>Feature sequence0001 210 986 gene locus_tag LOCUS_00010 210 986 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_00010 1533 1709 gene locus_tag LOCUS_00020 1533 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4022 1800 gene locus_tag LOCUS_00030 4022 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5735 4173 gene locus_tag LOCUS_00040 5735 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6398 5877 gene locus_tag LOCUS_00050 6398 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00050 6823 6449 gene locus_tag LOCUS_00060 6823 6449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8406 7858 gene locus_tag LOCUS_00070 8406 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9374 8436 gene locus_tag LOCUS_00080 9374 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9580 9651 gene locus_tag LOCUS_t00010 9580 9651 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 9892 10824 gene locus_tag LOCUS_00090 9892 10824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11558 11202 gene locus_tag LOCUS_00100 11558 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 12216 11743 gene locus_tag LOCUS_00110 12216 11743 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943352.1 protein_id gnl|my_center|LOCUS_00110 12553 13218 gene locus_tag LOCUS_00120 12553 13218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13957 14172 gene locus_tag LOCUS_00130 13957 14172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14203 14577 gene locus_tag LOCUS_00140 gene rpsL 14203 14577 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_00140 14552 15073 gene locus_tag LOCUS_00150 gene rpsG 14552 15073 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_00150 15257 16486 gene locus_tag LOCUS_00160 gene tuf 15257 16486 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057587.1 protein_id gnl|my_center|LOCUS_00160 16498 16860 gene locus_tag LOCUS_00170 gene rpsJ 16498 16860 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_00170 16934 17006 gene locus_tag LOCUS_t00020 16934 17006 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 17024 17109 gene locus_tag LOCUS_t00030 17024 17109 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 18142 17180 gene locus_tag LOCUS_00180 18142 17180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18407 18162 gene locus_tag LOCUS_00190 gene psaC 18407 18162 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056855.1 protein_id gnl|my_center|LOCUS_00190 20775 18887 gene locus_tag LOCUS_r00010 20775 18887 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 58 percent of the 23S ribosomal RNA 21382 21071 gene locus_tag LOCUS_00200 21382 21071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 23435 21448 gene locus_tag LOCUS_r00020 23435 21448 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 61 percent of the 23S ribosomal RNA 23684 23612 gene locus_tag LOCUS_t00040 23684 23612 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 23771 23696 gene locus_tag LOCUS_t00050 23771 23696 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 24700 23893 gene locus_tag LOCUS_r00030 24700 23893 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 50 percