my_center|LOCUS_00210 7781 8923 gene locus_tag LOCUS_00220 7781 8923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 8920 10197 gene locus_tag LOCUS_00230 8920 10197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 10184 10975 gene locus_tag LOCUS_00240 10184 10975 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143074.1 protein_id gnl|my_center|LOCUS_00240 11293 12354 gene locus_tag LOCUS_00250 11293 12354 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_00250 12484 13656 gene locus_tag LOCUS_00260 gene rodA 12484 13656 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_00260 14639 15616 gene locus_tag LOCUS_00270 14639 15616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_00270 15729 16703 gene locus_tag LOCUS_00280 15729 16703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267860.1 protein_id gnl|my_center|LOCUS_00280 17452 16919 gene locus_tag LOCUS_00290 17452 16919 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000764601.1 protein_id gnl|my_center|LOCUS_00290 19695 17632 gene locus_tag LOCUS_00300 19695 17632 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_00300 20186 19932 gene locus_tag LOCUS_00310 20186 19932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920999.1 protein_id gnl|my_center|LOCUS_00310 21229 20252 gene locus_tag LOCUS_00320 21229 20252 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142872.1 protein_id gnl|my_center|LOCUS_00320 21327 22154 gene locus_tag LOCUS_00330 21327 22154 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_00330 22435 23646 gene locus_tag LOCUS_00340 22435 23646 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028529.1 protein_id gnl|my_center|LOCUS_00340 24867 23971 gene locus_tag LOCUS_00350 24867 23971 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_00350 25516 24917 gene locus_tag LOCUS_00360 25516 24917 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_00360 26008 25667 gene locus_tag LOCUS_00370 26008 25667 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020812.1 protein_id gnl|my_center|LOCUS_00370 26303 25995 gene locus_tag LOCUS_00380 26303 25995 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_00380 27210 26344 gene locus_tag LOCUS_00390 27210 26344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 29946 27520 gene locus_tag LOCUS_00400 29946 27520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 30168 31808 gene locus_tag LOCUS_00410 30168 31808 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_00410 32345 32031 gene locus_tag LOCUS_00420 32345 32031 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_00420 33168 32410 gene locus_tag LOCUS_00430 33168 32410 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140107.1 protein_id gnl|my_center|LOCUS_00430 33566 33192 gene locus_tag LOCUS_00440 33566 33192 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_00440 33986 35182 gene locus_tag LOCUS_00450 33986 35182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 37613 36771 gene locus_tag LOCUS_00460 37613 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 38036 40288 gene locus_tag LOCUS_00470 38036 40288 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057710.1 protein_id gnl|my_center|LOCUS_00470 40291 41073 gene locus_tag LOCUS_00480 40291 41073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 41346 42392 gene locus_tag LOCUS_00490 gene fbp 41346 42392 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056391.1 protein_id gnl|my_center|LOCUS_00490 42508 43881 gene locus_tag LOCUS_00500 42508 43881 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_00500 43899 44543 gene locus_tag LOCUS_00510 43899 44543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188163.1 protein_id gnl|my_center|LOCUS_00510 44881 45369 gene locus_tag LOCUS_00520 44881 45369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 45541 45888 gene locus_tag LOCUS_00530 45541 45888 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057655.1 protein_id gnl|my_center|LOCUS_00530 45885 47321 gene locus_tag LOCUS_00540 45885 47321 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_00540 47318 47701 gene locus_tag LOCUS_00550 47318 47701 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_00550 47698 47949 gene locus_tag LOCUS_00560 47698 47949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_00560 47946 48215 gene locus_tag LOCUS_00570 47946 48215 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_00570 48224 48766 gene locus_tag LOCUS_00580 48224 48766 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057650.1 protein_id gnl|my_center|LOCUS_00580 48766 49428 gene locus_tag LOCUS_00590 48766 49428 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_00590 51768 49597 gene locus_tag LOCUS_00600 51768 49597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 52062 52664 gene locus_tag LOCUS_00610 gene lepB 52062 52664 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929024.1 protein_id gnl|my_center|LOCUS_00610 53678 52719 gene locus_tag LOCUS_00620 53678 52719 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524103.1 protein_id gnl|my_center|LOCUS_00620 55617 53824 gene locus_tag LOCUS_00630 gene typA 55617 53824 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_00630 56486 55782 gene locus_tag LOCUS_00640 56486 55782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 56610 57269 gene locus_tag LOCUS_00650 56610 57269 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_00650 >Feature sequence003 524 1159 gene locus_tag LOCUS_00660 524 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 1201 3525 gene locus_tag LOCUS_00670 gene feoB 1201 3525 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986795.1 protein_id gnl|my_center|LOCUS_00670 3862 4101 gene locus_tag LOCUS_00680 3862 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 4227 4775 gene locus_tag LOCUS_00690 4227 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 4787 6949 gene locus_tag LOCUS_00700 4787 6949 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056504.1 protein_id gnl|my_center|LOCUS_00700 6946 7110 gene locus_tag LOCUS_00710 6946 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 7349 7657 gene locus_tag LOCUS_00720 7349 7657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 7774 8757 gene locus_tag LOCUS_00730 7774 8757 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_00730 9146 8895 gene locus_tag LOCUS_00740 9146 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 9718 9158 gene locus_tag LOCUS_00750 9718 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 10107 10256 gene locus_tag LOCUS_00760 10107 10256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 10869 10414 gene locus_tag LOCUS_00770 10869 10414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 11263 11033 gene locus_tag LOCUS_00780 11263 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 12111 11395 gene locus_tag LOCUS_00790 12111 11395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_00790 12924 12115 gene locus_tag LOCUS_00800 12924 12115 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_00800 13703 12924 gene locus_tag LOCUS_00810 13703 12924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 15201 14233 gene locus_tag LOCUS_00820 15201 14233 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_00820 17256 15400 gene locus_tag LOCUS_00830 gene thrS 17256 15400 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_00830 17376 17537 gene locus_tag LOCUS_00840 17376 17537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 18980 17754 gene locus_tag LOCUS_00850 18980 17754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00850 19293 19478 gene locus_tag LOCUS_00860 19293 19478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 19482 19853 gene locus_tag LOCUS_00870 19482 19853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 19869 20783 gene locus_tag LOCUS_00880 19869 20783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20787 21134 gene locus_tag LOCUS_00890 20787 21134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 21145 21558 gene locus_tag LOCUS_00900 21145 21558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 22037 22420 gene locus_tag LOCUS_00910 22037 22420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 22816 22496 gene locus_tag LOCUS_00920 22816 22496 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143494.1 protein_id gnl|my_center|LOCUS_00920 23064 22813 gene locus_tag LOCUS_00930 23064 22813 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530040.1 protein_id gnl|my_center|LOCUS_00930 24275 23532 gene locus_tag LOCUS_00940 24275 23532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 24902 24390 gene locus_tag LOCUS_00950 gene fldA 24902 24390 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_00950 26196 25168 gene locus_tag LOCUS_00960 26196 25168 CDS product chlorophyll a/b binding light-harvesting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921141.1 protein_id gnl|my_center|LOCUS_00960 27222 26656 gene locus_tag LOCUS_00970 27222 26656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 27173 27961 gene locus_tag LOCUS_00980 gene rncS 27173 27961 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001146875.1 protein_id gnl|my_center|LOCUS_00980 28757 27978 gene locus_tag LOCUS_00990 28757 27978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 28928 29971 gene locus_tag LOCUS_01000 28928 29971 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_01000 29983 30324 gene locus_tag LOCUS_01010 29983 30324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 30344 31186 gene locus_tag LOCUS_01020 gene cysT 30344 31186 CDS product sulfate ABC transporter permease subunit CysT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056130.1 protein_id gnl|my_center|LOCUS_01020 31221 32063 gene locus_tag LOCUS_01030 gene cysW 31221 32063 CDS product sulfate ABC transporter permease subunit CysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056131.1 protein_id gnl|my_center|LOCUS_01030 32180 33217 gene locus_tag LOCUS_01040 32180 33217 CDS product TOBE-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057527.1 protein_id gnl|my_center|LOCUS_01040 33674 34861 gene locus_tag LOCUS_01050 33674 34861 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_01050 34886 35497 gene locus_tag LOCUS_01060 34886 35497 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_01060 38237 35601 gene locus_tag LOCUS_01070 38237 35601 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057830.1 protein_id gnl|my_center|LOCUS_01070 38242 38679 gene locus_tag LOCUS_01080 38242 38679 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_01080 38782 39861 gene locus_tag LOCUS_01090 38782 39861 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_01090 41084 40164 gene locus_tag LOCUS_01100 41084 40164 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_01100 41219 43018 gene locus_tag LOCUS_01110 gene thrS 41219 43018 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216087114.1 protein_id gnl|my_center|LOCUS_01110 43401 43105 gene locus_tag LOCUS_01120 43401 43105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_01120 43739 44464 gene locus_tag LOCUS_01130 43739 44464 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_01130 44477 45058 gene locus_tag LOCUS_01140 gene coaE 44477 45058 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124208.1 protein_id gnl|my_center|LOCUS_01140 46008 45178 gene locus_tag LOCUS_01150 46008 45178 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641277.1 protein_id gnl|my_center|LOCUS_01150 48390 46222 gene locus_tag LOCUS_01160 48390 46222 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920783.1 protein_id gnl|my_center|LOCUS_01160 48592 49146 gene locus_tag LOCUS_01170 gene cysC 48592 49146 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_01170 49242 50969 gene locus_tag LOCUS_01180 49242 50969 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142325.1 protein_id gnl|my_center|LOCUS_01180 52312 51365 gene locus_tag LOCUS_01190 52312 51365 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_01190 53796 52732 gene locus_tag LOCUS_01200 gene hemE 53796 52732 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_01200 56106 53887 gene locus_tag LOCUS_01210 56106 53887 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence004 645 403 gene locus_tag LOCUS_01220 645 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 2231 705 gene locus_tag LOCUS_01230 gene lnt 2231 705 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_01230 2457 3227 gene locus_tag LOCUS_01240 2457 3227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 3695 3309 gene locus_tag LOCUS_01250 3695 3309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_01250 4236 5156 gene locus_tag LOCUS_01260 4236 5156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 5430 6059 gene locus_tag LOCUS_01270 5430 6059 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_01270 6354 7004 gene locus_tag LOCUS_01280 6354 7004 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_01280 7119 8114 gene locus_tag LOCUS_01290 7119 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 8101 8553 gene locus_tag LOCUS_01300 8101 8553 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_01300 10005 8560 gene locus_tag LOCUS_01310 10005 8560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11457 10204 gene locus_tag LOCUS_01320 gene sbcD 11457 10204 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_01320 11643 11500 gene locus_tag LOCUS_01330 11643 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 11957 12352 gene locus_tag LOCUS_01340 11957 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 12507 13607 gene locus_tag LOCUS_01350 gene aroB 12507 13607 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_01350 15004 13748 gene locus_tag LOCUS_01360 15004 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 17166 15001 gene locus_tag LOCUS_01370 17166 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 17527 17712 gene locus_tag LOCUS_01380 17527 17712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 17705 17965 gene locus_tag LOCUS_01390 17705 17965 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_01390 18401 18123 gene locus_tag LOCUS_01400 18401 18123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 18779 18471 gene locus_tag LOCUS_01410 18779 18471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 19032 18772 gene locus_tag LOCUS_01420 19032 18772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 19368 19039 gene locus_tag LOCUS_01430 19368 19039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918611.1 protein_id gnl|my_center|LOCUS_01430 19735 19412 gene locus_tag LOCUS_01440 19735 19412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 21078 19939 gene locus_tag LOCUS_01450 21078 19939 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_01450 21317 22501 gene locus_tag LOCUS_01460 21317 22501 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_01460 22501 23085 gene locus_tag LOCUS_01470 22501 23085 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_01470 23829 23437 gene locus_tag LOCUS_01480 23829 23437 CDS product DUF4278 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056168.1 protein_id gnl|my_center|LOCUS_01480 24400 23984 gene locus_tag LOCUS_01490 24400 23984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 24873 25922 gene locus_tag LOCUS_01500 24873 25922 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_01500 25996 25924 gene locus_tag LOCUS_t00010 25996 25924 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 27714 26422 gene locus_tag LOCUS_01510 27714 26422 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_01510 27960 28781 gene locus_tag LOCUS_01520 27960 28781 CDS product FtsQ-type POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928485.1 protein_id gnl|my_center|LOCUS_01520 28974 30224 gene locus_tag LOCUS_01530 gene ftsZ 28974 30224 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_01530 30231 31031 gene locus_tag LOCUS_01540 gene thiD 30231 31031 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141510.1 protein_id gnl|my_center|LOCUS_01540 31422 31225 gene locus_tag LOCUS_01550 31422 31225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 31838 32761 gene locus_tag LOCUS_01560 31838 32761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 32821 33258 gene locus_tag LOCUS_01570 32821 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 35016 33505 gene locus_tag LOCUS_01580 35016 33505 CDS product amino acid ABC transporter substrate-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963438.1 protein_id gnl|my_center|LOCUS_01580 35215 35970 gene locus_tag LOCUS_01590 35215 35970 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246180.1 protein_id gnl|my_center|LOCUS_01590 36323 36718 gene locus_tag LOCUS_01600 36323 36718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 36772 38283 gene locus_tag LOCUS_01610 36772 38283 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_01610 38337 38771 gene locus_tag LOCUS_01620 38337 38771 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_01620 38872 39513 gene locus_tag LOCUS_01630 38872 39513 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_01630 39829 39539 gene locus_tag LOCUS_01640 39829 39539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 40101 39877 gene locus_tag LOCUS_01650 40101 39877 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_01650 40655 40380 gene locus_tag LOCUS_01660 40655 40380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_01660 40879 40652 gene locus_tag LOCUS_01670 40879 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 41553 41957 gene locus_tag LOCUS_01680 41553 41957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 42366 44813 gene locus_tag LOCUS_01690 42366 44813 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022220.1 protein_id gnl|my_center|LOCUS_01690 45390 44917 gene locus_tag LOCUS_01700 45390 44917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 >Feature sequence005 236 649 gene locus_tag LOCUS_01710 236 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1416 646 gene locus_tag LOCUS_01720 1416 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2719 1526 gene locus_tag LOCUS_01730 2719 1526 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_01730 3397 3107 gene locus_tag LOCUS_01740 gene kaiB 3397 3107 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_01740 4350 3394 gene locus_tag LOCUS_01750 4350 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 4481 4512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5378 4605 gene locus_tag LOCUS_01760 5378 4605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5774 5475 gene locus_tag LOCUS_01770 5774 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6068 6769 gene locus_tag LOCUS_01780 6068 6769 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056001.1 protein_id gnl|my_center|LOCUS_01780 6813 7202 gene locus_tag LOCUS_01790 6813 7202 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057922.1 protein_id gnl|my_center|LOCUS_01790 7385 8041 gene locus_tag LOCUS_01800 7385 8041 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003198.1 protein_id gnl|my_center|LOCUS_01800 8055 8813 gene locus_tag LOCUS_01810 8055 8813 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119071.1 protein_id gnl|my_center|LOCUS_01810 9020 9331 gene locus_tag LOCUS_01820 9020 9331 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_01820 9401 9628 gene locus_tag LOCUS_01830 9401 9628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 9721 9954 gene locus_tag LOCUS_01840 9721 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 10262 12070 gene locus_tag LOCUS_01850 10262 12070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12393 12635 gene locus_tag LOCUS_01860 12393 12635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 12622 13047 gene locus_tag LOCUS_01870 12622 13047 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_01870 13491 13213 gene locus_tag LOCUS_01880 13491 13213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 14677 13709 gene locus_tag LOCUS_01890 14677 13709 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_01890 14902 14702 gene locus_tag LOCUS_01900 14902 14702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 15068 15988 gene locus_tag LOCUS_01910 15068 15988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 17166 16210 gene locus_tag LOCUS_01920 17166 16210 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_01920 17527 17180 gene locus_tag LOCUS_01930 gene rplT 17527 17180 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057992.1 protein_id gnl|my_center|LOCUS_01930 17762 17559 gene locus_tag LOCUS_01940 gene rpmI 17762 17559 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_01940 17972 19147 gene locus_tag LOCUS_01950 17972 19147 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_01950 20307 21689 gene locus_tag LOCUS_01960 gene thiC 20307 21689 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_01960 22316 21777 gene locus_tag LOCUS_01970 22316 21777 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141530.1 protein_id gnl|my_center|LOCUS_01970 22656 23576 gene locus_tag LOCUS_01980 22656 23576 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056335.1 protein_id gnl|my_center|LOCUS_01980 25051 23984 gene locus_tag LOCUS_01990 25051 23984 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005897713.1 protein_id gnl|my_center|LOCUS_01990 25551 25105 gene locus_tag LOCUS_02000 25551 25105 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_02000 26042 25590 gene locus_tag LOCUS_02010 26042 25590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 26522 26046 gene locus_tag LOCUS_02020 26522 26046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 27052 26561 gene locus_tag LOCUS_02030 27052 26561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 30474 27115 gene locus_tag LOCUS_02040 30474 27115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 30960 33953 gene locus_tag LOCUS_02050 30960 33953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 34470 33979 gene locus_tag LOCUS_02060 34470 33979 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642421.1 protein_id gnl|my_center|LOCUS_02060 40736 34599 gene locus_tag LOCUS_02070 40736 34599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 <41365 40834 gene locus_tag LOCUS_02080 <41365 40834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056956.1:RNA-guided endonuclease TnpB family protein >Feature sequence006 598 149 gene locus_tag LOCUS_02090 598 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 834 598 gene locus_tag LOCUS_02100 834 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1037 882 gene locus_tag LOCUS_02110 1037 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 1572 997 gene locus_tag LOCUS_02120 1572 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 1759 1556 gene locus_tag LOCUS_02130 1759 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 2289 1909 gene locus_tag LOCUS_02140 2289 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2594 2286 gene locus_tag LOCUS_02150 2594 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3014 3382 gene locus_tag LOCUS_02160 3014 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3458 5854 gene locus_tag LOCUS_02170 3458 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6089 6277 gene locus_tag LOCUS_02180 6089 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6270 6557 gene locus_tag LOCUS_02190 6270 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 6716 7039 gene locus_tag LOCUS_02200 6716 7039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7968 7036 gene locus_tag LOCUS_02210 gene secF 7968 7036 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_02210 9506 8100 gene locus_tag LOCUS_02220 gene secD 9506 8100 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_02220 10516 9533 gene locus_tag LOCUS_02230 10516 9533 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_02230 10867 12435 gene locus_tag LOCUS_02240 10867 12435 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_02240 12515 13111 gene locus_tag LOCUS_02250 gene yqeK 12515 13111 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057165.1 protein_id gnl|my_center|LOCUS_02250 13167 13571 gene locus_tag LOCUS_02260 gene rsfS 13167 13571 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_02260 13577 14080 gene locus_tag LOCUS_02270 13577 14080 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_02270 14096 15049 gene locus_tag LOCUS_02280 14096 15049 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550332.1 protein_id gnl|my_center|LOCUS_02280 15340 15600 gene locus_tag LOCUS_02290 15340 15600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 15600 15866 gene locus_tag LOCUS_02300 15600 15866 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360769.1 protein_id gnl|my_center|LOCUS_02300 16987 16121 gene locus_tag LOCUS_02310 16987 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 17209 17703 gene locus_tag LOCUS_02320 17209 17703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 17758 18060 gene locus_tag LOCUS_02330 17758 18060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 18300 19457 gene locus_tag LOCUS_02340 18300 19457 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_02340 19460 20101 gene locus_tag LOCUS_02350 19460 20101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929189.1 protein_id gnl|my_center|LOCUS_02350 21876 20188 gene locus_tag LOCUS_02360 21876 20188 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057909.1 protein_id gnl|my_center|LOCUS_02360 22791 22234 gene locus_tag LOCUS_02370 22791 22234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 24288 22924 gene locus_tag LOCUS_02380 24288 22924 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_02380 24917 24447 gene locus_tag LOCUS_02390 24917 24447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 25618 24908 gene locus_tag LOCUS_02400 25618 24908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 25914 26213 gene locus_tag LOCUS_02410 25914 26213 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_02410 26197 26595 gene locus_tag LOCUS_02420 26197 26595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 26734 27000 gene locus_tag LOCUS_02430 26734 27000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 28661 26997 gene locus_tag LOCUS_02440 28661 26997 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_02440 28774 29661 gene locus_tag LOCUS_02450 gene cofG 28774 29661 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057355.1 protein_id gnl|my_center|LOCUS_02450 30301 31614 gene locus_tag LOCUS_02460 30301 31614 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_02460 31932 31585 gene locus_tag LOCUS_02470 31932 31585 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_02470 32169 33164 gene locus_tag LOCUS_02480 32169 33164 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143314.1 protein_id gnl|my_center|LOCUS_02480 33413 34087 gene locus_tag LOCUS_02490 33413 34087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 34452 34745 gene locus_tag LOCUS_02500 34452 34745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 34742 35086 gene locus_tag LOCUS_02510 34742 35086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 36617 35349 gene locus_tag LOCUS_02520 36617 35349 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228237.1 protein_id gnl|my_center|LOCUS_02520 38359 36617 gene locus_tag LOCUS_02530 38359 36617 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_02530 39697 38558 gene locus_tag LOCUS_02540 39697 38558 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_02540 >Feature sequence007 391 774 gene locus_tag LOCUS_02550 391 774 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056206.1 protein_id gnl|my_center|LOCUS_02550 1848 985 gene locus_tag LOCUS_02560 1848 985 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_02560 2109 2618 gene locus_tag LOCUS_02570 2109 2618 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125313.1 protein_id gnl|my_center|LOCUS_02570 2615 3742 gene locus_tag LOCUS_02580 2615 3742 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057098.1 protein_id gnl|my_center|LOCUS_02580 4898 3960 gene locus_tag LOCUS_02590 4898 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4981 5115 gene locus_tag LOCUS_02600 4981 5115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 5433 7361 gene locus_tag LOCUS_02610 5433 7361 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057496.1 protein_id gnl|my_center|LOCUS_02610 7524 8729 gene locus_tag LOCUS_02620 7524 8729 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_02620 9070 9351 gene locus_tag LOCUS_02630 9070 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 9339 9680 gene locus_tag LOCUS_02640 9339 9680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9765 10031 gene locus_tag LOCUS_02650 9765 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02650 10148 10297 gene locus_tag LOCUS_02660 10148 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 10819 11529 gene locus_tag LOCUS_02670 10819 11529 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933411.1 protein_id gnl|my_center|LOCUS_02670 11626 11841 gene locus_tag LOCUS_02680 11626 11841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 11842 12102 gene locus_tag LOCUS_02690 11842 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 12476 12162 gene locus_tag LOCUS_02700 12476 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 12712 13521 gene locus_tag LOCUS_02710 gene larE 12712 13521 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_02710 13848 14858 gene locus_tag LOCUS_02720 13848 14858 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_02720 14883 15674 gene locus_tag LOCUS_02730 14883 15674 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_02730 15776 17254 gene locus_tag LOCUS_02740 15776 17254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_02740 17285 18661 gene locus_tag LOCUS_02750 17285 18661 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_02750 20082 18673 gene locus_tag LOCUS_02760 20082 18673 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_02760 20722 20318 gene locus_tag LOCUS_02770 20722 20318 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_02770 20764 21315 gene locus_tag LOCUS_02780 20764 21315 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056210.1 protein_id gnl|my_center|LOCUS_02780 21447 21800 gene locus_tag LOCUS_02790 21447 21800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 21784 23685 gene locus_tag LOCUS_02800 21784 23685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 25682 23718 gene locus_tag LOCUS_02810 gene ftsH 25682 23718 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_02810 25815 26801 gene locus_tag LOCUS_02820 gene ccsB 25815 26801 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_02820 27183 28076 gene locus_tag LOCUS_02830 27183 28076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 28132 29454 gene locus_tag LOCUS_02840 28132 29454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 29782 31053 gene locus_tag LOCUS_02850 29782 31053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 31100 31612 gene locus_tag LOCUS_02860 31100 31612 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_02860 31668 32042 gene locus_tag LOCUS_02870 31668 32042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 33526 32030 gene locus_tag LOCUS_02880 33526 32030 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_02880 34211 33534 gene locus_tag LOCUS_02890 gene ntcA 34211 33534 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_02890 34426 35202 gene locus_tag LOCUS_02900 gene fabI 34426 35202 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_02900 35601 35365 gene locus_tag LOCUS_02910 35601 35365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 36349 35810 gene locus_tag LOCUS_02920 36349 35810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 39542 36354 gene locus_tag LOCUS_02930 39542 36354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 >Feature sequence008 638 973 gene locus_tag LOCUS_02940 638 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2098 1025 gene locus_tag LOCUS_02950 2098 1025 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920924.1 protein_id gnl|my_center|LOCUS_02950 2332 2904 gene locus_tag LOCUS_02960 2332 2904 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_02960 2904 3224 gene locus_tag LOCUS_02970 2904 3224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4414 3242 gene locus_tag LOCUS_02980 gene hemW 4414 3242 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799709.1 protein_id gnl|my_center|LOCUS_02980 5150 4563 gene locus_tag LOCUS_02990 5150 4563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 9580 5189 gene locus_tag LOCUS_03000 9580 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 9921 10136 gene locus_tag LOCUS_03010 9921 10136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 10492 11571 gene locus_tag LOCUS_03020 10492 11571 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_03020 11968 11690 gene locus_tag LOCUS_03030 11968 11690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 12403 13740 gene locus_tag LOCUS_03040 gene trmFO 12403 13740 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056303.1 protein_id gnl|my_center|LOCUS_03040 13802 14299 gene locus_tag LOCUS_03050 13802 14299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 17269 14621 gene locus_tag LOCUS_03060 gene mutS 17269 14621 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_03060 18267 17758 gene locus_tag LOCUS_03070 gene apcB 18267 17758 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_03070 19577 18450 gene locus_tag LOCUS_03080 gene proB 19577 18450 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_03080 19515 19724 gene locus_tag LOCUS_03090 19515 19724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 21653 19689 gene locus_tag LOCUS_03100 21653 19689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 22353 21712 gene locus_tag LOCUS_03110 22353 21712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 22811 22350 gene locus_tag LOCUS_03120 22811 22350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 24895 22886 gene locus_tag LOCUS_03130 24895 22886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 25087 25770 gene locus_tag LOCUS_03140 25087 25770 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_03140 25915 26514 gene locus_tag LOCUS_03150 25915 26514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022055.1 protein_id gnl|my_center|LOCUS_03150 26738 27556 gene locus_tag LOCUS_03160 26738 27556 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529017.1 protein_id gnl|my_center|LOCUS_03160 28622 27816 gene locus_tag LOCUS_03170 28622 27816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 28704 29777 gene locus_tag LOCUS_03180 gene murG 28704 29777 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057646.1 protein_id gnl|my_center|LOCUS_03180 30349 29759 gene locus_tag LOCUS_03190 30349 29759 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_03190 31245 30385 gene locus_tag LOCUS_03200 31245 30385 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_03200 33168 31873 gene locus_tag LOCUS_03210 33168 31873 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_03210 33548 34435 gene locus_tag LOCUS_03220 33548 34435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 34459 35037 gene locus_tag LOCUS_03230 34459 35037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 35121 35891 gene locus_tag LOCUS_03240 35121 35891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence009 1329 451 gene locus_tag LOCUS_03250 1329 451 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_03250 2235 1432 gene locus_tag LOCUS_03260 2235 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3266 2274 gene locus_tag LOCUS_03270 3266 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3716 4369 gene locus_tag LOCUS_03280 3716 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 4875 4690 gene locus_tag LOCUS_03290 4875 4690 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_03290 5096 4872 gene locus_tag LOCUS_03300 5096 4872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5390 5142 gene locus_tag LOCUS_03310 5390 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 5660 5860 gene locus_tag LOCUS_03320 5660 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5857 6147 gene locus_tag LOCUS_03330 5857 6147 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_03330 9406 6401 gene locus_tag LOCUS_03340 9406 6401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9720 9403 gene locus_tag LOCUS_03350 9720 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 10671 9949 gene locus_tag LOCUS_03360 10671 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 12434 10668 gene locus_tag LOCUS_03370 12434 10668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 12877 12647 gene locus_tag LOCUS_03380 12877 12647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13514 15325 gene locus_tag LOCUS_03390 gene lepA 13514 15325 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_03390 15381 16559 gene locus_tag LOCUS_03400 15381 16559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16563 17246 gene locus_tag LOCUS_03410 16563 17246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 17515 19329 gene locus_tag LOCUS_03420 17515 19329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056007.1 protein_id gnl|my_center|LOCUS_03420 19388 19699 gene locus_tag LOCUS_03430 19388 19699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 20754 19768 gene locus_tag LOCUS_03440 gene hemB 20754 19768 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144341.1 protein_id gnl|my_center|LOCUS_03440 21193 21558 gene locus_tag LOCUS_03450 21193 21558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 21618 21998 gene locus_tag LOCUS_03460 21618 21998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 22227 22078 gene locus_tag LOCUS_03470 22227 22078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 23027 22395 gene locus_tag LOCUS_03480 23027 22395 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105321.1 protein_id gnl|my_center|LOCUS_03480 24304 23024 gene locus_tag LOCUS_03490 24304 23024 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_03490 24773 25963 gene locus_tag LOCUS_03500 24773 25963 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_03500 26429 26190 gene locus_tag LOCUS_03510 26429 26190 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_03510 27361 26873 gene locus_tag LOCUS_03520 27361 26873 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_03520 27903 27394 gene locus_tag LOCUS_03530 gene ybeY 27903 27394 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_03530 28100 27915 gene locus_tag LOCUS_03540 28100 27915 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928928.1 protein_id gnl|my_center|LOCUS_03540 28467 28240 gene locus_tag LOCUS_03550 28467 28240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 28442 29878 gene locus_tag LOCUS_03560 28442 29878 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056643.1 protein_id gnl|my_center|LOCUS_03560 30192 30893 gene locus_tag LOCUS_03570 30192 30893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 31459 31791 gene locus_tag LOCUS_03580 31459 31791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 31798 32151 gene locus_tag LOCUS_03590 31798 32151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 32572 32808 gene locus_tag LOCUS_03600 32572 32808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 32789 33103 gene locus_tag LOCUS_03610 32789 33103 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_03610 33499 33744 gene locus_tag LOCUS_03620 33499 33744 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878101.1 protein_id gnl|my_center|LOCUS_03620 33741 34226 gene locus_tag LOCUS_03630 33741 34226 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_03630 34513 34788 gene locus_tag LOCUS_03640 34513 34788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 34785 35153 gene locus_tag LOCUS_03650 34785 35153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence010 949 743 gene locus_tag LOCUS_03660 949 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1344 1123 gene locus_tag LOCUS_03670 1344 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1866 1372 gene locus_tag LOCUS_03680 1866 1372 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_03680 2140 1850 gene locus_tag LOCUS_03690 2140 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 2492 2223 gene locus_tag LOCUS_03700 2492 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2733 2485 gene locus_tag LOCUS_03710 2733 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3451 4179 gene locus_tag LOCUS_03720 3451 4179 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_03720 5136 4255 gene locus_tag LOCUS_03730 5136 4255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6128 5343 gene locus_tag LOCUS_03740 6128 5343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6549 6247 gene locus_tag LOCUS_03750 6549 6247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 7424 6780 gene locus_tag LOCUS_03760 gene pdxH 7424 6780 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056186.1 protein_id gnl|my_center|LOCUS_03760 7476 8246 gene locus_tag LOCUS_03770 7476 8246 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_03770 10192 8708 gene locus_tag LOCUS_03780 10192 8708 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142619.1 protein_id gnl|my_center|LOCUS_03780 10462 11769 gene locus_tag LOCUS_03790 10462 11769 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056829.1 protein_id gnl|my_center|LOCUS_03790 11806 12612 gene locus_tag LOCUS_03800 11806 12612 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_03800 13985 12648 gene locus_tag LOCUS_03810 13985 12648 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_03810 14063 16195 gene locus_tag LOCUS_03820 14063 16195 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_03820 17180 16368 gene locus_tag LOCUS_03830 gene hypB 17180 16368 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_03830 17515 17171 gene locus_tag LOCUS_03840 gene hypA 17515 17171 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_03840 18725 17655 gene locus_tag LOCUS_03850 gene hypE 18725 17655 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720673.1 protein_id gnl|my_center|LOCUS_03850 19564 18857 gene locus_tag LOCUS_03860 19564 18857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03860 20052 20945 gene locus_tag LOCUS_03870 20052 20945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 21013 23481 gene locus_tag LOCUS_03880 gene recG 21013 23481 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_03880 24465 23917 gene locus_tag LOCUS_03890 24465 23917 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_03890 24974 24462 gene locus_tag LOCUS_03900 24974 24462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 25377 24979 gene locus_tag LOCUS_03910 25377 24979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 26100 25384 gene locus_tag LOCUS_03920 gene hoxU 26100 25384 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_03920 27813 26185 gene locus_tag LOCUS_03930 gene hcp 27813 26185 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545464.1 protein_id gnl|my_center|LOCUS_03930 28180 28449 gene locus_tag LOCUS_03940 28180 28449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 28648 28460 gene locus_tag LOCUS_03950 28648 28460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 28868 28650 gene locus_tag LOCUS_03960 28868 28650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 29401 28985 gene locus_tag LOCUS_03970 29401 28985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 29651 29403 gene locus_tag LOCUS_03980 29651 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 30297 29875 gene locus_tag LOCUS_03990 30297 29875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 30551 30294 gene locus_tag LOCUS_04000 30551 30294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 31580 30606 gene locus_tag LOCUS_04010 31580 30606 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065100.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04010 32769 31621 gene locus_tag LOCUS_04020 32769 31621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04020 34160 32844 gene locus_tag LOCUS_04030 34160 32844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 35302 34307 gene locus_tag LOCUS_04040 35302 34307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence011 385 804 gene locus_tag LOCUS_04050 385 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 789 1091 gene locus_tag LOCUS_04060 789 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1899 1204 gene locus_tag LOCUS_04070 1899 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3132 2098 gene locus_tag LOCUS_04080 gene gap 3132 2098 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055898.1 protein_id gnl|my_center|LOCUS_04080 3806 6226 gene locus_tag LOCUS_04090 3806 6226 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_04090 6900 6535 gene locus_tag LOCUS_04100 6900 6535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 7164 6904 gene locus_tag LOCUS_04110 7164 6904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7758 7561 gene locus_tag LOCUS_04120 7758 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8036 7773 gene locus_tag LOCUS_04130 8036 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 8805 8557 gene locus_tag LOCUS_04140 8805 8557 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_04140 9040 9342 gene locus_tag LOCUS_04150 9040 9342 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144191.1 protein_id gnl|my_center|LOCUS_04150 9442 9831 gene locus_tag LOCUS_04160 9442 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 9812 9991 gene locus_tag LOCUS_04170 9812 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 10138 10338 gene locus_tag LOCUS_04180 10138 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10339 10572 gene locus_tag LOCUS_04190 10339 10572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_04190 10886 10713 gene locus_tag LOCUS_04200 10886 10713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11092 10883 gene locus_tag LOCUS_04210 11092 10883 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_04210 11896 11324 gene locus_tag LOCUS_04220 11896 11324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 13039 11897 gene locus_tag LOCUS_04230 13039 11897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 13367 13128 gene locus_tag LOCUS_04240 13367 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16186 13751 gene locus_tag LOCUS_04250 gene pheT 16186 13751 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_04250 16396 17514 gene locus_tag LOCUS_04260 16396 17514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 17517 18293 gene locus_tag LOCUS_04270 17517 18293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 18382 19014 gene locus_tag LOCUS_04280 18382 19014 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929521.1 protein_id gnl|my_center|LOCUS_04280 19042 19821 gene locus_tag LOCUS_04290 19042 19821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_04290 19943 21319 gene locus_tag LOCUS_04300 19943 21319 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_04300 21628 21407 gene locus_tag LOCUS_04310 21628 21407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 21860 21603 gene locus_tag LOCUS_04320 21860 21603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 22375 22043 gene locus_tag LOCUS_04330 22375 22043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 23212 22523 gene locus_tag LOCUS_04340 23212 22523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 23636 24067 gene locus_tag LOCUS_04350 23636 24067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 24075 24317 gene locus_tag LOCUS_04360 24075 24317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 24354 25367 gene locus_tag LOCUS_04370 24354 25367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 25414 25986 gene locus_tag LOCUS_04380 25414 25986 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_04380 26571 27482 gene locus_tag LOCUS_04390 gene menA 26571 27482 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_04390 27755 29449 gene locus_tag LOCUS_04400 27755 29449 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_04400 29506 29958 gene locus_tag LOCUS_04410 29506 29958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 29961 31328 gene locus_tag LOCUS_04420 gene rlmD 29961 31328 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056786.1 protein_id gnl|my_center|LOCUS_04420 31670 32071 gene locus_tag LOCUS_04430 31670 32071 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_04430 32349 32068 gene locus_tag LOCUS_04440 32349 32068 CDS product DUF6439 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056108.1 protein_id gnl|my_center|LOCUS_04440 32422 32823 gene locus_tag LOCUS_04450 32422 32823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 33520 32879 gene locus_tag LOCUS_04460 33520 32879 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058167.1 protein_id gnl|my_center|LOCUS_04460 34010 33495 gene locus_tag LOCUS_04470 34010 33495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 >Feature sequence012 793 110 gene locus_tag LOCUS_04480 793 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3459 796 gene locus_tag LOCUS_04490 3459 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 3542 3946 gene locus_tag LOCUS_04500 3542 3946 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_04500 4717 4025 gene locus_tag LOCUS_04510 4717 4025 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_04510 6382 4781 gene locus_tag LOCUS_04520 gene dndC 6382 4781 CDS product DNA phosphorothioation system sulfurtransferase DndC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109921.1 protein_id gnl|my_center|LOCUS_04520 7776 6541 gene locus_tag LOCUS_04530 7776 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 8907 8173 gene locus_tag LOCUS_04540 8907 8173 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941468.1 protein_id gnl|my_center|LOCUS_04540 9746 8946 gene locus_tag LOCUS_04550 9746 8946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 10236 10400 gene locus_tag LOCUS_04560 10236 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 11052 10573 gene locus_tag LOCUS_04570 11052 10573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 15651 11434 gene locus_tag LOCUS_04580 15651 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 17525 15648 gene locus_tag LOCUS_04590 17525 15648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 31645 17522 gene locus_tag LOCUS_04600 31645 17522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04600 <33748 31642 gene locus_tag LOCUS_04610 <33748 31642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211478123.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted >Feature sequence013 1593 304 gene locus_tag LOCUS_04620 1593 304 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920845.1 protein_id gnl|my_center|LOCUS_04620 1800 3164 gene locus_tag LOCUS_04630 1800 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3327 4322 gene locus_tag LOCUS_04640 gene dusA 3327 4322 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_04640 4338 5150 gene locus_tag LOCUS_04650 4338 5150 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143024.1 protein_id gnl|my_center|LOCUS_04650 6189 5839 gene locus_tag LOCUS_04660 6189 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 6779 6198 gene locus_tag LOCUS_04670 6779 6198 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_04670 7896 7027 gene locus_tag LOCUS_04680 7896 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 8470 8288 gene locus_tag LOCUS_04690 8470 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 9435 9872 gene locus_tag LOCUS_04700 9435 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 10149 9967 gene locus_tag LOCUS_04710 10149 9967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10369 11940 gene locus_tag LOCUS_04720 10369 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 12046 13089 gene locus_tag LOCUS_04730 gene tsaD 12046 13089 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_04730 13270 14151 gene locus_tag LOCUS_04740 gene truB 13270 14151 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057445.1 protein_id gnl|my_center|LOCUS_04740 14598 14272 gene locus_tag LOCUS_04750 14598 14272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 15746 14700 gene locus_tag LOCUS_04760 gene hisC 15746 14700 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943720.1 protein_id gnl|my_center|LOCUS_04760 17079 15838 gene locus_tag LOCUS_04770 gene ispG 17079 15838 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_04770 18007 17093 gene locus_tag LOCUS_04780 18007 17093 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056888.1 protein_id gnl|my_center|LOCUS_04780 18438 19007 gene locus_tag LOCUS_04790 18438 19007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 19160 20881 gene locus_tag LOCUS_04800 gene lysS 19160 20881 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015229441.1 protein_id gnl|my_center|LOCUS_04800 22581 20935 gene locus_tag LOCUS_04810 22581 20935 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_04810 23080 22640 gene locus_tag LOCUS_04820 23080 22640 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_04820 24220 23714 gene locus_tag LOCUS_04830 24220 23714 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_04830 24465 25523 gene locus_tag LOCUS_04840 24465 25523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444437.1 protein_id gnl|my_center|LOCUS_04840 25627 26307 gene locus_tag LOCUS_04850 25627 26307 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_04850 26358 28085 gene locus_tag LOCUS_04860 gene recN 26358 28085 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140275.1 protein_id gnl|my_center|LOCUS_04860 28730 28089 gene locus_tag LOCUS_04870 28730 28089 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_04870 29396 28755 gene locus_tag LOCUS_04880 29396 28755 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140140.1 protein_id gnl|my_center|LOCUS_04880 29505 30662 gene locus_tag LOCUS_04890 29505 30662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 31196 30921 gene locus_tag LOCUS_04900 31196 30921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 31540 32982 gene locus_tag LOCUS_04910 gene cysS 31540 32982 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_04910 <33748 32965 gene locus_tag LOCUS_04920 <33748 32965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986277.1:glycine betaine ABC transporter substrate-binding protein >Feature sequence014 536 898 gene locus_tag LOCUS_04930 536 898 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_04930 956 1705 gene locus_tag LOCUS_04940 gene atpB 956 1705 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056285.1 protein_id gnl|my_center|LOCUS_04940 1936 2181 gene locus_tag LOCUS_04950 gene atpE 1936 2181 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_04950 2412 2843 gene locus_tag LOCUS_04960 2412 2843 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_04960 2970 3512 gene locus_tag LOCUS_04970 2970 3512 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524128.1 protein_id gnl|my_center|LOCUS_04970 3513 4061 gene locus_tag LOCUS_04980 gene atpH 3513 4061 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056289.1 protein_id gnl|my_center|LOCUS_04980 4130 5638 gene locus_tag LOCUS_04990 gene atpA 4130 5638 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056290.1 protein_id gnl|my_center|LOCUS_04990 5995 6942 gene locus_tag LOCUS_05000 5995 6942 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_05000 7397 7191 gene locus_tag LOCUS_05010 7397 7191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 7845 7621 gene locus_tag LOCUS_05020 7845 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9095 8490 gene locus_tag LOCUS_05030 9095 8490 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889236.1 protein_id gnl|my_center|LOCUS_05030 10516 9239 gene locus_tag LOCUS_05040 gene ahcY 10516 9239 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058222.1 protein_id gnl|my_center|LOCUS_05040 10760 11935 gene locus_tag LOCUS_05050 10760 11935 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065470411.1 protein_id gnl|my_center|LOCUS_05050 11935 12285 gene locus_tag LOCUS_05060 11935 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 12282 12521 gene locus_tag LOCUS_05070 12282 12521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 13276 12605 gene locus_tag LOCUS_05080 13276 12605 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057523.1 protein_id gnl|my_center|LOCUS_05080 14587 13292 gene locus_tag LOCUS_05090 14587 13292 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_05090 15958 14786 gene locus_tag LOCUS_05100 gene dxr 15958 14786 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921140.1 protein_id gnl|my_center|LOCUS_05100 17285 16452 gene locus_tag LOCUS_05110 17285 16452 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_05110 17951 19174 gene locus_tag LOCUS_05120 17951 19174 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920968.1 protein_id gnl|my_center|LOCUS_05120 19659 20474 gene locus_tag LOCUS_05130 19659 20474 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_05130 20699 21949 gene locus_tag LOCUS_05140 20699 21949 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_05140 22435 21983 gene locus_tag LOCUS_05150 gene ruvX 22435 21983 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_05150 23676 22435 gene locus_tag LOCUS_05160 23676 22435 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056850.1 protein_id gnl|my_center|LOCUS_05160 24091 24597 gene locus_tag LOCUS_05170 24091 24597 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_05170 24606 25013 gene locus_tag LOCUS_05180 24606 25013 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_05180 26144 25104 gene locus_tag LOCUS_05190 26144 25104 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_05190 26433 29678 gene locus_tag LOCUS_05200 gene carB 26433 29678 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058165.1 protein_id gnl|my_center|LOCUS_05200 29768 31171 gene locus_tag LOCUS_05210 29768 31171 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_05210 31757 31581 gene locus_tag LOCUS_05220 31757 31581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 33301 31871 gene locus_tag LOCUS_05230 gene lpdA 33301 31871 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence015 1410 460 gene locus_tag LOCUS_05240 1410 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2782 1418 gene locus_tag LOCUS_05250 2782 1418 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_05250 3139 4407 gene locus_tag LOCUS_05260 3139 4407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_05260 4672 5937 gene locus_tag LOCUS_05270 gene purD 4672 5937 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920939.1 protein_id gnl|my_center|LOCUS_05270 6160 7386 gene locus_tag LOCUS_05280 6160 7386 CDS product WcaI family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265553.1 protein_id gnl|my_center|LOCUS_05280 7563 9119 gene locus_tag LOCUS_05290 7563 9119 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057727.1 protein_id gnl|my_center|LOCUS_05290 9834 9196 gene locus_tag LOCUS_05300 gene sufR 9834 9196 CDS product iron-sulfur cluster biosynthesis transcriptional regulator SufR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056342.1 protein_id gnl|my_center|LOCUS_05300 10058 11500 gene locus_tag LOCUS_05310 gene sufB 10058 11500 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_05310 11623 12393 gene locus_tag LOCUS_05320 gene sufC 11623 12393 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_05320 12865 14148 gene locus_tag LOCUS_05330 gene sufD 12865 14148 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_05330 14204 15466 gene locus_tag LOCUS_05340 14204 15466 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_05340 15500 17005 gene locus_tag LOCUS_05350 15500 17005 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001275247.1 protein_id gnl|my_center|LOCUS_05350 18565 17693 gene locus_tag LOCUS_05360 18565 17693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 19117 19647 gene locus_tag LOCUS_05370 19117 19647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 19919 21718 gene locus_tag LOCUS_05380 19919 21718 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208105.1 protein_id gnl|my_center|LOCUS_05380 21696 22058 gene locus_tag LOCUS_05390 21696 22058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 23003 22380 gene locus_tag LOCUS_05400 23003 22380 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_05400 24812 23136 gene locus_tag LOCUS_05410 gene ctaD 24812 23136 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_05410 25807 24842 gene locus_tag LOCUS_05420 25807 24842 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057846.1 protein_id gnl|my_center|LOCUS_05420 26122 27042 gene locus_tag LOCUS_05430 26122 27042 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_05430 27056 28006 gene locus_tag LOCUS_05440 27056 28006 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920945.1 protein_id gnl|my_center|LOCUS_05440 29469 28135 gene locus_tag LOCUS_05450 gene dnaA 29469 28135 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_05450 29554 30132 gene locus_tag LOCUS_05460 gene def 29554 30132 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206042.1 protein_id gnl|my_center|LOCUS_05460 30558 31214 gene locus_tag LOCUS_05470 gene folE 30558 31214 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_05470 31331 31744 gene locus_tag LOCUS_05480 31331 31744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence016 213 1733 gene locus_tag LOCUS_05490 213 1733 CDS product methyltransferase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387742.1 protein_id gnl|my_center|LOCUS_05490 1909 2505 gene locus_tag LOCUS_05500 1909 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2532 3140 gene locus_tag LOCUS_05510 2532 3140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 3186 4379 gene locus_tag LOCUS_05520 3186 4379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5994 4390 gene locus_tag LOCUS_05530 5994 4390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 7475 6357 gene locus_tag LOCUS_05540 7475 6357 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_05540 7774 8934 gene locus_tag LOCUS_05550 gene mtnW 7774 8934 CDS product 2,3-diketo-5-methylthiopentyl-1-phosphate enolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245108.1 protein_id gnl|my_center|LOCUS_05550 10273 8990 gene locus_tag LOCUS_05560 gene serS 10273 8990 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_05560 10614 11216 gene locus_tag LOCUS_05570 10614 11216 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057675.1 protein_id gnl|my_center|LOCUS_05570 11327 12289 gene locus_tag LOCUS_05580 11327 12289 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057967.1 protein_id gnl|my_center|LOCUS_05580 12860 12351 gene locus_tag LOCUS_05590 12860 12351 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_05590 13137 14090 gene locus_tag LOCUS_05600 13137 14090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 17031 14104 gene locus_tag LOCUS_05610 17031 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 17363 18298 gene locus_tag LOCUS_05620 17363 18298 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_05620 18295 19077 gene locus_tag LOCUS_05630 18295 19077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 19292 19828 gene locus_tag LOCUS_05640 19292 19828 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_05640 21682 19883 gene locus_tag LOCUS_05650 21682 19883 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421615.1 protein_id gnl|my_center|LOCUS_05650 24467 21687 gene locus_tag LOCUS_05660 24467 21687 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_05660 24821 26251 gene locus_tag LOCUS_05670 gene pds 24821 26251 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_05670 26357 27289 gene locus_tag LOCUS_05680 26357 27289 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057400.1 protein_id gnl|my_center|LOCUS_05680 27721 27383 gene locus_tag LOCUS_05690 27721 27383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 28117 28359 gene locus_tag LOCUS_05700 28117 28359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 29112 28420 gene locus_tag LOCUS_05710 29112 28420 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_05710 >Feature sequence017 648 364 gene locus_tag LOCUS_05720 648 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 1463 633 gene locus_tag LOCUS_05730 gene rfbF 1463 633 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037178.1 protein_id gnl|my_center|LOCUS_05730 1824 3395 gene locus_tag LOCUS_05740 1824 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3885 3697 gene locus_tag LOCUS_05750 3885 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 4449 4015 gene locus_tag LOCUS_05760 4449 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4903 4577 gene locus_tag LOCUS_05770 4903 4577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 6398 5379 gene locus_tag LOCUS_05780 6398 5379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 8108 6435 gene locus_tag LOCUS_05790 8108 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 9605 8298 gene locus_tag LOCUS_05800 9605 8298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 10459 9686 gene locus_tag LOCUS_05810 10459 9686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12010 10508 gene locus_tag LOCUS_05820 12010 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 13929 12097 gene locus_tag LOCUS_05830 13929 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 14587 13991 gene locus_tag LOCUS_05840 14587 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 15748 14639 gene locus_tag LOCUS_05850 15748 14639 CDS product DUF2235 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226213.1 protein_id gnl|my_center|LOCUS_05850 16270 16998 gene locus_tag LOCUS_05860 16270 16998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 18174 17215 gene locus_tag LOCUS_05870 gene cysK 18174 17215 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_05870 18464 19159 gene locus_tag LOCUS_05880 18464 19159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 19156 19518 gene locus_tag LOCUS_05890 19156 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 19534 20064 gene locus_tag LOCUS_05900 19534 20064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 20618 22273 gene locus_tag LOCUS_05910 20618 22273 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_05910 23529 22303 gene locus_tag LOCUS_05920 23529 22303 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_05920 23542 24423 gene locus_tag LOCUS_05930 23542 24423 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_05930 27694 24572 gene locus_tag LOCUS_05940 27694 24572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <29401 27914 gene locus_tag LOCUS_05950 <29401 27914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein >Feature sequence018 2524 1406 gene locus_tag LOCUS_05960 gene kdpDN 2524 1406 CDS product KdpD-like non-kinase potassium sensor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181481.1 protein_id gnl|my_center|LOCUS_05960 3700 2750 gene locus_tag LOCUS_05970 3700 2750 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_05970 3966 4898 gene locus_tag LOCUS_05980 3966 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 5246 4980 gene locus_tag LOCUS_05990 5246 4980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141287.1 protein_id gnl|my_center|LOCUS_05990 6426 5461 gene locus_tag LOCUS_06000 6426 5461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 8830 6704 gene locus_tag LOCUS_06010 8830 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 9078 8833 gene locus_tag LOCUS_06020 9078 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 10759 9134 gene locus_tag LOCUS_06030 10759 9134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056296.1 protein_id gnl|my_center|LOCUS_06030 10923 11090 gene locus_tag LOCUS_06040 10923 11090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 11605 11249 gene locus_tag LOCUS_06050 11605 11249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 11834 14131 gene locus_tag LOCUS_06060 11834 14131 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920718.1 protein_id gnl|my_center|LOCUS_06060 14289 15287 gene locus_tag LOCUS_06070 14289 15287 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124832.1 protein_id gnl|my_center|LOCUS_06070 15569 16972 gene locus_tag LOCUS_06080 gene leuC 15569 16972 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_06080 17262 17444 gene locus_tag LOCUS_06090 17262 17444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 17848 17474 gene locus_tag LOCUS_06100 17848 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 20394 17950 gene locus_tag LOCUS_06110 20394 17950 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892072.1 protein_id gnl|my_center|LOCUS_06110 21399 20419 gene locus_tag LOCUS_06120 21399 20419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 22039 21494 gene locus_tag LOCUS_06130 22039 21494 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146551.1 protein_id gnl|my_center|LOCUS_06130 22292 23752 gene locus_tag LOCUS_06140 gene zds 22292 23752 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_06140 23924 24619 gene locus_tag LOCUS_06150 23924 24619 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057153.1 protein_id gnl|my_center|LOCUS_06150 24768 25787 gene locus_tag LOCUS_06160 24768 25787 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_06160 26148 27284 gene locus_tag LOCUS_06170 26148 27284 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057921.1 protein_id gnl|my_center|LOCUS_06170 27492 28748 gene locus_tag LOCUS_06180 27492 28748 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence019 1165 803 gene locus_tag LOCUS_06190 1165 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 1496 1152 gene locus_tag LOCUS_06200 1496 1152 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_06200 1661 2026 gene locus_tag LOCUS_06210 1661 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2027 2458 gene locus_tag LOCUS_06220 2027 2458 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_06220 2506 2820 gene locus_tag LOCUS_06230 2506 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2943 3158 gene locus_tag LOCUS_06240 2943 3158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3392 3787 gene locus_tag LOCUS_06250 3392 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3961 6966 gene locus_tag LOCUS_06260 3961 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7134 7343 gene locus_tag LOCUS_06270 7134 7343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 7324 7683 gene locus_tag LOCUS_06280 7324 7683 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289874.1 protein_id gnl|my_center|LOCUS_06280 7714 8949 gene locus_tag LOCUS_06290 7714 8949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 8919 10052 gene locus_tag LOCUS_06300 8919 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10364 11569 gene locus_tag LOCUS_06310 10364 11569 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_06310 11661 11736 gene locus_tag LOCUS_t00020 11661 11736 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 11904 13826 gene locus_tag LOCUS_06320 11904 13826 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_06320 14018 14152 gene locus_tag LOCUS_06330 14018 14152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 14768 14953 gene locus_tag LOCUS_06340 14768 14953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 15135 15737 gene locus_tag LOCUS_06350 15135 15737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 15740 15943 gene locus_tag LOCUS_06360 15740 15943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 16106 16741 gene locus_tag LOCUS_06370 16106 16741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 17008 18066 gene locus_tag LOCUS_06380 17008 18066 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_06380 18825 18124 gene locus_tag LOCUS_06390 18825 18124 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_06390 20568 18892 gene locus_tag LOCUS_06400 gene ribBA 20568 18892 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_06400 21584 20706 gene locus_tag LOCUS_06410 21584 20706 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_06410 22632 21817 gene locus_tag LOCUS_06420 22632 21817 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057794.1 protein_id gnl|my_center|LOCUS_06420 23240 22752 gene locus_tag LOCUS_06430 gene cpcA 23240 22752 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_06430 23825 23307 gene locus_tag LOCUS_06440 23825 23307 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_06440 24438 25661 gene locus_tag LOCUS_06450 24438 25661 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_06450 25741 26628 gene locus_tag LOCUS_06460 gene argB 25741 26628 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_06460 26797 27018 gene locus_tag LOCUS_06470 26797 27018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 27062 28282 gene locus_tag LOCUS_06480 27062 28282 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920707.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence020 392 96 gene locus_tag LOCUS_06490 392 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1963 563 gene locus_tag LOCUS_06500 1963 563 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_06500 3438 2569 gene locus_tag LOCUS_06510 gene bchL 3438 2569 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_06510 3899 4744 gene locus_tag LOCUS_06520 3899 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4749 4928 gene locus_tag LOCUS_06530 4749 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 6676 5468 gene locus_tag LOCUS_06540 6676 5468 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_06540 7244 6771 gene locus_tag LOCUS_06550 7244 6771 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_06550 7535 8236 gene locus_tag LOCUS_06560 7535 8236 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_06560 8344 8502 gene locus_tag LOCUS_06570 8344 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 8546 9142 gene locus_tag LOCUS_06580 8546 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 10233 9166 gene locus_tag LOCUS_06590 gene recA 10233 9166 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_06590 11313 10360 gene locus_tag LOCUS_06600 11313 10360 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_06600 12063 13439 gene locus_tag LOCUS_06610 12063 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 14463 14128 gene locus_tag LOCUS_06620 14463 14128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 14867 14451 gene locus_tag LOCUS_06630 14867 14451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 15408 16133 gene locus_tag LOCUS_06640 15408 16133 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056258.1 protein_id gnl|my_center|LOCUS_06640 16217 17464 gene locus_tag LOCUS_06650 16217 17464 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_06650 19027 17438 gene locus_tag LOCUS_06660 19027 17438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 21695 20010 gene locus_tag LOCUS_06670 21695 20010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 23139 21931 gene locus_tag LOCUS_06680 23139 21931 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_06680 24119 23244 gene locus_tag LOCUS_06690 24119 23244 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_06690 26490 24328 gene locus_tag LOCUS_06700 gene dnaK 26490 24328 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_06700 27604 26696 gene locus_tag LOCUS_06710 27604 26696 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928449.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence021 139 387 gene locus_tag LOCUS_06720 139 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 937 404 gene locus_tag LOCUS_06730 gene pyrR 937 404 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_06730 1059 2444 gene locus_tag LOCUS_06740 1059 2444 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528760.1 protein_id gnl|my_center|LOCUS_06740 3272 2436 gene locus_tag LOCUS_06750 3272 2436 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166908820.1 protein_id gnl|my_center|LOCUS_06750 4071 3274 gene locus_tag LOCUS_06760 gene cbiQ 4071 3274 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058272.1 protein_id gnl|my_center|LOCUS_06760 4352 4077 gene locus_tag LOCUS_06770 4352 4077 CDS product energy-coupling factor ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986836.1 protein_id gnl|my_center|LOCUS_06770 5060 4401 gene locus_tag LOCUS_06780 5060 4401 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235551391.1 protein_id gnl|my_center|LOCUS_06780 7297 5396 gene locus_tag LOCUS_06790 7297 5396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_06790 9085 7835 gene locus_tag LOCUS_06800 gene metK 9085 7835 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056822.1 protein_id gnl|my_center|LOCUS_06800 9411 11732 gene locus_tag LOCUS_06810 gene pcrA 9411 11732 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058290.1 protein_id gnl|my_center|LOCUS_06810 12198 12629 gene locus_tag LOCUS_06820 12198 12629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 14205 13042 gene locus_tag LOCUS_06830 14205 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 14893 14438 gene locus_tag LOCUS_06840 14893 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 15233 15556 gene locus_tag LOCUS_06850 gene trxA 15233 15556 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966364.1 protein_id gnl|my_center|LOCUS_06850 16014 16631 gene locus_tag LOCUS_06860 16014 16631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 17557 17868 gene locus_tag LOCUS_06870 gene groES 17557 17868 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_06870 17915 19540 gene locus_tag LOCUS_06880 gene groL 17915 19540 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056040.1 protein_id gnl|my_center|LOCUS_06880 20015 19815 gene locus_tag LOCUS_06890 20015 19815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 20828 20400 gene locus_tag LOCUS_06900 20828 20400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 21434 21829 gene locus_tag LOCUS_06910 21434 21829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 22733 22473 gene locus_tag LOCUS_06920 22733 22473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 23413 23024 gene locus_tag LOCUS_06930 23413 23024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 23612 23403 gene locus_tag LOCUS_06940 23612 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 23859 24152 gene locus_tag LOCUS_06950 23859 24152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 24407 25684 gene locus_tag LOCUS_06960 24407 25684 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_06960 25875 26936 gene locus_tag LOCUS_06970 gene corA 25875 26936 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_06970 27172 26996 gene locus_tag LOCUS_06980 27172 26996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence022 1461 283 gene locus_tag LOCUS_06990 1461 283 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_06990 2214 1738 gene locus_tag LOCUS_07000 2214 1738 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140618.1 protein_id gnl|my_center|LOCUS_07000 2458 2207 gene locus_tag LOCUS_07010 2458 2207 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140617.1 protein_id gnl|my_center|LOCUS_07010 2878 3072 gene locus_tag LOCUS_07020 2878 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3051 3302 gene locus_tag LOCUS_07030 3051 3302 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_07030 3580 4344 gene locus_tag LOCUS_07040 3580 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5647 5087 gene locus_tag LOCUS_07050 5647 5087 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097615831.1 protein_id gnl|my_center|LOCUS_07050 6110 5631 gene locus_tag LOCUS_07060 6110 5631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 8833 6296 gene locus_tag LOCUS_07070 8833 6296 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968158.1 protein_id gnl|my_center|LOCUS_07070 11089 9074 gene locus_tag LOCUS_07080 11089 9074 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056499.1 protein_id gnl|my_center|LOCUS_07080 13206 11167 gene locus_tag LOCUS_07090 gene speA 13206 11167 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057644.1 protein_id gnl|my_center|LOCUS_07090 13556 14089 gene locus_tag LOCUS_07100 13556 14089 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_07100 14311 14877 gene locus_tag LOCUS_07110 gene recR 14311 14877 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058038.1 protein_id gnl|my_center|LOCUS_07110 16300 14933 gene locus_tag LOCUS_07120 16300 14933 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187164.1 protein_id gnl|my_center|LOCUS_07120 16820 16401 gene locus_tag LOCUS_07130 16820 16401 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_07130 17218 16859 gene locus_tag LOCUS_07140 17218 16859 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_07140 18004 17294 gene locus_tag LOCUS_07150 18004 17294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 18094 18951 gene locus_tag LOCUS_07160 gene folD 18094 18951 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920629.1 protein_id gnl|my_center|LOCUS_07160 19331 19855 gene locus_tag LOCUS_07170 19331 19855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07170 19897 20067 gene locus_tag LOCUS_07180 19897 20067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07180 20905 20387 gene locus_tag LOCUS_07190 20905 20387 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_07190 21454 20942 gene locus_tag LOCUS_07200 21454 20942 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_07200 21728 22324 gene locus_tag LOCUS_07210 21728 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 22396 22647 gene locus_tag LOCUS_07220 22396 22647 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_07220 22884 24179 gene locus_tag LOCUS_07230 22884 24179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 24369 26048 gene locus_tag LOCUS_07240 24369 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 26764 26165 gene locus_tag LOCUS_07250 26764 26165 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_07250 27128 26946 gene locus_tag LOCUS_07260 27128 26946 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140794.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence023 1198 437 gene locus_tag LOCUS_07270 1198 437 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_07270 1637 1161 gene locus_tag LOCUS_07280 1637 1161 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_07280 3039 2101 gene locus_tag LOCUS_07290 3039 2101 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_07290 3913 3092 gene locus_tag LOCUS_07300 3913 3092 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_07300 4431 4063 gene locus_tag LOCUS_07310 4431 4063 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_07310 5133 4909 gene locus_tag LOCUS_07320 5133 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5419 5111 gene locus_tag LOCUS_07330 5419 5111 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_07330 6919 5702 gene locus_tag LOCUS_07340 6919 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7642 7103 gene locus_tag LOCUS_07350 7642 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 7948 7727 gene locus_tag LOCUS_07360 7948 7727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 8886 7945 gene locus_tag LOCUS_07370 8886 7945 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_07370 9125 9213 gene locus_tag LOCUS_t00030 9125 9213 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10041 9379 gene locus_tag LOCUS_07380 10041 9379 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_07380 10148 13159 gene locus_tag LOCUS_07390 10148 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13877 13173 gene locus_tag LOCUS_07400 13877 13173 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_07400 14494 14003 gene locus_tag LOCUS_07410 14494 14003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 14925 16928 gene locus_tag LOCUS_07420 gene uvrB 14925 16928 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057868.1 protein_id gnl|my_center|LOCUS_07420 16933 17814 gene locus_tag LOCUS_07430 16933 17814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07430 17811 17963 gene locus_tag LOCUS_07440 17811 17963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 20941 18149 gene locus_tag LOCUS_07450 20941 18149 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_07450 22390 21164 gene locus_tag LOCUS_07460 22390 21164 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_07460 23566 22439 gene locus_tag LOCUS_07470 23566 22439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_07470 23651 24586 gene locus_tag LOCUS_07480 23651 24586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 26854 24656 gene locus_tag LOCUS_07490 26854 24656 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143066.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence024 760 173 gene locus_tag LOCUS_07500 760 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2105 933 gene locus_tag LOCUS_07510 gene moeB 2105 933 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_07510 2660 2265 gene locus_tag LOCUS_07520 gene gcvH 2660 2265 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_07520 2991 5699 gene locus_tag LOCUS_07530 2991 5699 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057097.1 protein_id gnl|my_center|LOCUS_07530 6702 5722 gene locus_tag LOCUS_07540 6702 5722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950643.1 protein_id gnl|my_center|LOCUS_07540 7522 6737 gene locus_tag LOCUS_07550 7522 6737 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107719.1 protein_id gnl|my_center|LOCUS_07550 7703 7545 gene locus_tag LOCUS_07560 7703 7545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 8573 7899 gene locus_tag LOCUS_07570 8573 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 9676 8588 gene locus_tag LOCUS_07580 9676 8588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 11212 10160 gene locus_tag LOCUS_07590 11212 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 12258 11356 gene locus_tag LOCUS_07600 12258 11356 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921254.1 protein_id gnl|my_center|LOCUS_07600 13360 12248 gene locus_tag LOCUS_07610 13360 12248 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_07610 14488 13412 gene locus_tag LOCUS_07620 14488 13412 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387716.1 protein_id gnl|my_center|LOCUS_07620 15142 14549 gene locus_tag LOCUS_07630 15142 14549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 15502 15212 gene locus_tag LOCUS_07640 15502 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 16898 15915 gene locus_tag LOCUS_07650 16898 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 17905 17276 gene locus_tag LOCUS_07660 17905 17276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07660 19143 18364 gene locus_tag LOCUS_07670 19143 18364 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_07670 20516 19245 gene locus_tag LOCUS_07680 20516 19245 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_07680 21232 20588 gene locus_tag LOCUS_07690 21232 20588 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_07690 22049 21264 gene locus_tag LOCUS_07700 22049 21264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 24442 22064 gene locus_tag LOCUS_07710 24442 22064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 25345 24485 gene locus_tag LOCUS_07720 25345 24485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 26519 25599 gene locus_tag LOCUS_07730 26519 25599 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_07730 26768 26616 gene locus_tag LOCUS_07740 26768 26616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 >Feature sequence025 1849 509 gene locus_tag LOCUS_07750 gene aroA 1849 509 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_07750 1966 2190 gene locus_tag LOCUS_07760 1966 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 2393 2935 gene locus_tag LOCUS_07770 2393 2935 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_07770 3278 3030 gene locus_tag LOCUS_07780 3278 3030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3423 4763 gene locus_tag LOCUS_07790 3423 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4959 6089 gene locus_tag LOCUS_07800 4959 6089 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240438.1 protein_id gnl|my_center|LOCUS_07800 6211 7281 gene locus_tag LOCUS_07810 6211 7281 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_07810 8255 7308 gene locus_tag LOCUS_07820 8255 7308 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_07820 9346 8564 gene locus_tag LOCUS_07830 9346 8564 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_07830 9726 11153 gene locus_tag LOCUS_07840 gene gndA 9726 11153 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056424.1 protein_id gnl|my_center|LOCUS_07840 11868 11242 gene locus_tag LOCUS_07850 gene rnhB 11868 11242 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_07850 14036 11868 gene locus_tag LOCUS_07860 14036 11868 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_07860 14873 14724 gene locus_tag LOCUS_07870 14873 14724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 15807 15052 gene locus_tag LOCUS_07880 15807 15052 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_07880 16681 15977 gene locus_tag LOCUS_07890 16681 15977 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_07890 18059 16764 gene locus_tag LOCUS_07900 18059 16764 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141007.1 protein_id gnl|my_center|LOCUS_07900 19667 18117 gene locus_tag LOCUS_07910 19667 18117 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_07910 20471 19746 gene locus_tag LOCUS_07920 20471 19746 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142086.1 protein_id gnl|my_center|LOCUS_07920 22406 20553 gene locus_tag LOCUS_07930 22406 20553 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056748.1 protein_id gnl|my_center|LOCUS_07930 23397 22453 gene locus_tag LOCUS_07940 23397 22453 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_07940 23690 23839 gene locus_tag LOCUS_07950 23690 23839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 23854 24081 gene locus_tag LOCUS_07960 23854 24081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 25403 24510 gene locus_tag LOCUS_07970 25403 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 26884 25421 gene locus_tag LOCUS_07980 26884 25421 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143698.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence026 146 1654 gene locus_tag LOCUS_07990 146 1654 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920839.1 protein_id gnl|my_center|LOCUS_07990 3236 1677 gene locus_tag LOCUS_08000 3236 1677 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_08000 3715 3380 gene locus_tag LOCUS_08010 3715 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3892 5493 gene locus_tag LOCUS_08020 3892 5493 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_08020 6186 7436 gene locus_tag LOCUS_08030 gene rpoD 6186 7436 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173878.1 protein_id gnl|my_center|LOCUS_08030 7651 7944 gene locus_tag LOCUS_08040 gene rpsT 7651 7944 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_08040 7995 8774 gene locus_tag LOCUS_08050 7995 8774 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_08050 8939 12250 gene locus_tag LOCUS_08060 gene rpoB 8939 12250 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056489.1 protein_id gnl|my_center|LOCUS_08060 12467 16498 gene locus_tag LOCUS_08070 12467 16498 CDS product DNA-directed RNA polymerase subunit beta'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056487.1 protein_id gnl|my_center|LOCUS_08070 16900 16826 gene locus_tag LOCUS_t00040 16900 16826 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 17456 16941 gene locus_tag LOCUS_08080 17456 16941 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057519.1 protein_id gnl|my_center|LOCUS_08080 17648 17562 gene locus_tag LOCUS_t00050 17648 17562 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 18156 18917 gene locus_tag LOCUS_08090 18156 18917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 18994 21963 gene locus_tag LOCUS_08100 18994 21963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 22053 23822 gene locus_tag LOCUS_08110 22053 23822 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_08110 24580 23819 gene locus_tag LOCUS_08120 gene hisA 24580 23819 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140708.1 protein_id gnl|my_center|LOCUS_08120 25078 25359 gene locus_tag LOCUS_08130 25078 25359 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057702.1 protein_id gnl|my_center|LOCUS_08130 25343 25894 gene locus_tag LOCUS_08140 25343 25894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 >Feature sequence027 836 207 gene locus_tag LOCUS_08150 836 207 CDS product DUF1294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895592.1 protein_id gnl|my_center|LOCUS_08150 1982 1614 gene locus_tag LOCUS_08160 1982 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2254 1979 gene locus_tag LOCUS_08170 2254 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_08170 2615 2322 gene locus_tag LOCUS_08180 2615 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3657 3193 gene locus_tag LOCUS_08190 3657 3193 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_08190 4684 3701 gene locus_tag LOCUS_08200 gene msrP 4684 3701 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943358.1 protein_id gnl|my_center|LOCUS_08200 6200 4770 gene locus_tag LOCUS_08210 6200 4770 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_08210 6420 7175 gene locus_tag LOCUS_08220 6420 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 7608 9155 gene locus_tag LOCUS_08230 7608 9155 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_08230 9609 10943 gene locus_tag LOCUS_08240 9609 10943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 11346 13178 gene locus_tag LOCUS_08250 11346 13178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 14201 13203 gene locus_tag LOCUS_08260 14201 13203 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_08260 14542 20694 gene locus_tag LOCUS_08270 14542 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 21353 21096 gene locus_tag LOCUS_08280 21353 21096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 21609 21334 gene locus_tag LOCUS_08290 21609 21334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 21916 22401 gene locus_tag LOCUS_08300 21916 22401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 23140 22949 gene locus_tag LOCUS_08310 23140 22949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 23445 23137 gene locus_tag LOCUS_08320 23445 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 25707 23629 gene locus_tag LOCUS_08330 25707 23629 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence028 407 117 gene locus_tag LOCUS_08340 407 117 CDS product DUF2288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086400.1 protein_id gnl|my_center|LOCUS_08340 1627 8616 gene locus_tag LOCUS_08350 1627 8616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8637 9959 gene locus_tag LOCUS_08360 8637 9959 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033447772.1 protein_id gnl|my_center|LOCUS_08360 10174 11478 gene locus_tag LOCUS_08370 10174 11478 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_08370 11501 12664 gene locus_tag LOCUS_08380 gene devC 11501 12664 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056491.1 protein_id gnl|my_center|LOCUS_08380 12685 13392 gene locus_tag LOCUS_08390 12685 13392 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056490.1 protein_id gnl|my_center|LOCUS_08390 13453 13546 gene locus_tag LOCUS_t00060 13453 13546 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13565 14371 gene locus_tag LOCUS_08400 13565 14371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 16242 14368 gene locus_tag LOCUS_08410 gene mrdA 16242 14368 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057025.1 protein_id gnl|my_center|LOCUS_08410 16848 17189 gene locus_tag LOCUS_08420 16848 17189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056629.1 protein_id gnl|my_center|LOCUS_08420 17688 17404 gene locus_tag LOCUS_08430 17688 17404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 18853 17744 gene locus_tag LOCUS_08440 18853 17744 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_08440 19210 19329 gene locus_tag LOCUS_08450 19210 19329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 19457 20077 gene locus_tag LOCUS_08460 19457 20077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142966.1 protein_id gnl|my_center|LOCUS_08460 20306 21436 gene locus_tag LOCUS_08470 20306 21436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 21575 25138 gene locus_tag LOCUS_08480 gene metH 21575 25138 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence029 1783 242 gene locus_tag LOCUS_08490 1783 242 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_08490 2300 2572 gene locus_tag LOCUS_08500 2300 2572 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_08500 2576 3235 gene locus_tag LOCUS_08510 2576 3235 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_08510 3556 4128 gene locus_tag LOCUS_08520 3556 4128 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928580.1 protein_id gnl|my_center|LOCUS_08520 4261 5073 gene locus_tag LOCUS_08530 gene proC 4261 5073 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_08530 6837 5050 gene locus_tag LOCUS_08540 6837 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 7485 6964 gene locus_tag LOCUS_08550 7485 6964 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143393.1 protein_id gnl|my_center|LOCUS_08550 7567 7638 gene locus_tag LOCUS_t00070 7567 7638 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7778 8143 gene locus_tag LOCUS_08560 7778 8143 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140974.1 protein_id gnl|my_center|LOCUS_08560 8675 10135 gene locus_tag LOCUS_08570 8675 10135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 10810 10580 gene locus_tag LOCUS_08580 10810 10580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 10997 12835 gene locus_tag LOCUS_08590 10997 12835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 13568 13804 gene locus_tag LOCUS_08600 13568 13804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 13782 14207 gene locus_tag LOCUS_08610 13782 14207 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_08610 14467 14273 gene locus_tag LOCUS_08620 14467 14273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 16039 15101 gene locus_tag LOCUS_08630 16039 15101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 16901 16098 gene locus_tag LOCUS_08640 16901 16098 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817427.1 protein_id gnl|my_center|LOCUS_08640 18362 17025 gene locus_tag LOCUS_08650 18362 17025 CDS product MurT ligase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258102.1 protein_id gnl|my_center|LOCUS_08650 19373 18465 gene locus_tag LOCUS_08660 19373 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 19760 20950 gene locus_tag LOCUS_08670 19760 20950 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_08670 21025 22173 gene locus_tag LOCUS_08680 21025 22173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 22550 22239 gene locus_tag LOCUS_08690 gene nuoK 22550 22239 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_08690 23166 22570 gene locus_tag LOCUS_08700 23166 22570 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_08700 23846 23274 gene locus_tag LOCUS_08710 gene ndhI 23846 23274 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056515.1 protein_id gnl|my_center|LOCUS_08710 25007 23889 gene locus_tag LOCUS_08720 gene nuoH 25007 23889 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence030 617 865 gene locus_tag LOCUS_08730 617 865 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004615098.1 protein_id gnl|my_center|LOCUS_08730 935 2185 gene locus_tag LOCUS_08740 gene fabF 935 2185 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_08740 2268 4274 gene locus_tag LOCUS_08750 gene tkt 2268 4274 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057707.1 protein_id gnl|my_center|LOCUS_08750 4442 5209 gene locus_tag LOCUS_08760 4442 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 5206 5676 gene locus_tag LOCUS_08770 5206 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5673 6131 gene locus_tag LOCUS_08780 5673 6131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 7034 6141 gene locus_tag LOCUS_08790 7034 6141 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458865.1 protein_id gnl|my_center|LOCUS_08790 7513 7250 gene locus_tag LOCUS_08800 7513 7250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 7491 9023 gene locus_tag LOCUS_08810 7491 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 9152 9436 gene locus_tag LOCUS_08820 9152 9436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 9908 10168 gene locus_tag LOCUS_08830 9908 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 10155 10352 gene locus_tag LOCUS_08840 10155 10352 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_08840 10649 10897 gene locus_tag LOCUS_08850 10649 10897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10985 11344 gene locus_tag LOCUS_08860 10985 11344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08860 11683 11611 gene locus_tag LOCUS_t00080 11683 11611 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11796 12041 gene locus_tag LOCUS_08870 11796 12041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 12074 13408 gene locus_tag LOCUS_08880 12074 13408 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140787.1 protein_id gnl|my_center|LOCUS_08880 13485 14606 gene locus_tag LOCUS_08890 13485 14606 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_08890 14749 15909 gene locus_tag LOCUS_08900 gene grrM 14749 15909 CDS product GRRM system radical SAM/SPASM domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970460.1 protein_id gnl|my_center|LOCUS_08900 17586 16405 gene locus_tag LOCUS_08910 17586 16405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 17655 18653 gene locus_tag LOCUS_08920 17655 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 18706 20163 gene locus_tag LOCUS_08930 18706 20163 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141135.1 protein_id gnl|my_center|LOCUS_08930 20209 21279 gene locus_tag LOCUS_08940 20209 21279 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529999.1 protein_id gnl|my_center|LOCUS_08940 21281 22480 gene locus_tag LOCUS_08950 21281 22480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 22473 23264 gene locus_tag LOCUS_08960 22473 23264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 23330 24058 gene locus_tag LOCUS_08970 23330 24058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 24523 24260 gene locus_tag LOCUS_08980 24523 24260 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_08980 24707 24516 gene locus_tag LOCUS_08990 24707 24516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 >Feature sequence031 179 910 gene locus_tag LOCUS_09000 179 910 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_09000 1877 1305 gene locus_tag LOCUS_09010 1877 1305 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_09010 2087 4945 gene locus_tag LOCUS_09020 gene ileS 2087 4945 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921027.1 protein_id gnl|my_center|LOCUS_09020 5049 5471 gene locus_tag LOCUS_09030 5049 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 5482 6663 gene locus_tag LOCUS_09040 5482 6663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 6909 8018 gene locus_tag LOCUS_09050 6909 8018 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_09050 8008 8508 gene locus_tag LOCUS_09060 8008 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8634 9050 gene locus_tag LOCUS_09070 8634 9050 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_09070 10971 9091 gene locus_tag LOCUS_09080 10971 9091 CDS product DNA-directed RNA polymerase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056488.1 protein_id gnl|my_center|LOCUS_09080 12612 11152 gene locus_tag LOCUS_09090 12612 11152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 14286 12706 gene locus_tag LOCUS_09100 14286 12706 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_09100 17904 14542 gene locus_tag LOCUS_09110 gene smc 17904 14542 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_09110 18417 18148 gene locus_tag LOCUS_09120 18417 18148 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056004.1 protein_id gnl|my_center|LOCUS_09120 19776 18841 gene locus_tag LOCUS_09130 19776 18841 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088722.1 protein_id gnl|my_center|LOCUS_09130 20153 19773 gene locus_tag LOCUS_09140 20153 19773 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062081852.1 protein_id gnl|my_center|LOCUS_09140 21142 20219 gene locus_tag LOCUS_09150 21142 20219 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545278.1 protein_id gnl|my_center|LOCUS_09150 21942 21139 gene locus_tag LOCUS_09160 21942 21139 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_09160 22903 21953 gene locus_tag LOCUS_09170 22903 21953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 23949 22900 gene locus_tag LOCUS_09180 23949 22900 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105806.1 protein_id gnl|my_center|LOCUS_09180 24197 23961 gene locus_tag LOCUS_09190 24197 23961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 >Feature sequence032 1560 241 gene locus_tag LOCUS_09200 1560 241 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_09200 1711 2547 gene locus_tag LOCUS_09210 gene lpxA 1711 2547 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_09210 2666 3895 gene locus_tag LOCUS_09220 gene lpxB 2666 3895 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_09220 6922 3935 gene locus_tag LOCUS_09230 gene gcvP 6922 3935 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140250.1 protein_id gnl|my_center|LOCUS_09230 8655 7030 gene locus_tag LOCUS_09240 8655 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8996 9808 gene locus_tag LOCUS_09250 8996 9808 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228076.1 protein_id gnl|my_center|LOCUS_09250 10215 9865 gene locus_tag LOCUS_09260 10215 9865 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_09260 10443 11480 gene locus_tag LOCUS_09270 10443 11480 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056782.1 protein_id gnl|my_center|LOCUS_09270 11571 12320 gene locus_tag LOCUS_09280 11571 12320 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_09280 12332 12868 gene locus_tag LOCUS_09290 gene mreD 12332 12868 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144384.1 protein_id gnl|my_center|LOCUS_09290 13026 15476 gene locus_tag LOCUS_09300 13026 15476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 15622 17382 gene locus_tag LOCUS_09310 15622 17382 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_09310 17406 18332 gene locus_tag LOCUS_09320 17406 18332 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057302.1 protein_id gnl|my_center|LOCUS_09320 18887 20407 gene locus_tag LOCUS_09330 gene kaiC 18887 20407 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259117.1 protein_id gnl|my_center|LOCUS_09330 20553 21317 gene locus_tag LOCUS_09340 20553 21317 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 protein_id gnl|my_center|LOCUS_09340 21402 24026 gene locus_tag LOCUS_09350 21402 24026 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057891.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence033 3564 2125 gene locus_tag LOCUS_09360 3564 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 3948 5129 gene locus_tag LOCUS_09370 3948 5129 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_09370 5136 5492 gene locus_tag LOCUS_09380 5136 5492 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939601.1 protein_id gnl|my_center|LOCUS_09380 5551 6240 gene locus_tag LOCUS_09390 gene hypB 5551 6240 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_09390 6304 7344 gene locus_tag LOCUS_09400 6304 7344 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_09400 7487 8302 gene locus_tag LOCUS_09410 7487 8302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_09410 8373 9131 gene locus_tag LOCUS_09420 8373 9131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_09420 9437 10399 gene locus_tag LOCUS_09430 9437 10399 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140054.1 protein_id gnl|my_center|LOCUS_09430 10584 10955 gene locus_tag LOCUS_09440 10584 10955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 11261 11776 gene locus_tag LOCUS_09450 11261 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11850 12764 gene locus_tag LOCUS_09460 11850 12764 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870102.1 protein_id gnl|my_center|LOCUS_09460 13120 12836 gene locus_tag LOCUS_09470 13120 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 13331 13113 gene locus_tag LOCUS_09480 13331 13113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 13556 13389 gene locus_tag LOCUS_09490 13556 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 13780 14463 gene locus_tag LOCUS_09500 13780 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 15423 14593 gene locus_tag LOCUS_09510 15423 14593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 15879 16373 gene locus_tag LOCUS_09520 15879 16373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 16983 17180 gene locus_tag LOCUS_09530 16983 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09530 17594 17262 gene locus_tag LOCUS_09540 17594 17262 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_09540 17821 17600 gene locus_tag LOCUS_09550 17821 17600 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_09550 19452 17896 gene locus_tag LOCUS_09560 19452 17896 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_09560 19805 19626 gene locus_tag LOCUS_09570 19805 19626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 19875 20099 gene locus_tag LOCUS_09580 19875 20099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 20096 20488 gene locus_tag LOCUS_09590 20096 20488 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142729.1 protein_id gnl|my_center|LOCUS_09590 20684 21274 gene locus_tag LOCUS_09600 20684 21274 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_09600 22909 21707 gene locus_tag LOCUS_09610 22909 21707 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_09610 24023 22923 gene locus_tag LOCUS_09620 gene aroC 24023 22923 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence034 1350 58 gene locus_tag LOCUS_09630 1350 58 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056769.1 protein_id gnl|my_center|LOCUS_09630 2150 1398 gene locus_tag LOCUS_09640 2150 1398 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_09640 2225 2965 gene locus_tag LOCUS_09650 2225 2965 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057232.1 protein_id gnl|my_center|LOCUS_09650 3276 4040 gene locus_tag LOCUS_09660 3276 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 5767 4301 gene locus_tag LOCUS_09670 5767 4301 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_09670 6356 5946 gene locus_tag LOCUS_09680 gene tnpA 6356 5946 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_09680 6435 7730 gene locus_tag LOCUS_09690 6435 7730 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_09690 8563 8012 gene locus_tag LOCUS_09700 8563 8012 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920958.1 protein_id gnl|my_center|LOCUS_09700 8723 8989 gene locus_tag LOCUS_09710 8723 8989 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_09710 9297 9953 gene locus_tag LOCUS_09720 9297 9953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_09720 10268 10498 gene locus_tag LOCUS_09730 gene infA 10268 10498 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_09730 10833 11216 gene locus_tag LOCUS_09740 gene rpsM 10833 11216 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_09740 11256 11648 gene locus_tag LOCUS_09750 gene rpsK 11256 11648 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_09750 11841 12782 gene locus_tag LOCUS_09760 11841 12782 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143560.1 protein_id gnl|my_center|LOCUS_09760 12804 13154 gene locus_tag LOCUS_09770 gene rplQ 12804 13154 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_09770 13157 13987 gene locus_tag LOCUS_09780 gene truA 13157 13987 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055962.1 protein_id gnl|my_center|LOCUS_09780 14112 14567 gene locus_tag LOCUS_09790 gene rplM 14112 14567 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_09790 14572 14985 gene locus_tag LOCUS_09800 gene rpsI 14572 14985 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_09800 15005 15238 gene locus_tag LOCUS_09810 gene rpmE 15005 15238 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_09810 17897 15723 gene locus_tag LOCUS_09820 17897 15723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 18415 17915 gene locus_tag LOCUS_09830 18415 17915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 18614 18901 gene locus_tag LOCUS_09840 gene clpS 18614 18901 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_09840 18894 19724 gene locus_tag LOCUS_09850 18894 19724 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056065.1 protein_id gnl|my_center|LOCUS_09850 19777 21294 gene locus_tag LOCUS_09860 gene amt 19777 21294 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056043.1 protein_id gnl|my_center|LOCUS_09860 21677 21306 gene locus_tag LOCUS_09870 21677 21306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 22422 21694 gene locus_tag LOCUS_09880 22422 21694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 22883 22440 gene locus_tag LOCUS_09890 22883 22440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 >Feature sequence035 57 422 gene locus_tag LOCUS_09900 57 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 326 520 gene locus_tag LOCUS_09910 326 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 2676 517 gene locus_tag LOCUS_09920 2676 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5944 2690 gene locus_tag LOCUS_09930 5944 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142960.1 protein_id gnl|my_center|LOCUS_09930 7435 5969 gene locus_tag LOCUS_09940 7435 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 8267 8019 gene locus_tag LOCUS_09950 8267 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 8290 9546 gene locus_tag LOCUS_09960 8290 9546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929152.1 protein_id gnl|my_center|LOCUS_09960 9935 10480 gene locus_tag LOCUS_09970 9935 10480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 10559 10792 gene locus_tag LOCUS_09980 10559 10792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 10807 11214 gene locus_tag LOCUS_09990 10807 11214 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_09990 11806 11222 gene locus_tag LOCUS_10000 11806 11222 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_10000 12423 11833 gene locus_tag LOCUS_10010 12423 11833 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_10010 12677 14596 gene locus_tag LOCUS_10020 12677 14596 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_10020 14658 15107 gene locus_tag LOCUS_10030 14658 15107 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141484.1 protein_id gnl|my_center|LOCUS_10030 15355 16719 gene locus_tag LOCUS_10040 15355 16719 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_10040 16852 17688 gene locus_tag LOCUS_10050 16852 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 19438 17951 gene locus_tag LOCUS_10060 19438 17951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 21574 19844 gene locus_tag LOCUS_10070 21574 19844 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_10070 22931 21825 gene locus_tag LOCUS_10080 gene gcvT 22931 21825 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence036 152 904 gene locus_tag LOCUS_10090 152 904 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_10090 1609 1193 gene locus_tag LOCUS_10100 1609 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1786 1649 gene locus_tag LOCUS_10110 1786 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 2108 1842 gene locus_tag LOCUS_10120 2108 1842 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_10120 2314 2105 gene locus_tag LOCUS_10130 2314 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 2732 2397 gene locus_tag LOCUS_10140 2732 2397 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838298.1 protein_id gnl|my_center|LOCUS_10140 4359 2965 gene locus_tag LOCUS_10150 4359 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 4657 4824 gene locus_tag LOCUS_10160 4657 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 5444 4827 gene locus_tag LOCUS_10170 5444 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 6480 5491 gene locus_tag LOCUS_10180 6480 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7781 6723 gene locus_tag LOCUS_10190 gene mnmA 7781 6723 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_10190 7884 8528 gene locus_tag LOCUS_10200 7884 8528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9937 8960 gene locus_tag LOCUS_10210 9937 8960 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928745.1 protein_id gnl|my_center|LOCUS_10210 10277 11131 gene locus_tag LOCUS_10220 10277 11131 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_10220 11811 13184 gene locus_tag LOCUS_10230 gene mnmE 11811 13184 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056805.1 protein_id gnl|my_center|LOCUS_10230 13666 13358 gene locus_tag LOCUS_10240 13666 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14095 13799 gene locus_tag LOCUS_10250 14095 13799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 15630 14425 gene locus_tag LOCUS_10260 15630 14425 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 protein_id gnl|my_center|LOCUS_10260 15799 16995 gene locus_tag LOCUS_10270 gene alr 15799 16995 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_10270 17205 18509 gene locus_tag LOCUS_10280 17205 18509 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_10280 20586 18595 gene locus_tag LOCUS_10290 20586 18595 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056794.1 protein_id gnl|my_center|LOCUS_10290 21977 20889 gene locus_tag LOCUS_10300 21977 20889 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_10300 22219 22052 gene locus_tag LOCUS_10310 22219 22052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 22352 22933 gene locus_tag LOCUS_10320 22352 22933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence037 301 80 gene locus_tag LOCUS_10330 301 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 492 307 gene locus_tag LOCUS_10340 492 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 873 721 gene locus_tag LOCUS_10350 873 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2536 1097 gene locus_tag LOCUS_10360 2536 1097 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_10360 3822 2578 gene locus_tag LOCUS_10370 gene rimO 3822 2578 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_10370 4363 5214 gene locus_tag LOCUS_10380 4363 5214 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056034.1 protein_id gnl|my_center|LOCUS_10380 5418 6404 gene locus_tag LOCUS_10390 5418 6404 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_10390 6514 7707 gene locus_tag LOCUS_10400 6514 7707 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259289.1 protein_id gnl|my_center|LOCUS_10400 7688 8011 gene locus_tag LOCUS_10410 7688 8011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10410 8069 8635 gene locus_tag LOCUS_10420 8069 8635 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10420 8708 9946 gene locus_tag LOCUS_10430 gene dcm 8708 9946 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946968.1 protein_id gnl|my_center|LOCUS_10430 10711 10469 gene locus_tag LOCUS_10440 10711 10469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 10929 10708 gene locus_tag LOCUS_10450 10929 10708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 11472 13643 gene locus_tag LOCUS_10460 11472 13643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 14407 13937 gene locus_tag LOCUS_10470 14407 13937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 16064 14451 gene locus_tag LOCUS_10480 16064 14451 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_10480 17362 16442 gene locus_tag LOCUS_10490 17362 16442 CDS product FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143278.1 protein_id gnl|my_center|LOCUS_10490 17831 17397 gene locus_tag LOCUS_10500 17831 17397 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_10500 18936 18076 gene locus_tag LOCUS_10510 18936 18076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 20743 19058 gene locus_tag LOCUS_10520 gene ilvD 20743 19058 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_10520 21661 21335 gene locus_tag LOCUS_10530 21661 21335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 22103 21648 gene locus_tag LOCUS_10540 22103 21648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence038 1014 64 gene locus_tag LOCUS_10550 1014 64 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143271.1 protein_id gnl|my_center|LOCUS_10550 1244 1975 gene locus_tag LOCUS_10560 1244 1975 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_10560 2170 2703 gene locus_tag LOCUS_10570 gene dps 2170 2703 CDS product DNA starvation/stationary phase protection protein Dps inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258826.1 protein_id gnl|my_center|LOCUS_10570 4019 2736 gene locus_tag LOCUS_10580 4019 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 4451 4952 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccaactaatcctatttgacctaataggtaagg 5510 6112 gene locus_tag LOCUS_10590 5510 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 6128 7159 gene locus_tag LOCUS_10600 6128 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 7167 8591 gene locus_tag LOCUS_10610 7167 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 8602 9585 gene locus_tag LOCUS_10620 8602 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 9721 9954 gene locus_tag LOCUS_10630 9721 9954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 10109 10936 gene locus_tag LOCUS_10640 gene cmr4 10109 10936 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_10640 10956 11363 gene locus_tag LOCUS_10650 10956 11363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 11369 12994 gene locus_tag LOCUS_10660 11369 12994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 13443 14243 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttacctattaggtcaaataggattagttggaaac 15337 14429 gene locus_tag LOCUS_10670 15337 14429 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085605.1 protein_id gnl|my_center|LOCUS_10670 15569 17020 gene locus_tag LOCUS_10680 15569 17020 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_10680 17532 17236 gene locus_tag LOCUS_10690 17532 17236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 17705 17517 gene locus_tag LOCUS_10700 17705 17517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 18059 18751 gene locus_tag LOCUS_10710 18059 18751 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_10710 18924 19406 gene locus_tag LOCUS_10720 18924 19406 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_10720 19979 19746 gene locus_tag LOCUS_10730 19979 19746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 21139 20063 gene locus_tag LOCUS_10740 21139 20063 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970073.1 protein_id gnl|my_center|LOCUS_10740 21411 22178 gene locus_tag LOCUS_10750 21411 22178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618819.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence039 2462 273 gene locus_tag LOCUS_10760 2462 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2968 2495 gene locus_tag LOCUS_10770 2968 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_10770 4906 3596 gene locus_tag LOCUS_10780 4906 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6114 4909 gene locus_tag LOCUS_10790 6114 4909 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256400.1 protein_id gnl|my_center|LOCUS_10790 6533 6655 gene locus_tag LOCUS_10800 6533 6655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 6642 7658 gene locus_tag LOCUS_10810 6642 7658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 7719 7937 gene locus_tag LOCUS_10820 7719 7937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 7934 8143 gene locus_tag LOCUS_10830 7934 8143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 8372 8710 gene locus_tag LOCUS_10840 8372 8710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 10691 8880 gene locus_tag LOCUS_10850 10691 8880 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_10850 11468 11722 gene locus_tag LOCUS_10860 11468 11722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 13955 13368 gene locus_tag LOCUS_10870 13955 13368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 15390 14167 gene locus_tag LOCUS_10880 15390 14167 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888753.1 protein_id gnl|my_center|LOCUS_10880 15305 15529 gene locus_tag LOCUS_10890 15305 15529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 15662 15967 gene locus_tag LOCUS_10900 15662 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144163.1 protein_id gnl|my_center|LOCUS_10900 16058 17746 gene locus_tag LOCUS_10910 16058 17746 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_10910 17791 18513 gene locus_tag LOCUS_10920 17791 18513 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_10920 20085 18712 gene locus_tag LOCUS_10930 20085 18712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 21350 20133 gene locus_tag LOCUS_10940 21350 20133 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence040 793 353 gene locus_tag LOCUS_10950 793 353 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_10950 2494 1508 gene locus_tag LOCUS_10960 2494 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2857 2498 gene locus_tag LOCUS_10970 2857 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3464 5929 gene locus_tag LOCUS_10980 3464 5929 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056163.1 protein_id gnl|my_center|LOCUS_10980 6007 6288 gene locus_tag LOCUS_10990 6007 6288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 6999 6439 gene locus_tag LOCUS_11000 6999 6439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 9637 8462 gene locus_tag LOCUS_11010 9637 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 10281 9958 gene locus_tag LOCUS_11020 10281 9958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 11324 10575 gene locus_tag LOCUS_11030 11324 10575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 11607 11410 gene locus_tag LOCUS_11040 11607 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12628 11522 gene locus_tag LOCUS_11050 12628 11522 CDS product ISAs1-like element ISCbu1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957722.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11050 14192 13020 gene locus_tag LOCUS_11060 14192 13020 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250683.1 protein_id gnl|my_center|LOCUS_11060 15626 16432 gene locus_tag LOCUS_11070 15626 16432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 18117 16471 gene locus_tag LOCUS_11080 18117 16471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 18987 18733 gene locus_tag LOCUS_11090 18987 18733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 19560 19348 gene locus_tag LOCUS_11100 19560 19348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_11100 19622 20467 gene locus_tag LOCUS_11110 gene dapF 19622 20467 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_11110 20738 20526 gene locus_tag LOCUS_11120 20738 20526 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058042.1 protein_id gnl|my_center|LOCUS_11120 20792 21049 gene locus_tag LOCUS_11130 20792 21049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence041 <1 517 gene locus_tag LOCUS_11140 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein 1901 564 gene locus_tag LOCUS_11150 1901 564 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057325.1 protein_id gnl|my_center|LOCUS_11150 2616 2065 gene locus_tag LOCUS_11160 2616 2065 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_11160 2741 4312 gene locus_tag LOCUS_11170 2741 4312 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_11170 5010 4429 gene locus_tag LOCUS_11180 5010 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 5495 5722 gene locus_tag LOCUS_11190 5495 5722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5726 6112 gene locus_tag LOCUS_11200 5726 6112 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143544.1 protein_id gnl|my_center|LOCUS_11200 6504 6848 gene locus_tag LOCUS_11210 6504 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6833 7030 gene locus_tag LOCUS_11220 6833 7030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7059 7370 gene locus_tag LOCUS_11230 7059 7370 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836217.1 protein_id gnl|my_center|LOCUS_11230 7485 7709 gene locus_tag LOCUS_11240 7485 7709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 7711 7932 gene locus_tag LOCUS_11250 7711 7932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 7911 8225 gene locus_tag LOCUS_11260 7911 8225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 8307 9233 gene locus_tag LOCUS_11270 8307 9233 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_11270 9255 10049 gene locus_tag LOCUS_11280 9255 10049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 10171 11223 gene locus_tag LOCUS_11290 10171 11223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 11395 12120 gene locus_tag LOCUS_11300 11395 12120 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407647.1 protein_id gnl|my_center|LOCUS_11300 12219 12512 gene locus_tag LOCUS_11310 12219 12512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 12509 12943 gene locus_tag LOCUS_11320 12509 12943 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929167.1 protein_id gnl|my_center|LOCUS_11320 13158 13478 gene locus_tag LOCUS_11330 13158 13478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 14355 13858 gene locus_tag LOCUS_11340 14355 13858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 14459 15454 gene locus_tag LOCUS_11350 14459 15454 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000190761.1 protein_id gnl|my_center|LOCUS_11350 15644 16021 gene locus_tag LOCUS_11360 15644 16021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 16087 16947 gene locus_tag LOCUS_11370 16087 16947 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_11370 16977 18020 gene locus_tag LOCUS_11380 16977 18020 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141878.1 protein_id gnl|my_center|LOCUS_11380 18088 19074 gene locus_tag LOCUS_11390 18088 19074 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_11390 20280 19051 gene locus_tag LOCUS_11400 20280 19051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence042 179 2221 gene locus_tag LOCUS_11410 179 2221 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056767.1 protein_id gnl|my_center|LOCUS_11410 2343 3392 gene locus_tag LOCUS_11420 2343 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_11420 3566 5164 gene locus_tag LOCUS_11430 3566 5164 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125969.1 protein_id gnl|my_center|LOCUS_11430 6049 5360 gene locus_tag LOCUS_11440 6049 5360 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056267.1 protein_id gnl|my_center|LOCUS_11440 7457 6123 gene locus_tag LOCUS_11450 7457 6123 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_11450 8615 7467 gene locus_tag LOCUS_11460 8615 7467 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056182.1 protein_id gnl|my_center|LOCUS_11460 8977 9777 gene locus_tag LOCUS_11470 8977 9777 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057950.1 protein_id gnl|my_center|LOCUS_11470 9805 10986 gene locus_tag LOCUS_11480 9805 10986 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920982.1 protein_id gnl|my_center|LOCUS_11480 11256 10990 gene locus_tag LOCUS_11490 11256 10990 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_11490 11265 11504 gene locus_tag LOCUS_11500 11265 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 11688 12413 gene locus_tag LOCUS_11510 11688 12413 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929453.1 protein_id gnl|my_center|LOCUS_11510 12616 13680 gene locus_tag LOCUS_11520 12616 13680 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035321.1 protein_id gnl|my_center|LOCUS_11520 13664 14092 gene locus_tag LOCUS_11530 13664 14092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 14175 14402 gene locus_tag LOCUS_11540 14175 14402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 14549 16267 gene locus_tag LOCUS_11550 14549 16267 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057497.1 protein_id gnl|my_center|LOCUS_11550 16304 16681 gene locus_tag LOCUS_11560 16304 16681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_11560 16811 18148 gene locus_tag LOCUS_11570 16811 18148 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920668.1 protein_id gnl|my_center|LOCUS_11570 18255 19220 gene locus_tag LOCUS_11580 18255 19220 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_11580 >Feature sequence043 1879 191 gene locus_tag LOCUS_11590 1879 191 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898994.1 protein_id gnl|my_center|LOCUS_11590 2826 2167 gene locus_tag LOCUS_11600 2826 2167 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142802.1 protein_id gnl|my_center|LOCUS_11600 4452 3067 gene locus_tag LOCUS_11610 4452 3067 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_11610 5424 4498 gene locus_tag LOCUS_11620 5424 4498 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056512.1 protein_id gnl|my_center|LOCUS_11620 5616 8486 gene locus_tag LOCUS_11630 gene polA 5616 8486 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057179.1 protein_id gnl|my_center|LOCUS_11630 8491 8736 gene locus_tag LOCUS_11640 8491 8736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 8812 9021 gene locus_tag LOCUS_11650 8812 9021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 9621 9307 gene locus_tag LOCUS_11660 9621 9307 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257967.1 protein_id gnl|my_center|LOCUS_11660 10503 9901 gene locus_tag LOCUS_11670 10503 9901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 13154 10500 gene locus_tag LOCUS_11680 13154 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 13481 14020 gene locus_tag LOCUS_11690 13481 14020 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_11690 14064 15050 gene locus_tag LOCUS_11700 gene petA 14064 15050 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_11700 15183 16244 gene locus_tag LOCUS_11710 15183 16244 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479721.1 protein_id gnl|my_center|LOCUS_11710 16578 18227 gene locus_tag LOCUS_11720 16578 18227 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141468.1 protein_id gnl|my_center|LOCUS_11720 18647 18240 gene locus_tag LOCUS_11730 18647 18240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_11730 20275 18854 gene locus_tag LOCUS_11740 gene glnA 20275 18854 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057427.1 protein_id gnl|my_center|LOCUS_11740 20499 20329 gene locus_tag LOCUS_11750 20499 20329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence044 318 866 gene locus_tag LOCUS_11760 318 866 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920976.1 protein_id gnl|my_center|LOCUS_11760 1211 1136 gene locus_tag LOCUS_t00090 1211 1136 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1771 4296 gene locus_tag LOCUS_11770 1771 4296 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143331.1 protein_id gnl|my_center|LOCUS_11770 5759 4377 gene locus_tag LOCUS_11780 5759 4377 CDS product flavin monoamine oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899946.1 protein_id gnl|my_center|LOCUS_11780 7034 6342 gene locus_tag LOCUS_11790 7034 6342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 7330 7076 gene locus_tag LOCUS_11800 7330 7076 CDS product sulfiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056018.1 protein_id gnl|my_center|LOCUS_11800 7446 9209 gene locus_tag LOCUS_11810 7446 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 9383 11494 gene locus_tag LOCUS_11820 9383 11494 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056358.1 protein_id gnl|my_center|LOCUS_11820 11782 11567 gene locus_tag LOCUS_11830 11782 11567 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_11830 12094 11786 gene locus_tag LOCUS_11840 12094 11786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 12339 12725 gene locus_tag LOCUS_11850 12339 12725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 12725 13915 gene locus_tag LOCUS_11860 12725 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 14058 14309 gene locus_tag LOCUS_11870 14058 14309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 14554 14766 gene locus_tag LOCUS_11880 14554 14766 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532021.1 protein_id gnl|my_center|LOCUS_11880 14766 14972 gene locus_tag LOCUS_11890 14766 14972 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532022.1 protein_id gnl|my_center|LOCUS_11890 15246 15491 gene locus_tag LOCUS_11900 15246 15491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 15484 15900 gene locus_tag LOCUS_11910 15484 15900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 16138 16338 gene locus_tag LOCUS_11920 16138 16338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 16332 16544 gene locus_tag LOCUS_11930 16332 16544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 16681 16905 gene locus_tag LOCUS_11940 16681 16905 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_11940 16987 17196 gene locus_tag LOCUS_11950 16987 17196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 17489 17965 gene locus_tag LOCUS_11960 17489 17965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 17962 18174 gene locus_tag LOCUS_11970 17962 18174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 18412 18645 gene locus_tag LOCUS_11980 18412 18645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 18947 19105 gene locus_tag LOCUS_11990 18947 19105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 19102 19323 gene locus_tag LOCUS_12000 19102 19323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 19480 19734 gene locus_tag LOCUS_12010 19480 19734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 19767 20096 gene locus_tag LOCUS_12020 19767 20096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 20099 20347 gene locus_tag LOCUS_12030 20099 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence045 539 78 gene locus_tag LOCUS_12040 539 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1804 1514 gene locus_tag LOCUS_12050 1804 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2316 1867 gene locus_tag LOCUS_12060 2316 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 2675 6496 gene locus_tag LOCUS_12070 2675 6496 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190970337.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12070 6553 7272 gene locus_tag LOCUS_12080 6553 7272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12080 7443 9200 gene locus_tag LOCUS_12090 7443 9200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 9246 14249 gene locus_tag LOCUS_12100 9246 14249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 14332 15888 gene locus_tag LOCUS_12110 14332 15888 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142825.1 protein_id gnl|my_center|LOCUS_12110 15924 17096 gene locus_tag LOCUS_12120 15924 17096 CDS product multidrug efflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446769.1 protein_id gnl|my_center|LOCUS_12120 17161 18438 gene locus_tag LOCUS_12130 17161 18438 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266740.1 protein_id gnl|my_center|LOCUS_12130 18639 19391 gene locus_tag LOCUS_12140 18639 19391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 19620 20378 gene locus_tag LOCUS_12150 19620 20378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence046 108 566 gene locus_tag LOCUS_12160 108 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 1992 1186 gene locus_tag LOCUS_12170 1992 1186 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_12170 1211 1237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2060 2950 gene locus_tag LOCUS_12180 2060 2950 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_12180 3012 3989 gene locus_tag LOCUS_12190 3012 3989 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056703.1 protein_id gnl|my_center|LOCUS_12190 4013 4930 gene locus_tag LOCUS_12200 4013 4930 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_12200 5017 5805 gene locus_tag LOCUS_12210 5017 5805 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408189.1 protein_id gnl|my_center|LOCUS_12210 5990 7012 gene locus_tag LOCUS_12220 gene hemF 5990 7012 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920736.1 protein_id gnl|my_center|LOCUS_12220 7254 8228 gene locus_tag LOCUS_12230 gene tilS 7254 8228 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_12230 8336 10636 gene locus_tag LOCUS_12240 8336 10636 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056167.1 protein_id gnl|my_center|LOCUS_12240 10840 10601 gene locus_tag LOCUS_12250 10840 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125028.1 protein_id gnl|my_center|LOCUS_12250 11822 10941 gene locus_tag LOCUS_12260 11822 10941 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_12260 12489 11992 gene locus_tag LOCUS_12270 12489 11992 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058277.1 protein_id gnl|my_center|LOCUS_12270 13149 12634 gene locus_tag LOCUS_12280 13149 12634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 13220 13423 gene locus_tag LOCUS_12290 13220 13423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530057.1 protein_id gnl|my_center|LOCUS_12290 13961 13497 gene locus_tag LOCUS_12300 13961 13497 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_12300 14480 14349 gene locus_tag LOCUS_12310 14480 14349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 14804 15001 gene locus_tag LOCUS_12320 14804 15001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 15007 15345 gene locus_tag LOCUS_12330 15007 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 15293 15553 gene locus_tag LOCUS_12340 15293 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 15727 15885 gene locus_tag LOCUS_12350 15727 15885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 16525 16070 gene locus_tag LOCUS_12360 16525 16070 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141572.1 protein_id gnl|my_center|LOCUS_12360 16788 16528 gene locus_tag LOCUS_12370 16788 16528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17367 16957 gene locus_tag LOCUS_12380 17367 16957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 17608 17360 gene locus_tag LOCUS_12390 17608 17360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 20156 17844 gene locus_tag LOCUS_12400 20156 17844 CDS product DUF3488 and DUF4129 domain-containing transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056828.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence047 701 120 gene locus_tag LOCUS_12410 701 120 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_12410 1701 778 gene locus_tag LOCUS_12420 1701 778 CDS product restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909131.1 protein_id gnl|my_center|LOCUS_12420 2341 2006 gene locus_tag LOCUS_12430 2341 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 2476 2546 gene locus_tag LOCUS_t00100 2476 2546 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3212 2595 gene locus_tag LOCUS_12440 gene mtnB 3212 2595 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000111958.1 protein_id gnl|my_center|LOCUS_12440 3452 3832 gene locus_tag LOCUS_12450 3452 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_12450 5622 4189 gene locus_tag LOCUS_12460 5622 4189 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_12460 5903 7117 gene locus_tag LOCUS_12470 5903 7117 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058160.1 protein_id gnl|my_center|LOCUS_12470 9192 7270 gene locus_tag LOCUS_12480 gene gyrB 9192 7270 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056494.1 protein_id gnl|my_center|LOCUS_12480 10496 9675 gene locus_tag LOCUS_12490 10496 9675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_12490 12107 10758 gene locus_tag LOCUS_12500 12107 10758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 12838 12119 gene locus_tag LOCUS_12510 12838 12119 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143369.1 protein_id gnl|my_center|LOCUS_12510 15558 12946 gene locus_tag LOCUS_12520 15558 12946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 16955 15591 gene locus_tag LOCUS_12530 16955 15591 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057814.1 protein_id gnl|my_center|LOCUS_12530 18120 16972 gene locus_tag LOCUS_12540 18120 16972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 18366 19460 gene locus_tag LOCUS_12550 18366 19460 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_12550 19605 20138 gene locus_tag LOCUS_12560 gene pgsA 19605 20138 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence048 1639 179 gene locus_tag LOCUS_12570 1639 179 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142490.1 protein_id gnl|my_center|LOCUS_12570 2009 2146 gene locus_tag LOCUS_12580 2009 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2303 3409 gene locus_tag LOCUS_12590 2303 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5492 3705 gene locus_tag LOCUS_12600 gene aspS 5492 3705 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056986.1 protein_id gnl|my_center|LOCUS_12600 5713 6495 gene locus_tag LOCUS_12610 5713 6495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 8226 7360 gene locus_tag LOCUS_12620 8226 7360 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141575.1 protein_id gnl|my_center|LOCUS_12620 8225 8644 gene locus_tag LOCUS_12630 gene panD 8225 8644 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225586.1 protein_id gnl|my_center|LOCUS_12630 8719 9906 gene locus_tag LOCUS_12640 8719 9906 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_12640 10227 10237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11274 10519 gene locus_tag LOCUS_12650 11274 10519 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_12650 11791 13239 gene locus_tag LOCUS_12660 11791 13239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592997.1 protein_id gnl|my_center|LOCUS_12660 15468 13246 gene locus_tag LOCUS_12670 15468 13246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 16648 15596 gene locus_tag LOCUS_12680 16648 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 17680 16934 gene locus_tag LOCUS_12690 17680 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 18578 17673 gene locus_tag LOCUS_12700 gene crtB 18578 17673 CDS product cyanoexosortase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214431335.1 protein_id gnl|my_center|LOCUS_12700 19755 18616 gene locus_tag LOCUS_12710 19755 18616 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_12710 20203 19886 gene locus_tag LOCUS_12720 20203 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence049 624 418 gene locus_tag LOCUS_12730 624 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 957 1211 gene locus_tag LOCUS_12740 957 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1213 1566 gene locus_tag LOCUS_12750 1213 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1944 2753 gene locus_tag LOCUS_12760 1944 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2776 3522 gene locus_tag LOCUS_12770 2776 3522 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475861.1 protein_id gnl|my_center|LOCUS_12770 3672 4322 gene locus_tag LOCUS_12780 3672 4322 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_12780 4796 4284 gene locus_tag LOCUS_12790 4796 4284 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798971.1 protein_id gnl|my_center|LOCUS_12790 5180 4866 gene locus_tag LOCUS_12800 5180 4866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 5647 5240 gene locus_tag LOCUS_12810 gene speD 5647 5240 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_12810 5843 6127 gene locus_tag LOCUS_12820 5843 6127 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_12820 6143 6496 gene locus_tag LOCUS_12830 6143 6496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 7160 6507 gene locus_tag LOCUS_12840 7160 6507 CDS product DUF4335 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056686.1 protein_id gnl|my_center|LOCUS_12840 7789 7163 gene locus_tag LOCUS_12850 7789 7163 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_12850 8006 8524 gene locus_tag LOCUS_12860 8006 8524 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_12860 8682 9743 gene locus_tag LOCUS_12870 8682 9743 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_12870 9973 10281 gene locus_tag LOCUS_12880 9973 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 10285 11163 gene locus_tag LOCUS_12890 10285 11163 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143114.1 protein_id gnl|my_center|LOCUS_12890 11810 11316 gene locus_tag LOCUS_12900 11810 11316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 13273 11816 gene locus_tag LOCUS_12910 13273 11816 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057458.1 protein_id gnl|my_center|LOCUS_12910 13989 13387 gene locus_tag LOCUS_12920 13989 13387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 14073 15053 gene locus_tag LOCUS_12930 14073 15053 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243618.1 protein_id gnl|my_center|LOCUS_12930 15358 15077 gene locus_tag LOCUS_12940 15358 15077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 15600 16247 gene locus_tag LOCUS_12950 15600 16247 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_12950 17205 16729 gene locus_tag LOCUS_12960 gene ureE 17205 16729 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_12960 17768 17283 gene locus_tag LOCUS_12970 17768 17283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 18315 18617 gene locus_tag LOCUS_12980 18315 18617 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_12980 18851 19906 gene locus_tag LOCUS_12990 gene cobD 18851 19906 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058099.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence050 391 3969 gene locus_tag LOCUS_13000 391 3969 CDS product NB-ARC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144339.1 protein_id gnl|my_center|LOCUS_13000 4913 4002 gene locus_tag LOCUS_13010 4913 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6704 5004 gene locus_tag LOCUS_13020 6704 5004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 7622 7089 gene locus_tag LOCUS_13030 7622 7089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 8824 7751 gene locus_tag LOCUS_13040 gene bchI 8824 7751 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_13040 9309 8908 gene locus_tag LOCUS_13050 9309 8908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_13050 11643 9511 gene locus_tag LOCUS_13060 gene glyS 11643 9511 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_13060 11914 12435 gene locus_tag LOCUS_13070 11914 12435 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_13070 12464 13048 gene locus_tag LOCUS_13080 12464 13048 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_13080 14269 13079 gene locus_tag LOCUS_13090 14269 13079 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_13090 14986 14306 gene locus_tag LOCUS_13100 14986 14306 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106289931.1 protein_id gnl|my_center|LOCUS_13100 15078 16997 gene locus_tag LOCUS_13110 15078 16997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 17900 17046 gene locus_tag LOCUS_13120 gene pheA 17900 17046 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_13120 18932 18015 gene locus_tag LOCUS_13130 18932 18015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 18951 19439 gene locus_tag LOCUS_13140 18951 19439 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140692.1 protein_id gnl|my_center|LOCUS_13140 20024 19449 gene locus_tag LOCUS_13150 gene lepB 20024 19449 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056260.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence051 3370 1685 gene locus_tag LOCUS_13160 3370 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 3545 5545 gene locus_tag LOCUS_13170 gene bchD 3545 5545 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057253.1 protein_id gnl|my_center|LOCUS_13170 5913 6416 gene locus_tag LOCUS_13180 5913 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_13180 6427 7317 gene locus_tag LOCUS_13190 6427 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_13190 7501 8178 gene locus_tag LOCUS_13200 7501 8178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 8451 8849 gene locus_tag LOCUS_13210 8451 8849 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_13210 8993 9676 gene locus_tag LOCUS_13220 gene ispD 8993 9676 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056453.1 protein_id gnl|my_center|LOCUS_13220 9731 10672 gene locus_tag LOCUS_13230 9731 10672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 10950 10777 gene locus_tag LOCUS_13240 10950 10777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 11139 11972 gene locus_tag LOCUS_13250 gene menB 11139 11972 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_13250 12220 12522 gene locus_tag LOCUS_13260 12220 12522 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_13260 12877 13962 gene locus_tag LOCUS_13270 12877 13962 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257672.1 protein_id gnl|my_center|LOCUS_13270 14761 13991 gene locus_tag LOCUS_13280 14761 13991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 15614 14997 gene locus_tag LOCUS_13290 15614 14997 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141508.1 protein_id gnl|my_center|LOCUS_13290 15684 16223 gene locus_tag LOCUS_13300 15684 16223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 16817 18433 gene locus_tag LOCUS_13310 16817 18433 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036534662.1 protein_id gnl|my_center|LOCUS_13310 18599 19381 gene locus_tag LOCUS_13320 18599 19381 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_13320 19746 19982 gene locus_tag LOCUS_13330 19746 19982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence052 2504 81 gene locus_tag LOCUS_13340 2504 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2968 3684 gene locus_tag LOCUS_13350 2968 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3681 4103 gene locus_tag LOCUS_13360 3681 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 4361 4597 gene locus_tag LOCUS_13370 gene rpmB 4361 4597 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_13370 4742 5008 gene locus_tag LOCUS_13380 gene psaK 4742 5008 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_13380 5183 6319 gene locus_tag LOCUS_13390 5183 6319 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_13390 6768 6523 gene locus_tag LOCUS_13400 6768 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 8002 6827 gene locus_tag LOCUS_13410 8002 6827 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125209.1 protein_id gnl|my_center|LOCUS_13410 8061 9323 gene locus_tag LOCUS_13420 8061 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 9614 10909 gene locus_tag LOCUS_13430 9614 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 11185 11499 gene locus_tag LOCUS_13440 11185 11499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 11500 11850 gene locus_tag LOCUS_13450 11500 11850 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142949.1 protein_id gnl|my_center|LOCUS_13450 11887 12087 gene locus_tag LOCUS_13460 11887 12087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 12565 12164 gene locus_tag LOCUS_13470 gene cdd 12565 12164 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583680.1 protein_id gnl|my_center|LOCUS_13470 14313 13186 gene locus_tag LOCUS_13480 14313 13186 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920975.1 protein_id gnl|my_center|LOCUS_13480 14732 14388 gene locus_tag LOCUS_13490 14732 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 15750 14746 gene locus_tag LOCUS_13500 gene pheS 15750 14746 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_13500 15992 16285 gene locus_tag LOCUS_13510 15992 16285 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_13510 16723 16887 gene locus_tag LOCUS_13520 16723 16887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 19583 16884 gene locus_tag LOCUS_13530 19583 16884 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence053 654 1577 gene locus_tag LOCUS_13540 654 1577 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_13540 1846 1574 gene locus_tag LOCUS_13550 1846 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 2371 1853 gene locus_tag LOCUS_13560 2371 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2853 3776 gene locus_tag LOCUS_13570 2853 3776 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_13570 5255 4335 gene locus_tag LOCUS_13580 5255 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 6534 5620 gene locus_tag LOCUS_13590 6534 5620 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023152.1 protein_id gnl|my_center|LOCUS_13590 7035 6589 gene locus_tag LOCUS_13600 7035 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 8685 7270 gene locus_tag LOCUS_13610 8685 7270 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015158974.1 protein_id gnl|my_center|LOCUS_13610 10473 8830 gene locus_tag LOCUS_13620 10473 8830 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142055.1 protein_id gnl|my_center|LOCUS_13620 10728 12713 gene locus_tag LOCUS_13630 gene dndD 10728 12713 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_13630 12965 13363 gene locus_tag LOCUS_13640 gene dndE 12965 13363 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_13640 13470 14981 gene locus_tag LOCUS_13650 13470 14981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 15008 15769 gene locus_tag LOCUS_13660 15008 15769 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131423.1 protein_id gnl|my_center|LOCUS_13660 15766 16683 gene locus_tag LOCUS_13670 15766 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 18292 16778 gene locus_tag LOCUS_13680 18292 16778 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056025.1 protein_id gnl|my_center|LOCUS_13680 18395 19189 gene locus_tag LOCUS_13690 18395 19189 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190557989.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence054 <1 790 gene locus_tag LOCUS_13700 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020316.1:IS200/IS605 family element RNA-guided endonuclease TnpB 867 1253 gene locus_tag LOCUS_13710 867 1253 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_13710 1253 1783 gene locus_tag LOCUS_13720 1253 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 4464 1912 gene locus_tag LOCUS_13730 gene gyrA 4464 1912 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057209.1 protein_id gnl|my_center|LOCUS_13730 4720 5883 gene locus_tag LOCUS_13740 4720 5883 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_13740 6610 5885 gene locus_tag LOCUS_13750 6610 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 6855 6607 gene locus_tag LOCUS_13760 6855 6607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 7042 7215 gene locus_tag LOCUS_13770 7042 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 7169 7693 gene locus_tag LOCUS_13780 7169 7693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7697 8509 gene locus_tag LOCUS_13790 7697 8509 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_13790 9472 8531 gene locus_tag LOCUS_13800 gene ispE 9472 8531 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_13800 10296 9490 gene locus_tag LOCUS_13810 gene rsmA 10296 9490 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_13810 10421 10834 gene locus_tag LOCUS_13820 gene crcB 10421 10834 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258331.1 protein_id gnl|my_center|LOCUS_13820 10851 11255 gene locus_tag LOCUS_13830 gene crcB 10851 11255 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927153.1 protein_id gnl|my_center|LOCUS_13830 12314 11328 gene locus_tag LOCUS_13840 12314 11328 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_13840 12484 15018 gene locus_tag LOCUS_13850 12484 15018 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_13850 15292 15217 gene locus_tag LOCUS_t00110 15292 15217 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15582 15592 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15745 15960 gene locus_tag LOCUS_13860 15745 15960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 15984 16496 gene locus_tag LOCUS_13870 15984 16496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 17847 16504 gene locus_tag LOCUS_13880 17847 16504 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_13880 18160 19155 gene locus_tag LOCUS_13890 gene moaA 18160 19155 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence055 951 319 gene locus_tag LOCUS_13900 951 319 CDS product DUF938 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143861.1 protein_id gnl|my_center|LOCUS_13900 1811 4447 gene locus_tag LOCUS_13910 gene topA 1811 4447 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_13910 5353 4568 gene locus_tag LOCUS_13920 5353 4568 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_13920 6064 10350 gene locus_tag LOCUS_13930 6064 10350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 10688 10476 gene locus_tag LOCUS_13940 10688 10476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 10712 15472 gene locus_tag LOCUS_13950 10712 15472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 15512 16555 gene locus_tag LOCUS_13960 gene fni 15512 16555 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_13960 16549 17181 gene locus_tag LOCUS_13970 gene bacA 16549 17181 CDS product prephenate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968341.1 protein_id gnl|my_center|LOCUS_13970 17278 17778 gene locus_tag LOCUS_13980 17278 17778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 17953 18753 gene locus_tag LOCUS_13990 gene bacG 17953 18753 CDS product NADPH-dependent reductase BacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244095.1 protein_id gnl|my_center|LOCUS_13990 18792 19055 gene locus_tag LOCUS_14000 18792 19055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence056 1898 471 gene locus_tag LOCUS_14010 1898 471 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_14010 2110 3345 gene locus_tag LOCUS_14020 2110 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 4300 3356 gene locus_tag LOCUS_14030 4300 3356 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119887.1 protein_id gnl|my_center|LOCUS_14030 4656 4303 gene locus_tag LOCUS_14040 4656 4303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941231.1 protein_id gnl|my_center|LOCUS_14040 5491 4775 gene locus_tag LOCUS_14050 5491 4775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 5910 6440 gene locus_tag LOCUS_14060 5910 6440 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144198.1 protein_id gnl|my_center|LOCUS_14060 8589 6430 gene locus_tag LOCUS_14070 8589 6430 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_14070 10457 8643 gene locus_tag LOCUS_14080 gene sppA 10457 8643 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203293.1 protein_id gnl|my_center|LOCUS_14080 11321 12712 gene locus_tag LOCUS_14090 11321 12712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 13188 12709 gene locus_tag LOCUS_14100 13188 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 13521 13249 gene locus_tag LOCUS_14110 13521 13249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 13771 13544 gene locus_tag LOCUS_14120 13771 13544 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016020.1 protein_id gnl|my_center|LOCUS_14120 14146 13916 gene locus_tag LOCUS_14130 14146 13916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 14382 14143 gene locus_tag LOCUS_14140 14382 14143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 14521 16155 gene locus_tag LOCUS_14150 14521 16155 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058039.1 protein_id gnl|my_center|LOCUS_14150 16269 16979 gene locus_tag LOCUS_14160 16269 16979 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_14160 17264 18295 gene locus_tag LOCUS_14170 17264 18295 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144236.1 protein_id gnl|my_center|LOCUS_14170 18561 18821 gene locus_tag LOCUS_14180 18561 18821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence057 111 800 gene locus_tag LOCUS_14190 111 800 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_14190 1744 947 gene locus_tag LOCUS_14200 1744 947 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_14200 2077 3285 gene locus_tag LOCUS_14210 2077 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 3319 4311 gene locus_tag LOCUS_14220 3319 4311 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057700.1 protein_id gnl|my_center|LOCUS_14220 4377 4844 gene locus_tag LOCUS_14230 4377 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 6500 4839 gene locus_tag LOCUS_14240 6500 4839 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257017.1 protein_id gnl|my_center|LOCUS_14240 6572 6784 gene locus_tag LOCUS_14250 6572 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_14250 7527 6781 gene locus_tag LOCUS_14260 7527 6781 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_14260 8937 7618 gene locus_tag LOCUS_14270 8937 7618 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056402.1 protein_id gnl|my_center|LOCUS_14270 10210 9308 gene locus_tag LOCUS_14280 10210 9308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 10908 10225 gene locus_tag LOCUS_14290 10908 10225 CDS product phage Gp37/Gp68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142947.1 protein_id gnl|my_center|LOCUS_14290 11265 12029 gene locus_tag LOCUS_14300 11265 12029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 12026 12205 gene locus_tag LOCUS_14310 12026 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 12218 12436 gene locus_tag LOCUS_14320 12218 12436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14320 13713 12655 gene locus_tag LOCUS_14330 13713 12655 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_14330 14257 15540 gene locus_tag LOCUS_14340 14257 15540 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_14340 15691 16380 gene locus_tag LOCUS_14350 15691 16380 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037770.1 protein_id gnl|my_center|LOCUS_14350 16399 18540 gene locus_tag LOCUS_14360 16399 18540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 >Feature sequence058 998 141 gene locus_tag LOCUS_14370 998 141 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_14370 1428 1222 gene locus_tag LOCUS_14380 1428 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 2784 1450 gene locus_tag LOCUS_14390 gene clpX 2784 1450 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056361.1 protein_id gnl|my_center|LOCUS_14390 3493 2792 gene locus_tag LOCUS_14400 gene clpP 3493 2792 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056360.1 protein_id gnl|my_center|LOCUS_14400 5127 3736 gene locus_tag LOCUS_14410 gene tig 5127 3736 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_14410 5452 6489 gene locus_tag LOCUS_14420 5452 6489 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_14420 6911 7765 gene locus_tag LOCUS_14430 gene dapA 6911 7765 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_14430 8004 9752 gene locus_tag LOCUS_14440 8004 9752 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_14440 9941 10711 gene locus_tag LOCUS_14450 gene larB 9941 10711 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057031.1 protein_id gnl|my_center|LOCUS_14450 10785 12695 gene locus_tag LOCUS_14460 gene dxs 10785 12695 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056470.1 protein_id gnl|my_center|LOCUS_14460 13029 13265 gene locus_tag LOCUS_14470 13029 13265 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_14470 13262 13615 gene locus_tag LOCUS_14480 13262 13615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 14012 13599 gene locus_tag LOCUS_14490 14012 13599 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_14490 14203 14009 gene locus_tag LOCUS_14500 14203 14009 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_14500 14605 15063 gene locus_tag LOCUS_14510 14605 15063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 15137 15382 gene locus_tag LOCUS_14520 15137 15382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 17456 15357 gene locus_tag LOCUS_14530 17456 15357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 18419 17793 gene locus_tag LOCUS_14540 18419 17793 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence059 3535 602 gene locus_tag LOCUS_14550 3535 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 8575 3752 gene locus_tag LOCUS_14560 8575 3752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 13386 8653 gene locus_tag LOCUS_14570 13386 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 15329 13530 gene locus_tag LOCUS_14580 15329 13530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 15655 15392 gene locus_tag LOCUS_14590 15655 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 15941 16456 gene locus_tag LOCUS_14600 15941 16456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 17462 16560 gene locus_tag LOCUS_14610 17462 16560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 18449 18111 gene locus_tag LOCUS_14620 18449 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence060 <1 942 gene locus_tag LOCUS_14630 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162305080.1:calcium-binding protein 1306 2271 gene locus_tag LOCUS_14640 1306 2271 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_14640 2247 3599 gene locus_tag LOCUS_14650 2247 3599 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_14650 5044 3614 gene locus_tag LOCUS_14660 5044 3614 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_14660 6262 5054 gene locus_tag LOCUS_14670 6262 5054 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_14670 7470 6259 gene locus_tag LOCUS_14680 7470 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 8203 7421 gene locus_tag LOCUS_14690 8203 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 10291 8219 gene locus_tag LOCUS_14700 10291 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 10666 10427 gene locus_tag LOCUS_14710 10666 10427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 12207 10762 gene locus_tag LOCUS_14720 12207 10762 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201919.1 protein_id gnl|my_center|LOCUS_14720 13041 14513 gene locus_tag LOCUS_14730 13041 14513 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_14730 15739 14576 gene locus_tag LOCUS_14740 15739 14576 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_14740 15985 16803 gene locus_tag LOCUS_14750 15985 16803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 16944 17387 gene locus_tag LOCUS_14760 16944 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 17466 18029 gene locus_tag LOCUS_14770 17466 18029 CDS product DUF4334 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090605.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence061 715 86 gene locus_tag LOCUS_14780 715 86 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_14780 1409 912 gene locus_tag LOCUS_14790 1409 912 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_14790 2747 3769 gene locus_tag LOCUS_14800 2747 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 5104 3794 gene locus_tag LOCUS_14810 5104 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 5609 5109 gene locus_tag LOCUS_14820 5609 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 7218 6061 gene locus_tag LOCUS_14830 7218 6061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 8782 7910 gene locus_tag LOCUS_14840 8782 7910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 9999 12311 gene locus_tag LOCUS_14850 9999 12311 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143774.1 protein_id gnl|my_center|LOCUS_14850 12366 13823 gene locus_tag LOCUS_14860 12366 13823 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_14860 14817 13831 gene locus_tag LOCUS_14870 gene nadA 14817 13831 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_14870 15108 15869 gene locus_tag LOCUS_14880 gene tatC 15108 15869 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_14880 15948 16259 gene locus_tag LOCUS_14890 15948 16259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055877.1 protein_id gnl|my_center|LOCUS_14890 16853 18379 gene locus_tag LOCUS_14900 gene psbB 16853 18379 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence062 2327 1350 gene locus_tag LOCUS_14910 2327 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3477 2755 gene locus_tag LOCUS_14920 3477 2755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 5069 3543 gene locus_tag LOCUS_14930 5069 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 6034 5114 gene locus_tag LOCUS_14940 6034 5114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6503 6054 gene locus_tag LOCUS_14950 6503 6054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7399 6509 gene locus_tag LOCUS_14960 7399 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8403 7780 gene locus_tag LOCUS_14970 8403 7780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 9795 8449 gene locus_tag LOCUS_14980 9795 8449 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_14980 10855 10463 gene locus_tag LOCUS_14990 gene tnpA 10855 10463 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036865.1 protein_id gnl|my_center|LOCUS_14990 10921 12243 gene locus_tag LOCUS_15000 10921 12243 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_15000 12364 13806 gene locus_tag LOCUS_15010 12364 13806 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920897.1 protein_id gnl|my_center|LOCUS_15010 13896 14993 gene locus_tag LOCUS_15020 13896 14993 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_15020 14997 16679 gene locus_tag LOCUS_15030 14997 16679 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_15030 17109 16606 gene locus_tag LOCUS_15040 17109 16606 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257075.1 protein_id gnl|my_center|LOCUS_15040 17996 17355 gene locus_tag LOCUS_15050 17996 17355 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence063 504 259 gene locus_tag LOCUS_15060 504 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 815 2326 gene locus_tag LOCUS_15070 gene ilvA 815 2326 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_15070 2355 3218 gene locus_tag LOCUS_15080 gene rsmH 2355 3218 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_15080 4408 3263 gene locus_tag LOCUS_15090 4408 3263 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881286.1 protein_id gnl|my_center|LOCUS_15090 4829 4442 gene locus_tag LOCUS_tm00010 4829 4442 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 5617 7296 gene locus_tag LOCUS_15100 5617 7296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 8934 7642 gene locus_tag LOCUS_15110 8934 7642 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_15110 10860 10312 gene locus_tag LOCUS_15120 gene frr 10860 10312 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_15120 11569 10847 gene locus_tag LOCUS_15130 gene pyrH 11569 10847 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_15130 11879 12460 gene locus_tag LOCUS_15140 11879 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 13115 12660 gene locus_tag LOCUS_15150 gene aroQ 13115 12660 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_15150 13799 15187 gene locus_tag LOCUS_15160 13799 15187 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_15160 17295 15184 gene locus_tag LOCUS_15170 17295 15184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 17517 18197 gene locus_tag LOCUS_15180 17517 18197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 >Feature sequence064 658 885 gene locus_tag LOCUS_15190 658 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 1086 2621 gene locus_tag LOCUS_15200 gene purH 1086 2621 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057387.1 protein_id gnl|my_center|LOCUS_15200 3442 2693 gene locus_tag LOCUS_15210 3442 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 3714 3511 gene locus_tag LOCUS_15220 3714 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3959 3714 gene locus_tag LOCUS_15230 3959 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 5298 4036 gene locus_tag LOCUS_15240 5298 4036 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_15240 6254 5295 gene locus_tag LOCUS_15250 6254 5295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 7714 6254 gene locus_tag LOCUS_15260 7714 6254 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964010.1 protein_id gnl|my_center|LOCUS_15260 7877 8848 gene locus_tag LOCUS_15270 7877 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 9379 8954 gene locus_tag LOCUS_15280 9379 8954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 10628 9630 gene locus_tag LOCUS_15290 gene galE 10628 9630 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_15290 10697 12190 gene locus_tag LOCUS_15300 gene pap 10697 12190 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_15300 12452 13087 gene locus_tag LOCUS_15310 gene purN 12452 13087 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_15310 13723 13139 gene locus_tag LOCUS_15320 13723 13139 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_15320 14357 13770 gene locus_tag LOCUS_15330 14357 13770 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_15330 14559 17279 gene locus_tag LOCUS_15340 14559 17279 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence065 238 804 gene locus_tag LOCUS_15350 238 804 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_15350 833 1570 gene locus_tag LOCUS_15360 833 1570 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_15360 1739 2863 gene locus_tag LOCUS_15370 1739 2863 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_15370 3413 5293 gene locus_tag LOCUS_15380 gene dnaG 3413 5293 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_15380 6592 5306 gene locus_tag LOCUS_15390 6592 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142706.1 protein_id gnl|my_center|LOCUS_15390 7838 6678 gene locus_tag LOCUS_15400 7838 6678 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_15400 9006 8359 gene locus_tag LOCUS_15410 9006 8359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 10476 9736 gene locus_tag LOCUS_15420 10476 9736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 10985 10695 gene locus_tag LOCUS_15430 10985 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 11006 11494 gene locus_tag LOCUS_15440 11006 11494 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_15440 11494 12342 gene locus_tag LOCUS_15450 11494 12342 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140768.1 protein_id gnl|my_center|LOCUS_15450 12345 12812 gene locus_tag LOCUS_15460 gene bcp 12345 12812 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233532.1 protein_id gnl|my_center|LOCUS_15460 12969 13766 gene locus_tag LOCUS_15470 gene rpsB 12969 13766 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057525.1 protein_id gnl|my_center|LOCUS_15470 13883 14638 gene locus_tag LOCUS_15480 gene tsf 13883 14638 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124978.1 protein_id gnl|my_center|LOCUS_15480 14942 15220 gene locus_tag LOCUS_15490 14942 15220 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_15490 15183 15461 gene locus_tag LOCUS_15500 15183 15461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 15557 15835 gene locus_tag LOCUS_15510 15557 15835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 15859 16128 gene locus_tag LOCUS_15520 15859 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 16320 16595 gene locus_tag LOCUS_15530 16320 16595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_15530 16592 16963 gene locus_tag LOCUS_15540 16592 16963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence066 427 1344 gene locus_tag LOCUS_15550 427 1344 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_15550 2149 1319 gene locus_tag LOCUS_15560 2149 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 2382 2618 gene locus_tag LOCUS_15570 2382 2618 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_15570 3852 2635 gene locus_tag LOCUS_15580 gene tyrS 3852 2635 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_15580 4049 5734 gene locus_tag LOCUS_15590 4049 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 5780 6031 gene locus_tag LOCUS_15600 5780 6031 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057929.1 protein_id gnl|my_center|LOCUS_15600 6211 6948 gene locus_tag LOCUS_15610 6211 6948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_15610 8178 7093 gene locus_tag LOCUS_15620 gene orr 8178 7093 CDS product ornithine racemase Orr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986511.1 protein_id gnl|my_center|LOCUS_15620 9343 8183 gene locus_tag LOCUS_15630 9343 8183 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_15630 9695 9486 gene locus_tag LOCUS_15640 9695 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 10262 9948 gene locus_tag LOCUS_15650 10262 9948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 11803 10430 gene locus_tag LOCUS_15660 11803 10430 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_15660 12362 11877 gene locus_tag LOCUS_15670 12362 11877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_15670 14092 12485 gene locus_tag LOCUS_15680 14092 12485 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_15680 14630 14121 gene locus_tag LOCUS_15690 gene hoxE 14630 14121 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_15690 15296 15526 gene locus_tag LOCUS_15700 15296 15526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 15582 16604 gene locus_tag LOCUS_15710 15582 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 >Feature sequence067 194 811 gene locus_tag LOCUS_15720 194 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 1833 907 gene locus_tag LOCUS_15730 gene fabD 1833 907 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_15730 2995 2021 gene locus_tag LOCUS_15740 2995 2021 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056689.1 protein_id gnl|my_center|LOCUS_15740 4486 3431 gene locus_tag LOCUS_15750 gene plsX 4486 3431 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_15750 4636 5928 gene locus_tag LOCUS_15760 4636 5928 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_15760 7273 6212 gene locus_tag LOCUS_15770 gene argC 7273 6212 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058053.1 protein_id gnl|my_center|LOCUS_15770 7745 7482 gene locus_tag LOCUS_15780 7745 7482 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_15780 8752 7832 gene locus_tag LOCUS_15790 8752 7832 CDS product DUF389 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057303.1 protein_id gnl|my_center|LOCUS_15790 8934 9779 gene locus_tag LOCUS_15800 8934 9779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_15800 9776 9964 gene locus_tag LOCUS_15810 9776 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15810 10623 10066 gene locus_tag LOCUS_15820 10623 10066 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_15820 11994 10651 gene locus_tag LOCUS_15830 11994 10651 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_15830 12289 12122 gene locus_tag LOCUS_15840 12289 12122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 13513 12350 gene locus_tag LOCUS_15850 13513 12350 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055867.1 protein_id gnl|my_center|LOCUS_15850 13825 14877 gene locus_tag LOCUS_15860 13825 14877 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_15860 14870 15913 gene locus_tag LOCUS_15870 14870 15913 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121962.1 protein_id gnl|my_center|LOCUS_15870 16671 16450 gene locus_tag LOCUS_15880 16671 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 >Feature sequence068 246 701 gene locus_tag LOCUS_15890 246 701 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057290.1 protein_id gnl|my_center|LOCUS_15890 1029 1334 gene locus_tag LOCUS_15900 1029 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 1339 2226 gene locus_tag LOCUS_15910 1339 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2497 2688 gene locus_tag LOCUS_15920 2497 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 2859 3095 gene locus_tag LOCUS_15930 2859 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3095 3493 gene locus_tag LOCUS_15940 3095 3493 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140846.1 protein_id gnl|my_center|LOCUS_15940 4627 3716 gene locus_tag LOCUS_15950 4627 3716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 5196 6554 gene locus_tag LOCUS_15960 5196 6554 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057835.1 protein_id gnl|my_center|LOCUS_15960 6667 7497 gene locus_tag LOCUS_15970 gene ntrB 6667 7497 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920965.1 protein_id gnl|my_center|LOCUS_15970 7567 9585 gene locus_tag LOCUS_15980 7567 9585 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057837.1 protein_id gnl|my_center|LOCUS_15980 9703 10542 gene locus_tag LOCUS_15990 9703 10542 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_15990 10898 11371 gene locus_tag LOCUS_16000 10898 11371 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_16000 12072 11560 gene locus_tag LOCUS_16010 12072 11560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 13590 12085 gene locus_tag LOCUS_16020 13590 12085 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_16020 13839 14807 gene locus_tag LOCUS_16030 13839 14807 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_16030 14841 15350 gene locus_tag LOCUS_16040 14841 15350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_16040 15639 15568 gene locus_tag LOCUS_t00120 15639 15568 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15699 15953 gene locus_tag LOCUS_16050 15699 15953 CDS product DUF3493 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057674.1 protein_id gnl|my_center|LOCUS_16050 16175 16468 gene locus_tag LOCUS_16060 16175 16468 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence069 3321 259 gene locus_tag LOCUS_16070 3321 259 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_16070 3523 4311 gene locus_tag LOCUS_16080 3523 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 4679 4308 gene locus_tag LOCUS_16090 4679 4308 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799703.1 protein_id gnl|my_center|LOCUS_16090 4947 4783 gene locus_tag LOCUS_16100 4947 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 5478 6122 gene locus_tag LOCUS_16110 5478 6122 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_16110 6845 6174 gene locus_tag LOCUS_16120 6845 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 7434 7087 gene locus_tag LOCUS_16130 7434 7087 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_16130 7606 7421 gene locus_tag LOCUS_16140 7606 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 8460 7888 gene locus_tag LOCUS_16150 8460 7888 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142565.1 protein_id gnl|my_center|LOCUS_16150 8758 8817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8861 9988 gene locus_tag LOCUS_16160 gene recF 8861 9988 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142400.1 protein_id gnl|my_center|LOCUS_16160 11161 10097 gene locus_tag LOCUS_16170 11161 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 12038 11328 gene locus_tag LOCUS_16180 gene rpiA 12038 11328 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_16180 12635 12111 gene locus_tag LOCUS_16190 12635 12111 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_16190 13209 13409 gene locus_tag LOCUS_16200 13209 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 13543 14424 gene locus_tag LOCUS_16210 13543 14424 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057174.1 protein_id gnl|my_center|LOCUS_16210 15410 14427 gene locus_tag LOCUS_16220 15410 14427 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943586.1 protein_id gnl|my_center|LOCUS_16220 15679 15440 gene locus_tag LOCUS_16230 15679 15440 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057724.1 protein_id gnl|my_center|LOCUS_16230 16089 15694 gene locus_tag LOCUS_16240 gene arsC 16089 15694 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_16240 16310 16113 gene locus_tag LOCUS_16250 16310 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 16599 16276 gene locus_tag LOCUS_16260 16599 16276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence070 612 433 gene locus_tag LOCUS_16270 612 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1101 946 gene locus_tag LOCUS_16280 1101 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 2101 2700 gene locus_tag LOCUS_16290 gene raiA 2101 2700 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056677.1 protein_id gnl|my_center|LOCUS_16290 3169 2759 gene locus_tag LOCUS_16300 3169 2759 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_16300 4045 3404 gene locus_tag LOCUS_16310 4045 3404 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_16310 4022 5278 gene locus_tag LOCUS_16320 gene larC 4022 5278 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_16320 5879 5427 gene locus_tag LOCUS_16330 5879 5427 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141996.1 protein_id gnl|my_center|LOCUS_16330 7058 6513 gene locus_tag LOCUS_16340 7058 6513 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462984.1 protein_id gnl|my_center|LOCUS_16340 7415 7777 gene locus_tag LOCUS_16350 gene ndhC 7415 7777 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_16350 7825 8568 gene locus_tag LOCUS_16360 gene ndhK 7825 8568 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_16360 8569 9072 gene locus_tag LOCUS_16370 8569 9072 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_16370 10785 9280 gene locus_tag LOCUS_16380 10785 9280 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_16380 10966 12060 gene locus_tag LOCUS_16390 10966 12060 CDS product ATP/GTP phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616490.1 protein_id gnl|my_center|LOCUS_16390 12077 12742 gene locus_tag LOCUS_16400 12077 12742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 13280 12795 gene locus_tag LOCUS_16410 gene psbV 13280 12795 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_16410 13615 13409 gene locus_tag LOCUS_16420 13615 13409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 14030 14299 gene locus_tag LOCUS_16430 14030 14299 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_16430 14312 14866 gene locus_tag LOCUS_16440 gene gmk 14312 14866 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_16440 15213 15815 gene locus_tag LOCUS_16450 gene clpP 15213 15815 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125072.1 protein_id gnl|my_center|LOCUS_16450 16297 16103 gene locus_tag LOCUS_16460 16297 16103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence071 3882 535 gene locus_tag LOCUS_16470 3882 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 4838 3954 gene locus_tag LOCUS_16480 4838 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 5260 5045 gene locus_tag LOCUS_16490 5260 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 8410 5459 gene locus_tag LOCUS_16500 8410 5459 CDS product NHLP bacteriocin export ABC transporter permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458930.1 protein_id gnl|my_center|LOCUS_16500 10634 8397 gene locus_tag LOCUS_16510 10634 8397 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_16510 12253 10643 gene locus_tag LOCUS_16520 12253 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 13413 12304 gene locus_tag LOCUS_16530 13413 12304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 14672 13479 gene locus_tag LOCUS_16540 14672 13479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 15539 14715 gene locus_tag LOCUS_16550 15539 14715 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920789.1 protein_id gnl|my_center|LOCUS_16550 16496 16107 gene locus_tag LOCUS_16560 16496 16107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence072 1320 280 gene locus_tag LOCUS_16570 1320 280 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_16570 2505 1591 gene locus_tag LOCUS_16580 2505 1591 CDS product Sll0314/Alr1548 family TPR repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524124.1 protein_id gnl|my_center|LOCUS_16580 3770 2541 gene locus_tag LOCUS_16590 3770 2541 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_16590 4022 4669 gene locus_tag LOCUS_16600 4022 4669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_16600 4763 5440 gene locus_tag LOCUS_16610 gene rsmG 4763 5440 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_16610 6531 5443 gene locus_tag LOCUS_16620 gene cax 6531 5443 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_16620 7191 6580 gene locus_tag LOCUS_16630 7191 6580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 8833 7349 gene locus_tag LOCUS_16640 8833 7349 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056715.1 protein_id gnl|my_center|LOCUS_16640 8938 9609 gene locus_tag LOCUS_16650 8938 9609 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056716.1 protein_id gnl|my_center|LOCUS_16650 10262 11230 gene locus_tag LOCUS_16660 gene thiL 10262 11230 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_16660 12670 11234 gene locus_tag LOCUS_16670 gene ffh 12670 11234 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057808.1 protein_id gnl|my_center|LOCUS_16670 13128 12736 gene locus_tag LOCUS_16680 13128 12736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_16680 13213 14127 gene locus_tag LOCUS_16690 gene hslO 13213 14127 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_16690 14192 16147 gene locus_tag LOCUS_16700 14192 16147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence073 100 909 gene locus_tag LOCUS_16710 100 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 1847 1191 gene locus_tag LOCUS_16720 1847 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2842 1850 gene locus_tag LOCUS_16730 2842 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 3065 5878 gene locus_tag LOCUS_16740 gene secA 3065 5878 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057688.1 protein_id gnl|my_center|LOCUS_16740 6874 7353 gene locus_tag LOCUS_16750 gene ispF 6874 7353 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_16750 7395 7622 gene locus_tag LOCUS_16760 7395 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 7622 8008 gene locus_tag LOCUS_16770 7622 8008 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681559.1 protein_id gnl|my_center|LOCUS_16770 8101 9858 gene locus_tag LOCUS_16780 gene argS 8101 9858 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_16780 10462 10854 gene locus_tag LOCUS_16790 10462 10854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 10864 11643 gene locus_tag LOCUS_16800 10864 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105219828.1 protein_id gnl|my_center|LOCUS_16800 11648 11899 gene locus_tag LOCUS_16810 11648 11899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_16810 12349 11942 gene locus_tag LOCUS_16820 12349 11942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 14289 12349 gene locus_tag LOCUS_16830 14289 12349 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_16830 14768 14598 gene locus_tag LOCUS_16840 14768 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 15091 15792 gene locus_tag LOCUS_16850 15091 15792 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_16850 15808 16389 gene locus_tag LOCUS_16860 15808 16389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence074 2094 157 gene locus_tag LOCUS_16870 gene sir 2094 157 CDS product sulfite reductase, ferredoxin dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920675.1 protein_id gnl|my_center|LOCUS_16870 2291 4690 gene locus_tag LOCUS_16880 2291 4690 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_16880 5485 4898 gene locus_tag LOCUS_16890 gene msrA 5485 4898 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_16890 6141 8099 gene locus_tag LOCUS_16900 6141 8099 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261759.1 protein_id gnl|my_center|LOCUS_16900 10100 8460 gene locus_tag LOCUS_16910 10100 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142439.1 protein_id gnl|my_center|LOCUS_16910 12254 10176 gene locus_tag LOCUS_16920 12254 10176 CDS product caspase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057163.1 protein_id gnl|my_center|LOCUS_16920 13420 12251 gene locus_tag LOCUS_16930 gene sat 13420 12251 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_16930 13552 14256 gene locus_tag LOCUS_16940 13552 14256 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056362.1 protein_id gnl|my_center|LOCUS_16940 14592 15677 gene locus_tag LOCUS_16950 gene hppD 14592 15677 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810922.1 protein_id gnl|my_center|LOCUS_16950 16245 15709 gene locus_tag LOCUS_16960 16245 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence075 931 1272 gene locus_tag LOCUS_16970 931 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_16970 1477 1950 gene locus_tag LOCUS_16980 1477 1950 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057630.1 protein_id gnl|my_center|LOCUS_16980 2176 2763 gene locus_tag LOCUS_16990 2176 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 3133 2777 gene locus_tag LOCUS_17000 3133 2777 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_17000 3355 3951 gene locus_tag LOCUS_17010 3355 3951 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140153.1 protein_id gnl|my_center|LOCUS_17010 4107 5633 gene locus_tag LOCUS_17020 gene bchB 4107 5633 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_17020 6808 5681 gene locus_tag LOCUS_17030 6808 5681 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056272.1 protein_id gnl|my_center|LOCUS_17030 7971 7087 gene locus_tag LOCUS_17040 gene lipA 7971 7087 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_17040 8142 9890 gene locus_tag LOCUS_17050 8142 9890 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929136.1 protein_id gnl|my_center|LOCUS_17050 10599 10240 gene locus_tag LOCUS_17060 gene grxD 10599 10240 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_17060 12297 10651 gene locus_tag LOCUS_17070 12297 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 13102 12275 gene locus_tag LOCUS_17080 13102 12275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 14121 16313 gene locus_tag LOCUS_17090 14121 16313 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence076 1832 966 gene locus_tag LOCUS_17100 1832 966 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_17100 2107 3087 gene locus_tag LOCUS_17110 2107 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3178 4119 gene locus_tag LOCUS_17120 3178 4119 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_17120 4109 4939 gene locus_tag LOCUS_17130 4109 4939 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_17130 4942 6468 gene locus_tag LOCUS_17140 4942 6468 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_17140 6517 7137 gene locus_tag LOCUS_17150 6517 7137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 7251 7826 gene locus_tag LOCUS_17160 7251 7826 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_17160 8485 8183 gene locus_tag LOCUS_17170 8485 8183 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_17170 8712 8482 gene locus_tag LOCUS_17180 8712 8482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 9745 8870 gene locus_tag LOCUS_17190 9745 8870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 10180 10458 gene locus_tag LOCUS_17200 10180 10458 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_17200 10469 10774 gene locus_tag LOCUS_17210 10469 10774 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_17210 12328 10868 gene locus_tag LOCUS_17220 12328 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 13318 12419 gene locus_tag LOCUS_17230 13318 12419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 13517 13915 gene locus_tag LOCUS_17240 13517 13915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 13919 14326 gene locus_tag LOCUS_17250 13919 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence077 1058 489 gene locus_tag LOCUS_17260 1058 489 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_17260 2399 3019 gene locus_tag LOCUS_17270 2399 3019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3449 3186 gene locus_tag LOCUS_17280 3449 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3667 4059 gene locus_tag LOCUS_17290 3667 4059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 4077 4304 gene locus_tag LOCUS_17300 4077 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 4636 5265 gene locus_tag LOCUS_17310 4636 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 5405 6085 gene locus_tag LOCUS_17320 5405 6085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 7141 6776 gene locus_tag LOCUS_17330 7141 6776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 7455 7138 gene locus_tag LOCUS_17340 7455 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 7768 7929 gene locus_tag LOCUS_17350 7768 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 8143 9240 gene locus_tag LOCUS_17360 8143 9240 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090620535.1 protein_id gnl|my_center|LOCUS_17360 10029 9508 gene locus_tag LOCUS_17370 10029 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 10735 10199 gene locus_tag LOCUS_17380 10735 10199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 11563 10748 gene locus_tag LOCUS_17390 11563 10748 CDS product Ycf66 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057849.1 protein_id gnl|my_center|LOCUS_17390 12493 14187 gene locus_tag LOCUS_17400 12493 14187 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_17400 14339 16114 gene locus_tag LOCUS_17410 gene pyk 14339 16114 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence078 930 118 gene locus_tag LOCUS_17420 gene surE 930 118 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057623.1 protein_id gnl|my_center|LOCUS_17420 986 1060 gene locus_tag LOCUS_t00130 986 1060 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2052 1156 gene locus_tag LOCUS_17430 gene prmA 2052 1156 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_17430 3764 2187 gene locus_tag LOCUS_17440 gene serA 3764 2187 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_17440 6466 4688 gene locus_tag LOCUS_17450 gene ilvB 6466 4688 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057136.1 protein_id gnl|my_center|LOCUS_17450 6781 7455 gene locus_tag LOCUS_17460 gene bioD 6781 7455 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_17460 9271 7499 gene locus_tag LOCUS_17470 9271 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17470 11149 9287 gene locus_tag LOCUS_17480 11149 9287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17480 11603 12376 gene locus_tag LOCUS_17490 11603 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 12426 15662 gene locus_tag LOCUS_17500 12426 15662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence079 259 909 gene locus_tag LOCUS_17510 259 909 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869135.1 protein_id gnl|my_center|LOCUS_17510 919 2334 gene locus_tag LOCUS_17520 919 2334 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 protein_id gnl|my_center|LOCUS_17520 3346 2564 gene locus_tag LOCUS_17530 3346 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 4563 3343 gene locus_tag LOCUS_17540 4563 3343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 4961 4569 gene locus_tag LOCUS_17550 4961 4569 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974795.1 protein_id gnl|my_center|LOCUS_17550 5600 5046 gene locus_tag LOCUS_17560 5600 5046 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928657.1 protein_id gnl|my_center|LOCUS_17560 6611 5628 gene locus_tag LOCUS_17570 6611 5628 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920729.1 protein_id gnl|my_center|LOCUS_17570 7858 6641 gene locus_tag LOCUS_17580 7858 6641 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_17580 8820 7861 gene locus_tag LOCUS_17590 gene gmd 8820 7861 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_17590 9755 8835 gene locus_tag LOCUS_17600 gene aglG 9755 8835 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_17600 9994 10977 gene locus_tag LOCUS_17610 9994 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 11109 11465 gene locus_tag LOCUS_17620 gene folB 11109 11465 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_17620 11994 11452 gene locus_tag LOCUS_17630 11994 11452 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_17630 12155 12481 gene locus_tag LOCUS_17640 12155 12481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 13056 12478 gene locus_tag LOCUS_17650 13056 12478 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_17650 13969 13313 gene locus_tag LOCUS_17660 gene nth 13969 13313 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_17660 15060 13969 gene locus_tag LOCUS_17670 gene rseP 15060 13969 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_17670 15210 15581 gene locus_tag LOCUS_17680 15210 15581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 >Feature sequence080 776 465 gene locus_tag LOCUS_17690 776 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 985 2046 gene locus_tag LOCUS_17700 985 2046 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031370.1 protein_id gnl|my_center|LOCUS_17700 2771 2091 gene locus_tag LOCUS_17710 2771 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 3833 3018 gene locus_tag LOCUS_17720 3833 3018 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142967.1 protein_id gnl|my_center|LOCUS_17720 4083 3841 gene locus_tag LOCUS_17730 4083 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4730 6694 gene locus_tag LOCUS_17740 4730 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_17740 8253 7747 gene locus_tag LOCUS_17750 8253 7747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17750 9344 8481 gene locus_tag LOCUS_17760 9344 8481 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_17760 9550 10029 gene locus_tag LOCUS_17770 9550 10029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 11058 10774 gene locus_tag LOCUS_17780 11058 10774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 11222 11091 gene locus_tag LOCUS_17790 11222 11091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 11834 11412 gene locus_tag LOCUS_17800 11834 11412 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_17800 12063 11824 gene locus_tag LOCUS_17810 12063 11824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 12807 12379 gene locus_tag LOCUS_17820 12807 12379 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393815.1 protein_id gnl|my_center|LOCUS_17820 13046 12807 gene locus_tag LOCUS_17830 13046 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 13301 13056 gene locus_tag LOCUS_17840 13301 13056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 13869 13321 gene locus_tag LOCUS_17850 13869 13321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 14688 14278 gene locus_tag LOCUS_17860 14688 14278 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_17860 14929 14681 gene locus_tag LOCUS_17870 14929 14681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142425.1 protein_id gnl|my_center|LOCUS_17870 >Feature sequence081 256 441 gene locus_tag LOCUS_17880 256 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 815 1549 gene locus_tag LOCUS_17890 815 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 2434 1592 gene locus_tag LOCUS_17900 2434 1592 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_17900 2562 2477 gene locus_tag LOCUS_t00140 2562 2477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2741 4066 gene locus_tag LOCUS_17910 gene murA 2741 4066 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_17910 5065 4229 gene locus_tag LOCUS_17920 5065 4229 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920966.1 protein_id gnl|my_center|LOCUS_17920 6478 5075 gene locus_tag LOCUS_17930 6478 5075 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929421.1 protein_id gnl|my_center|LOCUS_17930 7322 6483 gene locus_tag LOCUS_17940 gene ntrB 7322 6483 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705090.1 protein_id gnl|my_center|LOCUS_17940 7752 7558 gene locus_tag LOCUS_17950 7752 7558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 8348 7746 gene locus_tag LOCUS_17960 8348 7746 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_17960 8620 9711 gene locus_tag LOCUS_17970 8620 9711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 9750 10496 gene locus_tag LOCUS_17980 9750 10496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 11389 11084 gene locus_tag LOCUS_17990 11389 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 12594 11626 gene locus_tag LOCUS_18000 12594 11626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_18000 13049 13648 gene locus_tag LOCUS_18010 13049 13648 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_18010 13827 14714 gene locus_tag LOCUS_18020 13827 14714 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_18020 14724 15134 gene locus_tag LOCUS_18030 14724 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence082 430 2271 gene locus_tag LOCUS_18040 430 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 2211 14369 gene locus_tag LOCUS_18050 2211 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 14412 14960 gene locus_tag LOCUS_18060 14412 14960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence083 1122 73 gene locus_tag LOCUS_18070 1122 73 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203374.1 protein_id gnl|my_center|LOCUS_18070 3928 1223 gene locus_tag LOCUS_18080 3928 1223 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_18080 4441 4103 gene locus_tag LOCUS_18090 4441 4103 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920728.1 protein_id gnl|my_center|LOCUS_18090 5279 4572 gene locus_tag LOCUS_18100 5279 4572 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_18100 5314 6534 gene locus_tag LOCUS_18110 5314 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 7096 7254 gene locus_tag LOCUS_18120 7096 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 8471 7395 gene locus_tag LOCUS_18130 gene rsgA 8471 7395 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_18130 8693 8472 gene locus_tag LOCUS_18140 8693 8472 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_18140 9820 8696 gene locus_tag LOCUS_18150 gene dnaJ 9820 8696 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_18150 12108 10060 gene locus_tag LOCUS_18160 gene dnaK 12108 10060 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056634.1 protein_id gnl|my_center|LOCUS_18160 12765 13769 gene locus_tag LOCUS_18170 12765 13769 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207999.1 protein_id gnl|my_center|LOCUS_18170 14183 13959 gene locus_tag LOCUS_18180 14183 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 15025 14438 gene locus_tag LOCUS_18190 15025 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence084 1968 736 gene locus_tag LOCUS_18200 1968 736 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075901854.1 protein_id gnl|my_center|LOCUS_18200 3035 5230 gene locus_tag LOCUS_18210 3035 5230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 6714 5317 gene locus_tag LOCUS_18220 6714 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8705 6744 gene locus_tag LOCUS_18230 8705 6744 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144292.1 protein_id gnl|my_center|LOCUS_18230 9856 8903 gene locus_tag LOCUS_18240 9856 8903 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967589.1 protein_id gnl|my_center|LOCUS_18240 10544 10071 gene locus_tag LOCUS_18250 10544 10071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143336.1 protein_id gnl|my_center|LOCUS_18250 10606 11928 gene locus_tag LOCUS_18260 10606 11928 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_18260 12041 12376 gene locus_tag LOCUS_18270 12041 12376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 12453 12797 gene locus_tag LOCUS_18280 12453 12797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 12900 14909 gene locus_tag LOCUS_18290 gene ligA 12900 14909 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056701.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence085 724 272 gene locus_tag LOCUS_18300 724 272 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_18300 829 1191 gene locus_tag LOCUS_18310 829 1191 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875991.1 protein_id gnl|my_center|LOCUS_18310 1197 2036 gene locus_tag LOCUS_18320 1197 2036 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_18320 2110 2568 gene locus_tag LOCUS_18330 2110 2568 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_18330 3045 2854 gene locus_tag LOCUS_18340 3045 2854 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_18340 3315 4271 gene locus_tag LOCUS_18350 3315 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 4562 4314 gene locus_tag LOCUS_18360 4562 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 4799 4963 gene locus_tag LOCUS_18370 4799 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 5106 6506 gene locus_tag LOCUS_18380 5106 6506 CDS product BCD family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141482.1 protein_id gnl|my_center|LOCUS_18380 6621 7058 gene locus_tag LOCUS_18390 6621 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 7922 7350 gene locus_tag LOCUS_18400 7922 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 8231 8623 gene locus_tag LOCUS_18410 8231 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 9569 8796 gene locus_tag LOCUS_18420 9569 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 10036 9809 gene locus_tag LOCUS_18430 10036 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 10363 10785 gene locus_tag LOCUS_18440 10363 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 11176 10811 gene locus_tag LOCUS_18450 11176 10811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116963198.1 protein_id gnl|my_center|LOCUS_18450 11322 11573 gene locus_tag LOCUS_18460 11322 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 11843 12073 gene locus_tag LOCUS_18470 11843 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 12070 12333 gene locus_tag LOCUS_18480 12070 12333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 14285 12378 gene locus_tag LOCUS_18490 gene mnmG 14285 12378 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence086 1292 111 gene locus_tag LOCUS_18500 1292 111 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_18500 2240 1476 gene locus_tag LOCUS_18510 gene map 2240 1476 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_18510 3437 2628 gene locus_tag LOCUS_18520 gene pstB 3437 2628 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140451.1 protein_id gnl|my_center|LOCUS_18520 4333 3449 gene locus_tag LOCUS_18530 gene pstA 4333 3449 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_18530 5311 4337 gene locus_tag LOCUS_18540 gene pstC 5311 4337 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140449.1 protein_id gnl|my_center|LOCUS_18540 6500 5487 gene locus_tag LOCUS_18550 gene pstS 6500 5487 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140448.1 protein_id gnl|my_center|LOCUS_18550 7410 7144 gene locus_tag LOCUS_18560 7410 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 8385 7588 gene locus_tag LOCUS_18570 gene pstB 8385 7588 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_18570 9335 8532 gene locus_tag LOCUS_18580 gene pstB 9335 8532 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_18580 10328 9435 gene locus_tag LOCUS_18590 gene pstA 10328 9435 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_18590 11588 10629 gene locus_tag LOCUS_18600 gene pstC 11588 10629 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_18600 12804 11683 gene locus_tag LOCUS_18610 gene pstS 12804 11683 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_18610 13434 14468 gene locus_tag LOCUS_18620 13434 14468 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence087 287 1324 gene locus_tag LOCUS_18630 gene glpX 287 1324 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_18630 1538 2164 gene locus_tag LOCUS_18640 1538 2164 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_18640 2169 3272 gene locus_tag LOCUS_18650 2169 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 3344 4630 gene locus_tag LOCUS_18660 3344 4630 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_18660 4961 6148 gene locus_tag LOCUS_18670 4961 6148 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_18670 6425 6841 gene locus_tag LOCUS_18680 6425 6841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 7275 8330 gene locus_tag LOCUS_18690 7275 8330 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140060.1 protein_id gnl|my_center|LOCUS_18690 8346 9233 gene locus_tag LOCUS_18700 8346 9233 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267092.1 protein_id gnl|my_center|LOCUS_18700 9246 9587 gene locus_tag LOCUS_18710 9246 9587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 9713 10795 gene locus_tag LOCUS_18720 gene gmd 9713 10795 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_18720 10808 11746 gene locus_tag LOCUS_18730 10808 11746 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056480.1 protein_id gnl|my_center|LOCUS_18730 12474 11800 gene locus_tag LOCUS_18740 12474 11800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 13155 14339 gene locus_tag LOCUS_18750 13155 14339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 >Feature sequence088 187 1629 gene locus_tag LOCUS_18760 187 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1920 2111 gene locus_tag LOCUS_18770 1920 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2115 2363 gene locus_tag LOCUS_18780 2115 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 2539 2751 gene locus_tag LOCUS_18790 2539 2751 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813809.1 protein_id gnl|my_center|LOCUS_18790 2906 3127 gene locus_tag LOCUS_18800 2906 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 3129 3341 gene locus_tag LOCUS_18810 3129 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 4948 4340 gene locus_tag LOCUS_18820 gene rpsD 4948 4340 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056002.1 protein_id gnl|my_center|LOCUS_18820 5227 5727 gene locus_tag LOCUS_18830 5227 5727 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_18830 6008 7135 gene locus_tag LOCUS_18840 6008 7135 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_18840 7268 8347 gene locus_tag LOCUS_18850 gene fba 7268 8347 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056231.1 protein_id gnl|my_center|LOCUS_18850 8539 9777 gene locus_tag LOCUS_18860 8539 9777 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_18860 10245 11549 gene locus_tag LOCUS_18870 10245 11549 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_18870 <14536 11869 gene locus_tag LOCUS_18880 <14536 11869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence089 865 11 gene locus_tag LOCUS_18890 865 11 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461868.1 protein_id gnl|my_center|LOCUS_18890 1445 2374 gene locus_tag LOCUS_18900 1445 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2575 3873 gene locus_tag LOCUS_18910 2575 3873 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_18910 3889 4980 gene locus_tag LOCUS_18920 gene metX 3889 4980 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_18920 5044 6459 gene locus_tag LOCUS_18930 5044 6459 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_18930 6456 7055 gene locus_tag LOCUS_18940 6456 7055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7281 7069 gene locus_tag LOCUS_18950 7281 7069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 9452 7302 gene locus_tag LOCUS_18960 9452 7302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 9826 9533 gene locus_tag LOCUS_18970 9826 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 10471 9833 gene locus_tag LOCUS_18980 10471 9833 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_18980 11077 10502 gene locus_tag LOCUS_18990 11077 10502 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_18990 11909 11235 gene locus_tag LOCUS_19000 11909 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 12650 12114 gene locus_tag LOCUS_19010 12650 12114 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929789.1 protein_id gnl|my_center|LOCUS_19010 13795 12848 gene locus_tag LOCUS_19020 gene cysK 13795 12848 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_19020 >Feature sequence090 1985 456 gene locus_tag LOCUS_19030 1985 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 2290 2958 gene locus_tag LOCUS_19040 2290 2958 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_19040 3020 3535 gene locus_tag LOCUS_19050 3020 3535 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_19050 4474 3602 gene locus_tag LOCUS_19060 4474 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_19060 5090 4491 gene locus_tag LOCUS_19070 5090 4491 CDS product DUF1517 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141514.1 protein_id gnl|my_center|LOCUS_19070 5509 6498 gene locus_tag LOCUS_19080 gene hpnH 5509 6498 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_19080 7873 6500 gene locus_tag LOCUS_19090 7873 6500 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_19090 8446 7997 gene locus_tag LOCUS_19100 gene ndk 8446 7997 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_19100 9589 8783 gene locus_tag LOCUS_19110 9589 8783 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_19110 9613 9777 gene locus_tag LOCUS_19120 9613 9777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 12974 10353 gene locus_tag LOCUS_19130 12974 10353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 13219 14274 gene locus_tag LOCUS_19140 13219 14274 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_19140 >Feature sequence091 1952 537 gene locus_tag LOCUS_19150 gene argH 1952 537 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_19150 2997 2386 gene locus_tag LOCUS_19160 2997 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 3328 3005 gene locus_tag LOCUS_19170 3328 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3644 4501 gene locus_tag LOCUS_19180 3644 4501 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142304.1 protein_id gnl|my_center|LOCUS_19180 4665 5729 gene locus_tag LOCUS_19190 4665 5729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 6561 5809 gene locus_tag LOCUS_19200 6561 5809 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_19200 6768 7445 gene locus_tag LOCUS_19210 6768 7445 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090466.1 protein_id gnl|my_center|LOCUS_19210 8097 7465 gene locus_tag LOCUS_19220 8097 7465 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056571.1 protein_id gnl|my_center|LOCUS_19220 8566 10770 gene locus_tag LOCUS_19230 8566 10770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 10794 12305 gene locus_tag LOCUS_19240 10794 12305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 12855 13856 gene locus_tag LOCUS_19250 12855 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 >Feature sequence092 576 791 gene locus_tag LOCUS_19260 576 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_19260 1709 888 gene locus_tag LOCUS_19270 1709 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 1857 2741 gene locus_tag LOCUS_19280 1857 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 2732 2947 gene locus_tag LOCUS_19290 2732 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 4118 2901 gene locus_tag LOCUS_19300 gene chlP 4118 2901 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_19300 6285 4606 gene locus_tag LOCUS_19310 6285 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 7890 6796 gene locus_tag LOCUS_19320 7890 6796 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_19320 9049 8054 gene locus_tag LOCUS_19330 9049 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 9341 9129 gene locus_tag LOCUS_19340 9341 9129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 9519 9325 gene locus_tag LOCUS_19350 9519 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 9644 9663 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10491 9775 gene locus_tag LOCUS_19360 gene fabG 10491 9775 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_19360 11694 10504 gene locus_tag LOCUS_19370 11694 10504 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228024.1 protein_id gnl|my_center|LOCUS_19370 11914 13071 gene locus_tag LOCUS_19380 11914 13071 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339450.1 protein_id gnl|my_center|LOCUS_19380 13853 13539 gene locus_tag LOCUS_19390 13853 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence093 1912 239 gene locus_tag LOCUS_19400 gene groL 1912 239 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142891.1 protein_id gnl|my_center|LOCUS_19400 2274 3482 gene locus_tag LOCUS_19410 2274 3482 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817269.1 protein_id gnl|my_center|LOCUS_19410 3585 5342 gene locus_tag LOCUS_19420 3585 5342 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926968.1 protein_id gnl|my_center|LOCUS_19420 7373 5352 gene locus_tag LOCUS_19430 7373 5352 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144393.1 protein_id gnl|my_center|LOCUS_19430 8221 7802 gene locus_tag LOCUS_19440 8221 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 9501 8221 gene locus_tag LOCUS_19450 9501 8221 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_19450 10375 9728 gene locus_tag LOCUS_19460 10375 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 13511 10389 gene locus_tag LOCUS_19470 13511 10389 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142413.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence094 451 281 gene locus_tag LOCUS_19480 451 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 707 910 gene locus_tag LOCUS_19490 707 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1138 2517 gene locus_tag LOCUS_19500 1138 2517 CDS product folate/biopterin family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055871.1 protein_id gnl|my_center|LOCUS_19500 2921 2676 gene locus_tag LOCUS_19510 2921 2676 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_19510 3227 3027 gene locus_tag LOCUS_19520 3227 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3556 3218 gene locus_tag LOCUS_19530 3556 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 4391 3702 gene locus_tag LOCUS_19540 4391 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4589 4819 gene locus_tag LOCUS_19550 4589 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5174 7345 gene locus_tag LOCUS_19560 5174 7345 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938554.1 protein_id gnl|my_center|LOCUS_19560 7459 8928 gene locus_tag LOCUS_19570 7459 8928 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_19570 9848 8973 gene locus_tag LOCUS_19580 9848 8973 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_19580 11103 10084 gene locus_tag LOCUS_19590 11103 10084 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_19590 11538 11215 gene locus_tag LOCUS_19600 11538 11215 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_19600 11842 11531 gene locus_tag LOCUS_19610 11842 11531 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_19610 13188 12205 gene locus_tag LOCUS_19620 gene gshB 13188 12205 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_19620 13464 13204 gene locus_tag LOCUS_19630 gene grxC 13464 13204 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence095 304 77 gene locus_tag LOCUS_19640 304 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 896 1336 gene locus_tag LOCUS_19650 896 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 1909 1706 gene locus_tag LOCUS_19660 1909 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 2262 1906 gene locus_tag LOCUS_19670 2262 1906 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097692.1 protein_id gnl|my_center|LOCUS_19670 2472 2723 gene locus_tag LOCUS_19680 2472 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 2784 3047 gene locus_tag LOCUS_19690 2784 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3044 3457 gene locus_tag LOCUS_19700 3044 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 4786 3473 gene locus_tag LOCUS_19710 4786 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 6085 4895 gene locus_tag LOCUS_19720 6085 4895 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920967.1 protein_id gnl|my_center|LOCUS_19720 7001 6087 gene locus_tag LOCUS_19730 7001 6087 CDS product carotenoid biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056269.1 protein_id gnl|my_center|LOCUS_19730 7864 9297 gene locus_tag LOCUS_19740 7864 9297 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056298.1 protein_id gnl|my_center|LOCUS_19740 10941 9352 gene locus_tag LOCUS_19750 10941 9352 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057809.1 protein_id gnl|my_center|LOCUS_19750 11089 12243 gene locus_tag LOCUS_19760 11089 12243 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_19760 13048 12221 gene locus_tag LOCUS_19770 13048 12221 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_19770 >Feature sequence096 949 386 gene locus_tag LOCUS_19780 949 386 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_19780 970 1170 gene locus_tag LOCUS_19790 970 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 1919 1317 gene locus_tag LOCUS_19800 1919 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2510 1950 gene locus_tag LOCUS_19810 2510 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 2722 2528 gene locus_tag LOCUS_19820 2722 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 4352 2970 gene locus_tag LOCUS_19830 4352 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 4949 4455 gene locus_tag LOCUS_19840 4949 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 5203 4952 gene locus_tag LOCUS_19850 5203 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 6426 5212 gene locus_tag LOCUS_19860 6426 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 6524 7012 gene locus_tag LOCUS_19870 6524 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 7353 7051 gene locus_tag LOCUS_19880 7353 7051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 8216 7524 gene locus_tag LOCUS_19890 8216 7524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 8262 9626 gene locus_tag LOCUS_19900 8262 9626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 10458 10886 gene locus_tag LOCUS_19910 10458 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 11253 13622 gene locus_tag LOCUS_19920 11253 13622 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143626.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence097 783 115 gene locus_tag LOCUS_19930 gene lipB 783 115 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056676.1 protein_id gnl|my_center|LOCUS_19930 1161 1454 gene locus_tag LOCUS_19940 1161 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 1588 1824 gene locus_tag LOCUS_19950 1588 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 1809 2213 gene locus_tag LOCUS_19960 1809 2213 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_19960 2388 2648 gene locus_tag LOCUS_19970 2388 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 2898 3152 gene locus_tag LOCUS_19980 2898 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 3242 3808 gene locus_tag LOCUS_19990 3242 3808 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928692.1 protein_id gnl|my_center|LOCUS_19990 3823 3987 gene locus_tag LOCUS_20000 3823 3987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 5484 4150 gene locus_tag LOCUS_20010 5484 4150 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460095.1 protein_id gnl|my_center|LOCUS_20010 5854 5513 gene locus_tag LOCUS_20020 5854 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 6394 5903 gene locus_tag LOCUS_20030 6394 5903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_20030 6692 6883 gene locus_tag LOCUS_20040 6692 6883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 8035 6824 gene locus_tag LOCUS_20050 8035 6824 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162850918.1 protein_id gnl|my_center|LOCUS_20050 9774 8527 gene locus_tag LOCUS_20060 gene trpB 9774 8527 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058306.1 protein_id gnl|my_center|LOCUS_20060 12549 9982 gene locus_tag LOCUS_20070 12549 9982 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058103.1 protein_id gnl|my_center|LOCUS_20070 13264 13004 gene locus_tag LOCUS_20080 13264 13004 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_20080 13499 13245 gene locus_tag LOCUS_20090 13499 13245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence098 575 4561 gene locus_tag LOCUS_20100 575 4561 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056126.1 protein_id gnl|my_center|LOCUS_20100 5180 4647 gene locus_tag LOCUS_20110 5180 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5397 5128 gene locus_tag LOCUS_20120 5397 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5658 6059 gene locus_tag LOCUS_20130 5658 6059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6304 7227 gene locus_tag LOCUS_20140 6304 7227 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056938.1 protein_id gnl|my_center|LOCUS_20140 8098 7289 gene locus_tag LOCUS_20150 8098 7289 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_20150 8533 8943 gene locus_tag LOCUS_20160 8533 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 10094 8910 gene locus_tag LOCUS_20170 10094 8910 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_20170 10281 11075 gene locus_tag LOCUS_20180 10281 11075 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_20180 12812 11460 gene locus_tag LOCUS_20190 12812 11460 CDS product TIGR03279 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057484.1 protein_id gnl|my_center|LOCUS_20190 12898 13128 gene locus_tag LOCUS_20200 12898 13128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 13147 13341 gene locus_tag LOCUS_20210 13147 13341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence099 348 1580 gene locus_tag LOCUS_20220 gene aroB 348 1580 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393064.1 protein_id gnl|my_center|LOCUS_20220 1577 2380 gene locus_tag LOCUS_20230 1577 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2700 3794 gene locus_tag LOCUS_20240 2700 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 3798 4850 gene locus_tag LOCUS_20250 3798 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 5806 7182 gene locus_tag LOCUS_20260 5806 7182 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329291.1 protein_id gnl|my_center|LOCUS_20260 7239 7493 gene locus_tag LOCUS_20270 7239 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 8157 7516 gene locus_tag LOCUS_20280 8157 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_20280 8449 9495 gene locus_tag LOCUS_20290 8449 9495 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_20290 9815 9886 gene locus_tag LOCUS_t00150 9815 9886 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10008 11504 gene locus_tag LOCUS_20300 10008 11504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 12224 11529 gene locus_tag LOCUS_20310 gene trmD 12224 11529 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_20310 12598 13452 gene locus_tag LOCUS_20320 12598 13452 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence100 2146 86 gene locus_tag LOCUS_20330 2146 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2612 2896 gene locus_tag LOCUS_20340 2612 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 2886 3296 gene locus_tag LOCUS_20350 2886 3296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20350 3727 4569 gene locus_tag LOCUS_20360 3727 4569 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_20360 4919 4695 gene locus_tag LOCUS_20370 4919 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940650.1 protein_id gnl|my_center|LOCUS_20370 5178 4909 gene locus_tag LOCUS_20380 5178 4909 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589156.1 protein_id gnl|my_center|LOCUS_20380 5547 5474 gene locus_tag LOCUS_t00160 5547 5474 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7492 5639 gene locus_tag LOCUS_20390 7492 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 8230 9933 gene locus_tag LOCUS_20400 gene hflX 8230 9933 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_20400 11376 10264 gene locus_tag LOCUS_20410 11376 10264 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_20410 11503 12279 gene locus_tag LOCUS_20420 gene fetB 11503 12279 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_20420 13413 12397 gene locus_tag LOCUS_20430 13413 12397 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140533.1 protein_id gnl|my_center|LOCUS_20430 >Feature sequence101 658 3627 gene locus_tag LOCUS_20440 gene pruA 658 3627 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056271.1 protein_id gnl|my_center|LOCUS_20440 3936 5570 gene locus_tag LOCUS_20450 3936 5570 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_20450 6049 5639 gene locus_tag LOCUS_20460 6049 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 7391 6039 gene locus_tag LOCUS_20470 7391 6039 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_20470 8092 7388 gene locus_tag LOCUS_20480 8092 7388 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_20480 8695 8381 gene locus_tag LOCUS_20490 8695 8381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 8990 8682 gene locus_tag LOCUS_20500 8990 8682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 9186 10442 gene locus_tag LOCUS_20510 9186 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 10619 12583 gene locus_tag LOCUS_20520 10619 12583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 12588 12809 gene locus_tag LOCUS_20530 12588 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence102 185 667 gene locus_tag LOCUS_20540 185 667 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_20540 3353 1152 gene locus_tag LOCUS_20550 3353 1152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056743.1 protein_id gnl|my_center|LOCUS_20550 3311 3619 gene locus_tag LOCUS_20560 3311 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 3901 7542 gene locus_tag LOCUS_20570 gene cobN 3901 7542 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056744.1 protein_id gnl|my_center|LOCUS_20570 7617 8906 gene locus_tag LOCUS_20580 7617 8906 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035889.1 protein_id gnl|my_center|LOCUS_20580 8911 9573 gene locus_tag LOCUS_20590 8911 9573 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986868.1 protein_id gnl|my_center|LOCUS_20590 10263 10811 gene locus_tag LOCUS_20600 gene rplJ 10263 10811 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_20600 10855 11250 gene locus_tag LOCUS_20610 gene rplL 10855 11250 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141601.1 protein_id gnl|my_center|LOCUS_20610 11578 12093 gene locus_tag LOCUS_20620 gene nrdR 11578 12093 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_20620 12326 13318 gene locus_tag LOCUS_20630 12326 13318 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057881.1 protein_id gnl|my_center|LOCUS_20630 >Feature sequence103 237 890 gene locus_tag LOCUS_20640 237 890 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_20640 1110 2249 gene locus_tag LOCUS_20650 1110 2249 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_20650 2364 2843 gene locus_tag LOCUS_20660 gene fabZ 2364 2843 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057628.1 protein_id gnl|my_center|LOCUS_20660 2847 3614 gene locus_tag LOCUS_20670 2847 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4075 3611 gene locus_tag LOCUS_20680 4075 3611 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143783.1 protein_id gnl|my_center|LOCUS_20680 4962 4144 gene locus_tag LOCUS_20690 4962 4144 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_20690 5835 5041 gene locus_tag LOCUS_20700 5835 5041 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_20700 6312 7370 gene locus_tag LOCUS_20710 gene nagA 6312 7370 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_20710 7769 7326 gene locus_tag LOCUS_20720 7769 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 9029 8016 gene locus_tag LOCUS_20730 9029 8016 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532977.1 protein_id gnl|my_center|LOCUS_20730 9575 9258 gene locus_tag LOCUS_20740 9575 9258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056366.1 protein_id gnl|my_center|LOCUS_20740 10282 9722 gene locus_tag LOCUS_20750 10282 9722 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_20750 10483 10800 gene locus_tag LOCUS_20760 gene grxC 10483 10800 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_20760 10785 11273 gene locus_tag LOCUS_20770 10785 11273 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_20770 11361 11543 gene locus_tag LOCUS_20780 11361 11543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 11816 12118 gene locus_tag LOCUS_20790 11816 12118 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958263.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence104 4591 158 gene locus_tag LOCUS_20800 4591 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 5883 6152 gene locus_tag LOCUS_20810 5883 6152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 6149 6550 gene locus_tag LOCUS_20820 6149 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 7922 6813 gene locus_tag LOCUS_20830 7922 6813 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524107.1 protein_id gnl|my_center|LOCUS_20830 8500 7943 gene locus_tag LOCUS_20840 8500 7943 CDS product Ycf51 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056935.1 protein_id gnl|my_center|LOCUS_20840 8477 9094 gene locus_tag LOCUS_20850 8477 9094 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_20850 9354 9671 gene locus_tag LOCUS_20860 9354 9671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 9668 10030 gene locus_tag LOCUS_20870 9668 10030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 10030 10722 gene locus_tag LOCUS_20880 gene queC 10030 10722 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_20880 11321 10749 gene locus_tag LOCUS_20890 11321 10749 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_20890 11885 12838 gene locus_tag LOCUS_20900 11885 12838 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056398.1 protein_id gnl|my_center|LOCUS_20900 >Feature sequence105 118 786 gene locus_tag LOCUS_20910 gene phoU 118 786 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583268.1 protein_id gnl|my_center|LOCUS_20910 1604 813 gene locus_tag LOCUS_20920 1604 813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_20920 1946 1758 gene locus_tag LOCUS_20930 1946 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 1995 2471 gene locus_tag LOCUS_20940 gene ndhN 1995 2471 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_20940 2880 2593 gene locus_tag LOCUS_20950 2880 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3177 4619 gene locus_tag LOCUS_20960 gene gltX 3177 4619 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056357.1 protein_id gnl|my_center|LOCUS_20960 5329 6411 gene locus_tag LOCUS_20970 5329 6411 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388802.1 protein_id gnl|my_center|LOCUS_20970 6542 7954 gene locus_tag LOCUS_20980 6542 7954 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057779.1 protein_id gnl|my_center|LOCUS_20980 7954 8826 gene locus_tag LOCUS_20990 7954 8826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 9286 9627 gene locus_tag LOCUS_21000 9286 9627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 9684 10478 gene locus_tag LOCUS_21010 9684 10478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 10552 11328 gene locus_tag LOCUS_21020 10552 11328 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142041.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence106 956 531 gene locus_tag LOCUS_21030 956 531 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_21030 3260 1314 gene locus_tag LOCUS_21040 3260 1314 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_21040 3967 3530 gene locus_tag LOCUS_21050 3967 3530 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_21050 4200 3967 gene locus_tag LOCUS_21060 4200 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 4532 4257 gene locus_tag LOCUS_21070 4532 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 5490 4681 gene locus_tag LOCUS_21080 5490 4681 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920882.1 protein_id gnl|my_center|LOCUS_21080 6139 5552 gene locus_tag LOCUS_21090 6139 5552 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_21090 6897 6397 gene locus_tag LOCUS_21100 6897 6397 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_21100 8288 6900 gene locus_tag LOCUS_21110 8288 6900 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_21110 9046 9723 gene locus_tag LOCUS_21120 9046 9723 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_21120 9900 12947 gene locus_tag LOCUS_21130 9900 12947 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_21130 >Feature sequence107 2074 428 gene locus_tag LOCUS_21140 2074 428 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140397.1 protein_id gnl|my_center|LOCUS_21140 2220 2543 gene locus_tag LOCUS_21150 2220 2543 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_21150 3680 2544 gene locus_tag LOCUS_21160 3680 2544 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_21160 3853 4296 gene locus_tag LOCUS_21170 3853 4296 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_21170 4265 5089 gene locus_tag LOCUS_21180 4265 5089 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_21180 5472 6023 gene locus_tag LOCUS_21190 5472 6023 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_21190 7265 6090 gene locus_tag LOCUS_21200 7265 6090 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057862.1 protein_id gnl|my_center|LOCUS_21200 7303 8493 gene locus_tag LOCUS_21210 7303 8493 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_21210 8601 9350 gene locus_tag LOCUS_21220 8601 9350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 9981 9592 gene locus_tag LOCUS_21230 9981 9592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056454.1 protein_id gnl|my_center|LOCUS_21230 10143 11240 gene locus_tag LOCUS_21240 gene queA 10143 11240 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_21240 11403 13112 gene locus_tag LOCUS_21250 11403 13112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence108 268 35 gene locus_tag LOCUS_21260 268 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 1467 367 gene locus_tag LOCUS_21270 1467 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 2020 3627 gene locus_tag LOCUS_21280 2020 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 5965 4121 gene locus_tag LOCUS_21290 5965 4121 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530091.1 protein_id gnl|my_center|LOCUS_21290 7950 6049 gene locus_tag LOCUS_21300 gene arsA 7950 6049 CDS product arsenical pump-driving ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461627.1 protein_id gnl|my_center|LOCUS_21300 8646 7963 gene locus_tag LOCUS_21310 8646 7963 CDS product GvpL/GvpF family gas vesicle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928988.1 protein_id gnl|my_center|LOCUS_21310 8787 9071 gene locus_tag LOCUS_21320 8787 9071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 9489 9226 gene locus_tag LOCUS_21330 9489 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 10238 9504 gene locus_tag LOCUS_21340 10238 9504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 10727 10254 gene locus_tag LOCUS_21350 10727 10254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 11285 11013 gene locus_tag LOCUS_21360 11285 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 11700 11278 gene locus_tag LOCUS_21370 11700 11278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 12759 11719 gene locus_tag LOCUS_21380 12759 11719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence109 247 1416 gene locus_tag LOCUS_21390 247 1416 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_21390 2348 1485 gene locus_tag LOCUS_21400 2348 1485 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142464.1 protein_id gnl|my_center|LOCUS_21400 2610 4613 gene locus_tag LOCUS_21410 2610 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5248 5562 gene locus_tag LOCUS_21420 5248 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 5809 6228 gene locus_tag LOCUS_21430 5809 6228 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391723.1 protein_id gnl|my_center|LOCUS_21430 6270 6668 gene locus_tag LOCUS_21440 6270 6668 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_21440 6661 7119 gene locus_tag LOCUS_21450 6661 7119 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174492.1 protein_id gnl|my_center|LOCUS_21450 7123 7557 gene locus_tag LOCUS_21460 7123 7557 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545804.1 protein_id gnl|my_center|LOCUS_21460 7550 11002 gene locus_tag LOCUS_21470 7550 11002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 11054 12055 gene locus_tag LOCUS_21480 11054 12055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 12069 12767 gene locus_tag LOCUS_21490 12069 12767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence110 1306 314 gene locus_tag LOCUS_21500 1306 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2220 2558 gene locus_tag LOCUS_21510 gene psb28 2220 2558 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_21510 3141 2623 gene locus_tag LOCUS_21520 3141 2623 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140843.1 protein_id gnl|my_center|LOCUS_21520 3471 3148 gene locus_tag LOCUS_21530 3471 3148 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_21530 5309 3486 gene locus_tag LOCUS_21540 5309 3486 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_21540 5820 5320 gene locus_tag LOCUS_21550 5820 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 7352 5805 gene locus_tag LOCUS_21560 7352 5805 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_21560 7640 7945 gene locus_tag LOCUS_21570 7640 7945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 7955 9250 gene locus_tag LOCUS_21580 7955 9250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 9783 10232 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggcgtggtgtcgggcgtggtgtggggcgtg 10608 12596 gene locus_tag LOCUS_21590 10608 12596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 >Feature sequence111 465 190 gene locus_tag LOCUS_21600 465 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 697 1374 gene locus_tag LOCUS_21610 697 1374 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_21610 1697 2305 gene locus_tag LOCUS_21620 1697 2305 CDS product PEP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921553.1 protein_id gnl|my_center|LOCUS_21620 3542 3892 gene locus_tag LOCUS_21630 3542 3892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 4112 5764 gene locus_tag LOCUS_21640 4112 5764 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_21640 7136 5889 gene locus_tag LOCUS_21650 7136 5889 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057902.1 protein_id gnl|my_center|LOCUS_21650 7567 8904 gene locus_tag LOCUS_21660 7567 8904 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_21660 9715 9413 gene locus_tag LOCUS_21670 9715 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 9788 9976 gene locus_tag LOCUS_21680 9788 9976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 12513 11008 gene locus_tag LOCUS_21690 gene crtD 12513 11008 CDS product C-3',4' desaturase CrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056087.1 protein_id gnl|my_center|LOCUS_21690 >Feature sequence112 >Feature sequence113 394 2898 gene locus_tag LOCUS_21700 394 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 2903 3091 gene locus_tag LOCUS_21710 2903 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 3127 3489 gene locus_tag LOCUS_21720 3127 3489 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21720 3613 3861 gene locus_tag LOCUS_21730 3613 3861 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_21730 3858 4226 gene locus_tag LOCUS_21740 3858 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 4466 4789 gene locus_tag LOCUS_21750 4466 4789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 4793 5137 gene locus_tag LOCUS_21760 4793 5137 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142157.1 protein_id gnl|my_center|LOCUS_21760 5149 5397 gene locus_tag LOCUS_21770 5149 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 5553 6614 gene locus_tag LOCUS_21780 5553 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 6695 7321 gene locus_tag LOCUS_21790 6695 7321 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_21790 7977 7318 gene locus_tag LOCUS_21800 7977 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 8328 9299 gene locus_tag LOCUS_21810 gene sds 8328 9299 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_21810 9841 9296 gene locus_tag LOCUS_21820 9841 9296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056601.1 protein_id gnl|my_center|LOCUS_21820 10313 11953 gene locus_tag LOCUS_21830 gene cimA 10313 11953 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056694.1 protein_id gnl|my_center|LOCUS_21830 12590 12096 gene locus_tag LOCUS_21840 12590 12096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence114 277 2388 gene locus_tag LOCUS_21850 gene recQ 277 2388 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_21850 2742 2545 gene locus_tag LOCUS_21860 2742 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3432 4880 gene locus_tag LOCUS_21870 gene atpD 3432 4880 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056375.1 protein_id gnl|my_center|LOCUS_21870 4955 5371 gene locus_tag LOCUS_21880 gene atpC 4955 5371 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_21880 5536 6417 gene locus_tag LOCUS_21890 5536 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 7074 6751 gene locus_tag LOCUS_21900 7074 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 7178 7600 gene locus_tag LOCUS_21910 7178 7600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 7597 7860 gene locus_tag LOCUS_21920 7597 7860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 7906 8973 gene locus_tag LOCUS_21930 gene mraY 7906 8973 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_21930 9297 8974 gene locus_tag LOCUS_21940 9297 8974 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_21940 9665 9955 gene locus_tag LOCUS_21950 9665 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 10052 10285 gene locus_tag LOCUS_21960 10052 10285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 <12634 10462 gene locus_tag LOCUS_21970 <12634 10462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein >Feature sequence115 242 880 gene locus_tag LOCUS_21980 242 880 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_21980 1185 1787 gene locus_tag LOCUS_21990 1185 1787 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_21990 2828 1893 gene locus_tag LOCUS_22000 2828 1893 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_22000 3015 3506 gene locus_tag LOCUS_22010 3015 3506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4550 4170 gene locus_tag LOCUS_22020 4550 4170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_22020 6077 5025 gene locus_tag LOCUS_22030 6077 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 7630 6587 gene locus_tag LOCUS_22040 7630 6587 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_22040 7866 7642 gene locus_tag LOCUS_22050 7866 7642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 8376 7909 gene locus_tag LOCUS_22060 8376 7909 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057639.1 protein_id gnl|my_center|LOCUS_22060 8538 9104 gene locus_tag LOCUS_22070 8538 9104 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_22070 9176 10024 gene locus_tag LOCUS_22080 gene nadC 9176 10024 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_22080 11017 10220 gene locus_tag LOCUS_22090 11017 10220 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_22090 11152 11313 gene locus_tag LOCUS_22100 11152 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 11626 12081 gene locus_tag LOCUS_22110 11626 12081 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929341.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence116 168 848 gene locus_tag LOCUS_22120 168 848 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_22120 1120 1992 gene locus_tag LOCUS_22130 1120 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142558.1 protein_id gnl|my_center|LOCUS_22130 2056 2127 gene locus_tag LOCUS_t00170 2056 2127 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2157 2759 gene locus_tag LOCUS_22140 gene tsaB 2157 2759 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_22140 4415 2760 gene locus_tag LOCUS_22150 4415 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 4630 5403 gene locus_tag LOCUS_22160 gene cysE 4630 5403 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_22160 5605 8484 gene locus_tag LOCUS_22170 gene uvrA 5605 8484 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524117.1 protein_id gnl|my_center|LOCUS_22170 9250 8474 gene locus_tag LOCUS_22180 9250 8474 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202282.1 protein_id gnl|my_center|LOCUS_22180 9527 9243 gene locus_tag LOCUS_22190 9527 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 >Feature sequence117 503 754 gene locus_tag LOCUS_22200 503 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 2030 867 gene locus_tag LOCUS_22210 gene hemH 2030 867 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_22210 2150 2773 gene locus_tag LOCUS_22220 2150 2773 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_22220 2890 3444 gene locus_tag LOCUS_22230 2890 3444 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_22230 3808 4593 gene locus_tag LOCUS_22240 3808 4593 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891922.1 protein_id gnl|my_center|LOCUS_22240 4622 5410 gene locus_tag LOCUS_22250 4622 5410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 6732 5740 gene locus_tag LOCUS_22260 gene ilvC 6732 5740 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_22260 7244 8359 gene locus_tag LOCUS_22270 gene pilM 7244 8359 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_22270 8369 9139 gene locus_tag LOCUS_22280 8369 9139 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_22280 9136 9909 gene locus_tag LOCUS_22290 9136 9909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 9983 12064 gene locus_tag LOCUS_22300 9983 12064 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058177.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence118 884 132 gene locus_tag LOCUS_22310 884 132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294685.1 protein_id gnl|my_center|LOCUS_22310 2921 945 gene locus_tag LOCUS_22320 2921 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3070 3696 gene locus_tag LOCUS_22330 3070 3696 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_22330 5024 3978 gene locus_tag LOCUS_22340 5024 3978 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142088.1 protein_id gnl|my_center|LOCUS_22340 7030 5024 gene locus_tag LOCUS_22350 7030 5024 CDS product nitrate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057192.1 protein_id gnl|my_center|LOCUS_22350 7998 7171 gene locus_tag LOCUS_22360 gene ntrB 7998 7171 CDS product nitrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142085.1 protein_id gnl|my_center|LOCUS_22360 9538 8216 gene locus_tag LOCUS_22370 9538 8216 CDS product CmpA/NrtA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057190.1 protein_id gnl|my_center|LOCUS_22370 10666 11832 gene locus_tag LOCUS_22380 10666 11832 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_22380 12031 11834 gene locus_tag LOCUS_22390 12031 11834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence119 933 469 gene locus_tag LOCUS_22400 933 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2523 1006 gene locus_tag LOCUS_22410 2523 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 3809 2715 gene locus_tag LOCUS_22420 3809 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 4922 4749 gene locus_tag LOCUS_22430 4922 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 4999 5163 gene locus_tag LOCUS_22440 4999 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 7709 5355 gene locus_tag LOCUS_22450 7709 5355 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_22450 8277 7834 gene locus_tag LOCUS_22460 8277 7834 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056063.1 protein_id gnl|my_center|LOCUS_22460 9087 8506 gene locus_tag LOCUS_22470 9087 8506 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056337.1 protein_id gnl|my_center|LOCUS_22470 10142 9084 gene locus_tag LOCUS_22480 10142 9084 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_22480 10315 10139 gene locus_tag LOCUS_22490 10315 10139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 10520 11074 gene locus_tag LOCUS_22500 10520 11074 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_22500 11995 11153 gene locus_tag LOCUS_22510 11995 11153 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_22510 >Feature sequence120 290 1552 gene locus_tag LOCUS_22520 290 1552 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_22520 1615 1869 gene locus_tag LOCUS_22530 1615 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 3054 1858 gene locus_tag LOCUS_22540 3054 1858 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_22540 3257 4183 gene locus_tag LOCUS_22550 3257 4183 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_22550 4198 4851 gene locus_tag LOCUS_22560 4198 4851 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889576.1 protein_id gnl|my_center|LOCUS_22560 5088 5711 gene locus_tag LOCUS_22570 5088 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 6832 5828 gene locus_tag LOCUS_22580 6832 5828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 7035 7670 gene locus_tag LOCUS_22590 7035 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 7912 8619 gene locus_tag LOCUS_22600 7912 8619 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_22600 8888 11638 gene locus_tag LOCUS_22610 8888 11638 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142684.1 protein_id gnl|my_center|LOCUS_22610 >Feature sequence121 258 2891 gene locus_tag LOCUS_22620 gene cphA 258 2891 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058004.1 protein_id gnl|my_center|LOCUS_22620 2923 5574 gene locus_tag LOCUS_22630 2923 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6452 5808 gene locus_tag LOCUS_22640 6452 5808 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_22640 7190 6462 gene locus_tag LOCUS_22650 7190 6462 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929702.1 protein_id gnl|my_center|LOCUS_22650 7358 7206 gene locus_tag LOCUS_22660 7358 7206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 7424 8950 gene locus_tag LOCUS_22670 gene radA 7424 8950 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_22670 9170 9625 gene locus_tag LOCUS_22680 9170 9625 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_22680 9638 10093 gene locus_tag LOCUS_22690 9638 10093 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_22690 10105 10560 gene locus_tag LOCUS_22700 10105 10560 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_22700 10573 11031 gene locus_tag LOCUS_22710 10573 11031 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_22710 11024 11953 gene locus_tag LOCUS_22720 11024 11953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence122 425 778 gene locus_tag LOCUS_22730 425 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 1420 833 gene locus_tag LOCUS_22740 1420 833 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107734.1 protein_id gnl|my_center|LOCUS_22740 2824 1616 gene locus_tag LOCUS_22750 2824 1616 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107732.1 protein_id gnl|my_center|LOCUS_22750 3611 2829 gene locus_tag LOCUS_22760 3611 2829 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115101.1 protein_id gnl|my_center|LOCUS_22760 4726 3608 gene locus_tag LOCUS_22770 4726 3608 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117847.1 protein_id gnl|my_center|LOCUS_22770 5266 4736 gene locus_tag LOCUS_22780 5266 4736 CDS product DUF4242 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000171919.1 protein_id gnl|my_center|LOCUS_22780 5637 7040 gene locus_tag LOCUS_22790 5637 7040 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058264.1 protein_id gnl|my_center|LOCUS_22790 8471 7032 gene locus_tag LOCUS_22800 8471 7032 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393748.1 protein_id gnl|my_center|LOCUS_22800 10460 8646 gene locus_tag LOCUS_22810 10460 8646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056407.1 protein_id gnl|my_center|LOCUS_22810 11577 10501 gene locus_tag LOCUS_22820 11577 10501 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057861.1 protein_id gnl|my_center|LOCUS_22820 11990 11613 gene locus_tag LOCUS_22830 11990 11613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence123 325 618 gene locus_tag LOCUS_22840 325 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 800 982 gene locus_tag LOCUS_22850 800 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1041 1301 gene locus_tag LOCUS_22860 1041 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1536 1715 gene locus_tag LOCUS_22870 1536 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 2133 3746 gene locus_tag LOCUS_22880 2133 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 5974 3941 gene locus_tag LOCUS_22890 5974 3941 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058192.1 protein_id gnl|my_center|LOCUS_22890 6318 7445 gene locus_tag LOCUS_22900 gene ychF 6318 7445 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057426.1 protein_id gnl|my_center|LOCUS_22900 7930 9963 gene locus_tag LOCUS_22910 7930 9963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 10244 11143 gene locus_tag LOCUS_22920 10244 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 11270 11581 gene locus_tag LOCUS_22930 11270 11581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 11574 11993 gene locus_tag LOCUS_22940 11574 11993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence124 52 831 gene locus_tag LOCUS_22950 52 831 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142987.1 protein_id gnl|my_center|LOCUS_22950 902 1969 gene locus_tag LOCUS_22960 902 1969 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545331.1 protein_id gnl|my_center|LOCUS_22960 2148 3572 gene locus_tag LOCUS_22970 2148 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 3620 4894 gene locus_tag LOCUS_22980 3620 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 4920 5609 gene locus_tag LOCUS_22990 4920 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 5668 6732 gene locus_tag LOCUS_23000 5668 6732 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_23000 6743 8968 gene locus_tag LOCUS_23010 6743 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 9083 9009 gene locus_tag LOCUS_t00180 9083 9009 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9214 9765 gene locus_tag LOCUS_23020 9214 9765 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201440.1 protein_id gnl|my_center|LOCUS_23020 10839 10309 gene locus_tag LOCUS_23030 10839 10309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 12008 10872 gene locus_tag LOCUS_23040 12008 10872 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_23040 >Feature sequence125 1124 114 gene locus_tag LOCUS_23050 gene prfB 1124 114 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126988096.1 protein_id gnl|my_center|LOCUS_23050 2613 1501 gene locus_tag LOCUS_23060 2613 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 2775 4124 gene locus_tag LOCUS_23070 gene murD 2775 4124 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_23070 4319 6970 gene locus_tag LOCUS_23080 4319 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 7161 7376 gene locus_tag LOCUS_23090 gene ndhO 7161 7376 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055872.1 protein_id gnl|my_center|LOCUS_23090 7403 8380 gene locus_tag LOCUS_23100 gene mdh 7403 8380 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_23100 9508 8381 gene locus_tag LOCUS_23110 9508 8381 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_23110 10291 9941 gene locus_tag LOCUS_23120 10291 9941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 10857 10687 gene locus_tag LOCUS_23130 10857 10687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 10796 11455 gene locus_tag LOCUS_23140 10796 11455 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056123.1 protein_id gnl|my_center|LOCUS_23140 11491 11988 gene locus_tag LOCUS_23150 11491 11988 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125616.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence126 1338 268 gene locus_tag LOCUS_23160 1338 268 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_23160 1999 1631 gene locus_tag LOCUS_23170 1999 1631 CDS product DUF1818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_23170 2485 2006 gene locus_tag LOCUS_23180 2485 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 3840 2743 gene locus_tag LOCUS_23190 3840 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 3971 4630 gene locus_tag LOCUS_23200 3971 4630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 4631 4927 gene locus_tag LOCUS_23210 4631 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 5364 5984 gene locus_tag LOCUS_23220 5364 5984 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157768333.1 protein_id gnl|my_center|LOCUS_23220 8056 6017 gene locus_tag LOCUS_23230 8056 6017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 8141 9148 gene locus_tag LOCUS_23240 8141 9148 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_23240 10379 10546 gene locus_tag LOCUS_23250 10379 10546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 11293 11511 gene locus_tag LOCUS_23260 11293 11511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 11786 11634 gene locus_tag LOCUS_23270 11786 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence127 534 902 gene locus_tag LOCUS_23280 534 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_23280 899 1912 gene locus_tag LOCUS_23290 899 1912 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_23290 3745 2087 gene locus_tag LOCUS_23300 3745 2087 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_23300 4486 3758 gene locus_tag LOCUS_23310 4486 3758 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_23310 5049 4483 gene locus_tag LOCUS_23320 5049 4483 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_23320 5822 5382 gene locus_tag LOCUS_23330 5822 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 6061 5825 gene locus_tag LOCUS_23340 6061 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23340 6082 6276 gene locus_tag LOCUS_23350 6082 6276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 7431 6349 gene locus_tag LOCUS_23360 7431 6349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 8030 8269 gene locus_tag LOCUS_23370 8030 8269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 8453 8857 gene locus_tag LOCUS_23380 8453 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 8899 11208 gene locus_tag LOCUS_23390 8899 11208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 11725 11925 gene locus_tag LOCUS_23400 11725 11925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 >Feature sequence128 1812 151 gene locus_tag LOCUS_23410 1812 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 2391 1924 gene locus_tag LOCUS_23420 2391 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 4455 2443 gene locus_tag LOCUS_23430 4455 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 6045 4825 gene locus_tag LOCUS_23440 6045 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 8125 6056 gene locus_tag LOCUS_23450 8125 6056 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_23450 >Feature sequence129 183 584 gene locus_tag LOCUS_23460 183 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_23460 976 2451 gene locus_tag LOCUS_23470 976 2451 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057553.1 protein_id gnl|my_center|LOCUS_23470 2461 2700 gene locus_tag LOCUS_23480 2461 2700 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_23480 2988 3605 gene locus_tag LOCUS_23490 2988 3605 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_23490 4411 3707 gene locus_tag LOCUS_23500 4411 3707 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144068.1 protein_id gnl|my_center|LOCUS_23500 4428 5198 gene locus_tag LOCUS_23510 4428 5198 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_23510 5259 6134 gene locus_tag LOCUS_23520 5259 6134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 7301 6363 gene locus_tag LOCUS_23530 7301 6363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 7946 7317 gene locus_tag LOCUS_23540 7946 7317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529035.1 protein_id gnl|my_center|LOCUS_23540 9093 7993 gene locus_tag LOCUS_23550 9093 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 9930 9130 gene locus_tag LOCUS_23560 9930 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 9954 10445 gene locus_tag LOCUS_23570 9954 10445 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937385.1 protein_id gnl|my_center|LOCUS_23570 11530 10643 gene locus_tag LOCUS_23580 11530 10643 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_23580 >Feature sequence130 1059 1385 gene locus_tag LOCUS_23590 1059 1385 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_23590 1382 1711 gene locus_tag LOCUS_23600 1382 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1781 2809 gene locus_tag LOCUS_23610 gene obgE 1781 2809 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_23610 3184 2819 gene locus_tag LOCUS_23620 3184 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 3425 3177 gene locus_tag LOCUS_23630 3425 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 3761 3519 gene locus_tag LOCUS_23640 3761 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 4382 3825 gene locus_tag LOCUS_23650 4382 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 4916 4431 gene locus_tag LOCUS_23660 4916 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 6245 4947 gene locus_tag LOCUS_23670 6245 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 7628 6537 gene locus_tag LOCUS_23680 gene rfbB 7628 6537 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_23680 8586 7660 gene locus_tag LOCUS_23690 8586 7660 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_23690 9560 8844 gene locus_tag LOCUS_23700 gene purQ 9560 8844 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_23700 10030 9758 gene locus_tag LOCUS_23710 gene purS 10030 9758 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_23710 10062 10445 gene locus_tag LOCUS_23720 10062 10445 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_23720 11481 10531 gene locus_tag LOCUS_23730 gene accD 11481 10531 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_23730 11709 11500 gene locus_tag LOCUS_23740 11709 11500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 >Feature sequence131 117 3182 gene locus_tag LOCUS_23750 117 3182 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142489.1 protein_id gnl|my_center|LOCUS_23750 3234 4226 gene locus_tag LOCUS_23760 3234 4226 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_23760 4799 4987 gene locus_tag LOCUS_23770 4799 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 5174 5980 gene locus_tag LOCUS_23780 5174 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022977.1 protein_id gnl|my_center|LOCUS_23780 6104 6331 gene locus_tag LOCUS_23790 6104 6331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 7217 6369 gene locus_tag LOCUS_23800 7217 6369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 7987 7226 gene locus_tag LOCUS_23810 7987 7226 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_23810 8694 8014 gene locus_tag LOCUS_23820 8694 8014 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056503.1 protein_id gnl|my_center|LOCUS_23820 9261 9512 gene locus_tag LOCUS_23830 9261 9512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 9521 9952 gene locus_tag LOCUS_23840 9521 9952 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227761.1 protein_id gnl|my_center|LOCUS_23840 10176 10376 gene locus_tag LOCUS_23850 10176 10376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 10363 10509 gene locus_tag LOCUS_23860 10363 10509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 10558 10788 gene locus_tag LOCUS_23870 10558 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 10778 11161 gene locus_tag LOCUS_23880 10778 11161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 >Feature sequence132 1336 1163 gene locus_tag LOCUS_23890 1336 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 4815 1606 gene locus_tag LOCUS_23900 4815 1606 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064958.1 protein_id gnl|my_center|LOCUS_23900 6003 6809 gene locus_tag LOCUS_23910 gene aqpZ 6003 6809 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_23910 7317 6847 gene locus_tag LOCUS_23920 gene tsaE 7317 6847 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_23920 7658 8857 gene locus_tag LOCUS_23930 7658 8857 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_23930 10434 8854 gene locus_tag LOCUS_23940 10434 8854 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056886.1 protein_id gnl|my_center|LOCUS_23940 11030 10632 gene locus_tag LOCUS_23950 gene rbfA 11030 10632 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_23950 11269 11072 gene locus_tag LOCUS_23960 11269 11072 CDS product DUF751 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057323.1 protein_id gnl|my_center|LOCUS_23960 >Feature sequence133 386 1663 gene locus_tag LOCUS_23970 386 1663 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_23970 1667 2926 gene locus_tag LOCUS_23980 1667 2926 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142579.1 protein_id gnl|my_center|LOCUS_23980 3051 2978 gene locus_tag LOCUS_t00190 3051 2978 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 3405 3674 gene locus_tag LOCUS_23990 3405 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 4342 4560 gene locus_tag LOCUS_24000 4342 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 4553 4837 gene locus_tag LOCUS_24010 4553 4837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 5036 5269 gene locus_tag LOCUS_24020 5036 5269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 5266 5607 gene locus_tag LOCUS_24030 5266 5607 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250020.1 protein_id gnl|my_center|LOCUS_24030 5917 6915 gene locus_tag LOCUS_24040 5917 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 7569 7072 gene locus_tag LOCUS_24050 7569 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24050 7730 9256 gene locus_tag LOCUS_24060 7730 9256 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967310.1 protein_id gnl|my_center|LOCUS_24060 9590 9997 gene locus_tag LOCUS_24070 9590 9997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 10058 10774 gene locus_tag LOCUS_24080 gene pdaB 10058 10774 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000945995.1 protein_id gnl|my_center|LOCUS_24080 11169 11435 gene locus_tag LOCUS_24090 11169 11435 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence134 473 400 gene locus_tag LOCUS_t00200 473 400 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 517 1017 gene locus_tag LOCUS_24100 gene moaC 517 1017 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087579.1 protein_id gnl|my_center|LOCUS_24100 4790 1119 gene locus_tag LOCUS_24110 4790 1119 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388379.1 protein_id gnl|my_center|LOCUS_24110 6691 4961 gene locus_tag LOCUS_24120 6691 4961 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141774.1 protein_id gnl|my_center|LOCUS_24120 7057 7347 gene locus_tag LOCUS_24130 7057 7347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 9736 7472 gene locus_tag LOCUS_24140 gene hypF 9736 7472 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_24140 10460 9786 gene locus_tag LOCUS_24150 10460 9786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_24150 11007 10513 gene locus_tag LOCUS_24160 11007 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 >Feature sequence135 559 768 gene locus_tag LOCUS_24170 559 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 912 1430 gene locus_tag LOCUS_24180 912 1430 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888688.1 protein_id gnl|my_center|LOCUS_24180 1700 2065 gene locus_tag LOCUS_24190 1700 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2071 2388 gene locus_tag LOCUS_24200 2071 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 2758 4665 gene locus_tag LOCUS_24210 gene shc 2758 4665 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058142.1 protein_id gnl|my_center|LOCUS_24210 5043 4726 gene locus_tag LOCUS_24220 5043 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 5239 6234 gene locus_tag LOCUS_24230 5239 6234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 6489 7394 gene locus_tag LOCUS_24240 6489 7394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7727 7437 gene locus_tag LOCUS_24250 7727 7437 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057272.1 protein_id gnl|my_center|LOCUS_24250 8344 7730 gene locus_tag LOCUS_24260 8344 7730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 8644 8856 gene locus_tag LOCUS_24270 8644 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 9003 9893 gene locus_tag LOCUS_24280 gene trpC 9003 9893 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_24280 10127 11281 gene locus_tag LOCUS_24290 10127 11281 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_24290 >Feature sequence136 339 584 gene locus_tag LOCUS_24300 339 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 581 805 gene locus_tag LOCUS_24310 581 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 795 1097 gene locus_tag LOCUS_24320 795 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24320 1868 1128 gene locus_tag LOCUS_24330 1868 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 2155 2400 gene locus_tag LOCUS_24340 2155 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 2393 2602 gene locus_tag LOCUS_24350 2393 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 3256 2804 gene locus_tag LOCUS_24360 3256 2804 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258781.1 protein_id gnl|my_center|LOCUS_24360 3492 3256 gene locus_tag LOCUS_24370 3492 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 4565 4876 gene locus_tag LOCUS_24380 4565 4876 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_24380 4943 5284 gene locus_tag LOCUS_24390 4943 5284 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_24390 5317 5628 gene locus_tag LOCUS_24400 5317 5628 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_24400 5699 7657 gene locus_tag LOCUS_24410 5699 7657 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171949.1 protein_id gnl|my_center|LOCUS_24410 7789 8451 gene locus_tag LOCUS_24420 7789 8451 CDS product carbon dioxide concentrating mechanism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142090.1 protein_id gnl|my_center|LOCUS_24420 9002 10417 gene locus_tag LOCUS_24430 9002 10417 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142153.1 protein_id gnl|my_center|LOCUS_24430 10548 10946 gene locus_tag LOCUS_24440 10548 10946 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_24440 10962 11297 gene locus_tag LOCUS_24450 10962 11297 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142155.1 protein_id gnl|my_center|LOCUS_24450 >Feature sequence137 611 2089 gene locus_tag LOCUS_24460 611 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24460 2102 3862 gene locus_tag LOCUS_24470 2102 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24470 3912 4478 gene locus_tag LOCUS_24480 3912 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228656.1 protein_id gnl|my_center|LOCUS_24480 5250 5011 gene locus_tag LOCUS_24490 5250 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 6217 5270 gene locus_tag LOCUS_24500 6217 5270 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957516.1 protein_id gnl|my_center|LOCUS_24500 6272 6484 gene locus_tag LOCUS_24510 6272 6484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 6481 6894 gene locus_tag LOCUS_24520 6481 6894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 7290 7027 gene locus_tag LOCUS_24530 7290 7027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 7618 8046 gene locus_tag LOCUS_24540 7618 8046 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228629.1 protein_id gnl|my_center|LOCUS_24540 9404 8241 gene locus_tag LOCUS_24550 gene devC 9404 8241 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141427.1 protein_id gnl|my_center|LOCUS_24550 10788 9421 gene locus_tag LOCUS_24560 10788 9421 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056492.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence138 926 177 gene locus_tag LOCUS_24570 926 177 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124783.1 protein_id gnl|my_center|LOCUS_24570 1286 1669 gene locus_tag LOCUS_24580 1286 1669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1887 1660 gene locus_tag LOCUS_24590 1887 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2159 1884 gene locus_tag LOCUS_24600 2159 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 4021 2687 gene locus_tag LOCUS_24610 4021 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 8657 4083 gene locus_tag LOCUS_24620 gene gltB 8657 4083 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_24620 9214 8867 gene locus_tag LOCUS_24630 9214 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 9492 9211 gene locus_tag LOCUS_24640 9492 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 10208 9834 gene locus_tag LOCUS_24650 10208 9834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 10500 10201 gene locus_tag LOCUS_24660 10500 10201 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_24660 11165 11001 gene locus_tag LOCUS_24670 11165 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 >Feature sequence139 1453 236 gene locus_tag LOCUS_24680 1453 236 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056036.1 protein_id gnl|my_center|LOCUS_24680 3095 1824 gene locus_tag LOCUS_24690 3095 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 4115 3660 gene locus_tag LOCUS_24700 4115 3660 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_24700 5860 4166 gene locus_tag LOCUS_24710 5860 4166 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140102.1 protein_id gnl|my_center|LOCUS_24710 5996 7639 gene locus_tag LOCUS_24720 5996 7639 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025269720.1 protein_id gnl|my_center|LOCUS_24720 8197 7622 gene locus_tag LOCUS_24730 8197 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 9267 8308 gene locus_tag LOCUS_24740 9267 8308 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_24740 9504 9313 gene locus_tag LOCUS_24750 9504 9313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 11094 9625 gene locus_tag LOCUS_24760 11094 9625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 >Feature sequence140 2066 189 gene locus_tag LOCUS_24770 gene uvrC 2066 189 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_24770 2409 2149 gene locus_tag LOCUS_24780 2409 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 3574 2489 gene locus_tag LOCUS_24790 gene leuB 3574 2489 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057439.1 protein_id gnl|my_center|LOCUS_24790 4819 3746 gene locus_tag LOCUS_24800 4819 3746 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_24800 5699 4824 gene locus_tag LOCUS_24810 gene rfbD 5699 4824 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_24810 6250 5705 gene locus_tag LOCUS_24820 gene rfbC 6250 5705 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_24820 6384 7478 gene locus_tag LOCUS_24830 gene bioB 6384 7478 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_24830 7549 8100 gene locus_tag LOCUS_24840 7549 8100 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_24840 8112 8582 gene locus_tag LOCUS_24850 gene lspA 8112 8582 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_24850 8936 8724 gene locus_tag LOCUS_24860 8936 8724 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_24860 10955 9162 gene locus_tag LOCUS_24870 10955 9162 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence141 353 931 gene locus_tag LOCUS_24880 353 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 1069 1971 gene locus_tag LOCUS_24890 1069 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 2222 2509 gene locus_tag LOCUS_24900 2222 2509 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010699606.1 protein_id gnl|my_center|LOCUS_24900 2487 2759 gene locus_tag LOCUS_24910 2487 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 3522 3040 gene locus_tag LOCUS_24920 3522 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 3893 3519 gene locus_tag LOCUS_24930 3893 3519 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_24930 4355 4095 gene locus_tag LOCUS_24940 4355 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 4718 5008 gene locus_tag LOCUS_24950 4718 5008 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038219.1 protein_id gnl|my_center|LOCUS_24950 5005 5373 gene locus_tag LOCUS_24960 5005 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 8068 5771 gene locus_tag LOCUS_24970 8068 5771 CDS product TOMM precursor leader peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227744.1 protein_id gnl|my_center|LOCUS_24970 8630 9004 gene locus_tag LOCUS_24980 8630 9004 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057533.1 protein_id gnl|my_center|LOCUS_24980 9177 10103 gene locus_tag LOCUS_24990 9177 10103 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_24990 10182 10427 gene locus_tag LOCUS_25000 gene psbE 10182 10427 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_25000 10453 10587 gene locus_tag LOCUS_25010 gene psbF 10453 10587 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_25010 10760 10879 gene locus_tag LOCUS_25020 10760 10879 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence142 556 1398 gene locus_tag LOCUS_25030 556 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 2941 1517 gene locus_tag LOCUS_25040 2941 1517 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_25040 4552 3116 gene locus_tag LOCUS_25050 4552 3116 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_25050 4944 6041 gene locus_tag LOCUS_25060 gene ribD 4944 6041 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057986.1 protein_id gnl|my_center|LOCUS_25060 6180 8237 gene locus_tag LOCUS_25070 gene htpG 6180 8237 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057033.1 protein_id gnl|my_center|LOCUS_25070 8446 9948 gene locus_tag LOCUS_25080 8446 9948 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_25080 10009 10410 gene locus_tag LOCUS_25090 10009 10410 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085898.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence143 679 1920 gene locus_tag LOCUS_25100 gene argJ 679 1920 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057748.1 protein_id gnl|my_center|LOCUS_25100 2443 2261 gene locus_tag LOCUS_25110 2443 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 2859 4961 gene locus_tag LOCUS_25120 2859 4961 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_25120 5121 6542 gene locus_tag LOCUS_25130 5121 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 7365 6619 gene locus_tag LOCUS_25140 7365 6619 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_25140 7647 9137 gene locus_tag LOCUS_25150 7647 9137 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057081.1 protein_id gnl|my_center|LOCUS_25150 9441 11027 gene locus_tag LOCUS_25160 9441 11027 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence144 1317 742 gene locus_tag LOCUS_25170 1317 742 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_25170 2039 1452 gene locus_tag LOCUS_25180 2039 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 2470 2225 gene locus_tag LOCUS_25190 2470 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2895 2467 gene locus_tag LOCUS_25200 2895 2467 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626168.1 protein_id gnl|my_center|LOCUS_25200 4987 3056 gene locus_tag LOCUS_25210 4987 3056 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797673.1 protein_id gnl|my_center|LOCUS_25210 5643 5158 gene locus_tag LOCUS_25220 5643 5158 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_25220 7089 5908 gene locus_tag LOCUS_25230 7089 5908 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207588.1 protein_id gnl|my_center|LOCUS_25230 7453 8427 gene locus_tag LOCUS_25240 7453 8427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 9085 10989 gene locus_tag LOCUS_25250 gene dnaK 9085 10989 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_25250 >Feature sequence145 158 352 gene locus_tag LOCUS_25260 158 352 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022121.1 protein_id gnl|my_center|LOCUS_25260 349 606 gene locus_tag LOCUS_25270 349 606 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393298.1 protein_id gnl|my_center|LOCUS_25270 790 927 gene locus_tag LOCUS_25280 790 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 1026 1535 gene locus_tag LOCUS_25290 1026 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_25290 1607 2386 gene locus_tag LOCUS_25300 1607 2386 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_25300 2406 4478 gene locus_tag LOCUS_25310 2406 4478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4513 5139 gene locus_tag LOCUS_25320 4513 5139 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_25320 5156 6469 gene locus_tag LOCUS_25330 5156 6469 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058269.1 protein_id gnl|my_center|LOCUS_25330 6531 7541 gene locus_tag LOCUS_25340 gene trpS 6531 7541 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057831.1 protein_id gnl|my_center|LOCUS_25340 8032 8796 gene locus_tag LOCUS_25350 8032 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 9029 9208 gene locus_tag LOCUS_25360 9029 9208 CDS product ssl1498 family light-harvesting-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055918.1 protein_id gnl|my_center|LOCUS_25360 10065 9283 gene locus_tag LOCUS_25370 10065 9283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 10128 10676 gene locus_tag LOCUS_25380 gene psbP 10128 10676 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence146 167 2152 gene locus_tag LOCUS_25390 167 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 2589 3368 gene locus_tag LOCUS_25400 2589 3368 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_25400 3937 3410 gene locus_tag LOCUS_25410 3937 3410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 4344 4682 gene locus_tag LOCUS_25420 4344 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 4731 4976 gene locus_tag LOCUS_25430 4731 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 5087 6670 gene locus_tag LOCUS_25440 5087 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 7512 6700 gene locus_tag LOCUS_25450 7512 6700 CDS product rhodanese-related sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085861.1 protein_id gnl|my_center|LOCUS_25450 7590 7662 gene locus_tag LOCUS_t00210 7590 7662 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7868 8650 gene locus_tag LOCUS_25460 gene recO 7868 8650 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058068.1 protein_id gnl|my_center|LOCUS_25460 8778 10166 gene locus_tag LOCUS_25470 8778 10166 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058069.1 protein_id gnl|my_center|LOCUS_25470 >Feature sequence147 508 1191 gene locus_tag LOCUS_25480 508 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1358 2872 gene locus_tag LOCUS_25490 1358 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 3163 3792 gene locus_tag LOCUS_25500 gene hisB 3163 3792 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055988.1 protein_id gnl|my_center|LOCUS_25500 4931 3822 gene locus_tag LOCUS_25510 gene thrC 4931 3822 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_25510 5311 7020 gene locus_tag LOCUS_25520 5311 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 7250 7975 gene locus_tag LOCUS_25530 7250 7975 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_25530 8053 8123 gene locus_tag LOCUS_t00220 8053 8123 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 8608 8183 gene locus_tag LOCUS_25540 8608 8183 CDS product lysozyme inhibitor LprI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816150.1 protein_id gnl|my_center|LOCUS_25540 <10980 8776 gene locus_tag LOCUS_25550 <10980 8776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141880.1:FdhF/YdeP family oxidoreductase >Feature sequence148 362 1495 gene locus_tag LOCUS_25560 362 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 1898 3412 gene locus_tag LOCUS_25570 1898 3412 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_25570 3507 3848 gene locus_tag LOCUS_25580 3507 3848 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_25580 3858 4325 gene locus_tag LOCUS_25590 gene tspO 3858 4325 CDS product tryptophan-rich sensory protein TspO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338115.1 protein_id gnl|my_center|LOCUS_25590 5781 4993 gene locus_tag LOCUS_25600 gene cobM 5781 4993 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056411.1 protein_id gnl|my_center|LOCUS_25600 6003 7760 gene locus_tag LOCUS_25610 6003 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 7762 9339 gene locus_tag LOCUS_25620 7762 9339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 9432 10748 gene locus_tag LOCUS_25630 9432 10748 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence149 667 233 gene locus_tag LOCUS_25640 667 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_25640 1645 749 gene locus_tag LOCUS_25650 1645 749 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928954.1 protein_id gnl|my_center|LOCUS_25650 1946 1824 gene locus_tag LOCUS_25660 1946 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 2685 1975 gene locus_tag LOCUS_25670 2685 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 3863 2685 gene locus_tag LOCUS_25680 3863 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 6546 3937 gene locus_tag LOCUS_25690 gene acnB 6546 3937 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797887.1 protein_id gnl|my_center|LOCUS_25690 7031 7708 gene locus_tag LOCUS_25700 gene deoC 7031 7708 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_25700 7881 8615 gene locus_tag LOCUS_25710 7881 8615 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_25710 8750 9400 gene locus_tag LOCUS_25720 gene hisG 8750 9400 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056035.1 protein_id gnl|my_center|LOCUS_25720 10593 9445 gene locus_tag LOCUS_25730 gene chrA 10593 9445 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence150 1592 249 gene locus_tag LOCUS_25740 gene pyk 1592 249 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_25740 1814 1966 gene locus_tag LOCUS_25750 1814 1966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2342 2049 gene locus_tag LOCUS_25760 2342 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3739 2459 gene locus_tag LOCUS_25770 3739 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 4331 5023 gene locus_tag LOCUS_25780 gene bchM 4331 5023 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_25780 5027 5794 gene locus_tag LOCUS_25790 gene panB 5027 5794 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 protein_id gnl|my_center|LOCUS_25790 5787 6269 gene locus_tag LOCUS_25800 gene msrA 5787 6269 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060839.1 protein_id gnl|my_center|LOCUS_25800 6333 6641 gene locus_tag LOCUS_25810 6333 6641 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_25810 6746 7093 gene locus_tag LOCUS_25820 6746 7093 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_25820 7568 7161 gene locus_tag LOCUS_25830 7568 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 9164 7647 gene locus_tag LOCUS_25840 gene cobA 9164 7647 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_25840 10153 9242 gene locus_tag LOCUS_25850 10153 9242 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_25850 10792 10202 gene locus_tag LOCUS_25860 gene cbiT 10792 10202 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence151 101 577 gene locus_tag LOCUS_25870 101 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25870 1008 664 gene locus_tag LOCUS_25880 1008 664 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869620.1 protein_id gnl|my_center|LOCUS_25880 1306 998 gene locus_tag LOCUS_25890 1306 998 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_25890 1936 1544 gene locus_tag LOCUS_25900 1936 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 2307 1936 gene locus_tag LOCUS_25910 2307 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2593 2907 gene locus_tag LOCUS_25920 2593 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 3378 3151 gene locus_tag LOCUS_25930 3378 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 3616 3365 gene locus_tag LOCUS_25940 3616 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073593944.1 protein_id gnl|my_center|LOCUS_25940 4362 3877 gene locus_tag LOCUS_25950 4362 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 5469 4366 gene locus_tag LOCUS_25960 gene wecB 5469 4366 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_25960 6936 5605 gene locus_tag LOCUS_25970 6936 5605 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144101.1 protein_id gnl|my_center|LOCUS_25970 7765 6983 gene locus_tag LOCUS_25980 7765 6983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_25980 7985 10555 gene locus_tag LOCUS_25990 7985 10555 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058092.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence152 1710 52 gene locus_tag LOCUS_26000 1710 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 2757 1774 gene locus_tag LOCUS_26010 gene holA 2757 1774 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_26010 3002 2793 gene locus_tag LOCUS_26020 3002 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 3147 3977 gene locus_tag LOCUS_26030 3147 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 7397 4071 gene locus_tag LOCUS_26040 7397 4071 CDS product AAA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057338.1 protein_id gnl|my_center|LOCUS_26040 7512 7868 gene locus_tag LOCUS_26050 7512 7868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 8022 8222 gene locus_tag LOCUS_26060 8022 8222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 9211 8288 gene locus_tag LOCUS_26070 9211 8288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 9250 9753 gene locus_tag LOCUS_26080 9250 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 10639 9791 gene locus_tag LOCUS_26090 10639 9791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920996.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence153 6579 4900 gene locus_tag LOCUS_26100 6579 4900 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_26100 8423 6912 gene locus_tag LOCUS_26110 gene crtH 8423 6912 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_26110 8812 10641 gene locus_tag LOCUS_26120 8812 10641 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261053.1 protein_id gnl|my_center|LOCUS_26120 >Feature sequence154 263 21 gene locus_tag LOCUS_26130 263 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1087 893 gene locus_tag LOCUS_26140 1087 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 1415 1125 gene locus_tag LOCUS_26150 1415 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 3291 1969 gene locus_tag LOCUS_26160 3291 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 3930 3769 gene locus_tag LOCUS_26170 3930 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 4856 4551 gene locus_tag LOCUS_26180 4856 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 5648 4914 gene locus_tag LOCUS_26190 5648 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 7203 5749 gene locus_tag LOCUS_26200 7203 5749 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625978.1 protein_id gnl|my_center|LOCUS_26200 9824 7206 gene locus_tag LOCUS_26210 9824 7206 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_26210 10299 9832 gene locus_tag LOCUS_26220 10299 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 >Feature sequence155 1073 180 gene locus_tag LOCUS_26230 1073 180 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_26230 1943 1311 gene locus_tag LOCUS_26240 gene mtnX 1943 1311 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245748.1 protein_id gnl|my_center|LOCUS_26240 2030 2848 gene locus_tag LOCUS_26250 2030 2848 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_26250 4142 2925 gene locus_tag LOCUS_26260 4142 2925 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_26260 4237 4485 gene locus_tag LOCUS_26270 4237 4485 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_26270 4692 4952 gene locus_tag LOCUS_26280 4692 4952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 4918 5361 gene locus_tag LOCUS_26290 4918 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26290 8105 5406 gene locus_tag LOCUS_26300 8105 5406 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888895.1 protein_id gnl|my_center|LOCUS_26300 10675 8288 gene locus_tag LOCUS_26310 10675 8288 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence156 <1 1702 gene locus_tag LOCUS_26320 <1 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074472092.1:collagen-like protein 1712 2233 gene locus_tag LOCUS_26330 1712 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 2252 2863 gene locus_tag LOCUS_26340 2252 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 2916 3428 gene locus_tag LOCUS_26350 2916 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 3674 4651 gene locus_tag LOCUS_26360 3674 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 4679 5095 gene locus_tag LOCUS_26370 4679 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 5083 5418 gene locus_tag LOCUS_26380 5083 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 5553 6167 gene locus_tag LOCUS_26390 5553 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 6175 6771 gene locus_tag LOCUS_26400 6175 6771 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_26400 6800 7015 gene locus_tag LOCUS_26410 6800 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 7012 9222 gene locus_tag LOCUS_26420 7012 9222 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941639.1 protein_id gnl|my_center|LOCUS_26420 9362 10021 gene locus_tag LOCUS_26430 9362 10021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 10021 10590 gene locus_tag LOCUS_26440 10021 10590 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029538.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence157 269 880 gene locus_tag LOCUS_26450 269 880 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_26450 1017 2033 gene locus_tag LOCUS_26460 1017 2033 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_26460 2164 2373 gene locus_tag LOCUS_26470 gene thiS 2164 2373 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056654.1 protein_id gnl|my_center|LOCUS_26470 2407 3543 gene locus_tag LOCUS_26480 2407 3543 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_26480 3540 4310 gene locus_tag LOCUS_26490 3540 4310 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_26490 4720 5031 gene locus_tag LOCUS_26500 4720 5031 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143612.1 protein_id gnl|my_center|LOCUS_26500 6227 5268 gene locus_tag LOCUS_26510 gene hemC 6227 5268 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_26510 6612 8180 gene locus_tag LOCUS_26520 6612 8180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 8965 8630 gene locus_tag LOCUS_26530 8965 8630 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460613.1 protein_id gnl|my_center|LOCUS_26530 9255 8962 gene locus_tag LOCUS_26540 9255 8962 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143513.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence158 315 572 gene locus_tag LOCUS_26550 315 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 827 600 gene locus_tag LOCUS_26560 827 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 1233 1367 gene locus_tag LOCUS_26570 1233 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 1424 1627 gene locus_tag LOCUS_26580 1424 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 1720 3165 gene locus_tag LOCUS_26590 1720 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057099.1 protein_id gnl|my_center|LOCUS_26590 3381 5618 gene locus_tag LOCUS_26600 3381 5618 CDS product FUSC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036738.1 protein_id gnl|my_center|LOCUS_26600 7971 5893 gene locus_tag LOCUS_26610 7971 5893 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_26610 8220 8044 gene locus_tag LOCUS_26620 8220 8044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 8911 8321 gene locus_tag LOCUS_26630 gene leuD 8911 8321 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_26630 9470 8931 gene locus_tag LOCUS_26640 9470 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 10027 9476 gene locus_tag LOCUS_26650 gene cobU 10027 9476 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_26650 10453 10076 gene locus_tag LOCUS_26660 10453 10076 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence159 1383 751 gene locus_tag LOCUS_26670 1383 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_26670 1519 2466 gene locus_tag LOCUS_26680 gene queG 1519 2466 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_26680 2456 3094 gene locus_tag LOCUS_26690 2456 3094 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174997.1 protein_id gnl|my_center|LOCUS_26690 3320 3235 gene locus_tag LOCUS_t00230 3320 3235 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3493 3732 gene locus_tag LOCUS_26700 gene ndhL 3493 3732 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056553.1 protein_id gnl|my_center|LOCUS_26700 3753 4058 gene locus_tag LOCUS_26710 3753 4058 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_26710 4281 4709 gene locus_tag LOCUS_26720 4281 4709 CDS product ATP-dependent zinc protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958324.1 protein_id gnl|my_center|LOCUS_26720 6340 4913 gene locus_tag LOCUS_26730 6340 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 8163 6352 gene locus_tag LOCUS_26740 8163 6352 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056587.1 protein_id gnl|my_center|LOCUS_26740 9216 8215 gene locus_tag LOCUS_26750 9216 8215 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_26750 10420 9839 gene locus_tag LOCUS_26760 10420 9839 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_26760 >Feature sequence160 1506 229 gene locus_tag LOCUS_26770 1506 229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039737632.1 protein_id gnl|my_center|LOCUS_26770 2716 1646 gene locus_tag LOCUS_26780 2716 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 3725 2751 gene locus_tag LOCUS_26790 3725 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 5934 4474 gene locus_tag LOCUS_26800 5934 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 6315 7685 gene locus_tag LOCUS_26810 6315 7685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 7725 9329 gene locus_tag LOCUS_26820 7725 9329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036215.1 protein_id gnl|my_center|LOCUS_26820 9394 10251 gene locus_tag LOCUS_26830 9394 10251 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_26830 >Feature sequence161 180 815 gene locus_tag LOCUS_26840 gene trmB 180 815 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_26840 832 1458 gene locus_tag LOCUS_26850 832 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 1478 2278 gene locus_tag LOCUS_26860 1478 2278 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_26860 4177 2699 gene locus_tag LOCUS_26870 gene glgA 4177 2699 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011110443.1 protein_id gnl|my_center|LOCUS_26870 5782 4358 gene locus_tag LOCUS_26880 gene dacB 5782 4358 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_26880 5957 7309 gene locus_tag LOCUS_26890 gene gor 5957 7309 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_26890 8389 7610 gene locus_tag LOCUS_26900 8389 7610 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258918.1 protein_id gnl|my_center|LOCUS_26900 8622 9107 gene locus_tag LOCUS_26910 8622 9107 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_26910 9365 9877 gene locus_tag LOCUS_26920 9365 9877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 9902 10411 gene locus_tag LOCUS_26930 9902 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 >Feature sequence162 690 208 gene locus_tag LOCUS_26940 690 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 2650 908 gene locus_tag LOCUS_26950 2650 908 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056502.1 protein_id gnl|my_center|LOCUS_26950 3079 2681 gene locus_tag LOCUS_26960 3079 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 3295 3570 gene locus_tag LOCUS_26970 3295 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 3608 5158 gene locus_tag LOCUS_26980 3608 5158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 5172 5561 gene locus_tag LOCUS_26990 5172 5561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 6025 5759 gene locus_tag LOCUS_27000 6025 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 6308 6027 gene locus_tag LOCUS_27010 6308 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 7800 6556 gene locus_tag LOCUS_27020 7800 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 8559 7846 gene locus_tag LOCUS_27030 8559 7846 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_27030 9583 8948 gene locus_tag LOCUS_27040 9583 8948 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_27040 10280 9642 gene locus_tag LOCUS_27050 10280 9642 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798139.1 protein_id gnl|my_center|LOCUS_27050 >Feature sequence163 3024 406 gene locus_tag LOCUS_27060 gene clpB 3024 406 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_27060 5319 3418 gene locus_tag LOCUS_27070 5319 3418 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929297.1 protein_id gnl|my_center|LOCUS_27070 5710 5973 gene locus_tag LOCUS_27080 5710 5973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 6115 7227 gene locus_tag LOCUS_27090 gene hypD 6115 7227 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225639.1 protein_id gnl|my_center|LOCUS_27090 7315 7668 gene locus_tag LOCUS_27100 7315 7668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 8162 7665 gene locus_tag LOCUS_27110 8162 7665 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_27110 >Feature sequence164 1727 1005 gene locus_tag LOCUS_27120 1727 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 2682 1753 gene locus_tag LOCUS_27130 2682 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27130 6207 2692 gene locus_tag LOCUS_27140 6207 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 6625 6233 gene locus_tag LOCUS_27150 6625 6233 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_27150 7040 6639 gene locus_tag LOCUS_27160 7040 6639 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065296.1 protein_id gnl|my_center|LOCUS_27160 7735 7082 gene locus_tag LOCUS_27170 7735 7082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27170 8799 7732 gene locus_tag LOCUS_27180 8799 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27180 9612 8911 gene locus_tag LOCUS_27190 9612 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence165 160 384 gene locus_tag LOCUS_27200 160 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 737 540 gene locus_tag LOCUS_27210 737 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 1166 1372 gene locus_tag LOCUS_27220 1166 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 1375 1881 gene locus_tag LOCUS_27230 1375 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3939 2068 gene locus_tag LOCUS_27240 3939 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4875 4000 gene locus_tag LOCUS_27250 4875 4000 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929069.1 protein_id gnl|my_center|LOCUS_27250 5810 4968 gene locus_tag LOCUS_27260 5810 4968 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012164238.1 protein_id gnl|my_center|LOCUS_27260 7218 6019 gene locus_tag LOCUS_27270 7218 6019 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_27270 7731 7507 gene locus_tag LOCUS_27280 7731 7507 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057795.1 protein_id gnl|my_center|LOCUS_27280 8820 8260 gene locus_tag LOCUS_27290 8820 8260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 10128 9103 gene locus_tag LOCUS_27300 gene rlmN 10128 9103 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence166 535 269 gene locus_tag LOCUS_27310 535 269 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_27310 1314 700 gene locus_tag LOCUS_27320 gene lexA 1314 700 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_27320 2237 5791 gene locus_tag LOCUS_27330 gene nifJ 2237 5791 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_27330 5794 6819 gene locus_tag LOCUS_27340 5794 6819 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_27340 7177 8385 gene locus_tag LOCUS_27350 7177 8385 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057156.1 protein_id gnl|my_center|LOCUS_27350 8642 8445 gene locus_tag LOCUS_27360 8642 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 8841 8629 gene locus_tag LOCUS_27370 8841 8629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 9063 8848 gene locus_tag LOCUS_27380 9063 8848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 9314 9066 gene locus_tag LOCUS_27390 9314 9066 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_27390 9839 9552 gene locus_tag LOCUS_27400 9839 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27400 10432 9812 gene locus_tag LOCUS_27410 10432 9812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27410 >Feature sequence167 465 178 gene locus_tag LOCUS_27420 465 178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1487 462 gene locus_tag LOCUS_27430 1487 462 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_27430 3743 1647 gene locus_tag LOCUS_27440 3743 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 3811 4602 gene locus_tag LOCUS_27450 3811 4602 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_27450 4834 4613 gene locus_tag LOCUS_27460 4834 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 5090 4881 gene locus_tag LOCUS_27470 5090 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 7068 5131 gene locus_tag LOCUS_27480 7068 5131 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816805.1 protein_id gnl|my_center|LOCUS_27480 7757 7074 gene locus_tag LOCUS_27490 7757 7074 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_27490 8354 7776 gene locus_tag LOCUS_27500 8354 7776 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_27500 8874 8410 gene locus_tag LOCUS_27510 8874 8410 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_27510 9653 8880 gene locus_tag LOCUS_27520 9653 8880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 10000 10185 gene locus_tag LOCUS_27530 10000 10185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 >Feature sequence168 1414 719 gene locus_tag LOCUS_27540 1414 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3171 1762 gene locus_tag LOCUS_27550 3171 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 4417 3476 gene locus_tag LOCUS_27560 4417 3476 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_27560 4691 6130 gene locus_tag LOCUS_27570 gene glmM 4691 6130 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_27570 6188 7915 gene locus_tag LOCUS_27580 6188 7915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 8062 9057 gene locus_tag LOCUS_27590 8062 9057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 9054 10223 gene locus_tag LOCUS_27600 9054 10223 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_27600 >Feature sequence169 607 149 gene locus_tag LOCUS_27610 607 149 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_27610 1190 624 gene locus_tag LOCUS_27620 1190 624 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_27620 1248 1799 gene locus_tag LOCUS_27630 1248 1799 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056687.1 protein_id gnl|my_center|LOCUS_27630 2246 3580 gene locus_tag LOCUS_27640 2246 3580 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_27640 3669 4979 gene locus_tag LOCUS_27650 gene purB 3669 4979 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_27650 5294 6007 gene locus_tag LOCUS_27660 5294 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 7311 6010 gene locus_tag LOCUS_27670 7311 6010 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034351354.1 protein_id gnl|my_center|LOCUS_27670 7678 7412 gene locus_tag LOCUS_27680 7678 7412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 7870 7691 gene locus_tag LOCUS_27690 7870 7691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 8666 7968 gene locus_tag LOCUS_27700 8666 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 10113 8677 gene locus_tag LOCUS_27710 10113 8677 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence170 1206 1919 gene locus_tag LOCUS_27720 1206 1919 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_27720 2972 1971 gene locus_tag LOCUS_27730 2972 1971 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_27730 5105 3285 gene locus_tag LOCUS_27740 5105 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 5897 7423 gene locus_tag LOCUS_27750 5897 7423 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056133.1 protein_id gnl|my_center|LOCUS_27750 7497 8060 gene locus_tag LOCUS_27760 7497 8060 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_27760 8276 10327 gene locus_tag LOCUS_27770 8276 10327 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142700.1 protein_id gnl|my_center|LOCUS_27770 >Feature sequence171 839 81 gene locus_tag LOCUS_27780 839 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 1383 1766 gene locus_tag LOCUS_27790 gene rpsL 1383 1766 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143913.1 protein_id gnl|my_center|LOCUS_27790 1922 2392 gene locus_tag LOCUS_27800 gene rpsG 1922 2392 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_27800 2535 4610 gene locus_tag LOCUS_27810 gene fusA 2535 4610 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057586.1 protein_id gnl|my_center|LOCUS_27810 4764 5993 gene locus_tag LOCUS_27820 gene tuf 4764 5993 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143916.1 protein_id gnl|my_center|LOCUS_27820 6084 6401 gene locus_tag LOCUS_27830 gene rpsJ 6084 6401 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_27830 7677 6802 gene locus_tag LOCUS_27840 gene glyQ 7677 6802 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920808.1 protein_id gnl|my_center|LOCUS_27840 8652 7804 gene locus_tag LOCUS_27850 8652 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 9293 10111 gene locus_tag LOCUS_27860 9293 10111 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_27860 >Feature sequence172 916 1554 gene locus_tag LOCUS_27870 gene rplC 916 1554 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_27870 1575 2207 gene locus_tag LOCUS_27880 gene rplD 1575 2207 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_27880 2197 2502 gene locus_tag LOCUS_27890 2197 2502 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_27890 2536 3369 gene locus_tag LOCUS_27900 gene rplB 2536 3369 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055939.1 protein_id gnl|my_center|LOCUS_27900 3400 3681 gene locus_tag LOCUS_27910 gene rpsS 3400 3681 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055940.1 protein_id gnl|my_center|LOCUS_27910 3870 4229 gene locus_tag LOCUS_27920 gene rplV 3870 4229 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_27920 4253 4981 gene locus_tag LOCUS_27930 gene rpsC 4253 4981 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_27930 5012 5431 gene locus_tag LOCUS_27940 gene rplP 5012 5431 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_27940 5431 5649 gene locus_tag LOCUS_27950 gene rpmC 5431 5649 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143907.1 protein_id gnl|my_center|LOCUS_27950 5656 5898 gene locus_tag LOCUS_27960 gene rpsQ 5656 5898 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_27960 5919 6287 gene locus_tag LOCUS_27970 gene rplN 5919 6287 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_27970 6328 6681 gene locus_tag LOCUS_27980 gene rplX 6328 6681 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_27980 6736 7275 gene locus_tag LOCUS_27990 gene rplE 6736 7275 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_27990 7505 7906 gene locus_tag LOCUS_28000 gene rpsH 7505 7906 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_28000 8012 8581 gene locus_tag LOCUS_28010 gene rplF 8012 8581 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_28010 8585 8947 gene locus_tag LOCUS_28020 gene rplR 8585 8947 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143899.1 protein_id gnl|my_center|LOCUS_28020 8974 9495 gene locus_tag LOCUS_28030 gene rpsE 8974 9495 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_28030 9506 9949 gene locus_tag LOCUS_28040 gene rplO 9506 9949 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_28040 >Feature sequence173 138 272 gene locus_tag LOCUS_28050 138 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 496 1461 gene locus_tag LOCUS_28060 496 1461 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064509752.1 protein_id gnl|my_center|LOCUS_28060 1872 1507 gene locus_tag LOCUS_28070 1872 1507 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_28070 2870 3082 gene locus_tag LOCUS_28080 2870 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 4663 3218 gene locus_tag LOCUS_28090 4663 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 5388 4660 gene locus_tag LOCUS_28100 5388 4660 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929061.1 protein_id gnl|my_center|LOCUS_28100 5760 6470 gene locus_tag LOCUS_28110 5760 6470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_28110 6758 7186 gene locus_tag LOCUS_28120 6758 7186 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140553.1 protein_id gnl|my_center|LOCUS_28120 7251 10160 gene locus_tag LOCUS_28130 7251 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence174 254 745 gene locus_tag LOCUS_28140 254 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1872 808 gene locus_tag LOCUS_28150 1872 808 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_28150 3234 1951 gene locus_tag LOCUS_28160 3234 1951 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_28160 6765 3709 gene locus_tag LOCUS_28170 gene ppc 6765 3709 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_28170 7253 7065 gene locus_tag LOCUS_28180 7253 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 7537 7250 gene locus_tag LOCUS_28190 gene minE 7537 7250 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_28190 8367 7567 gene locus_tag LOCUS_28200 gene minD 8367 7567 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_28200 9396 8569 gene locus_tag LOCUS_28210 gene minC 9396 8569 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141990.1 protein_id gnl|my_center|LOCUS_28210 9801 9409 gene locus_tag LOCUS_28220 9801 9409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 >Feature sequence175 595 2274 gene locus_tag LOCUS_28230 gene pckA 595 2274 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_28230 3595 2378 gene locus_tag LOCUS_28240 3595 2378 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_28240 4315 3617 gene locus_tag LOCUS_28250 gene urtE 4315 3617 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_28250 5100 4354 gene locus_tag LOCUS_28260 gene urtD 5100 4354 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_28260 6369 5215 gene locus_tag LOCUS_28270 gene urtC 6369 5215 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_28270 7569 6373 gene locus_tag LOCUS_28280 7569 6373 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_28280 8980 7664 gene locus_tag LOCUS_28290 gene urtA 8980 7664 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_28290 9932 9657 gene locus_tag LOCUS_28300 9932 9657 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_28300 >Feature sequence176 2018 1314 gene locus_tag LOCUS_28310 2018 1314 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390738.1 protein_id gnl|my_center|LOCUS_28310 2641 2015 gene locus_tag LOCUS_28320 2641 2015 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763134.1 protein_id gnl|my_center|LOCUS_28320 4067 2643 gene locus_tag LOCUS_28330 4067 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 4615 4304 gene locus_tag LOCUS_28340 4615 4304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 4679 5947 gene locus_tag LOCUS_28350 4679 5947 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269017.1 protein_id gnl|my_center|LOCUS_28350 6081 6713 gene locus_tag LOCUS_28360 6081 6713 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_28360 6806 7144 gene locus_tag LOCUS_28370 6806 7144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 9744 7303 gene locus_tag LOCUS_28380 gene ppsA 9744 7303 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence177 2382 169 gene locus_tag LOCUS_28390 gene psaB 2382 169 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056579.1 protein_id gnl|my_center|LOCUS_28390 4807 2561 gene locus_tag LOCUS_28400 gene psaA 4807 2561 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_28400 5403 6683 gene locus_tag LOCUS_28410 5403 6683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 7296 7862 gene locus_tag LOCUS_28420 7296 7862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 8524 7985 gene locus_tag LOCUS_28430 8524 7985 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_28430 8949 8644 gene locus_tag LOCUS_28440 8949 8644 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_28440 9455 9048 gene locus_tag LOCUS_28450 9455 9048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 9749 9471 gene locus_tag LOCUS_28460 9749 9471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 >Feature sequence178 405 584 gene locus_tag LOCUS_28470 405 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 660 1007 gene locus_tag LOCUS_28480 660 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 1122 3113 gene locus_tag LOCUS_28490 1122 3113 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056292.1 protein_id gnl|my_center|LOCUS_28490 3498 3094 gene locus_tag LOCUS_28500 3498 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 3938 3531 gene locus_tag LOCUS_28510 3938 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 3983 4888 gene locus_tag LOCUS_28520 3983 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 5230 5958 gene locus_tag LOCUS_28530 5230 5958 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057150.1 protein_id gnl|my_center|LOCUS_28530 6008 6706 gene locus_tag LOCUS_28540 gene folE 6008 6706 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_28540 7425 6790 gene locus_tag LOCUS_28550 7425 6790 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_28550 7546 7812 gene locus_tag LOCUS_28560 gene psaK 7546 7812 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_28560 8403 8161 gene locus_tag LOCUS_28570 8403 8161 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878574.1 protein_id gnl|my_center|LOCUS_28570 8647 8420 gene locus_tag LOCUS_28580 8647 8420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 9682 9155 gene locus_tag LOCUS_28590 9682 9155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence179 2529 2185 gene locus_tag LOCUS_28600 2529 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 3643 2909 gene locus_tag LOCUS_28610 3643 2909 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_28610 5066 3675 gene locus_tag LOCUS_28620 5066 3675 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142146.1 protein_id gnl|my_center|LOCUS_28620 7459 5279 gene locus_tag LOCUS_28630 7459 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 9631 7472 gene locus_tag LOCUS_28640 9631 7472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 9912 9649 gene locus_tag LOCUS_28650 9912 9649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence180 304 609 gene locus_tag LOCUS_28660 304 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 569 775 gene locus_tag LOCUS_28670 569 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 765 986 gene locus_tag LOCUS_28680 765 986 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_28680 1005 1553 gene locus_tag LOCUS_28690 1005 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 1806 1576 gene locus_tag LOCUS_28700 1806 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2235 2537 gene locus_tag LOCUS_28710 2235 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 2612 2752 gene locus_tag LOCUS_28720 2612 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 2872 3168 gene locus_tag LOCUS_28730 2872 3168 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045668639.1 protein_id gnl|my_center|LOCUS_28730 3149 3496 gene locus_tag LOCUS_28740 3149 3496 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941219.1 protein_id gnl|my_center|LOCUS_28740 3938 4186 gene locus_tag LOCUS_28750 3938 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 4355 7834 gene locus_tag LOCUS_28760 4355 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 8329 7928 gene locus_tag LOCUS_28770 8329 7928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 9552 8833 gene locus_tag LOCUS_28780 gene udp 9552 8833 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868970.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence181 354 1223 gene locus_tag LOCUS_28790 354 1223 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_28790 1463 2167 gene locus_tag LOCUS_28800 gene ubiE 1463 2167 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_28800 2290 3441 gene locus_tag LOCUS_28810 2290 3441 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231833781.1 protein_id gnl|my_center|LOCUS_28810 4290 3586 gene locus_tag LOCUS_28820 4290 3586 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_28820 5424 4618 gene locus_tag LOCUS_28830 5424 4618 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_28830 6009 5644 gene locus_tag LOCUS_28840 6009 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057414.1 protein_id gnl|my_center|LOCUS_28840 6369 6010 gene locus_tag LOCUS_28850 6369 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 7940 7155 gene locus_tag LOCUS_28860 7940 7155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 9010 7937 gene locus_tag LOCUS_28870 9010 7937 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_28870 9180 9599 gene locus_tag LOCUS_28880 gene tnpA 9180 9599 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703865.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence182 211 939 gene locus_tag LOCUS_28890 211 939 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039062.1 protein_id gnl|my_center|LOCUS_28890 1708 968 gene locus_tag LOCUS_28900 1708 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5044 2012 gene locus_tag LOCUS_28910 gene infB 5044 2012 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056909.1 protein_id gnl|my_center|LOCUS_28910 5437 5156 gene locus_tag LOCUS_28920 5437 5156 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172451.1 protein_id gnl|my_center|LOCUS_28920 6630 5434 gene locus_tag LOCUS_28930 gene nusA 6630 5434 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057772.1 protein_id gnl|my_center|LOCUS_28930 7279 6809 gene locus_tag LOCUS_28940 gene rimP 7279 6809 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920953.1 protein_id gnl|my_center|LOCUS_28940 7494 9389 gene locus_tag LOCUS_28950 gene ftsH2 7494 9389 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence183 175 2385 gene locus_tag LOCUS_28960 175 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 2387 3640 gene locus_tag LOCUS_28970 2387 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 4174 4482 gene locus_tag LOCUS_28980 4174 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057985.1 protein_id gnl|my_center|LOCUS_28980 4645 5106 gene locus_tag LOCUS_28990 4645 5106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 5103 6188 gene locus_tag LOCUS_29000 gene cax 5103 6188 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_29000 6441 8021 gene locus_tag LOCUS_29010 6441 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 9284 8067 gene locus_tag LOCUS_29020 9284 8067 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776584.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence184 430 188 gene locus_tag LOCUS_29030 430 188 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_29030 659 423 gene locus_tag LOCUS_29040 659 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 848 1495 gene locus_tag LOCUS_29050 848 1495 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_29050 1569 1805 gene locus_tag LOCUS_29060 1569 1805 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_29060 2007 3095 gene locus_tag LOCUS_29070 gene aksF 2007 3095 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875823.1 protein_id gnl|my_center|LOCUS_29070 3255 3890 gene locus_tag LOCUS_29080 3255 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 4072 4887 gene locus_tag LOCUS_29090 4072 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 5024 6226 gene locus_tag LOCUS_29100 5024 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 6847 6248 gene locus_tag LOCUS_29110 6847 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 8046 6895 gene locus_tag LOCUS_29120 8046 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 8861 8358 gene locus_tag LOCUS_29130 8861 8358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 9127 9441 gene locus_tag LOCUS_29140 9127 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058283.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence185 1113 820 gene locus_tag LOCUS_29150 1113 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1927 1244 gene locus_tag LOCUS_29160 1927 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 3277 1928 gene locus_tag LOCUS_29170 3277 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29170 4444 3503 gene locus_tag LOCUS_29180 4444 3503 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_29180 4555 5217 gene locus_tag LOCUS_29190 4555 5217 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_29190 5278 6411 gene locus_tag LOCUS_29200 5278 6411 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_29200 6467 6760 gene locus_tag LOCUS_29210 gene clpS 6467 6760 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_29210 6763 7047 gene locus_tag LOCUS_29220 6763 7047 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_29220 7137 8999 gene locus_tag LOCUS_29230 7137 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence186 1025 480 gene locus_tag LOCUS_29240 gene rsmD 1025 480 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056896.1 protein_id gnl|my_center|LOCUS_29240 1706 1029 gene locus_tag LOCUS_29250 1706 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2856 1900 gene locus_tag LOCUS_29260 gene era 2856 1900 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055911.1 protein_id gnl|my_center|LOCUS_29260 2913 3659 gene locus_tag LOCUS_29270 2913 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_29270 4000 5124 gene locus_tag LOCUS_29280 gene cbiD 4000 5124 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056612.1 protein_id gnl|my_center|LOCUS_29280 5268 6893 gene locus_tag LOCUS_29290 gene guaA 5268 6893 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_29290 7539 8312 gene locus_tag LOCUS_29300 7539 8312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 8840 9094 gene locus_tag LOCUS_29310 8840 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 >Feature sequence187 1105 2142 gene locus_tag LOCUS_29320 1105 2142 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_29320 2161 3018 gene locus_tag LOCUS_29330 2161 3018 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167919.1 protein_id gnl|my_center|LOCUS_29330 3031 4437 gene locus_tag LOCUS_29340 3031 4437 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_29340 5326 4379 gene locus_tag LOCUS_29350 gene miaA 5326 4379 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_29350 7798 5945 gene locus_tag LOCUS_29360 gene ftsH3 7798 5945 CDS product ATP-dependent zinc metalloprotease FtsH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055986.1 protein_id gnl|my_center|LOCUS_29360 7977 8207 gene locus_tag LOCUS_29370 7977 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 8774 8433 gene locus_tag LOCUS_29380 8774 8433 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_29380 9388 8777 gene locus_tag LOCUS_29390 9388 8777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29390 >Feature sequence188 6076 290 gene locus_tag LOCUS_29400 6076 290 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_29400 6762 6169 gene locus_tag LOCUS_29410 6762 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 7932 6844 gene locus_tag LOCUS_29420 7932 6844 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225697.1 protein_id gnl|my_center|LOCUS_29420 8164 8436 gene locus_tag LOCUS_29430 8164 8436 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_29430 8420 8674 gene locus_tag LOCUS_29440 8420 8674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence189 1525 368 gene locus_tag LOCUS_29450 gene corA 1525 368 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_29450 1717 2745 gene locus_tag LOCUS_29460 gene pdxA 1717 2745 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173758.1 protein_id gnl|my_center|LOCUS_29460 2770 4134 gene locus_tag LOCUS_29470 2770 4134 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_29470 4200 7529 gene locus_tag LOCUS_29480 4200 7529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 7644 9302 gene locus_tag LOCUS_29490 7644 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence190 354 632 gene locus_tag LOCUS_29500 354 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 873 1103 gene locus_tag LOCUS_29510 873 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 1289 1624 gene locus_tag LOCUS_29520 1289 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 2819 1857 gene locus_tag LOCUS_29530 2819 1857 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_29530 4140 3139 gene locus_tag LOCUS_29540 4140 3139 CDS product curli production assembly/transport component CsgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869127.1 protein_id gnl|my_center|LOCUS_29540 5206 4214 gene locus_tag LOCUS_29550 5206 4214 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_29550 5730 6116 gene locus_tag LOCUS_29560 5730 6116 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_29560 6469 7263 gene locus_tag LOCUS_29570 6469 7263 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928875.1 protein_id gnl|my_center|LOCUS_29570 8043 7246 gene locus_tag LOCUS_29580 8043 7246 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_29580 8189 8767 gene locus_tag LOCUS_29590 gene rimM 8189 8767 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence191 288 1109 gene locus_tag LOCUS_29600 288 1109 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140835.1 protein_id gnl|my_center|LOCUS_29600 1271 2005 gene locus_tag LOCUS_29610 1271 2005 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_29610 2253 3110 gene locus_tag LOCUS_29620 2253 3110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 3235 4077 gene locus_tag LOCUS_29630 3235 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142083.1 protein_id gnl|my_center|LOCUS_29630 4091 4750 gene locus_tag LOCUS_29640 4091 4750 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_29640 4777 5640 gene locus_tag LOCUS_29650 4777 5640 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967128.1 protein_id gnl|my_center|LOCUS_29650 6480 6130 gene locus_tag LOCUS_29660 6480 6130 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057859.1 protein_id gnl|my_center|LOCUS_29660 7133 6615 gene locus_tag LOCUS_29670 gene scpB 7133 6615 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056690.1 protein_id gnl|my_center|LOCUS_29670 7195 8007 gene locus_tag LOCUS_29680 7195 8007 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057953.1 protein_id gnl|my_center|LOCUS_29680 7997 8836 gene locus_tag LOCUS_29690 7997 8836 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_29690 9191 8913 gene locus_tag LOCUS_29700 9191 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29700 >Feature sequence192 <1 605 gene locus_tag LOCUS_29710 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056632.1:tetratricopeptide repeat protein 602 1231 gene locus_tag LOCUS_29720 602 1231 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_29720 1310 1543 gene locus_tag LOCUS_29730 1310 1543 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057407.1 protein_id gnl|my_center|LOCUS_29730 1970 3358 gene locus_tag LOCUS_29740 gene hpnO 1970 3358 CDS product aminobacteriohopanetriol synthase HpnO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085794.1 protein_id gnl|my_center|LOCUS_29740 3365 4462 gene locus_tag LOCUS_29750 3365 4462 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760696.1 protein_id gnl|my_center|LOCUS_29750 4582 5577 gene locus_tag LOCUS_29760 4582 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 7161 5599 gene locus_tag LOCUS_29770 gene kaiC 7161 5599 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_29770 7669 7355 gene locus_tag LOCUS_29780 gene kaiB 7669 7355 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_29780 8607 7726 gene locus_tag LOCUS_29790 8607 7726 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_29790 >Feature sequence193 332 144 gene locus_tag LOCUS_29800 332 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 1322 549 gene locus_tag LOCUS_29810 1322 549 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_29810 2522 1866 gene locus_tag LOCUS_29820 2522 1866 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_29820 3435 2545 gene locus_tag LOCUS_29830 3435 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 3514 4074 gene locus_tag LOCUS_29840 3514 4074 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_29840 4451 4726 gene locus_tag LOCUS_29850 4451 4726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 4971 5969 gene locus_tag LOCUS_29860 4971 5969 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928617.1 protein_id gnl|my_center|LOCUS_29860 6926 5976 gene locus_tag LOCUS_29870 6926 5976 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479942.1 protein_id gnl|my_center|LOCUS_29870 7790 6939 gene locus_tag LOCUS_29880 gene lgt 7790 6939 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_29880 7863 7945 gene locus_tag LOCUS_t00240 7863 7945 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8681 9145 gene locus_tag LOCUS_29890 8681 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence194 538 840 gene locus_tag LOCUS_29900 538 840 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_29900 984 1068 gene locus_tag LOCUS_t00250 984 1068 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1077 1148 gene locus_tag LOCUS_t00260 1077 1148 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1293 4301 gene locus_tag LOCUS_29910 1293 4301 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056145.1 protein_id gnl|my_center|LOCUS_29910 4429 4298 gene locus_tag LOCUS_29920 4429 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 4598 5446 gene locus_tag LOCUS_29930 4598 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 5661 6023 gene locus_tag LOCUS_29940 gene rplS 5661 6023 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057143.1 protein_id gnl|my_center|LOCUS_29940 6125 6197 gene locus_tag LOCUS_t00270 6125 6197 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6322 6558 gene locus_tag LOCUS_29950 gene secE 6322 6558 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056148.1 protein_id gnl|my_center|LOCUS_29950 6555 7172 gene locus_tag LOCUS_29960 gene nusG 6555 7172 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_29960 7176 7601 gene locus_tag LOCUS_29970 gene rplK 7176 7601 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_29970 7657 8370 gene locus_tag LOCUS_29980 gene rplA 7657 8370 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_29980 8766 8443 gene locus_tag LOCUS_29990 8766 8443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 9040 8732 gene locus_tag LOCUS_30000 9040 8732 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence195 2299 575 gene locus_tag LOCUS_30010 2299 575 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141773.1 protein_id gnl|my_center|LOCUS_30010 2950 3300 gene locus_tag LOCUS_30020 2950 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3302 3889 gene locus_tag LOCUS_30030 3302 3889 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_30030 3889 8721 gene locus_tag LOCUS_30040 3889 8721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30040 >Feature sequence196 506 102 gene locus_tag LOCUS_30050 506 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 770 507 gene locus_tag LOCUS_30060 770 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30060 1385 1101 gene locus_tag LOCUS_30070 1385 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1705 3045 gene locus_tag LOCUS_30080 gene miaB 1705 3045 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057155.1 protein_id gnl|my_center|LOCUS_30080 3110 3496 gene locus_tag LOCUS_30090 3110 3496 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_30090 4918 3506 gene locus_tag LOCUS_30100 4918 3506 CDS product YcjF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057275.1 protein_id gnl|my_center|LOCUS_30100 5095 5289 gene locus_tag LOCUS_30110 gene rpmG 5095 5289 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_30110 5330 5545 gene locus_tag LOCUS_30120 gene rpsR 5330 5545 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_30120 6266 8494 gene locus_tag LOCUS_30130 6266 8494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 8571 8643 gene locus_tag LOCUS_t00280 8571 8643 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence197 113 307 gene locus_tag LOCUS_30140 113 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 589 389 gene locus_tag LOCUS_30150 589 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 2777 966 gene locus_tag LOCUS_30160 2777 966 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_30160 3189 2821 gene locus_tag LOCUS_30170 3189 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 3343 3516 gene locus_tag LOCUS_30180 3343 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 4130 3528 gene locus_tag LOCUS_30190 4130 3528 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040689791.1 protein_id gnl|my_center|LOCUS_30190 5233 4208 gene locus_tag LOCUS_30200 5233 4208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 5454 6602 gene locus_tag LOCUS_30210 5454 6602 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_30210 7946 6825 gene locus_tag LOCUS_30220 7946 6825 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141501.1 protein_id gnl|my_center|LOCUS_30220 8118 8747 gene locus_tag LOCUS_30230 gene ruvA 8118 8747 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence198 806 93 gene locus_tag LOCUS_30240 806 93 CDS product GDSL-type esterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125174.1 protein_id gnl|my_center|LOCUS_30240 1034 1927 gene locus_tag LOCUS_30250 1034 1927 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986764.1 protein_id gnl|my_center|LOCUS_30250 2213 2521 gene locus_tag LOCUS_30260 2213 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 2544 3029 gene locus_tag LOCUS_30270 2544 3029 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056942.1 protein_id gnl|my_center|LOCUS_30270 3122 5782 gene locus_tag LOCUS_30280 gene clpB 3122 5782 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058284.1 protein_id gnl|my_center|LOCUS_30280 6413 5892 gene locus_tag LOCUS_30290 6413 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 7740 6571 gene locus_tag LOCUS_30300 gene acsF 7740 6571 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_30300 8390 8770 gene locus_tag LOCUS_30310 8390 8770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 >Feature sequence199 1417 428 gene locus_tag LOCUS_30320 1417 428 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_30320 1591 2538 gene locus_tag LOCUS_30330 gene speE 1591 2538 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_30330 4897 2615 gene locus_tag LOCUS_30340 gene recJ 4897 2615 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_30340 5196 4942 gene locus_tag LOCUS_30350 5196 4942 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_30350 8239 5216 gene locus_tag LOCUS_30360 8239 5216 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence200 1513 170 gene locus_tag LOCUS_30370 1513 170 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_30370 2292 1564 gene locus_tag LOCUS_30380 2292 1564 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055907.1 protein_id gnl|my_center|LOCUS_30380 2673 2311 gene locus_tag LOCUS_30390 2673 2311 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_30390 3632 2676 gene locus_tag LOCUS_30400 3632 2676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256681.1 protein_id gnl|my_center|LOCUS_30400 5366 3633 gene locus_tag LOCUS_30410 5366 3633 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041470421.1 protein_id gnl|my_center|LOCUS_30410 5571 5906 gene locus_tag LOCUS_30420 5571 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 6536 7309 gene locus_tag LOCUS_30430 6536 7309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 8576 7698 gene locus_tag LOCUS_30440 gene murB 8576 7698 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056225.1 protein_id gnl|my_center|LOCUS_30440 >Feature sequence201 <1 552 gene locus_tag LOCUS_30450 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003732689.1:molybdenum cofactor biosynthesis protein MoaB 1165 554 gene locus_tag LOCUS_30460 1165 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1300 1965 gene locus_tag LOCUS_30470 1300 1965 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_30470 2195 3145 gene locus_tag LOCUS_30480 2195 3145 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_30480 3151 3741 gene locus_tag LOCUS_30490 gene wcaF 3151 3741 CDS product colanic acid biosynthesis acetyltransferase WcaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097875.1 protein_id gnl|my_center|LOCUS_30490 5840 4089 gene locus_tag LOCUS_30500 5840 4089 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_30500 7415 6012 gene locus_tag LOCUS_30510 7415 6012 CDS product glutamate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261695.1 protein_id gnl|my_center|LOCUS_30510 7698 7444 gene locus_tag LOCUS_30520 7698 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 7882 8436 gene locus_tag LOCUS_30530 7882 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence202 750 544 gene locus_tag LOCUS_30540 750 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 1517 2068 gene locus_tag LOCUS_30550 1517 2068 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219860.1 protein_id gnl|my_center|LOCUS_30550 3669 3283 gene locus_tag LOCUS_30560 3669 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141236.1 protein_id gnl|my_center|LOCUS_30560 4136 6466 gene locus_tag LOCUS_30570 4136 6466 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057757.1 protein_id gnl|my_center|LOCUS_30570 7194 6853 gene locus_tag LOCUS_30580 7194 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 7207 8172 gene locus_tag LOCUS_30590 7207 8172 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_30590 8214 8426 gene locus_tag LOCUS_30600 8214 8426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 >Feature sequence203 226 969 gene locus_tag LOCUS_30610 226 969 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_30610 1264 2523 gene locus_tag LOCUS_30620 1264 2523 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_30620 2788 3735 gene locus_tag LOCUS_30630 2788 3735 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920765.1 protein_id gnl|my_center|LOCUS_30630 4110 3883 gene locus_tag LOCUS_30640 4110 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 4312 4103 gene locus_tag LOCUS_30650 4312 4103 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_30650 4804 4529 gene locus_tag LOCUS_30660 4804 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_30660 5700 5008 gene locus_tag LOCUS_30670 5700 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30670 6630 6409 gene locus_tag LOCUS_30680 6630 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 7119 6667 gene locus_tag LOCUS_30690 7119 6667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 7417 7103 gene locus_tag LOCUS_30700 7417 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 8434 7436 gene locus_tag LOCUS_30710 8434 7436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480572.1 protein_id gnl|my_center|LOCUS_30710 >Feature sequence204 7608 490 gene locus_tag LOCUS_30720 7608 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 8465 8085 gene locus_tag LOCUS_30730 8465 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 >Feature sequence205 226 1113 gene locus_tag LOCUS_30740 gene sucD 226 1113 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 protein_id gnl|my_center|LOCUS_30740 1420 6024 gene locus_tag LOCUS_30750 1420 6024 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057208.1 protein_id gnl|my_center|LOCUS_30750 6094 7089 gene locus_tag LOCUS_30760 gene dcm 6094 7089 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222381.1 protein_id gnl|my_center|LOCUS_30760 7179 7400 gene locus_tag LOCUS_30770 7179 7400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 7673 8455 gene locus_tag LOCUS_30780 7673 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence206 138 305 gene locus_tag LOCUS_30790 138 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 905 414 gene locus_tag LOCUS_30800 905 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 1322 2881 gene locus_tag LOCUS_30810 1322 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 2935 3279 gene locus_tag LOCUS_30820 2935 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 3411 4520 gene locus_tag LOCUS_30830 3411 4520 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_30830 4733 7519 gene locus_tag LOCUS_30840 4733 7519 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057066.1 protein_id gnl|my_center|LOCUS_30840 7783 8196 gene locus_tag LOCUS_30850 7783 8196 CDS product RIP homotypic interaction motif-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229547.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence207 350 592 gene locus_tag LOCUS_30860 350 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 1266 3932 gene locus_tag LOCUS_30870 gene adhE 1266 3932 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056082.1 protein_id gnl|my_center|LOCUS_30870 4772 3999 gene locus_tag LOCUS_30880 gene gloB 4772 3999 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_30880 6668 4818 gene locus_tag LOCUS_30890 6668 4818 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928942.1 protein_id gnl|my_center|LOCUS_30890 7083 8234 gene locus_tag LOCUS_30900 7083 8234 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056253.1 protein_id gnl|my_center|LOCUS_30900 8339 8521 gene locus_tag LOCUS_30910 8339 8521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence208 602 63 gene locus_tag LOCUS_30920 602 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 688 1479 gene locus_tag LOCUS_30930 688 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30930 2524 1547 gene locus_tag LOCUS_30940 2524 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 2631 4229 gene locus_tag LOCUS_30950 gene gpmI 2631 4229 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_30950 4509 4748 gene locus_tag LOCUS_30960 gene secG 4509 4748 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_30960 4749 5465 gene locus_tag LOCUS_30970 4749 5465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_30970 5880 5509 gene locus_tag LOCUS_30980 5880 5509 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142420.1 protein_id gnl|my_center|LOCUS_30980 6080 5880 gene locus_tag LOCUS_30990 6080 5880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 6292 6537 gene locus_tag LOCUS_31000 6292 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 6534 7034 gene locus_tag LOCUS_31010 6534 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 7120 7299 gene locus_tag LOCUS_31020 7120 7299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31020 7499 8227 gene locus_tag LOCUS_31030 7499 8227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 >Feature sequence209 1191 259 gene locus_tag LOCUS_31040 1191 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 1607 1338 gene locus_tag LOCUS_31050 gene rpmA 1607 1338 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_31050 2031 1642 gene locus_tag LOCUS_31060 gene rplU 2031 1642 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056022.1 protein_id gnl|my_center|LOCUS_31060 2227 3147 gene locus_tag LOCUS_31070 gene murQ 2227 3147 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_31070 3175 4665 gene locus_tag LOCUS_31080 3175 4665 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_31080 4845 5210 gene locus_tag LOCUS_31090 4845 5210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 5320 5898 gene locus_tag LOCUS_31100 5320 5898 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_31100 6660 6070 gene locus_tag LOCUS_31110 6660 6070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 7171 6662 gene locus_tag LOCUS_31120 7171 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_31120 <8551 7203 gene locus_tag LOCUS_31130 <8551 7203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence210 194 553 gene locus_tag LOCUS_31140 gene psb28 194 553 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928665.1 protein_id gnl|my_center|LOCUS_31140 724 1671 gene locus_tag LOCUS_31150 724 1671 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056318.1 protein_id gnl|my_center|LOCUS_31150 2431 1706 gene locus_tag LOCUS_31160 2431 1706 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_31160 2660 4063 gene locus_tag LOCUS_31170 gene lysA 2660 4063 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_31170 4247 5005 gene locus_tag LOCUS_31180 4247 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 5002 5751 gene locus_tag LOCUS_31190 gene uppS 5002 5751 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_31190 5992 6306 gene locus_tag LOCUS_31200 5992 6306 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_31200 8415 6568 gene locus_tag LOCUS_31210 8415 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 >Feature sequence211 1046 264 gene locus_tag LOCUS_31220 1046 264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140293.1 protein_id gnl|my_center|LOCUS_31220 1834 1061 gene locus_tag LOCUS_31230 gene cbiQ 1834 1061 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140294.1 protein_id gnl|my_center|LOCUS_31230 2261 1938 gene locus_tag LOCUS_31240 2261 1938 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_31240 3018 2275 gene locus_tag LOCUS_31250 3018 2275 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_31250 3487 4677 gene locus_tag LOCUS_31260 3487 4677 CDS product ScyD/ScyE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092108067.1 protein_id gnl|my_center|LOCUS_31260 4881 5417 gene locus_tag LOCUS_31270 4881 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 5955 5776 gene locus_tag LOCUS_31280 5955 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 6087 6689 gene locus_tag LOCUS_31290 6087 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 6808 8229 gene locus_tag LOCUS_31300 6808 8229 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_31300 >Feature sequence212 427 1377 gene locus_tag LOCUS_31310 427 1377 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_31310 2400 1459 gene locus_tag LOCUS_31320 2400 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 2565 3824 gene locus_tag LOCUS_31330 gene coaBC 2565 3824 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_31330 3868 4167 gene locus_tag LOCUS_31340 3868 4167 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_31340 5171 6127 gene locus_tag LOCUS_31350 5171 6127 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_31350 7108 6221 gene locus_tag LOCUS_31360 7108 6221 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_31360 7517 7191 gene locus_tag LOCUS_31370 7517 7191 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_31370 7839 7537 gene locus_tag LOCUS_31380 gene ureA 7839 7537 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_31380 7931 8239 gene locus_tag LOCUS_31390 7931 8239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 8372 8193 gene locus_tag LOCUS_31400 8372 8193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence213 1778 603 gene locus_tag LOCUS_31410 1778 603 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142934.1 protein_id gnl|my_center|LOCUS_31410 2247 1786 gene locus_tag LOCUS_31420 2247 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 2738 2328 gene locus_tag LOCUS_31430 2738 2328 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_31430 3034 4743 gene locus_tag LOCUS_31440 gene menD 3034 4743 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_31440 4960 6093 gene locus_tag LOCUS_31450 4960 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 6510 6100 gene locus_tag LOCUS_31460 6510 6100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 6809 6552 gene locus_tag LOCUS_31470 6809 6552 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_31470 6841 8316 gene locus_tag LOCUS_31480 6841 8316 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_31480 >Feature sequence214 724 1878 gene locus_tag LOCUS_31490 724 1878 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057128.1 protein_id gnl|my_center|LOCUS_31490 2179 2015 gene locus_tag LOCUS_31500 2179 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 2306 3682 gene locus_tag LOCUS_31510 2306 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 3664 4635 gene locus_tag LOCUS_31520 3664 4635 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_31520 4644 7457 gene locus_tag LOCUS_31530 4644 7457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 >Feature sequence215 474 2753 gene locus_tag LOCUS_31540 gene glgB 474 2753 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_31540 3324 2923 gene locus_tag LOCUS_31550 3324 2923 CDS product fasciclin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141008.1 protein_id gnl|my_center|LOCUS_31550 4016 4972 gene locus_tag LOCUS_31560 4016 4972 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_31560 4975 8211 gene locus_tag LOCUS_31570 4975 8211 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920803.1 protein_id gnl|my_center|LOCUS_31570 >Feature sequence216 277 492 gene locus_tag LOCUS_31580 277 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 498 782 gene locus_tag LOCUS_31590 498 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 2233 863 gene locus_tag LOCUS_31600 2233 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 3024 2581 gene locus_tag LOCUS_31610 3024 2581 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_31610 3283 3011 gene locus_tag LOCUS_31620 3283 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 3954 3529 gene locus_tag LOCUS_31630 3954 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 4542 6188 gene locus_tag LOCUS_31640 4542 6188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 6386 6703 gene locus_tag LOCUS_31650 6386 6703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 6703 6897 gene locus_tag LOCUS_31660 6703 6897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31660 6898 7068 gene locus_tag LOCUS_31670 6898 7068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 7299 7162 gene locus_tag LOCUS_31680 7299 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 7427 7879 gene locus_tag LOCUS_31690 7427 7879 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence217 702 1892 gene locus_tag LOCUS_31700 702 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 2294 3823 gene locus_tag LOCUS_31710 gene zwf 2294 3823 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_31710 4083 5438 gene locus_tag LOCUS_31720 gene opcA 4083 5438 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_31720 5596 6180 gene locus_tag LOCUS_31730 5596 6180 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_31730 7539 6331 gene locus_tag LOCUS_31740 7539 6331 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_31740 7703 8113 gene locus_tag LOCUS_31750 7703 8113 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence218 537 761 gene locus_tag LOCUS_31760 537 761 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_31760 937 1527 gene locus_tag LOCUS_31770 937 1527 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_31770 1563 1847 gene locus_tag LOCUS_31780 1563 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_31780 2077 3087 gene locus_tag LOCUS_31790 gene egtD 2077 3087 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_31790 3128 4483 gene locus_tag LOCUS_31800 3128 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 4755 5189 gene locus_tag LOCUS_31810 4755 5189 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_31810 5325 7103 gene locus_tag LOCUS_31820 5325 7103 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_31820 7402 7902 gene locus_tag LOCUS_31830 7402 7902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 >Feature sequence219 240 1664 gene locus_tag LOCUS_31840 240 1664 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257074.1 protein_id gnl|my_center|LOCUS_31840 2323 1751 gene locus_tag LOCUS_31850 2323 1751 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_31850 3510 2350 gene locus_tag LOCUS_31860 3510 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 4866 3595 gene locus_tag LOCUS_31870 4866 3595 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_31870 5056 6324 gene locus_tag LOCUS_31880 5056 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 6545 6673 gene locus_tag LOCUS_31890 6545 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 6994 6833 gene locus_tag LOCUS_31900 6994 6833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 6986 7783 gene locus_tag LOCUS_31910 6986 7783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31910 >Feature sequence220 1237 1602 gene locus_tag LOCUS_31920 1237 1602 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_31920 1694 2224 gene locus_tag LOCUS_31930 1694 2224 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056202.1 protein_id gnl|my_center|LOCUS_31930 2314 4977 gene locus_tag LOCUS_31940 2314 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 5051 6262 gene locus_tag LOCUS_31950 5051 6262 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056224.1 protein_id gnl|my_center|LOCUS_31950 6709 7977 gene locus_tag LOCUS_31960 6709 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 >Feature sequence221 390 196 gene locus_tag LOCUS_31970 390 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 637 1212 gene locus_tag LOCUS_31980 637 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 1214 2893 gene locus_tag LOCUS_31990 1214 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 2905 3114 gene locus_tag LOCUS_32000 2905 3114 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_32000 3808 3314 gene locus_tag LOCUS_32010 3808 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_32010 4956 3808 gene locus_tag LOCUS_32020 gene yidC 4956 3808 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_32020 5436 5041 gene locus_tag LOCUS_32030 5436 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32030 5788 5426 gene locus_tag LOCUS_32040 5788 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32040 5952 5815 gene locus_tag LOCUS_32050 gene rpmH 5952 5815 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141474.1 protein_id gnl|my_center|LOCUS_32050 6043 8007 gene locus_tag LOCUS_32060 6043 8007 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_32060 >Feature sequence222 687 445 gene locus_tag LOCUS_32070 687 445 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809228.1 protein_id gnl|my_center|LOCUS_32070 957 688 gene locus_tag LOCUS_32080 957 688 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_32080 1541 1152 gene locus_tag LOCUS_32090 1541 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32090 1844 1542 gene locus_tag LOCUS_32100 1844 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 2497 2090 gene locus_tag LOCUS_32110 2497 2090 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142874.1 protein_id gnl|my_center|LOCUS_32110 2883 2497 gene locus_tag LOCUS_32120 2883 2497 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_32120 3143 2928 gene locus_tag LOCUS_32130 3143 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 3454 4455 gene locus_tag LOCUS_32140 3454 4455 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_32140 5378 4452 gene locus_tag LOCUS_32150 5378 4452 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_32150 6607 5549 gene locus_tag LOCUS_32160 6607 5549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 7608 6862 gene locus_tag LOCUS_32170 7608 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140907.1 protein_id gnl|my_center|LOCUS_32170 >Feature sequence223 469 1872 gene locus_tag LOCUS_32180 gene fumC 469 1872 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083118.1 protein_id gnl|my_center|LOCUS_32180 3514 2012 gene locus_tag LOCUS_32190 3514 2012 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_32190 5976 3649 gene locus_tag LOCUS_32200 5976 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 6737 6111 gene locus_tag LOCUS_32210 gene pth 6737 6111 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140541.1 protein_id gnl|my_center|LOCUS_32210 7011 6787 gene locus_tag LOCUS_32220 7011 6787 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140944.1 protein_id gnl|my_center|LOCUS_32220 7851 7450 gene locus_tag LOCUS_32230 7851 7450 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920646.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence224 746 228 gene locus_tag LOCUS_32240 746 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 981 1298 gene locus_tag LOCUS_32250 981 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 1310 1618 gene locus_tag LOCUS_32260 1310 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 1775 2608 gene locus_tag LOCUS_32270 gene xerD 1775 2608 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439987.1 protein_id gnl|my_center|LOCUS_32270 2711 3598 gene locus_tag LOCUS_32280 2711 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 3595 3789 gene locus_tag LOCUS_32290 3595 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 7044 4081 gene locus_tag LOCUS_32300 7044 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 >Feature sequence225 195 854 gene locus_tag LOCUS_32310 195 854 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_32310 1794 1072 gene locus_tag LOCUS_32320 gene grpE 1794 1072 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_32320 2035 4050 gene locus_tag LOCUS_32330 2035 4050 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_32330 4210 5310 gene locus_tag LOCUS_32340 4210 5310 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_32340 5718 6932 gene locus_tag LOCUS_32350 5718 6932 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_32350 7027 7563 gene locus_tag LOCUS_32360 7027 7563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524130.1 protein_id gnl|my_center|LOCUS_32360 >Feature sequence226 560 2929 gene locus_tag LOCUS_32370 gene atsD 560 2929 CDS product arylsulfatase AtsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403397.1 protein_id gnl|my_center|LOCUS_32370 3105 3779 gene locus_tag LOCUS_32380 3105 3779 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190428.1 protein_id gnl|my_center|LOCUS_32380 3876 4481 gene locus_tag LOCUS_32390 3876 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 4533 4916 gene locus_tag LOCUS_32400 4533 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 4932 5390 gene locus_tag LOCUS_32410 4932 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32410 5693 6055 gene locus_tag LOCUS_32420 5693 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 6579 6226 gene locus_tag LOCUS_32430 6579 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 6910 6572 gene locus_tag LOCUS_32440 6910 6572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 7074 7253 gene locus_tag LOCUS_32450 7074 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 7313 7552 gene locus_tag LOCUS_32460 7313 7552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 >Feature sequence227 1155 1394 gene locus_tag LOCUS_32470 1155 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 1384 1722 gene locus_tag LOCUS_32480 1384 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 2111 3259 gene locus_tag LOCUS_32490 gene dprA 2111 3259 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_32490 3592 3269 gene locus_tag LOCUS_32500 gene trxA 3592 3269 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_32500 3970 5175 gene locus_tag LOCUS_32510 3970 5175 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_32510 5730 5179 gene locus_tag LOCUS_32520 5730 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 6500 5844 gene locus_tag LOCUS_32530 6500 5844 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141737.1 protein_id gnl|my_center|LOCUS_32530 7358 6768 gene locus_tag LOCUS_32540 7358 6768 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_32540 >Feature sequence228 727 2199 gene locus_tag LOCUS_32550 gene murJ 727 2199 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058183.1 protein_id gnl|my_center|LOCUS_32550 2604 2275 gene locus_tag LOCUS_32560 2604 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 3330 2680 gene locus_tag LOCUS_32570 3330 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 4652 3372 gene locus_tag LOCUS_32580 gene hisS 4652 3372 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057735.1 protein_id gnl|my_center|LOCUS_32580 6583 4673 gene locus_tag LOCUS_32590 6583 4673 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083755.1 protein_id gnl|my_center|LOCUS_32590 6590 6898 gene locus_tag LOCUS_32600 6590 6898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 7032 7238 gene locus_tag LOCUS_32610 7032 7238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 7241 7468 gene locus_tag LOCUS_32620 7241 7468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence229 635 81 gene locus_tag LOCUS_32630 635 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 3369 1063 gene locus_tag LOCUS_32640 3369 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 4179 3382 gene locus_tag LOCUS_32650 4179 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 6640 4169 gene locus_tag LOCUS_32660 6640 4169 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056217.1 protein_id gnl|my_center|LOCUS_32660 7660 7169 gene locus_tag LOCUS_32670 7660 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 >Feature sequence230 709 320 gene locus_tag LOCUS_32680 709 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 708 1646 gene locus_tag LOCUS_32690 708 1646 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057118.1 protein_id gnl|my_center|LOCUS_32690 2325 1633 gene locus_tag LOCUS_32700 gene tpiA 2325 1633 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_32700 2735 3499 gene locus_tag LOCUS_32710 2735 3499 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337498.1 protein_id gnl|my_center|LOCUS_32710 4665 3418 gene locus_tag LOCUS_32720 4665 3418 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920848.1 protein_id gnl|my_center|LOCUS_32720 5424 4798 gene locus_tag LOCUS_32730 5424 4798 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057328.1 protein_id gnl|my_center|LOCUS_32730 6213 5491 gene locus_tag LOCUS_32740 gene pgl 6213 5491 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_32740 6538 7329 gene locus_tag LOCUS_32750 6538 7329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence231 863 132 gene locus_tag LOCUS_32760 863 132 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_32760 1306 968 gene locus_tag LOCUS_32770 1306 968 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_32770 1427 1600 gene locus_tag LOCUS_32780 1427 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 2305 3738 gene locus_tag LOCUS_32790 2305 3738 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_32790 3942 5390 gene locus_tag LOCUS_32800 3942 5390 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_32800 5587 6807 gene locus_tag LOCUS_32810 5587 6807 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228075.1 protein_id gnl|my_center|LOCUS_32810 6809 7471 gene locus_tag LOCUS_32820 6809 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 >Feature sequence232 933 2291 gene locus_tag LOCUS_32830 gene trxB 933 2291 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057761.1 protein_id gnl|my_center|LOCUS_32830 2413 3243 gene locus_tag LOCUS_32840 2413 3243 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_32840 3745 3446 gene locus_tag LOCUS_32850 3745 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3885 4691 gene locus_tag LOCUS_32860 3885 4691 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057297.1 protein_id gnl|my_center|LOCUS_32860 5055 5435 gene locus_tag LOCUS_32870 5055 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 6443 5466 gene locus_tag LOCUS_32880 gene fmt 6443 5466 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_32880 7300 6506 gene locus_tag LOCUS_32890 gene pgeF 7300 6506 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_32890 >Feature sequence233 142 552 gene locus_tag LOCUS_32900 142 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 641 1837 gene locus_tag LOCUS_32910 641 1837 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_32910 2572 1967 gene locus_tag LOCUS_32920 2572 1967 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_32920 4286 2673 gene locus_tag LOCUS_32930 gene metG 4286 2673 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_32930 4442 5158 gene locus_tag LOCUS_32940 4442 5158 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142237.1 protein_id gnl|my_center|LOCUS_32940 6018 5470 gene locus_tag LOCUS_32950 6018 5470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 6773 6159 gene locus_tag LOCUS_32960 6773 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32960 7494 6751 gene locus_tag LOCUS_32970 7494 6751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32970 >Feature sequence234 2026 395 gene locus_tag LOCUS_32980 2026 395 CDS product peptide ligase PGM1-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057239.1 protein_id gnl|my_center|LOCUS_32980 2832 2338 gene locus_tag LOCUS_32990 2832 2338 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_32990 3384 2965 gene locus_tag LOCUS_33000 3384 2965 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_33000 4195 3395 gene locus_tag LOCUS_33010 gene cobA 4195 3395 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_33010 4756 4466 gene locus_tag LOCUS_33020 4756 4466 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_33020 5056 4766 gene locus_tag LOCUS_33030 5056 4766 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_33030 5520 5257 gene locus_tag LOCUS_33040 5520 5257 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927120.1 protein_id gnl|my_center|LOCUS_33040 6485 5868 gene locus_tag LOCUS_33050 6485 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 >Feature sequence235 722 456 gene locus_tag LOCUS_33060 722 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 1123 737 gene locus_tag LOCUS_33070 1123 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 <7371 1531 gene locus_tag LOCUS_33080 <7371 1531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014467599.1:RHS repeat-associated core domain-containing protein >Feature sequence236 380 1414 gene locus_tag LOCUS_33090 gene pyrC 380 1414 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_33090 2750 1455 gene locus_tag LOCUS_33100 2750 1455 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682315.1 protein_id gnl|my_center|LOCUS_33100 3292 3149 gene locus_tag LOCUS_33110 3292 3149 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_33110 3569 5131 gene locus_tag LOCUS_33120 3569 5131 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_33120 5489 6562 gene locus_tag LOCUS_33130 5489 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 7008 6565 gene locus_tag LOCUS_33140 7008 6565 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144350.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence237 861 580 gene locus_tag LOCUS_33150 861 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 1712 1101 gene locus_tag LOCUS_33160 1712 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 2824 3141 gene locus_tag LOCUS_33170 2824 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 4038 3490 gene locus_tag LOCUS_33180 4038 3490 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_33180 4621 4157 gene locus_tag LOCUS_33190 gene smpB 4621 4157 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_33190 4823 5524 gene locus_tag LOCUS_33200 gene psb29 4823 5524 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_33200 5662 6798 gene locus_tag LOCUS_33210 gene cofH 5662 6798 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_33210 7171 6893 gene locus_tag LOCUS_33220 7171 6893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence238 73 360 gene locus_tag LOCUS_33230 73 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 1032 412 gene locus_tag LOCUS_33240 1032 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 1230 1448 gene locus_tag LOCUS_33250 1230 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 <7250 1542 gene locus_tag LOCUS_33260 <7250 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941413.1:fibronectin type III domain-containing protein >Feature sequence239 155 2227 gene locus_tag LOCUS_33270 155 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33270 2399 2647 gene locus_tag LOCUS_33280 2399 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 3086 2850 gene locus_tag LOCUS_33290 3086 2850 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_33290 3468 3163 gene locus_tag LOCUS_33300 3468 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 3557 6916 gene locus_tag LOCUS_33310 3557 6916 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_33310 >Feature sequence240 279 998 gene locus_tag LOCUS_33320 gene sfsA 279 998 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057534.1 protein_id gnl|my_center|LOCUS_33320 1739 1128 gene locus_tag LOCUS_33330 1739 1128 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_33330 2334 1762 gene locus_tag LOCUS_33340 2334 1762 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_33340 2823 2554 gene locus_tag LOCUS_33350 2823 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124299.1 protein_id gnl|my_center|LOCUS_33350 3368 3108 gene locus_tag LOCUS_33360 3368 3108 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_33360 3621 3361 gene locus_tag LOCUS_33370 3621 3361 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_33370 5486 3867 gene locus_tag LOCUS_33380 5486 3867 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_33380 6170 5499 gene locus_tag LOCUS_33390 6170 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 6628 6323 gene locus_tag LOCUS_33400 6628 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 >Feature sequence241 1769 714 gene locus_tag LOCUS_33410 gene aroF 1769 714 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_33410 2292 1828 gene locus_tag LOCUS_33420 2292 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 2586 2317 gene locus_tag LOCUS_33430 gene rpsO 2586 2317 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144014.1 protein_id gnl|my_center|LOCUS_33430 2871 3200 gene locus_tag LOCUS_33440 2871 3200 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141521.1 protein_id gnl|my_center|LOCUS_33440 4419 5846 gene locus_tag LOCUS_33450 gene glgA 4419 5846 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056608.1 protein_id gnl|my_center|LOCUS_33450 6516 5896 gene locus_tag LOCUS_33460 6516 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 6729 7061 gene locus_tag LOCUS_33470 6729 7061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence242 207 509 gene locus_tag LOCUS_33480 207 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 478 807 gene locus_tag LOCUS_33490 478 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 979 1482 gene locus_tag LOCUS_33500 979 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 2034 1465 gene locus_tag LOCUS_33510 2034 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33510 2171 3415 gene locus_tag LOCUS_33520 2171 3415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33520 3430 4557 gene locus_tag LOCUS_33530 3430 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 4607 5035 gene locus_tag LOCUS_33540 4607 5035 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_33540 5062 5424 gene locus_tag LOCUS_33550 5062 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_33550 5604 6143 gene locus_tag LOCUS_33560 5604 6143 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_33560 6674 6501 gene locus_tag LOCUS_33570 6674 6501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 >Feature sequence243 >Feature sequence244 757 569 gene locus_tag LOCUS_33580 757 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1781 948 gene locus_tag LOCUS_33590 1781 948 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_33590 2031 2375 gene locus_tag LOCUS_33600 2031 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 2444 3877 gene locus_tag LOCUS_33610 2444 3877 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920889.1 protein_id gnl|my_center|LOCUS_33610 5469 4114 gene locus_tag LOCUS_33620 5469 4114 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143065.1 protein_id gnl|my_center|LOCUS_33620 6765 5479 gene locus_tag LOCUS_33630 6765 5479 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence245 1066 449 gene locus_tag LOCUS_33640 1066 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1319 1576 gene locus_tag LOCUS_33650 1319 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 3990 1744 gene locus_tag LOCUS_33660 3990 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 5742 6776 gene locus_tag LOCUS_33670 gene pdhA 5742 6776 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence246 3389 291 gene locus_tag LOCUS_33680 3389 291 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921798.1 protein_id gnl|my_center|LOCUS_33680 5177 3663 gene locus_tag LOCUS_33690 5177 3663 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120143.1 protein_id gnl|my_center|LOCUS_33690 6249 5275 gene locus_tag LOCUS_33700 6249 5275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33700 >Feature sequence247 82 3579 gene locus_tag LOCUS_33710 gene mfd 82 3579 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_33710 3895 3805 gene locus_tag LOCUS_t00290 3895 3805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5108 4011 gene locus_tag LOCUS_33720 5108 4011 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_33720 6937 5108 gene locus_tag LOCUS_33730 6937 5108 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143667.1 protein_id gnl|my_center|LOCUS_33730 >Feature sequence248 265 1584 gene locus_tag LOCUS_33740 265 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33740 1904 3022 gene locus_tag LOCUS_33750 gene rfbG 1904 3022 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_33750 3097 4434 gene locus_tag LOCUS_33760 gene rfbH 3097 4434 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126347.1 protein_id gnl|my_center|LOCUS_33760 6724 6915 gene locus_tag LOCUS_33770 6724 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 >Feature sequence249 333 593 gene locus_tag LOCUS_33780 333 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 599 1006 gene locus_tag LOCUS_33790 599 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33790 1520 1104 gene locus_tag LOCUS_33800 1520 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33800 1765 1517 gene locus_tag LOCUS_33810 1765 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence250 1535 231 gene locus_tag LOCUS_33820 1535 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33820 2410 1538 gene locus_tag LOCUS_33830 2410 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 3767 2967 gene locus_tag LOCUS_33840 3767 2967 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_33840 3981 5060 gene locus_tag LOCUS_33850 3981 5060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_33850 5328 6365 gene locus_tag LOCUS_33860 gene csaB 5328 6365 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence251 779 84 gene locus_tag LOCUS_33870 gene purU 779 84 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_33870 1477 902 gene locus_tag LOCUS_33880 1477 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 1764 1522 gene locus_tag LOCUS_33890 1764 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 1974 2825 gene locus_tag LOCUS_33900 1974 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 4097 2931 gene locus_tag LOCUS_33910 4097 2931 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920638.1 protein_id gnl|my_center|LOCUS_33910 4231 4159 gene locus_tag LOCUS_t00300 4231 4159 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4551 4351 gene locus_tag LOCUS_33920 4551 4351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 5651 4887 gene locus_tag LOCUS_33930 gene hisF 5651 4887 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_33930 5675 6751 gene locus_tag LOCUS_33940 gene ruvB 5675 6751 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence252 205 1524 gene locus_tag LOCUS_33950 gene secY 205 1524 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055954.1 protein_id gnl|my_center|LOCUS_33950 1595 2161 gene locus_tag LOCUS_33960 1595 2161 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038393.1 protein_id gnl|my_center|LOCUS_33960 2949 3635 gene locus_tag LOCUS_33970 2949 3635 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_33970 3671 4270 gene locus_tag LOCUS_33980 3671 4270 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_33980 4377 4787 gene locus_tag LOCUS_33990 4377 4787 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706948.1 protein_id gnl|my_center|LOCUS_33990 5560 4880 gene locus_tag LOCUS_34000 5560 4880 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_34000 6391 5936 gene locus_tag LOCUS_34010 6391 5936 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056015.1 protein_id gnl|my_center|LOCUS_34010 6749 6447 gene locus_tag LOCUS_34020 6749 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence253 1244 1077 gene locus_tag LOCUS_34030 1244 1077 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705362.1 protein_id gnl|my_center|LOCUS_34030 1353 1718 gene locus_tag LOCUS_34040 1353 1718 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807198.1 protein_id gnl|my_center|LOCUS_34040 3222 1924 gene locus_tag LOCUS_34050 gene eno 3222 1924 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056505.1 protein_id gnl|my_center|LOCUS_34050 4030 3269 gene locus_tag LOCUS_34060 4030 3269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 6224 4146 gene locus_tag LOCUS_34070 gene glgX 6224 4146 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_34070 6287 6472 gene locus_tag LOCUS_34080 6287 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34080 >Feature sequence254 494 249 gene locus_tag LOCUS_34090 gene psaC 494 249 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_34090 746 2716 gene locus_tag LOCUS_34100 gene acs 746 2716 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056731.1 protein_id gnl|my_center|LOCUS_34100 2977 3552 gene locus_tag LOCUS_34110 2977 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 3592 4116 gene locus_tag LOCUS_34120 3592 4116 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356874.1 protein_id gnl|my_center|LOCUS_34120 4750 4244 gene locus_tag LOCUS_34130 4750 4244 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141597.1 protein_id gnl|my_center|LOCUS_34130 5441 4848 gene locus_tag LOCUS_34140 5441 4848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 6746 5556 gene locus_tag LOCUS_34150 6746 5556 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142859.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence255 394 146 gene locus_tag LOCUS_34160 394 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34160 642 307 gene locus_tag LOCUS_34170 642 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34170 6454 920 gene locus_tag LOCUS_34180 6454 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34180 >Feature sequence256 182 1315 gene locus_tag LOCUS_34190 182 1315 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_34190 2081 1323 gene locus_tag LOCUS_34200 2081 1323 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084858.1 protein_id gnl|my_center|LOCUS_34200 2230 3429 gene locus_tag LOCUS_34210 2230 3429 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_34210 3436 6738 gene locus_tag LOCUS_34220 3436 6738 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143976.1 protein_id gnl|my_center|LOCUS_34220 >Feature sequence257 2157 142 gene locus_tag LOCUS_34230 2157 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 3414 2212 gene locus_tag LOCUS_34240 3414 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 4829 3492 gene locus_tag LOCUS_34250 4829 3492 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_34250 5383 5961 gene locus_tag LOCUS_34260 5383 5961 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920879.1 protein_id gnl|my_center|LOCUS_34260 6471 6154 gene locus_tag LOCUS_34270 6471 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 >Feature sequence258 111 725 gene locus_tag LOCUS_34280 111 725 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_34280 1943 678 gene locus_tag LOCUS_34290 1943 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 2049 2600 gene locus_tag LOCUS_34300 2049 2600 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920633.1 protein_id gnl|my_center|LOCUS_34300 3027 2605 gene locus_tag LOCUS_34310 3027 2605 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_34310 4129 3377 gene locus_tag LOCUS_34320 4129 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 4465 5121 gene locus_tag LOCUS_34330 4465 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_34330 5145 5936 gene locus_tag LOCUS_34340 5145 5936 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141905.1 protein_id gnl|my_center|LOCUS_34340 6418 6071 gene locus_tag LOCUS_34350 6418 6071 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817423.1 protein_id gnl|my_center|LOCUS_34350 6724 6422 gene locus_tag LOCUS_34360 6724 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34360 >Feature sequence259 2284 116 gene locus_tag LOCUS_34370 gene ppk1 2284 116 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921077.1 protein_id gnl|my_center|LOCUS_34370 <6800 3080 gene locus_tag LOCUS_34380 <6800 3080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001257485.1:glycosyl hydrolase family 18 protein >Feature sequence260 76 366 gene locus_tag LOCUS_34390 76 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34390 904 467 gene locus_tag LOCUS_34400 904 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34400 2676 991 gene locus_tag LOCUS_34410 2676 991 CDS product DUF6345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226017.1 protein_id gnl|my_center|LOCUS_34410 4435 2708 gene locus_tag LOCUS_34420 4435 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 5092 4574 gene locus_tag LOCUS_34430 5092 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34430 5676 5494 gene locus_tag LOCUS_34440 5676 5494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 5718 6713 gene locus_tag LOCUS_34450 5718 6713 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951379.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence261 3 332 gene locus_tag LOCUS_34460 3 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 404 3028 gene locus_tag LOCUS_34470 gene alaS 404 3028 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057938.1 protein_id gnl|my_center|LOCUS_34470 3081 4580 gene locus_tag LOCUS_34480 3081 4580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_34480 4573 5334 gene locus_tag LOCUS_34490 4573 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34490 6428 6153 gene locus_tag LOCUS_34500 6428 6153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34500 >Feature sequence262 756 382 gene locus_tag LOCUS_34510 756 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34510 1670 771 gene locus_tag LOCUS_34520 1670 771 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938053.1 protein_id gnl|my_center|LOCUS_34520 2928 1759 gene locus_tag LOCUS_34530 2928 1759 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_34530 3961 3002 gene locus_tag LOCUS_34540 3961 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34540 4762 4028 gene locus_tag LOCUS_34550 4762 4028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34550 5079 4870 gene locus_tag LOCUS_34560 5079 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 6238 5174 gene locus_tag LOCUS_34570 6238 5174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34570 >Feature sequence263 1338 2591 gene locus_tag LOCUS_34580 1338 2591 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_34580 2788 2919 gene locus_tag LOCUS_34590 2788 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34590 4598 3003 gene locus_tag LOCUS_34600 4598 3003 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_34600 4791 5390 gene locus_tag LOCUS_34610 4791 5390 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_34610 5513 5980 gene locus_tag LOCUS_34620 5513 5980 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132355466.1 protein_id gnl|my_center|LOCUS_34620 6253 6080 gene locus_tag LOCUS_34630 6253 6080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence264 189 539 gene locus_tag LOCUS_34640 189 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 600 872 gene locus_tag LOCUS_34650 600 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 1363 1566 gene locus_tag LOCUS_34660 1363 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 1583 2830 gene locus_tag LOCUS_34670 1583 2830 CDS product GDL motif peptide-associated radical SAM/SPASM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200682.1 protein_id gnl|my_center|LOCUS_34670 2782 2973 gene locus_tag LOCUS_34680 2782 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 3806 3012 gene locus_tag LOCUS_34690 gene trpA 3806 3012 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_34690 4071 4988 gene locus_tag LOCUS_34700 4071 4988 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_34700 6174 5149 gene locus_tag LOCUS_34710 6174 5149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_34710 >Feature sequence265 577 152 gene locus_tag LOCUS_34720 577 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 946 587 gene locus_tag LOCUS_34730 946 587 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_34730 1202 1501 gene locus_tag LOCUS_34740 1202 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 1470 2117 gene locus_tag LOCUS_34750 1470 2117 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_34750 2500 2799 gene locus_tag LOCUS_34760 2500 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 3767 2835 gene locus_tag LOCUS_34770 3767 2835 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_34770 4215 6101 gene locus_tag LOCUS_34780 gene ftsH2 4215 6101 CDS product ATP-dependent zinc metalloprotease FtsH2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056581.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence266 1161 268 gene locus_tag LOCUS_34790 1161 268 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_34790 1400 1756 gene locus_tag LOCUS_34800 1400 1756 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_34800 1788 2918 gene locus_tag LOCUS_34810 1788 2918 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_34810 2972 3535 gene locus_tag LOCUS_34820 2972 3535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 3539 3790 gene locus_tag LOCUS_34830 3539 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 3902 4075 gene locus_tag LOCUS_34840 3902 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 5374 4115 gene locus_tag LOCUS_34850 5374 4115 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544926.1 protein_id gnl|my_center|LOCUS_34850 6142 5543 gene locus_tag LOCUS_34860 6142 5543 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_34860 >Feature sequence267 387 1196 gene locus_tag LOCUS_34870 387 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 2058 1366 gene locus_tag LOCUS_34880 2058 1366 CDS product CadD family cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485755.1 protein_id gnl|my_center|LOCUS_34880 3344 2334 gene locus_tag LOCUS_34890 gene cax 3344 2334 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_34890 4296 3499 gene locus_tag LOCUS_34900 gene pstB 4296 3499 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_34900 5292 4402 gene locus_tag LOCUS_34910 gene pstA 5292 4402 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_34910 6239 5298 gene locus_tag LOCUS_34920 gene pstC 6239 5298 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405018.1 protein_id gnl|my_center|LOCUS_34920 >Feature sequence268 342 716 gene locus_tag LOCUS_34930 342 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 905 1396 gene locus_tag LOCUS_34940 905 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 1383 1592 gene locus_tag LOCUS_34950 1383 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 2815 1817 gene locus_tag LOCUS_34960 2815 1817 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_34960 3192 2980 gene locus_tag LOCUS_34970 3192 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 3341 4117 gene locus_tag LOCUS_34980 3341 4117 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_34980 5111 4440 gene locus_tag LOCUS_34990 5111 4440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 5471 5118 gene locus_tag LOCUS_35000 5471 5118 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143142.1 protein_id gnl|my_center|LOCUS_35000 5680 5468 gene locus_tag LOCUS_35010 5680 5468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35010 6016 5735 gene locus_tag LOCUS_35020 6016 5735 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928995.1 protein_id gnl|my_center|LOCUS_35020 >Feature sequence269 141 611 gene locus_tag LOCUS_35030 141 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35030 713 1090 gene locus_tag LOCUS_35040 713 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1240 2133 gene locus_tag LOCUS_35050 1240 2133 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_35050 2229 2546 gene locus_tag LOCUS_35060 2229 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3101 2547 gene locus_tag LOCUS_35070 3101 2547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 4039 3239 gene locus_tag LOCUS_35080 gene xth 4039 3239 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_35080 4646 4062 gene locus_tag LOCUS_35090 4646 4062 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_35090 5204 4746 gene locus_tag LOCUS_35100 gene rplI 5204 4746 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_35100 5522 5809 gene locus_tag LOCUS_35110 5522 5809 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929315.1 protein_id gnl|my_center|LOCUS_35110 6246 5806 gene locus_tag LOCUS_35120 6246 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence270 431 1219 gene locus_tag LOCUS_35130 431 1219 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545759.1 protein_id gnl|my_center|LOCUS_35130 1379 1963 gene locus_tag LOCUS_35140 1379 1963 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_35140 2068 3456 gene locus_tag LOCUS_35150 2068 3456 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_35150 3456 3833 gene locus_tag LOCUS_35160 3456 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 3857 4138 gene locus_tag LOCUS_35170 3857 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 4641 4213 gene locus_tag LOCUS_35180 4641 4213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_35180 4839 6140 gene locus_tag LOCUS_35190 4839 6140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence271 285 1496 gene locus_tag LOCUS_35200 285 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 1676 3334 gene locus_tag LOCUS_35210 1676 3334 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057517.1 protein_id gnl|my_center|LOCUS_35210 3550 5199 gene locus_tag LOCUS_35220 3550 5199 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_35220 5600 5310 gene locus_tag LOCUS_35230 5600 5310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 6073 5666 gene locus_tag LOCUS_35240 6073 5666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence272 711 355 gene locus_tag LOCUS_35250 711 355 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_35250 1218 880 gene locus_tag LOCUS_35260 1218 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 1381 1196 gene locus_tag LOCUS_35270 1381 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 1925 1422 gene locus_tag LOCUS_35280 1925 1422 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_35280 2075 4345 gene locus_tag LOCUS_35290 gene purL 2075 4345 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_35290 4648 6111 gene locus_tag LOCUS_35300 gene purF 4648 6111 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence273 522 85 gene locus_tag LOCUS_35310 522 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 1298 597 gene locus_tag LOCUS_35320 1298 597 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_35320 1462 2130 gene locus_tag LOCUS_35330 1462 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 3070 2309 gene locus_tag LOCUS_35340 3070 2309 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057760.1 protein_id gnl|my_center|LOCUS_35340 3622 3071 gene locus_tag LOCUS_35350 3622 3071 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_35350 5439 3757 gene locus_tag LOCUS_35360 5439 3757 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057114.1 protein_id gnl|my_center|LOCUS_35360 <6290 5501 gene locus_tag LOCUS_35370 <6290 5501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054297574.1:IS200/IS605 family element RNA-guided endonuclease TnpB >Feature sequence274 286 570 gene locus_tag LOCUS_35380 286 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 564 839 gene locus_tag LOCUS_35390 564 839 CDS product type II toxin-antitoxin system YafQ family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812628.1 protein_id gnl|my_center|LOCUS_35390 1167 3035 gene locus_tag LOCUS_35400 1167 3035 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_35400 3119 3373 gene locus_tag LOCUS_35410 3119 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_35410 3366 3668 gene locus_tag LOCUS_35420 3366 3668 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_35420 3924 5009 gene locus_tag LOCUS_35430 gene ald 3924 5009 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143957.1 protein_id gnl|my_center|LOCUS_35430 5050 5829 gene locus_tag LOCUS_35440 5050 5829 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175245.1 protein_id gnl|my_center|LOCUS_35440 >Feature sequence275 637 2010 gene locus_tag LOCUS_35450 637 2010 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_35450 2441 2902 gene locus_tag LOCUS_35460 2441 2902 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_35460 4226 3012 gene locus_tag LOCUS_35470 4226 3012 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_35470 4649 4305 gene locus_tag LOCUS_35480 4649 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_35480 5234 5040 gene locus_tag LOCUS_35490 5234 5040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 5594 5944 gene locus_tag LOCUS_35500 5594 5944 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_35500 >Feature sequence276 461 1054 gene locus_tag LOCUS_35510 gene rdgB 461 1054 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_35510 1892 1017 gene locus_tag LOCUS_35520 gene lipA 1892 1017 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_35520 1993 2068 gene locus_tag LOCUS_t00310 1993 2068 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2271 5324 gene locus_tag LOCUS_35530 2271 5324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 5921 5481 gene locus_tag LOCUS_35540 5921 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35540 >Feature sequence277 1373 492 gene locus_tag LOCUS_35550 1373 492 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_35550 1553 2980 gene locus_tag LOCUS_35560 1553 2980 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057580.1 protein_id gnl|my_center|LOCUS_35560 3198 4415 gene locus_tag LOCUS_35570 3198 4415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_35570 4908 4477 gene locus_tag LOCUS_35580 4908 4477 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_35580 5038 5967 gene locus_tag LOCUS_35590 5038 5967 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence278 207 596 gene locus_tag LOCUS_35600 207 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 590 1009 gene locus_tag LOCUS_35610 590 1009 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911313.1 protein_id gnl|my_center|LOCUS_35610 2513 1230 gene locus_tag LOCUS_35620 2513 1230 CDS product DUF3086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056951.1 protein_id gnl|my_center|LOCUS_35620 3011 2595 gene locus_tag LOCUS_35630 3011 2595 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_35630 3851 3051 gene locus_tag LOCUS_35640 3851 3051 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_35640 5280 3946 gene locus_tag LOCUS_35650 gene ftsY 5280 3946 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056772.1 protein_id gnl|my_center|LOCUS_35650 5506 6093 gene locus_tag LOCUS_35660 5506 6093 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_35660 >Feature sequence279 1023 2003 gene locus_tag LOCUS_35670 gene cysK 1023 2003 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222180.1 protein_id gnl|my_center|LOCUS_35670 2141 2959 gene locus_tag LOCUS_35680 2141 2959 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194474.1 protein_id gnl|my_center|LOCUS_35680 3035 3967 gene locus_tag LOCUS_35690 3035 3967 CDS product family 2A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001107594.1 protein_id gnl|my_center|LOCUS_35690 4637 4317 gene locus_tag LOCUS_35700 4637 4317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 4620 5675 gene locus_tag LOCUS_35710 4620 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 >Feature sequence280 >Feature sequence281 1474 299 gene locus_tag LOCUS_35720 1474 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 2293 1847 gene locus_tag LOCUS_35730 2293 1847 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_35730 4538 2232 gene locus_tag LOCUS_35740 4538 2232 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971984.1 protein_id gnl|my_center|LOCUS_35740 5544 4885 gene locus_tag LOCUS_35750 5544 4885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence282 701 1054 gene locus_tag LOCUS_35760 701 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 1198 1671 gene locus_tag LOCUS_35770 1198 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35770 1674 1901 gene locus_tag LOCUS_35780 1674 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1921 2253 gene locus_tag LOCUS_35790 1921 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 2535 2774 gene locus_tag LOCUS_35800 2535 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35800 2771 2959 gene locus_tag LOCUS_35810 2771 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 3185 3391 gene locus_tag LOCUS_35820 3185 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 3391 3660 gene locus_tag LOCUS_35830 3391 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 3908 4195 gene locus_tag LOCUS_35840 3908 4195 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_35840 5354 4200 gene locus_tag LOCUS_35850 gene gshA 5354 4200 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_35850 5786 5394 gene locus_tag LOCUS_35860 gene ruvX 5786 5394 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence283 1648 119 gene locus_tag LOCUS_35870 1648 119 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056367.1 protein_id gnl|my_center|LOCUS_35870 2139 3611 gene locus_tag LOCUS_35880 gene gatB 2139 3611 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_35880 3866 4531 gene locus_tag LOCUS_35890 3866 4531 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920739.1 protein_id gnl|my_center|LOCUS_35890 5016 4549 gene locus_tag LOCUS_35900 5016 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35900 5829 5047 gene locus_tag LOCUS_35910 5829 5047 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920643.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence284 403 837 gene locus_tag LOCUS_35920 403 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 1226 2026 gene locus_tag LOCUS_35930 1226 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057863.1 protein_id gnl|my_center|LOCUS_35930 2032 2916 gene locus_tag LOCUS_35940 gene prmC 2032 2916 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_35940 3449 2913 gene locus_tag LOCUS_35950 3449 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 4114 3413 gene locus_tag LOCUS_35960 gene pyrF 4114 3413 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_35960 4593 4129 gene locus_tag LOCUS_35970 4593 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 5797 4616 gene locus_tag LOCUS_35980 5797 4616 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_35980 >Feature sequence285 1599 787 gene locus_tag LOCUS_35990 gene lpxC 1599 787 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_35990 3706 1685 gene locus_tag LOCUS_36000 3706 1685 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057626.1 protein_id gnl|my_center|LOCUS_36000 4351 4100 gene locus_tag LOCUS_36010 4351 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 4793 4305 gene locus_tag LOCUS_36020 4793 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 5479 5967 gene locus_tag LOCUS_36030 5479 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 >Feature sequence286 335 1759 gene locus_tag LOCUS_36040 335 1759 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_36040 3029 1788 gene locus_tag LOCUS_36050 3029 1788 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056626.1 protein_id gnl|my_center|LOCUS_36050 3372 3956 gene locus_tag LOCUS_36060 3372 3956 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057925.1 protein_id gnl|my_center|LOCUS_36060 4330 5664 gene locus_tag LOCUS_36070 4330 5664 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_36070 >Feature sequence287 1725 439 gene locus_tag LOCUS_36080 1725 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 3232 1994 gene locus_tag LOCUS_36090 3232 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 4281 3247 gene locus_tag LOCUS_36100 4281 3247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 4544 5155 gene locus_tag LOCUS_36110 4544 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 5312 5806 gene locus_tag LOCUS_36120 5312 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 >Feature sequence288 378 1304 gene locus_tag LOCUS_36130 gene argF 378 1304 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_36130 1437 1862 gene locus_tag LOCUS_36140 1437 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797542.1 protein_id gnl|my_center|LOCUS_36140 3415 1913 gene locus_tag LOCUS_36150 gene malQ 3415 1913 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_36150 4896 3772 gene locus_tag LOCUS_36160 4896 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227417.1 protein_id gnl|my_center|LOCUS_36160 5773 5288 gene locus_tag LOCUS_36170 5773 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 >Feature sequence289 1465 431 gene locus_tag LOCUS_36180 gene trpD 1465 431 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057551.1 protein_id gnl|my_center|LOCUS_36180 2072 1545 gene locus_tag LOCUS_36190 2072 1545 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_36190 2384 2971 gene locus_tag LOCUS_36200 2384 2971 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_36200 2974 3783 gene locus_tag LOCUS_36210 2974 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36210 4189 3719 gene locus_tag LOCUS_36220 4189 3719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence290 314 1081 gene locus_tag LOCUS_36230 314 1081 CDS product proteasome-type protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920648.1 protein_id gnl|my_center|LOCUS_36230 1113 1850 gene locus_tag LOCUS_36240 1113 1850 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975024.1 protein_id gnl|my_center|LOCUS_36240 1970 2389 gene locus_tag LOCUS_36250 1970 2389 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_36250 2382 3269 gene locus_tag LOCUS_36260 2382 3269 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056486.1 protein_id gnl|my_center|LOCUS_36260 3248 3332 gene locus_tag LOCUS_t00320 3248 3332 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3645 4070 gene locus_tag LOCUS_36270 3645 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 5315 4242 gene locus_tag LOCUS_36280 5315 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 >Feature sequence291 267 509 gene locus_tag LOCUS_36290 267 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 503 823 gene locus_tag LOCUS_36300 503 823 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_36300 1094 1306 gene locus_tag LOCUS_36310 1094 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36310 1806 1531 gene locus_tag LOCUS_36320 1806 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36320 1975 1691 gene locus_tag LOCUS_36330 1975 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 4404 2506 gene locus_tag LOCUS_36340 4404 2506 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_36340 5334 4651 gene locus_tag LOCUS_36350 5334 4651 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_36350 >Feature sequence292 110 460 gene locus_tag LOCUS_36360 110 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_36360 1030 461 gene locus_tag LOCUS_36370 1030 461 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_36370 1687 1049 gene locus_tag LOCUS_36380 1687 1049 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_36380 2921 2016 gene locus_tag LOCUS_36390 2921 2016 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_36390 3056 3574 gene locus_tag LOCUS_36400 3056 3574 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_36400 3582 3998 gene locus_tag LOCUS_36410 3582 3998 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_36410 4002 4631 gene locus_tag LOCUS_36420 4002 4631 CDS product DUF1361 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140730.1 protein_id gnl|my_center|LOCUS_36420 4977 5684 gene locus_tag LOCUS_36430 4977 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 >Feature sequence293 791 393 gene locus_tag LOCUS_36440 791 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36440 1074 775 gene locus_tag LOCUS_36450 1074 775 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_36450 1675 1139 gene locus_tag LOCUS_36460 1675 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 1807 2631 gene locus_tag LOCUS_36470 1807 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 2729 2529 gene locus_tag LOCUS_36480 2729 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36480 3123 3317 gene locus_tag LOCUS_36490 3123 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 3760 3344 gene locus_tag LOCUS_36500 3760 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 4336 5442 gene locus_tag LOCUS_36510 4336 5442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259230.1 protein_id gnl|my_center|LOCUS_36510 >Feature sequence294 316 516 gene locus_tag LOCUS_36520 316 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 958 2103 gene locus_tag LOCUS_36530 958 2103 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_36530 2815 2078 gene locus_tag LOCUS_36540 2815 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 3044 2793 gene locus_tag LOCUS_36550 3044 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 3198 4556 gene locus_tag LOCUS_36560 gene der 3198 4556 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_36560 4560 5435 gene locus_tag LOCUS_36570 4560 5435 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_36570 5446 5658 gene locus_tag LOCUS_36580 5446 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 >Feature sequence295 >Feature sequence296 1175 231 gene locus_tag LOCUS_36590 1175 231 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140702.1 protein_id gnl|my_center|LOCUS_36590 2118 1249 gene locus_tag LOCUS_36600 2118 1249 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_36600 2277 3194 gene locus_tag LOCUS_36610 2277 3194 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141275.1 protein_id gnl|my_center|LOCUS_36610 3310 4503 gene locus_tag LOCUS_36620 3310 4503 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_36620 4741 4550 gene locus_tag LOCUS_36630 4741 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 5051 4797 gene locus_tag LOCUS_36640 5051 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 5314 5051 gene locus_tag LOCUS_36650 5314 5051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 >Feature sequence297 1186 320 gene locus_tag LOCUS_36660 1186 320 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_36660 2187 1186 gene locus_tag LOCUS_36670 2187 1186 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_36670 3738 2302 gene locus_tag LOCUS_36680 3738 2302 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_36680 4164 4832 gene locus_tag LOCUS_36690 4164 4832 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_36690 4884 5366 gene locus_tag LOCUS_36700 gene petD 4884 5366 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_36700 >Feature sequence298 1028 369 gene locus_tag LOCUS_36710 1028 369 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_36710 1624 1046 gene locus_tag LOCUS_36720 1624 1046 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_36720 2028 1639 gene locus_tag LOCUS_36730 2028 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36730 2228 2004 gene locus_tag LOCUS_36740 2228 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 2259 2519 gene locus_tag LOCUS_36750 2259 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 2629 3267 gene locus_tag LOCUS_36760 gene hisH 2629 3267 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_36760 4008 3256 gene locus_tag LOCUS_36770 4008 3256 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_36770 5433 4318 gene locus_tag LOCUS_36780 5433 4318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 >Feature sequence299 1002 130 gene locus_tag LOCUS_36790 1002 130 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_36790 1779 1258 gene locus_tag LOCUS_36800 1779 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36800 2285 1905 gene locus_tag LOCUS_36810 2285 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 3549 2467 gene locus_tag LOCUS_36820 3549 2467 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_36820 5438 4815 gene locus_tag LOCUS_36830 5438 4815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 >Feature sequence300 513 2561 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctaatagggcttaagattaattggaac 3067 2795 gene locus_tag LOCUS_36840 gene cas2 3067 2795 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_36840 4084 3080 gene locus_tag LOCUS_36850 gene cas1 4084 3080 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_36850 4683 4090 gene locus_tag LOCUS_36860 gene cas4 4683 4090 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_36860 5522 4686 gene locus_tag LOCUS_36870 5522 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 >Feature sequence301 666 232 gene locus_tag LOCUS_36880 666 232 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_36880 891 2687 gene locus_tag LOCUS_36890 891 2687 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_199341128.1 protein_id gnl|my_center|LOCUS_36890 3151 5247 gene locus_tag LOCUS_36900 gene pta 3151 5247 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_36900 >Feature sequence302 1167 88 gene locus_tag LOCUS_36910 1167 88 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_36910 1605 1195 gene locus_tag LOCUS_36920 1605 1195 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258116.1 protein_id gnl|my_center|LOCUS_36920 1883 1593 gene locus_tag LOCUS_36930 1883 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 2604 3398 gene locus_tag LOCUS_36940 2604 3398 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084173.1 protein_id gnl|my_center|LOCUS_36940 3447 3806 gene locus_tag LOCUS_36950 gene trxA 3447 3806 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_36950 3823 5001 gene locus_tag LOCUS_36960 3823 5001 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_36960 5033 5170 gene locus_tag LOCUS_36970 5033 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence303 1176 169 gene locus_tag LOCUS_36980 1176 169 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_36980 2038 1388 gene locus_tag LOCUS_36990 2038 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 4579 2210 gene locus_tag LOCUS_37000 gene glgX 4579 2210 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258959.1 protein_id gnl|my_center|LOCUS_37000 5187 4870 gene locus_tag LOCUS_37010 5187 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37010 >Feature sequence304 588 1049 gene locus_tag LOCUS_37020 588 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_37020 1137 2261 gene locus_tag LOCUS_37030 gene tgt 1137 2261 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_37030 3266 2589 gene locus_tag LOCUS_37040 3266 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37040 4003 3641 gene locus_tag LOCUS_37050 4003 3641 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_37050 5006 4200 gene locus_tag LOCUS_37060 5006 4200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37060 5285 5136 gene locus_tag LOCUS_37070 5285 5136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence305 1212 232 gene locus_tag LOCUS_37080 gene chlG 1212 232 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920891.1 protein_id gnl|my_center|LOCUS_37080 2295 1219 gene locus_tag LOCUS_37090 2295 1219 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_37090 2716 2318 gene locus_tag LOCUS_37100 2716 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37100 3336 3004 gene locus_tag LOCUS_37110 3336 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 4518 3622 gene locus_tag LOCUS_37120 4518 3622 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057164.1 protein_id gnl|my_center|LOCUS_37120 5326 4976 gene locus_tag LOCUS_37130 5326 4976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37130 >Feature sequence306 220 2334 gene locus_tag LOCUS_37140 gene kdpB 220 2334 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140577.1 protein_id gnl|my_center|LOCUS_37140 2334 3434 gene locus_tag LOCUS_37150 2334 3434 CDS product HindVP family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038499775.1 protein_id gnl|my_center|LOCUS_37150 3431 4363 gene locus_tag LOCUS_37160 3431 4363 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_37160 4613 5257 gene locus_tag LOCUS_37170 gene kdpC 4613 5257 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140578.1 protein_id gnl|my_center|LOCUS_37170 >Feature sequence307 379 1563 gene locus_tag LOCUS_37180 379 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1641 3518 gene locus_tag LOCUS_37190 gene ftsH 1641 3518 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_37190 4487 3567 gene locus_tag LOCUS_37200 4487 3567 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_37200 >Feature sequence308 491 117 gene locus_tag LOCUS_37210 491 117 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_37210 646 1281 gene locus_tag LOCUS_37220 gene hisIE 646 1281 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_37220 1646 3031 gene locus_tag LOCUS_37230 gene lpdA 1646 3031 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830471.1 protein_id gnl|my_center|LOCUS_37230 3057 3680 gene locus_tag LOCUS_37240 gene tmk 3057 3680 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_37240 3685 5178 gene locus_tag LOCUS_37250 3685 5178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence309 329 256 gene locus_tag LOCUS_t00330 329 256 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2140 413 gene locus_tag LOCUS_37260 2140 413 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057217.1 protein_id gnl|my_center|LOCUS_37260 2720 2343 gene locus_tag LOCUS_37270 gene petE 2720 2343 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_37270 2913 3233 gene locus_tag LOCUS_37280 2913 3233 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_37280 3350 5029 gene locus_tag LOCUS_37290 3350 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence310 265 633 gene locus_tag LOCUS_37300 265 633 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_37300 1965 874 gene locus_tag LOCUS_37310 1965 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 2703 2029 gene locus_tag LOCUS_37320 2703 2029 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921118.1 protein_id gnl|my_center|LOCUS_37320 2781 3497 gene locus_tag LOCUS_37330 2781 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37330 4473 3520 gene locus_tag LOCUS_37340 4473 3520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256383.1 protein_id gnl|my_center|LOCUS_37340 >Feature sequence311 518 57 gene locus_tag LOCUS_37350 518 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 1042 842 gene locus_tag LOCUS_37360 1042 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 1785 1096 gene locus_tag LOCUS_37370 1785 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37370 2074 4281 gene locus_tag LOCUS_37380 2074 4281 CDS product PhoX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140564.1 protein_id gnl|my_center|LOCUS_37380 4897 4367 gene locus_tag LOCUS_37390 gene infC 4897 4367 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_37390 >Feature sequence312 297 1505 gene locus_tag LOCUS_37400 297 1505 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890088.1 protein_id gnl|my_center|LOCUS_37400 1735 3621 gene locus_tag LOCUS_37410 1735 3621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37410 3614 5176 gene locus_tag LOCUS_37420 3614 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37420 >Feature sequence313 259 1623 gene locus_tag LOCUS_37430 gene asnS 259 1623 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_37430 2016 1693 gene locus_tag LOCUS_37440 2016 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 2290 2006 gene locus_tag LOCUS_37450 2290 2006 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929718.1 protein_id gnl|my_center|LOCUS_37450 2538 3443 gene locus_tag LOCUS_37460 2538 3443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37460 3558 3746 gene locus_tag LOCUS_37470 3558 3746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3971 4333 gene locus_tag LOCUS_37480 3971 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 4570 4824 gene locus_tag LOCUS_37490 4570 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 4821 5162 gene locus_tag LOCUS_37500 4821 5162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 >Feature sequence314 165 971 gene locus_tag LOCUS_37510 165 971 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_37510 2403 1156 gene locus_tag LOCUS_37520 2403 1156 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143911.1 protein_id gnl|my_center|LOCUS_37520 2821 2414 gene locus_tag LOCUS_37530 2821 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057546.1 protein_id gnl|my_center|LOCUS_37530 3064 2993 gene locus_tag LOCUS_t00340 3064 2993 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3455 3135 gene locus_tag LOCUS_37540 3455 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 4056 3511 gene locus_tag LOCUS_37550 gene ribH 4056 3511 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_37550 4337 4149 gene locus_tag LOCUS_37560 4337 4149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 5169 4720 gene locus_tag LOCUS_37570 5169 4720 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112796.1 protein_id gnl|my_center|LOCUS_37570 >Feature sequence315 968 81 gene locus_tag LOCUS_37580 968 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 1084 2088 gene locus_tag LOCUS_37590 1084 2088 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_37590 2101 3534 gene locus_tag LOCUS_37600 2101 3534 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_37600 4009 3713 gene locus_tag LOCUS_37610 4009 3713 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057540.1 protein_id gnl|my_center|LOCUS_37610 4988 4122 gene locus_tag LOCUS_37620 gene rlmB 4988 4122 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_37620 >Feature sequence316 832 122 gene locus_tag LOCUS_37630 832 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37630 1137 1727 gene locus_tag LOCUS_37640 1137 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 1957 2403 gene locus_tag LOCUS_37650 1957 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37650 2563 4767 gene locus_tag LOCUS_37660 2563 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 4804 5220 gene locus_tag LOCUS_37670 4804 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 >Feature sequence317 67 423 gene locus_tag LOCUS_37680 67 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 416 2029 gene locus_tag LOCUS_37690 416 2029 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_37690 4485 2245 gene locus_tag LOCUS_37700 4485 2245 CDS product glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920844.1 protein_id gnl|my_center|LOCUS_37700 >Feature sequence318 431 1099 gene locus_tag LOCUS_37710 431 1099 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058278.1 protein_id gnl|my_center|LOCUS_37710 1641 1114 gene locus_tag LOCUS_37720 1641 1114 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143166.1 protein_id gnl|my_center|LOCUS_37720 1928 1635 gene locus_tag LOCUS_37730 1928 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37730 2712 2074 gene locus_tag LOCUS_37740 2712 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_37740 4438 2915 gene locus_tag LOCUS_37750 4438 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_37750 >Feature sequence319 283 576 gene locus_tag LOCUS_37760 283 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 573 938 gene locus_tag LOCUS_37770 573 938 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_37770 1134 2540 gene locus_tag LOCUS_37780 1134 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 2649 3014 gene locus_tag LOCUS_37790 2649 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 3164 3358 gene locus_tag LOCUS_37800 3164 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 3345 3548 gene locus_tag LOCUS_37810 3345 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 3654 3836 gene locus_tag LOCUS_37820 3654 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 3833 4024 gene locus_tag LOCUS_37830 3833 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 4315 4530 gene locus_tag LOCUS_37840 4315 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 >Feature sequence320 1459 1109 gene locus_tag LOCUS_37850 1459 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37850 2530 1553 gene locus_tag LOCUS_37860 2530 1553 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37860 2614 3864 gene locus_tag LOCUS_37870 2614 3864 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_37870 4505 3924 gene locus_tag LOCUS_37880 4505 3924 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_37880 4684 4914 gene locus_tag LOCUS_37890 4684 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence321 571 263 gene locus_tag LOCUS_37900 571 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37900 949 632 gene locus_tag LOCUS_37910 949 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37910 2040 946 gene locus_tag LOCUS_37920 2040 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37920 3915 2248 gene locus_tag LOCUS_37930 gene nadB 3915 2248 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_37930 4514 4107 gene locus_tag LOCUS_37940 gene psbU 4514 4107 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_37940 >Feature sequence322 896 138 gene locus_tag LOCUS_37950 896 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 2151 988 gene locus_tag LOCUS_37960 2151 988 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_37960 <5023 2353 gene locus_tag LOCUS_37970 <5023 2353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015613294.1:N-6 DNA methylase >Feature sequence323 45 341 gene locus_tag LOCUS_37980 45 341 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_37980 338 1747 gene locus_tag LOCUS_37990 338 1747 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_37990 2047 1808 gene locus_tag LOCUS_38000 2047 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 2591 4066 gene locus_tag LOCUS_38010 2591 4066 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057582.1 protein_id gnl|my_center|LOCUS_38010 >Feature sequence324 <1 1371 gene locus_tag LOCUS_38020 <1 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878349.1:Na+/H+ antiporter 2139 1390 gene locus_tag LOCUS_38030 2139 1390 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_38030 2601 2152 gene locus_tag LOCUS_38040 2601 2152 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929036.1 protein_id gnl|my_center|LOCUS_38040 2896 4080 gene locus_tag LOCUS_38050 2896 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 4077 4805 gene locus_tag LOCUS_38060 4077 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence325 123 818 gene locus_tag LOCUS_38070 gene fabG 123 818 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144338.1 protein_id gnl|my_center|LOCUS_38070 888 1544 gene locus_tag LOCUS_38080 gene plsY 888 1544 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056950.1 protein_id gnl|my_center|LOCUS_38080 2128 1715 gene locus_tag LOCUS_38090 2128 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 2492 2154 gene locus_tag LOCUS_38100 2492 2154 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_38100 2990 2520 gene locus_tag LOCUS_38110 2990 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 4422 3625 gene locus_tag LOCUS_38120 gene dapB 4422 3625 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920961.1 protein_id gnl|my_center|LOCUS_38120 >Feature sequence326 164 367 gene locus_tag LOCUS_38130 164 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 388 669 gene locus_tag LOCUS_38140 388 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38140 1721 801 gene locus_tag LOCUS_38150 1721 801 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143980.1 protein_id gnl|my_center|LOCUS_38150 1868 2551 gene locus_tag LOCUS_38160 1868 2551 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633409.1 protein_id gnl|my_center|LOCUS_38160 2869 3303 gene locus_tag LOCUS_38170 2869 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 4111 3314 gene locus_tag LOCUS_38180 4111 3314 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223173767.1 protein_id gnl|my_center|LOCUS_38180 4386 4697 gene locus_tag LOCUS_38190 4386 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 >Feature sequence327 <1 702 gene locus_tag LOCUS_38200 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583766.1:agmatinase 749 822 gene locus_tag LOCUS_t00350 749 822 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 903 1952 gene locus_tag LOCUS_38210 903 1952 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057531.1 protein_id gnl|my_center|LOCUS_38210 2170 2042 gene locus_tag LOCUS_38220 2170 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 3149 2466 gene locus_tag LOCUS_38230 3149 2466 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_38230 3980 3471 gene locus_tag LOCUS_38240 3980 3471 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence328 376 1752 gene locus_tag LOCUS_38250 376 1752 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920940.1 protein_id gnl|my_center|LOCUS_38250 2451 2065 gene locus_tag LOCUS_38260 2451 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 2774 4633 gene locus_tag LOCUS_38270 2774 4633 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence329 392 1291 gene locus_tag LOCUS_38280 392 1291 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000588823.1 protein_id gnl|my_center|LOCUS_38280 2278 2027 gene locus_tag LOCUS_38290 2278 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 2533 2279 gene locus_tag LOCUS_38300 2533 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 3017 2700 gene locus_tag LOCUS_38310 3017 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 3369 3052 gene locus_tag LOCUS_38320 3369 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 3773 3985 gene locus_tag LOCUS_38330 3773 3985 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921047.1 protein_id gnl|my_center|LOCUS_38330 4052 4831 gene locus_tag LOCUS_38340 4052 4831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence330 636 1553 gene locus_tag LOCUS_38350 636 1553 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_38350 1564 2259 gene locus_tag LOCUS_38360 1564 2259 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_38360 2402 2842 gene locus_tag LOCUS_38370 2402 2842 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141481.1 protein_id gnl|my_center|LOCUS_38370 3482 3820 gene locus_tag LOCUS_38380 3482 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 >Feature sequence331 466 1680 gene locus_tag LOCUS_38390 466 1680 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_38390 2942 1686 gene locus_tag LOCUS_38400 gene hisD 2942 1686 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058085.1 protein_id gnl|my_center|LOCUS_38400 3249 4595 gene locus_tag LOCUS_38410 gene accC 3249 4595 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence332 217 600 gene locus_tag LOCUS_38420 217 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 1023 760 gene locus_tag LOCUS_38430 1023 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38430 1400 1281 gene locus_tag LOCUS_38440 1400 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2216 2506 gene locus_tag LOCUS_38450 2216 2506 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141164.1 protein_id gnl|my_center|LOCUS_38450 2496 2849 gene locus_tag LOCUS_38460 2496 2849 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_38460 4064 2904 gene locus_tag LOCUS_38470 4064 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 >Feature sequence333 560 1339 gene locus_tag LOCUS_38480 560 1339 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_38480 1537 2001 gene locus_tag LOCUS_38490 1537 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2418 3239 gene locus_tag LOCUS_38500 2418 3239 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 protein_id gnl|my_center|LOCUS_38500 3297 4163 gene locus_tag LOCUS_38510 3297 4163 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_38510 >Feature sequence334 2482 890 gene locus_tag LOCUS_38520 2482 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 >Feature sequence335 2859 808 gene locus_tag LOCUS_38530 2859 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38530 3783 3160 gene locus_tag LOCUS_38540 3783 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 4305 4180 gene locus_tag LOCUS_38550 4305 4180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence336 283 2928 gene locus_tag LOCUS_38560 283 2928 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141744.1 protein_id gnl|my_center|LOCUS_38560 4359 2935 gene locus_tag LOCUS_38570 4359 2935 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence337 1637 294 gene locus_tag LOCUS_38580 1637 294 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920812.1 protein_id gnl|my_center|LOCUS_38580 2277 1735 gene locus_tag LOCUS_38590 2277 1735 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_38590 3749 2280 gene locus_tag LOCUS_38600 3749 2280 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056379.1 protein_id gnl|my_center|LOCUS_38600 3934 4398 gene locus_tag LOCUS_38610 3934 4398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920763.1 protein_id gnl|my_center|LOCUS_38610 >Feature sequence338 313 1242 gene locus_tag LOCUS_38620 313 1242 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056823.1 protein_id gnl|my_center|LOCUS_38620 1270 1602 gene locus_tag LOCUS_38630 1270 1602 CDS product BON domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174551.1 protein_id gnl|my_center|LOCUS_38630 1749 4301 gene locus_tag LOCUS_38640 gene leuS 1749 4301 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence339 1137 112 gene locus_tag LOCUS_38650 1137 112 CDS product sulfonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199695.1 protein_id gnl|my_center|LOCUS_38650 1558 2241 gene locus_tag LOCUS_38660 1558 2241 CDS product cadmium resistance transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948539.1 protein_id gnl|my_center|LOCUS_38660 2510 3439 gene locus_tag LOCUS_38670 2510 3439 CDS product sulfate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056129.1 protein_id gnl|my_center|LOCUS_38670 3534 4475 gene locus_tag LOCUS_38680 3534 4475 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227811.1 protein_id gnl|my_center|LOCUS_38680 >Feature sequence340 547 1680 gene locus_tag LOCUS_38690 547 1680 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345474.1 protein_id gnl|my_center|LOCUS_38690 1796 2026 gene locus_tag LOCUS_38700 1796 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 2135 3295 gene locus_tag LOCUS_38710 2135 3295 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121451.1 protein_id gnl|my_center|LOCUS_38710 4328 3552 gene locus_tag LOCUS_38720 4328 3552 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_38720 >Feature sequence341 285 1568 gene locus_tag LOCUS_38730 285 1568 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141361.1 protein_id gnl|my_center|LOCUS_38730 <4570 1843 gene locus_tag LOCUS_38740 <4570 1843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence342 1493 393 gene locus_tag LOCUS_38750 gene prfA 1493 393 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056003.1 protein_id gnl|my_center|LOCUS_38750 2117 4270 gene locus_tag LOCUS_38760 2117 4270 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058027.1 protein_id gnl|my_center|LOCUS_38760 >Feature sequence343 317 583 gene locus_tag LOCUS_38770 317 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_38770 742 2643 gene locus_tag LOCUS_38780 gene glmS 742 2643 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921151.1 protein_id gnl|my_center|LOCUS_38780 2824 3141 gene locus_tag LOCUS_38790 2824 3141 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_38790 3780 3286 gene locus_tag LOCUS_38800 3780 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence344 889 497 gene locus_tag LOCUS_38810 889 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 2041 2325 gene locus_tag LOCUS_38820 2041 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 2516 2962 gene locus_tag LOCUS_38830 2516 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 3152 3625 gene locus_tag LOCUS_38840 3152 3625 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000281042.1 protein_id gnl|my_center|LOCUS_38840 4213 4479 gene locus_tag LOCUS_38850 4213 4479 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131963.1 protein_id gnl|my_center|LOCUS_38850 >Feature sequence345 222 809 gene locus_tag LOCUS_38860 gene hemJ 222 809 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143033.1 protein_id gnl|my_center|LOCUS_38860 1204 2667 gene locus_tag LOCUS_38870 1204 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 2823 3476 gene locus_tag LOCUS_38880 gene nusB 2823 3476 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056630.1 protein_id gnl|my_center|LOCUS_38880 3968 3495 gene locus_tag LOCUS_38890 3968 3495 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_38890 4400 3990 gene locus_tag LOCUS_38900 gene gloA 4400 3990 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_38900 >Feature sequence346 71 268 gene locus_tag LOCUS_38910 71 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 2275 1424 gene locus_tag LOCUS_38920 gene murI 2275 1424 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_38920 4271 2373 gene locus_tag LOCUS_38930 4271 2373 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920663.1 protein_id gnl|my_center|LOCUS_38930 >Feature sequence347 266 835 gene locus_tag LOCUS_38940 266 835 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_38940 867 1076 gene locus_tag LOCUS_38950 867 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 1799 2773 gene locus_tag LOCUS_38960 gene arsM 1799 2773 CDS product arsenosugar biosynthesis arsenite methyltransferase ArsM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143344.1 protein_id gnl|my_center|LOCUS_38960 2887 3864 gene locus_tag LOCUS_38970 gene arsS 2887 3864 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272452.1 protein_id gnl|my_center|LOCUS_38970 4372 4100 gene locus_tag LOCUS_38980 4372 4100 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_38980 >Feature sequence348 1004 162 gene locus_tag LOCUS_38990 gene folP 1004 162 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_38990 1908 1111 gene locus_tag LOCUS_39000 1908 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 2724 2065 gene locus_tag LOCUS_39010 2724 2065 CDS product ATP synthase F0 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057008.1 protein_id gnl|my_center|LOCUS_39010 3234 2761 gene locus_tag LOCUS_39020 gene coaD 3234 2761 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_39020 3515 3231 gene locus_tag LOCUS_39030 3515 3231 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057607.1 protein_id gnl|my_center|LOCUS_39030 3866 3549 gene locus_tag LOCUS_39040 gene trxA 3866 3549 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_39040 >Feature sequence349 <1 802 gene locus_tag LOCUS_39050 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056941.1:serine/threonine-protein kinase 1027 1602 gene locus_tag LOCUS_39060 gene def 1027 1602 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_39060 1634 1831 gene locus_tag LOCUS_39070 1634 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057514.1 protein_id gnl|my_center|LOCUS_39070 2093 2410 gene locus_tag LOCUS_39080 2093 2410 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_39080 4132 2492 gene locus_tag LOCUS_39090 4132 2492 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056613.1 protein_id gnl|my_center|LOCUS_39090 >Feature sequence350 694 1443 gene locus_tag LOCUS_39100 694 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1809 2510 gene locus_tag LOCUS_39110 1809 2510 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888749.1 protein_id gnl|my_center|LOCUS_39110 2779 4296 gene locus_tag LOCUS_39120 2779 4296 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057656.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence351 1052 297 gene locus_tag LOCUS_39130 1052 297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143324.1 protein_id gnl|my_center|LOCUS_39130 1802 1053 gene locus_tag LOCUS_39140 1802 1053 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143325.1 protein_id gnl|my_center|LOCUS_39140 3102 2227 gene locus_tag LOCUS_39150 3102 2227 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546238.1 protein_id gnl|my_center|LOCUS_39150 3268 3768 gene locus_tag LOCUS_39160 3268 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 3894 4148 gene locus_tag LOCUS_39170 3894 4148 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377382.1 protein_id gnl|my_center|LOCUS_39170 >Feature sequence352 975 328 gene locus_tag LOCUS_39180 975 328 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_39180 1724 1077 gene locus_tag LOCUS_39190 1724 1077 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140508.1 protein_id gnl|my_center|LOCUS_39190 4108 1760 gene locus_tag LOCUS_39200 4108 1760 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096663323.1 protein_id gnl|my_center|LOCUS_39200 >Feature sequence353 1783 218 gene locus_tag LOCUS_39210 1783 218 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193934126.1 protein_id gnl|my_center|LOCUS_39210 2342 2497 gene locus_tag LOCUS_39220 2342 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39220 2859 3959 gene locus_tag LOCUS_39230 2859 3959 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence354 571 125 gene locus_tag LOCUS_39240 571 125 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_39240 791 558 gene locus_tag LOCUS_39250 791 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39250 1212 1664 gene locus_tag LOCUS_39260 1212 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 1805 1969 gene locus_tag LOCUS_39270 1805 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39270 1985 2542 gene locus_tag LOCUS_39280 1985 2542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39280 2792 3325 gene locus_tag LOCUS_39290 2792 3325 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_39290 3554 4144 gene locus_tag LOCUS_39300 3554 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence355 916 788 gene locus_tag LOCUS_39310 916 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 1006 1440 gene locus_tag LOCUS_39320 1006 1440 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_39320 1610 1470 gene locus_tag LOCUS_39330 1610 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 <4188 1635 gene locus_tag LOCUS_39340 <4188 1635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence356 242 1333 gene locus_tag LOCUS_39350 242 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 3979 1730 gene locus_tag LOCUS_39360 3979 1730 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057331.1 protein_id gnl|my_center|LOCUS_39360 >Feature sequence357 772 89 gene locus_tag LOCUS_39370 772 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144095.1 protein_id gnl|my_center|LOCUS_39370 1640 786 gene locus_tag LOCUS_39380 1640 786 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_39380 2117 1644 gene locus_tag LOCUS_39390 2117 1644 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125731.1 protein_id gnl|my_center|LOCUS_39390 2554 3903 gene locus_tag LOCUS_39400 2554 3903 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921237.1 protein_id gnl|my_center|LOCUS_39400 3997 3925 gene locus_tag LOCUS_t00360 3997 3925 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence358 1752 274 gene locus_tag LOCUS_39410 1752 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39410 2559 2203 gene locus_tag LOCUS_39420 2559 2203 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_39420 3242 2904 gene locus_tag LOCUS_39430 3242 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 3493 3846 gene locus_tag LOCUS_39440 3493 3846 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence359 245 1108 gene locus_tag LOCUS_39450 245 1108 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_39450 1406 2029 gene locus_tag LOCUS_39460 1406 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 2124 2819 gene locus_tag LOCUS_39470 2124 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 2902 3438 gene locus_tag LOCUS_39480 2902 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39480 3457 3729 gene locus_tag LOCUS_39490 3457 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 3862 4050 gene locus_tag LOCUS_39500 3862 4050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39500 >Feature sequence360 469 83 gene locus_tag LOCUS_39510 469 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 1536 592 gene locus_tag LOCUS_39520 1536 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 2604 2323 gene locus_tag LOCUS_39530 2604 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 2678 3181 gene locus_tag LOCUS_39540 2678 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence361 333 770 gene locus_tag LOCUS_39550 gene cynS 333 770 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896757.1 protein_id gnl|my_center|LOCUS_39550 1150 1458 gene locus_tag LOCUS_39560 1150 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 1374 1616 gene locus_tag LOCUS_39570 1374 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 2384 1620 gene locus_tag LOCUS_39580 2384 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 2838 4049 gene locus_tag LOCUS_39590 2838 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence362 868 197 gene locus_tag LOCUS_39600 868 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39600 927 1826 gene locus_tag LOCUS_39610 927 1826 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_39610 2484 2083 gene locus_tag LOCUS_39620 gene aroH 2484 2083 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_39620 3374 2553 gene locus_tag LOCUS_39630 gene sppA 3374 2553 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence363 1329 127 gene locus_tag LOCUS_39640 1329 127 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_39640 2595 1372 gene locus_tag LOCUS_39650 2595 1372 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902302.1 protein_id gnl|my_center|LOCUS_39650 2865 4052 gene locus_tag LOCUS_39660 2865 4052 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012165757.1 protein_id gnl|my_center|LOCUS_39660 >Feature sequence364 496 248 gene locus_tag LOCUS_39670 496 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 902 579 gene locus_tag LOCUS_39680 902 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1178 1035 gene locus_tag LOCUS_39690 1178 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 1541 2182 gene locus_tag LOCUS_39700 1541 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 2581 2315 gene locus_tag LOCUS_39710 2581 2315 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_39710 2834 2574 gene locus_tag LOCUS_39720 2834 2574 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000587616.1 protein_id gnl|my_center|LOCUS_39720 3242 3102 gene locus_tag LOCUS_39730 3242 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 3484 3239 gene locus_tag LOCUS_39740 3484 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence365 3993 1609 gene locus_tag LOCUS_39750 3993 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 >Feature sequence366 2040 400 gene locus_tag LOCUS_39760 gene hmpF 2040 400 CDS product pilus motility taxis protein HmpF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058194.1 protein_id gnl|my_center|LOCUS_39760 3350 2019 gene locus_tag LOCUS_39770 3350 2019 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_39770 >Feature sequence367 1920 115 gene locus_tag LOCUS_39780 1920 115 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057670.1 protein_id gnl|my_center|LOCUS_39780 3757 2282 gene locus_tag LOCUS_39790 3757 2282 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_39790 >Feature sequence368 1256 162 gene locus_tag LOCUS_39800 1256 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 2089 1364 gene locus_tag LOCUS_39810 2089 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 3561 2095 gene locus_tag LOCUS_39820 3561 2095 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929293.1 protein_id gnl|my_center|LOCUS_39820 >Feature sequence369 1068 91 gene locus_tag LOCUS_39830 1068 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 2666 1098 gene locus_tag LOCUS_39840 2666 1098 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_39840 3117 2725 gene locus_tag LOCUS_39850 3117 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 3668 3198 gene locus_tag LOCUS_39860 3668 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39860 >Feature sequence370 337 203 gene locus_tag LOCUS_39870 337 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 556 1914 gene locus_tag LOCUS_39880 gene glmU 556 1914 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_39880 3709 2264 gene locus_tag LOCUS_39890 3709 2264 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_39890 >Feature sequence371 2109 94 gene locus_tag LOCUS_39900 2109 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 2500 3477 gene locus_tag LOCUS_39910 2500 3477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence372 1009 116 gene locus_tag LOCUS_39920 1009 116 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_39920 1763 969 gene locus_tag LOCUS_39930 1763 969 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_39930 2552 1953 gene locus_tag LOCUS_39940 2552 1953 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932882.1 protein_id gnl|my_center|LOCUS_39940 3185 3379 gene locus_tag LOCUS_39950 gene psbH 3185 3379 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_39950 3484 3732 gene locus_tag LOCUS_39960 3484 3732 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence373 2247 268 gene locus_tag LOCUS_39970 gene ppsA 2247 268 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005629687.1 protein_id gnl|my_center|LOCUS_39970 2748 3443 gene locus_tag LOCUS_39980 2748 3443 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_39980 >Feature sequence374 139 456 gene locus_tag LOCUS_39990 139 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 783 577 gene locus_tag LOCUS_40000 783 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 1014 1625 gene locus_tag LOCUS_40010 1014 1625 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_40010 1908 1654 gene locus_tag LOCUS_40020 1908 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 3611 1905 gene locus_tag LOCUS_40030 3611 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 >Feature sequence375 441 1745 gene locus_tag LOCUS_40040 gene thrC 441 1745 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056826.1 protein_id gnl|my_center|LOCUS_40040 1824 2099 gene locus_tag LOCUS_40050 1824 2099 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_40050 2613 2323 gene locus_tag LOCUS_40060 2613 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 2780 2601 gene locus_tag LOCUS_40070 2780 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 3458 2991 gene locus_tag LOCUS_40080 3458 2991 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_40080 >Feature sequence376 1090 350 gene locus_tag LOCUS_40090 1090 350 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_40090 1892 2611 gene locus_tag LOCUS_40100 1892 2611 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_40100 >Feature sequence377 696 217 gene locus_tag LOCUS_40110 696 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 917 1363 gene locus_tag LOCUS_40120 917 1363 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391317.1 protein_id gnl|my_center|LOCUS_40120 1488 1943 gene locus_tag LOCUS_40130 1488 1943 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_40130 2740 1952 gene locus_tag LOCUS_40140 2740 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058196.1 protein_id gnl|my_center|LOCUS_40140 3309 2797 gene locus_tag LOCUS_40150 3309 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 >Feature sequence378 196 891 gene locus_tag LOCUS_40160 196 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 897 1169 gene locus_tag LOCUS_40170 897 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_40170 1426 2169 gene locus_tag LOCUS_40180 1426 2169 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_40180 3528 2212 gene locus_tag LOCUS_40190 3528 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40190 >Feature sequence379 2851 1013 gene locus_tag LOCUS_40200 2851 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 <3730 2855 gene locus_tag LOCUS_40210 <3730 2855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001032249.1:molybdate ABC transporter substrate-binding protein >Feature sequence380 1013 249 gene locus_tag LOCUS_40220 gene cobS 1013 249 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_40220 1284 1643 gene locus_tag LOCUS_40230 1284 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 1971 2456 gene locus_tag LOCUS_40240 1971 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 2459 2644 gene locus_tag LOCUS_40250 2459 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 2871 3146 gene locus_tag LOCUS_40260 2871 3146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 3143 3556 gene locus_tag LOCUS_40270 3143 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 >Feature sequence381 <1 1577 gene locus_tag LOCUS_40280 <1 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142355.1:gamma-glutamyltransferase 1646 3166 gene locus_tag LOCUS_40290 1646 3166 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_40290 3484 3221 gene locus_tag LOCUS_40300 3484 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence382 174 2114 gene locus_tag LOCUS_40310 174 2114 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_40310 2599 2144 gene locus_tag LOCUS_40320 2599 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 2746 2877 gene locus_tag LOCUS_40330 2746 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 3479 3102 gene locus_tag LOCUS_40340 3479 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40340 >Feature sequence383 88 1407 gene locus_tag LOCUS_40350 88 1407 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530640.1 protein_id gnl|my_center|LOCUS_40350 1455 1685 gene locus_tag LOCUS_40360 1455 1685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 1703 2677 gene locus_tag LOCUS_40370 1703 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40370 2738 3598 gene locus_tag LOCUS_40380 2738 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40380 >Feature sequence384 936 91 gene locus_tag LOCUS_40390 936 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 1160 1717 gene locus_tag LOCUS_40400 gene efp 1160 1717 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057134.1 protein_id gnl|my_center|LOCUS_40400 1885 2379 gene locus_tag LOCUS_40410 gene accB 1885 2379 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_40410 2385 3371 gene locus_tag LOCUS_40420 2385 3371 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055856.1 protein_id gnl|my_center|LOCUS_40420 >Feature sequence385 1514 258 gene locus_tag LOCUS_40430 1514 258 CDS product GAF domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056050.1 protein_id gnl|my_center|LOCUS_40430 1909 2229 gene locus_tag LOCUS_40440 1909 2229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40440 <3644 2377 gene locus_tag LOCUS_40450 <3644 2377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233171.1:subtilisin AprE >Feature sequence386 483 884 gene locus_tag LOCUS_40460 483 884 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_40460 1689 2060 gene locus_tag LOCUS_40470 1689 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 2467 3282 gene locus_tag LOCUS_40480 2467 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 >Feature sequence387 872 477 gene locus_tag LOCUS_40490 872 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 1321 899 gene locus_tag LOCUS_40500 1321 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40500 2746 1709 gene locus_tag LOCUS_40510 2746 1709 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057692.1 protein_id gnl|my_center|LOCUS_40510 3449 3054 gene locus_tag LOCUS_40520 gene queF 3449 3054 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_40520 >Feature sequence388 375 294 gene locus_tag LOCUS_t00370 375 294 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1110 430 gene locus_tag LOCUS_40530 1110 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056940.1 protein_id gnl|my_center|LOCUS_40530 1234 2289 gene locus_tag LOCUS_40540 1234 2289 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_40540 3363 2458 gene locus_tag LOCUS_40550 gene rimK 3363 2458 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_40550 >Feature sequence389 188 835 gene locus_tag LOCUS_40560 188 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40560 876 3257 gene locus_tag LOCUS_40570 876 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 >Feature sequence390 221 81 gene locus_tag LOCUS_40580 221 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 634 359 gene locus_tag LOCUS_40590 634 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_40590 1661 1011 gene locus_tag LOCUS_40600 1661 1011 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140806.1 protein_id gnl|my_center|LOCUS_40600 1796 2050 gene locus_tag LOCUS_40610 1796 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40610 2846 2226 gene locus_tag LOCUS_40620 2846 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 3040 2855 gene locus_tag LOCUS_40630 3040 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40630 >Feature sequence391 381 127 gene locus_tag LOCUS_40640 381 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40640 732 514 gene locus_tag LOCUS_40650 732 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 1488 1069 gene locus_tag LOCUS_40660 1488 1069 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141668.1 protein_id gnl|my_center|LOCUS_40660 1877 1485 gene locus_tag LOCUS_40670 1877 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 >Feature sequence392 3278 498 gene locus_tag LOCUS_40680 3278 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 >Feature sequence393 778 389 gene locus_tag LOCUS_40690 778 389 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_40690 1079 1522 gene locus_tag LOCUS_40700 1079 1522 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_40700 1536 1943 gene locus_tag LOCUS_40710 1536 1943 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530041.1 protein_id gnl|my_center|LOCUS_40710 1946 2926 gene locus_tag LOCUS_40720 gene cbiB 1946 2926 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058209.1 protein_id gnl|my_center|LOCUS_40720 3241 2867 gene locus_tag LOCUS_40730 3241 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40730 >Feature sequence394 1244 351 gene locus_tag LOCUS_40740 1244 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 1442 2590 gene locus_tag LOCUS_40750 gene carA 1442 2590 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_40750 2665 3015 gene locus_tag LOCUS_40760 2665 3015 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524127.1 protein_id gnl|my_center|LOCUS_40760 3019 3435 gene locus_tag LOCUS_40770 3019 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence395 232 498 gene locus_tag LOCUS_40780 232 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40780 583 978 gene locus_tag LOCUS_40790 583 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 1319 984 gene locus_tag LOCUS_40800 1319 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 1614 2321 gene locus_tag LOCUS_40810 gene rpe 1614 2321 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_40810 3396 2590 gene locus_tag LOCUS_40820 gene hisN 3396 2590 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_40820 >Feature sequence396 946 122 gene locus_tag LOCUS_40830 946 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 3419 1455 gene locus_tag LOCUS_40840 3419 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence397 959 270 gene locus_tag LOCUS_40850 959 270 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_40850 2356 1592 gene locus_tag LOCUS_40860 2356 1592 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_40860 2549 3112 gene locus_tag LOCUS_40870 2549 3112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence398 726 451 gene locus_tag LOCUS_40880 726 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 1132 878 gene locus_tag LOCUS_40890 1132 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 1874 1602 gene locus_tag LOCUS_40900 1874 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_40900 2098 1871 gene locus_tag LOCUS_40910 2098 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2530 2727 gene locus_tag LOCUS_40920 2530 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 2908 3180 gene locus_tag LOCUS_40930 2908 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40930 >Feature sequence399 510 94 gene locus_tag LOCUS_40940 510 94 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225807463.1 protein_id gnl|my_center|LOCUS_40940 748 494 gene locus_tag LOCUS_40950 748 494 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771148.1 protein_id gnl|my_center|LOCUS_40950 929 1618 gene locus_tag LOCUS_40960 929 1618 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143931.1 protein_id gnl|my_center|LOCUS_40960 2533 1856 gene locus_tag LOCUS_40970 2533 1856 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400924.1 protein_id gnl|my_center|LOCUS_40970 3182 2592 gene locus_tag LOCUS_40980 3182 2592 CDS product Coq4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141416.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence400 73 306 gene locus_tag LOCUS_40990 73 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 281 823 gene locus_tag LOCUS_41000 281 823 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_41000 1918 905 gene locus_tag LOCUS_41010 gene cydB 1918 905 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057440.1 protein_id gnl|my_center|LOCUS_41010 3354 1927 gene locus_tag LOCUS_41020 3354 1927 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057441.1 protein_id gnl|my_center|LOCUS_41020 >Feature sequence401 1111 275 gene locus_tag LOCUS_41030 1111 275 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143597.1 protein_id gnl|my_center|LOCUS_41030 2432 1197 gene locus_tag LOCUS_41040 2432 1197 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_41040 2589 2801 gene locus_tag LOCUS_41050 2589 2801 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_41050 3301 2852 gene locus_tag LOCUS_41060 3301 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence402 634 140 gene locus_tag LOCUS_41070 634 140 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_41070 683 1246 gene locus_tag LOCUS_41080 683 1246 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_41080 1518 3080 gene locus_tag LOCUS_41090 1518 3080 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence403 2556 169 gene locus_tag LOCUS_41100 2556 169 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141541.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence404 1538 495 gene locus_tag LOCUS_41110 gene dcm 1538 495 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_41110 <3452 2294 gene locus_tag LOCUS_41120 <3452 2294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459437.1:RNA-guided endonuclease TnpB family protein 2302 2371 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence405 139 441 gene locus_tag LOCUS_41130 139 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3326 453 gene locus_tag LOCUS_41140 3326 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 >Feature sequence406 696 154 gene locus_tag LOCUS_41150 696 154 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_41150 804 1643 gene locus_tag LOCUS_41160 gene ylqF 804 1643 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057347.1 protein_id gnl|my_center|LOCUS_41160 1805 3289 gene locus_tag LOCUS_41170 1805 3289 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence407 <1 732 gene locus_tag LOCUS_41180 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_045053120.1:LPS export ABC transporter ATP-binding protein 767 1936 gene locus_tag LOCUS_41190 767 1936 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140933.1 protein_id gnl|my_center|LOCUS_41190 2812 1973 gene locus_tag LOCUS_41200 gene rsmI 2812 1973 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057354.1 protein_id gnl|my_center|LOCUS_41200 >Feature sequence408 354 1406 gene locus_tag LOCUS_41210 gene purM 354 1406 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_41210 1926 3272 gene locus_tag LOCUS_41220 1926 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 >Feature sequence409 <1 1085 gene locus_tag LOCUS_41230 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012502785.1:tetratricopeptide repeat protein 1241 1483 gene locus_tag LOCUS_41240 1241 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41240 1480 1848 gene locus_tag LOCUS_41250 1480 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 1985 2242 gene locus_tag LOCUS_41260 1985 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 2244 2684 gene locus_tag LOCUS_41270 2244 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41270 2722 3105 gene locus_tag LOCUS_41280 2722 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 >Feature sequence410 317 565 gene locus_tag LOCUS_41290 317 565 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391712.1 protein_id gnl|my_center|LOCUS_41290 569 799 gene locus_tag LOCUS_41300 569 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 1180 1389 gene locus_tag LOCUS_41310 1180 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41310 1661 1879 gene locus_tag LOCUS_41320 1661 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 1879 2118 gene locus_tag LOCUS_41330 1879 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 >Feature sequence411 1148 108 gene locus_tag LOCUS_41340 gene dcm 1148 108 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964364.1 protein_id gnl|my_center|LOCUS_41340 1434 2486 gene locus_tag LOCUS_41350 1434 2486 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143724.1 protein_id gnl|my_center|LOCUS_41350 3025 2732 gene locus_tag LOCUS_41360 3025 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41360 >Feature sequence412 225 449 gene locus_tag LOCUS_41370 225 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 2294 990 gene locus_tag LOCUS_41380 gene hisD 2294 990 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337274.1 protein_id gnl|my_center|LOCUS_41380 2547 3233 gene locus_tag LOCUS_41390 2547 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929300.1 protein_id gnl|my_center|LOCUS_41390 >Feature sequence413 961 92 gene locus_tag LOCUS_41400 961 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41400 2120 1059 gene locus_tag LOCUS_41410 2120 1059 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057198.1 protein_id gnl|my_center|LOCUS_41410 3135 2164 gene locus_tag LOCUS_41420 3135 2164 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_41420 >Feature sequence414 532 107 gene locus_tag LOCUS_41430 532 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41430 1812 535 gene locus_tag LOCUS_41440 1812 535 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_41440 2673 2017 gene locus_tag LOCUS_41450 2673 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 >Feature sequence415 >Feature sequence416 591 160 gene locus_tag LOCUS_41460 591 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 1214 1141 gene locus_tag LOCUS_t00380 1214 1141 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1316 1702 gene locus_tag LOCUS_41470 1316 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 2083 1955 gene locus_tag LOCUS_41480 2083 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 2348 2076 gene locus_tag LOCUS_41490 2348 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 <3245 2461 gene locus_tag LOCUS_41500 <3245 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986679.1:AAA family ATPase >Feature sequence417 134 364 gene locus_tag LOCUS_41510 134 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 595 819 gene locus_tag LOCUS_41520 595 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41520 812 1129 gene locus_tag LOCUS_41530 812 1129 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393300.1 protein_id gnl|my_center|LOCUS_41530 1119 1346 gene locus_tag LOCUS_41540 1119 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41540 2007 1732 gene locus_tag LOCUS_41550 2007 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327108.1 protein_id gnl|my_center|LOCUS_41550 2242 2469 gene locus_tag LOCUS_41560 2242 2469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 2476 2724 gene locus_tag LOCUS_41570 2476 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 2788 3039 gene locus_tag LOCUS_41580 2788 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41580 >Feature sequence418 1066 320 gene locus_tag LOCUS_41590 1066 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 2982 1276 gene locus_tag LOCUS_41600 2982 1276 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120704930.1 protein_id gnl|my_center|LOCUS_41600 >Feature sequence419 1954 197 gene locus_tag LOCUS_41610 1954 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 <3215 1905 gene locus_tag LOCUS_41620 <3215 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein note possible pseudo, frameshifted >Feature sequence420 836 588 gene locus_tag LOCUS_41630 836 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 981 1274 gene locus_tag LOCUS_41640 981 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057054.1 protein_id gnl|my_center|LOCUS_41640 1362 2432 gene locus_tag LOCUS_41650 1362 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 <3206 2449 gene locus_tag LOCUS_41660 <3206 2449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142642.1:ribonuclease III >Feature sequence421 228 1007 gene locus_tag LOCUS_41670 228 1007 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_41670 1696 1004 gene locus_tag LOCUS_41680 1696 1004 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_41680 2988 1735 gene locus_tag LOCUS_41690 2988 1735 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_41690 >Feature sequence422 887 114 gene locus_tag LOCUS_41700 887 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 1573 950 gene locus_tag LOCUS_41710 1573 950 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_41710 1917 1744 gene locus_tag LOCUS_41720 1917 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41720 2216 2479 gene locus_tag LOCUS_41730 2216 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 2476 2994 gene locus_tag LOCUS_41740 2476 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence423 532 191 gene locus_tag LOCUS_41750 532 191 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_41750 1890 727 gene locus_tag LOCUS_41760 1890 727 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_41760 2218 1973 gene locus_tag LOCUS_41770 2218 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 2989 2300 gene locus_tag LOCUS_41780 2989 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 >Feature sequence424 2046 433 gene locus_tag LOCUS_41790 2046 433 CDS product vanadium-dependent haloperoxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089742.1 protein_id gnl|my_center|LOCUS_41790 >Feature sequence425 >Feature sequence426 407 333 gene locus_tag LOCUS_t00390 407 333 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1634 495 gene locus_tag LOCUS_41800 1634 495 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_41800 1833 2591 gene locus_tag LOCUS_41810 1833 2591 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140639.1 protein_id gnl|my_center|LOCUS_41810 2838 2608 gene locus_tag LOCUS_41820 gene yidD 2838 2608 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_41820 >Feature sequence427 <1 2441 gene locus_tag LOCUS_41830 <1 2441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890314.1:class I SAM-dependent DNA methyltransferase 2980 2519 gene locus_tag LOCUS_41840 2980 2519 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_41840 >Feature sequence428 <1 515 gene locus_tag LOCUS_41850 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106290870.1:glycosyltransferase family 4 protein 645 1049 gene locus_tag LOCUS_41860 645 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 1053 1280 gene locus_tag LOCUS_41870 1053 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 1307 2743 gene locus_tag LOCUS_41880 1307 2743 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence429 341 2863 gene locus_tag LOCUS_41890 341 2863 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_41890 >Feature sequence430 700 536 gene locus_tag LOCUS_41900 700 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 1383 910 gene locus_tag LOCUS_41910 1383 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41910 1559 1939 gene locus_tag LOCUS_41920 1559 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 2392 2072 gene locus_tag LOCUS_41930 2392 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 2612 2394 gene locus_tag LOCUS_41940 2612 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 >Feature sequence431 <1 2439 gene locus_tag LOCUS_41950 <1 2439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence432 1130 678 gene locus_tag LOCUS_41960 1130 678 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921062.1 protein_id gnl|my_center|LOCUS_41960 2128 1148 gene locus_tag LOCUS_41970 2128 1148 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_41970 2425 2456 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence433 1124 1954 gene locus_tag LOCUS_41980 1124 1954 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_41980 2812 1955 gene locus_tag LOCUS_41990 2812 1955 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057406.1 protein_id gnl|my_center|LOCUS_41990 >Feature sequence434 1041 46 gene locus_tag LOCUS_42000 1041 46 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_42000 1541 1825 gene locus_tag LOCUS_42010 1541 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 1889 2722 gene locus_tag LOCUS_42020 1889 2722 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_42020 2905 2723 gene locus_tag LOCUS_42030 2905 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 >Feature sequence435 <2991 439 gene locus_tag LOCUS_42040 <2991 439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence436 1764 112 gene locus_tag LOCUS_42050 gene mutL 1764 112 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137908825.1 protein_id gnl|my_center|LOCUS_42050 2042 2779 gene locus_tag LOCUS_42060 2042 2779 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_42060 >Feature sequence437 >Feature sequence438 748 1233 gene locus_tag LOCUS_42070 gene apcA 748 1233 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_42070 1313 1798 gene locus_tag LOCUS_42080 gene apcB 1313 1798 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_42080 1989 2192 gene locus_tag LOCUS_42090 1989 2192 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_42090 2661 2245 gene locus_tag LOCUS_42100 gene msrB 2661 2245 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence439 >Feature sequence440 235 1242 gene locus_tag LOCUS_42110 gene dusB 235 1242 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056835.1 protein_id gnl|my_center|LOCUS_42110 1641 1261 gene locus_tag LOCUS_42120 1641 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42120 1909 1649 gene locus_tag LOCUS_42130 1909 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 2492 2226 gene locus_tag LOCUS_42140 2492 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 >Feature sequence441 993 229 gene locus_tag LOCUS_42150 gene fabG 993 229 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_42150 2048 1143 gene locus_tag LOCUS_42160 2048 1143 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407374.1 protein_id gnl|my_center|LOCUS_42160 2639 2154 gene locus_tag LOCUS_42170 2639 2154 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_42170 >Feature sequence442 2 346 gene locus_tag LOCUS_42180 2 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42180 2865 376 gene locus_tag LOCUS_42190 gene priA 2865 376 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920687.1 protein_id gnl|my_center|LOCUS_42190 >Feature sequence443 687 2159 gene locus_tag LOCUS_42200 687 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42200 2497 2210 gene locus_tag LOCUS_42210 2497 2210 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081705261.1 protein_id gnl|my_center|LOCUS_42210 2714 2478 gene locus_tag LOCUS_42220 2714 2478 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928690.1 protein_id gnl|my_center|LOCUS_42220 >Feature sequence444 2626 1673 gene locus_tag LOCUS_42230 2626 1673 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220240.1 protein_id gnl|my_center|LOCUS_42230 >Feature sequence445 134 424 gene locus_tag LOCUS_42240 134 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 1239 508 gene locus_tag LOCUS_42250 gene radC 1239 508 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_42250 2524 1337 gene locus_tag LOCUS_42260 2524 1337 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence446 445 1743 gene locus_tag LOCUS_42270 445 1743 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921083.1 protein_id gnl|my_center|LOCUS_42270 1850 2698 gene locus_tag LOCUS_42280 1850 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42280 >Feature sequence447 129 1511 gene locus_tag LOCUS_42290 gene psbC 129 1511 CDS product photosystem II reaction center protein CP43 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124637.1 protein_id gnl|my_center|LOCUS_42290 1765 2574 gene locus_tag LOCUS_42300 1765 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_42300 >Feature sequence448 22 237 gene locus_tag LOCUS_42310 22 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 285 467 gene locus_tag LOCUS_42320 285 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42320 1002 1301 gene locus_tag LOCUS_42330 1002 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 1289 1627 gene locus_tag LOCUS_42340 1289 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42340 1674 1811 gene locus_tag LOCUS_42350 1674 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 1907 2086 gene locus_tag LOCUS_42360 1907 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 2122 2559 gene locus_tag LOCUS_42370 2122 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42370 >Feature sequence449 1676 867 gene locus_tag LOCUS_42380 1676 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42380 2170 1946 gene locus_tag LOCUS_42390 2170 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 >Feature sequence450 2496 1306 gene locus_tag LOCUS_42400 2496 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42400 >Feature sequence451 523 182 gene locus_tag LOCUS_42410 523 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42410 798 520 gene locus_tag LOCUS_42420 798 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42420 1636 887 gene locus_tag LOCUS_42430 1636 887 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038849.1 protein_id gnl|my_center|LOCUS_42430 2448 2011 gene locus_tag LOCUS_42440 2448 2011 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392208.1 protein_id gnl|my_center|LOCUS_42440 2651 2436 gene locus_tag LOCUS_42450 2651 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42450 >Feature sequence452 359 96 gene locus_tag LOCUS_42460 359 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 811 590 gene locus_tag LOCUS_42470 811 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 1557 1069 gene locus_tag LOCUS_42480 1557 1069 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582524.1 protein_id gnl|my_center|LOCUS_42480 1840 1559 gene locus_tag LOCUS_42490 1840 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42490 >Feature sequence453 248 1879 gene locus_tag LOCUS_42500 248 1879 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929004.1 protein_id gnl|my_center|LOCUS_42500 1927 2355 gene locus_tag LOCUS_42510 1927 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 >Feature sequence454 403 1626 gene locus_tag LOCUS_42520 403 1626 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057105.1 protein_id gnl|my_center|LOCUS_42520 1679 2173 gene locus_tag LOCUS_42530 gene sixA 1679 2173 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057106.1 protein_id gnl|my_center|LOCUS_42530 2242 2643 gene locus_tag LOCUS_42540 2242 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence455 927 118 gene locus_tag LOCUS_42550 927 118 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_42550 1174 1476 gene locus_tag LOCUS_42560 1174 1476 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_42560 2324 1665 gene locus_tag LOCUS_42570 2324 1665 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957597.1 protein_id gnl|my_center|LOCUS_42570 >Feature sequence456 231 560 gene locus_tag LOCUS_42580 231 560 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_42580 913 1269 gene locus_tag LOCUS_42590 913 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42590 1725 1507 gene locus_tag LOCUS_42600 1725 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42600 2026 2565 gene locus_tag LOCUS_42610 2026 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42610 >Feature sequence457 1872 346 gene locus_tag LOCUS_42620 1872 346 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_42620 2053 2394 gene locus_tag LOCUS_42630 2053 2394 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_42630 >Feature sequence458 317 132 gene locus_tag LOCUS_42640 317 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 486 683 gene locus_tag LOCUS_42650 486 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42650 836 678 gene locus_tag LOCUS_42660 836 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42660 1248 829 gene locus_tag LOCUS_42670 1248 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 1613 1245 gene locus_tag LOCUS_42680 1613 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 1999 1784 gene locus_tag LOCUS_42690 1999 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 >Feature sequence459 >Feature sequence460 2256 736 gene locus_tag LOCUS_42700 gene trpE 2256 736 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057509.1 protein_id gnl|my_center|LOCUS_42700 >Feature sequence461 352 152 gene locus_tag LOCUS_42710 352 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42710 656 1993 gene locus_tag LOCUS_42720 656 1993 CDS product trans-splicing intein-formed DNA polymerase III subunit alpha C-terminal partner DnaE-C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057904.1 protein_id gnl|my_center|LOCUS_42720 2155 1997 gene locus_tag LOCUS_42730 2155 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42730 >Feature sequence462 241 984 gene locus_tag LOCUS_42740 241 984 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_42740 995 1585 gene locus_tag LOCUS_42750 995 1585 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140532.1 protein_id gnl|my_center|LOCUS_42750 1741 2355 gene locus_tag LOCUS_42760 1741 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056873.1 protein_id gnl|my_center|LOCUS_42760 >Feature sequence463 168 560 gene locus_tag LOCUS_42770 168 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42770 >Feature sequence464 194 2245 gene locus_tag LOCUS_42780 194 2245 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056567.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence465 753 43 gene locus_tag LOCUS_42790 753 43 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_42790 829 1557 gene locus_tag LOCUS_42800 829 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42800 2312 1560 gene locus_tag LOCUS_42810 2312 1560 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194094.1 protein_id gnl|my_center|LOCUS_42810 >Feature sequence466 <1 500 gene locus_tag LOCUS_42820 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003404760.1:IS607-like element IS1535 family transposase 1261 671 gene locus_tag LOCUS_42830 1261 671 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_42830 >Feature sequence467 1330 143 gene locus_tag LOCUS_42840 1330 143 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799340.1 protein_id gnl|my_center|LOCUS_42840 2345 1401 gene locus_tag LOCUS_42850 2345 1401 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_42850 >Feature sequence468 155 2206 gene locus_tag LOCUS_42860 155 2206 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_42860 >Feature sequence469 1372 818 gene locus_tag LOCUS_42870 1372 818 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_42870 1534 1836 gene locus_tag LOCUS_42880 gene rpsN 1534 1836 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_42880 <2533 1927 gene locus_tag LOCUS_42890 <2533 1927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein >Feature sequence470 >Feature sequence471 430 86 gene locus_tag LOCUS_42900 430 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 450 716 gene locus_tag LOCUS_42910 450 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 713 1186 gene locus_tag LOCUS_42920 713 1186 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_42920 2339 1251 gene locus_tag LOCUS_42930 2339 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence472 215 1099 gene locus_tag LOCUS_42940 215 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 1394 2425 gene locus_tag LOCUS_42950 gene lpxD 1394 2425 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142707.1 protein_id gnl|my_center|LOCUS_42950 >Feature sequence473 229 645 gene locus_tag LOCUS_42960 229 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 633 968 gene locus_tag LOCUS_42970 633 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 >Feature sequence474 63 323 gene locus_tag LOCUS_42980 63 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 313 510 gene locus_tag LOCUS_42990 313 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42990 870 1076 gene locus_tag LOCUS_43000 870 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43000 1430 1573 gene locus_tag LOCUS_43010 1430 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 1676 2002 gene locus_tag LOCUS_43020 1676 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 1987 2220 gene locus_tag LOCUS_43030 1987 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43030 >Feature sequence475 476 171 gene locus_tag LOCUS_43040 476 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43040 819 2420 gene locus_tag LOCUS_43050 819 2420 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890485.1 protein_id gnl|my_center|LOCUS_43050 >Feature sequence476 1857 2294 gene locus_tag LOCUS_43060 1857 2294 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_43060 >Feature sequence477 72 545 gene locus_tag LOCUS_43070 72 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 653 1018 gene locus_tag LOCUS_43080 653 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43080 1483 1034 gene locus_tag LOCUS_43090 1483 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43090 1803 1480 gene locus_tag LOCUS_43100 1803 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43100 2182 1859 gene locus_tag LOCUS_43110 2182 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43110 >Feature sequence478 460 68 gene locus_tag LOCUS_43120 460 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 1812 754 gene locus_tag LOCUS_43130 1812 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 1918 2064 gene locus_tag LOCUS_43140 1918 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence479 275 81 gene locus_tag LOCUS_43150 275 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43150 562 1317 gene locus_tag LOCUS_43160 562 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43160 1629 2069 gene locus_tag LOCUS_43170 1629 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43170 2180 2419 gene locus_tag LOCUS_43180 2180 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 >Feature sequence480 396 214 gene locus_tag LOCUS_43190 396 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 816 463 gene locus_tag LOCUS_43200 816 463 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057416.1 protein_id gnl|my_center|LOCUS_43200 1279 1208 gene locus_tag LOCUS_t00400 1279 1208 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1621 1851 gene locus_tag LOCUS_43210 1621 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 1844 2218 gene locus_tag LOCUS_43220 1844 2218 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_43220 >Feature sequence481 1180 380 gene locus_tag LOCUS_43230 1180 380 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_43230 1756 1223 gene locus_tag LOCUS_43240 gene purE 1756 1223 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_43240 <2448 1839 gene locus_tag LOCUS_43250 <2448 1839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929453.1:Uma2 family endonuclease >Feature sequence482 224 1165 gene locus_tag LOCUS_43260 224 1165 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_43260 2146 1205 gene locus_tag LOCUS_43270 2146 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_43270 >Feature sequence483 361 167 gene locus_tag LOCUS_43280 361 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 570 908 gene locus_tag LOCUS_43290 570 908 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_43290 1045 2121 gene locus_tag LOCUS_43300 gene hrcA 1045 2121 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_43300 >Feature sequence484 1071 442 gene locus_tag LOCUS_43310 1071 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 1485 2093 gene locus_tag LOCUS_43320 1485 2093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_43320 >Feature sequence485 1210 62 gene locus_tag LOCUS_43330 1210 62 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056541.1 protein_id gnl|my_center|LOCUS_43330 1711 1935 gene locus_tag LOCUS_43340 1711 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 1971 2210 gene locus_tag LOCUS_43350 1971 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence486 1919 1650 gene locus_tag LOCUS_43360 1919 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43360 >Feature sequence487 365 165 gene locus_tag LOCUS_43370 365 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43370 776 1420 gene locus_tag LOCUS_43380 776 1420 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_43380 1992 1798 gene locus_tag LOCUS_43390 1992 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43390 >Feature sequence488 <1 589 gene locus_tag LOCUS_43400 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929431.1:Uma2 family endonuclease 622 2307 gene locus_tag LOCUS_43410 622 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence489 291 1367 gene locus_tag LOCUS_43420 291 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 1506 2312 gene locus_tag LOCUS_43430 1506 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence490 177 28 gene locus_tag LOCUS_43440 177 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43440 626 216 gene locus_tag LOCUS_43450 626 216 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_43450 907 629 gene locus_tag LOCUS_43460 907 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43460 1160 1002 gene locus_tag LOCUS_43470 1160 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43470 1566 1811 gene locus_tag LOCUS_43480 1566 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43480 1824 2033 gene locus_tag LOCUS_43490 1824 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43490 >Feature sequence491 227 955 gene locus_tag LOCUS_43500 227 955 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_43500 1044 1214 gene locus_tag LOCUS_43510 1044 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_43510 1886 1266 gene locus_tag LOCUS_43520 1886 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43520 >Feature sequence492 296 1507 gene locus_tag LOCUS_43530 296 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence493 667 2235 gene locus_tag LOCUS_43540 gene kdpA 667 2235 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140576.1 protein_id gnl|my_center|LOCUS_43540 >Feature sequence494 76 888 gene locus_tag LOCUS_43550 76 888 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_43550 944 1375 gene locus_tag LOCUS_43560 944 1375 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_43560 >Feature sequence495 342 1205 gene locus_tag LOCUS_43570 342 1205 CDS product DUF4115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144381.1 protein_id gnl|my_center|LOCUS_43570 1779 1267 gene locus_tag LOCUS_43580 1779 1267 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524126.1 protein_id gnl|my_center|LOCUS_43580 >Feature sequence496 <1 2029 gene locus_tag LOCUS_43590 <1 2029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence497 1427 2173 gene locus_tag LOCUS_43600 1427 2173 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_43600 >Feature sequence498 1945 362 gene locus_tag LOCUS_43610 gene ndhD1 1945 362 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056566.1 protein_id gnl|my_center|LOCUS_43610 >Feature sequence499 161 2014 gene locus_tag LOCUS_43620 161 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43620 >Feature sequence500 779 973 gene locus_tag LOCUS_43630 779 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43630 976 1650 gene locus_tag LOCUS_43640 976 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_43640 >Feature sequence501 <2219 155 gene locus_tag LOCUS_43650 <2219 155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940952.1:Calx-beta domain-containing protein >Feature sequence502 133 909 gene locus_tag LOCUS_43660 133 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43660 1938 1402 gene locus_tag LOCUS_43670 1938 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence503 143 703 gene locus_tag LOCUS_43680 143 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 1270 818 gene locus_tag LOCUS_43690 1270 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 1426 2013 gene locus_tag LOCUS_43700 gene pyrE 1426 2013 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_43700 >Feature sequence504 861 1184 gene locus_tag LOCUS_43710 861 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43710 1174 1362 gene locus_tag LOCUS_43720 1174 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 1822 1454 gene locus_tag LOCUS_43730 1822 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 >Feature sequence505 1217 324 gene locus_tag LOCUS_43740 1217 324 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_43740 1670 1455 gene locus_tag LOCUS_43750 1670 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43750 1976 1785 gene locus_tag LOCUS_43760 1976 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43760 >Feature sequence506 <2126 627 gene locus_tag LOCUS_43770 <2126 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207783.1:S8 family serine peptidase >Feature sequence507 578 1645 gene locus_tag LOCUS_43780 gene mtnA 578 1645 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056904.1 protein_id gnl|my_center|LOCUS_43780 >Feature sequence508 815 522 gene locus_tag LOCUS_43790 815 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 1878 1096 gene locus_tag LOCUS_43800 1878 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43800 >Feature sequence509 511 92 gene locus_tag LOCUS_43810 511 92 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141695.1 protein_id gnl|my_center|LOCUS_43810 791 501 gene locus_tag LOCUS_43820 791 501 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530146.1 protein_id gnl|my_center|LOCUS_43820 1976 1356 gene locus_tag LOCUS_43830 1976 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 >Feature sequence510 326 1867 gene locus_tag LOCUS_43840 326 1867 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_43840 >Feature sequence511 996 1541 gene locus_tag LOCUS_43850 996 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43850 1794 1636 gene locus_tag LOCUS_43860 1794 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43860 >Feature sequence512 1257 1988 gene locus_tag LOCUS_43870 1257 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence513 837 94 gene locus_tag LOCUS_43880 837 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 1084 1206 gene locus_tag LOCUS_43890 1084 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 1286 1894 gene locus_tag LOCUS_43900 1286 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 >Feature sequence514 478 1872 gene locus_tag LOCUS_43910 478 1872 CDS product DUF2252 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039725284.1 protein_id gnl|my_center|LOCUS_43910 >Feature sequence515 1625 237 gene locus_tag LOCUS_43920 1625 237 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088430287.1 protein_id gnl|my_center|LOCUS_43920 >Feature sequence516 >Feature sequence517 1708 188 gene locus_tag LOCUS_43930 1708 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence518 350 580 gene locus_tag LOCUS_43940 350 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43940 604 981 gene locus_tag LOCUS_43950 604 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43950 978 1370 gene locus_tag LOCUS_43960 978 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43960 <2081 1475 gene locus_tag LOCUS_43970 <2081 1475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein >Feature sequence519 635 1135 gene locus_tag LOCUS_43980 635 1135 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056117.1 protein_id gnl|my_center|LOCUS_43980 1505 1699 gene locus_tag LOCUS_43990 1505 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence520 176 1069 gene locus_tag LOCUS_44000 176 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 1208 1687 gene locus_tag LOCUS_44010 1208 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143509.1 protein_id gnl|my_center|LOCUS_44010 >Feature sequence521 271 1035 gene locus_tag LOCUS_44020 271 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44020 1059 1985 gene locus_tag LOCUS_44030 1059 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 >Feature sequence522 102 425 gene locus_tag LOCUS_44040 102 425 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_44040 660 884 gene locus_tag LOCUS_44050 660 884 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_44050 881 1213 gene locus_tag LOCUS_44060 881 1213 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142392.1 protein_id gnl|my_center|LOCUS_44060 1730 1524 gene locus_tag LOCUS_44070 1730 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence523 1812 49 gene locus_tag LOCUS_44080 1812 49 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_44080 >Feature sequence524 305 1879 gene locus_tag LOCUS_44090 305 1879 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056564.1 protein_id gnl|my_center|LOCUS_44090 >Feature sequence525 445 675 gene locus_tag LOCUS_44100 445 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 1693 1367 gene locus_tag LOCUS_44110 1693 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence526 >Feature sequence527 1201 215 gene locus_tag LOCUS_44120 1201 215 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_44120 >Feature sequence528 <1 685 gene locus_tag LOCUS_44130 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143123.1:Uma2 family endonuclease 720 1574 gene locus_tag LOCUS_44140 720 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44140 >Feature sequence529 399 1826 gene locus_tag LOCUS_44150 gene murC 399 1826 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056226.1 protein_id gnl|my_center|LOCUS_44150 >Feature sequence530 353 1147 gene locus_tag LOCUS_44160 353 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_44160 1152 1571 gene locus_tag LOCUS_44170 1152 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 1724 1578 gene locus_tag LOCUS_44180 1724 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44180 >Feature sequence531 860 441 gene locus_tag LOCUS_44190 860 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44190 1102 845 gene locus_tag LOCUS_44200 1102 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 1363 1746 gene locus_tag LOCUS_44210 1363 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 >Feature sequence532 1346 189 gene locus_tag LOCUS_44220 gene bioF 1346 189 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140400.1 protein_id gnl|my_center|LOCUS_44220 1772 1413 gene locus_tag LOCUS_44230 1772 1413 CDS product DUF6464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057913.1 protein_id gnl|my_center|LOCUS_44230 >Feature sequence533 272 757 gene locus_tag LOCUS_44240 272 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 937 1275 gene locus_tag LOCUS_44250 937 1275 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_44250 >Feature sequence534 900 124 gene locus_tag LOCUS_44260 900 124 CDS product DUF2092 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967308.1 protein_id gnl|my_center|LOCUS_44260 1595 933 gene locus_tag LOCUS_44270 1595 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence535 1621 185 gene locus_tag LOCUS_44280 1621 185 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_44280 >Feature sequence536 1583 300 gene locus_tag LOCUS_44290 1583 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44290 >Feature sequence537 908 63 gene locus_tag LOCUS_44300 gene map 908 63 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056279.1 protein_id gnl|my_center|LOCUS_44300 >Feature sequence538 >Feature sequence539 666 166 gene locus_tag LOCUS_44310 666 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1061 687 gene locus_tag LOCUS_44320 1061 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 1654 1061 gene locus_tag LOCUS_44330 1654 1061 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056172.1 protein_id gnl|my_center|LOCUS_44330 >Feature sequence540 694 113 gene locus_tag LOCUS_44340 gene aat 694 113 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_44340 729 1070 gene locus_tag LOCUS_44350 729 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_44350 1675 1085 gene locus_tag LOCUS_44360 1675 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44360 >Feature sequence541 <1 829 gene locus_tag LOCUS_44370 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929431.1:Uma2 family endonuclease 865 1470 gene locus_tag LOCUS_44380 gene cobO 865 1470 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_44380 >Feature sequence542 892 248 gene locus_tag LOCUS_44390 892 248 CDS product RloB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994243.1 protein_id gnl|my_center|LOCUS_44390 <1794 894 gene locus_tag LOCUS_44400 <1794 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein >Feature sequence543 1139 381 gene locus_tag LOCUS_44410 1139 381 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355989.1 protein_id gnl|my_center|LOCUS_44410 >Feature sequence544 684 85 gene locus_tag LOCUS_44420 684 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 1278 802 gene locus_tag LOCUS_44430 1278 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 1548 1339 gene locus_tag LOCUS_44440 1548 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence545 1565 111 gene locus_tag LOCUS_44450 1565 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 >Feature sequence546 1389 244 gene locus_tag LOCUS_44460 1389 244 CDS product TIGR03032 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141502.1 protein_id gnl|my_center|LOCUS_44460 >Feature sequence547 804 1439 gene locus_tag LOCUS_44470 804 1439 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_44470 >Feature sequence548 188 430 gene locus_tag LOCUS_44480 188 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 417 824 gene locus_tag LOCUS_44490 417 824 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393507.1 protein_id gnl|my_center|LOCUS_44490 >Feature sequence549 816 1235 gene locus_tag LOCUS_44500 816 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44500 >Feature sequence550 1223 189 gene locus_tag LOCUS_44510 gene cobW 1223 189 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_44510 >Feature sequence551 948 529 gene locus_tag LOCUS_44520 948 529 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057574.1 protein_id gnl|my_center|LOCUS_44520 1514 1137 gene locus_tag LOCUS_44530 1514 1137 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056170.1 protein_id gnl|my_center|LOCUS_44530 >Feature sequence552 1487 231 gene locus_tag LOCUS_44540 gene dcm 1487 231 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963014.1 protein_id gnl|my_center|LOCUS_44540 >Feature sequence553 987 352 gene locus_tag LOCUS_44550 987 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 <1596 972 gene locus_tag LOCUS_44560 <1596 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142246.1:IS1634 family transposase >Feature sequence554 <1589 527 gene locus_tag LOCUS_44570 <1589 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055860.1:urease subunit alpha >Feature sequence555 1354 635 gene locus_tag LOCUS_44580 1354 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44580 >Feature sequence556 <1575 286 gene locus_tag LOCUS_44590 <1575 286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975828.1:pre-peptidase C-terminal domain-containing protein >Feature sequence557 1064 96 gene locus_tag LOCUS_44600 1064 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44600 1095 1307 gene locus_tag LOCUS_44610 1095 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44610 >Feature sequence558 791 102 gene locus_tag LOCUS_44620 791 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 920 1276 gene locus_tag LOCUS_44630 gene tnpA 920 1276 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862466.1 protein_id gnl|my_center|LOCUS_44630 >Feature sequence559 1195 203 gene locus_tag LOCUS_44640 1195 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44640 >Feature sequence560 226 702 gene locus_tag LOCUS_44650 226 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44650 >Feature sequence561 325 678 gene locus_tag LOCUS_44660 325 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44660 820 1353 gene locus_tag LOCUS_44670 820 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44670 >Feature sequence562 583 104 gene locus_tag LOCUS_44680 583 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44680 985 626 gene locus_tag LOCUS_44690 985 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44690 1205 1396 gene locus_tag LOCUS_44700 1205 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44700 >Feature sequence563 166 29 gene locus_tag LOCUS_44710 166 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 735 328 gene locus_tag LOCUS_44720 735 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44720 1196 780 gene locus_tag LOCUS_44730 1196 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44730 >Feature sequence564 1222 197 gene locus_tag LOCUS_44740 1222 197 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_44740 >Feature sequence565 668 1246 gene locus_tag LOCUS_44750 668 1246 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_44750 >Feature sequence566 419 96 gene locus_tag LOCUS_44760 419 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44760 673 416 gene locus_tag LOCUS_44770 673 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44770 1074 787 gene locus_tag LOCUS_44780 1074 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44780 >Feature sequence567 <1355 137 gene locus_tag LOCUS_44790 <1355 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140150.1:IS4-like element ISGvi2 family transposase >Feature sequence568 <1 575 gene locus_tag LOCUS_44800 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041170082.1:calcium-binding protein >Feature sequence569 361 669 gene locus_tag LOCUS_44810 361 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44810 >Feature sequence570 >Feature sequence571 1209 292 gene locus_tag LOCUS_44820 gene thrB 1209 292 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_44820 >Feature sequence572 129 383 gene locus_tag LOCUS_44830 129 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44830 1004 327 gene locus_tag LOCUS_44840 1004 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44840 >Feature sequence573 >Feature sequence574 >Feature sequence575 1037 576 gene locus_tag LOCUS_44850 1037 576 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_44850 >Feature sequence576 601 467 gene locus_tag LOCUS_44860 601 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44860 821 582 gene locus_tag LOCUS_44870 821 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 1105 959 gene locus_tag LOCUS_44880 1105 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44880 >Feature sequence577 835 335 gene locus_tag LOCUS_44890 835 335 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_44890 1077 832 gene locus_tag LOCUS_44900 1077 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 >Feature sequence578 >Feature sequence579 647 829 gene locus_tag LOCUS_44910 647 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 >Feature sequence580 825 397 gene locus_tag LOCUS_44920 825 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence581 <1202 39 gene locus_tag LOCUS_44930 <1202 39 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056941.1:serine/threonine-protein kinase >Feature sequence582 >Feature sequence583 395 1006 gene locus_tag LOCUS_44940 395 1006 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_44940 >Feature sequence584 477 1001 gene locus_tag LOCUS_44950 gene ilvN 477 1001 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056724.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence585 <1 936 gene locus_tag LOCUS_44960 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023004217.1:VCBS domain-containing protein >Feature sequence586 <1 933 gene locus_tag LOCUS_44970 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence587 <1146 193 gene locus_tag LOCUS_44980 <1146 193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140181.1:group II intron reverse transcriptase/maturase >Feature sequence588 926 480 gene locus_tag LOCUS_44990 926 480 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929464.1 protein_id gnl|my_center|LOCUS_44990 >Feature sequence589 1070 492 gene locus_tag LOCUS_45000 gene rimI 1070 492 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056322.1 protein_id gnl|my_center|LOCUS_45000 >Feature sequence590 >Feature sequence591 <1 1026 gene locus_tag LOCUS_45010 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011254458.1:RNA-guided endonuclease TnpB family protein >Feature sequence592 273 581 gene locus_tag LOCUS_45020 273 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45020 >Feature sequence593 >Feature sequence594 >Feature sequence595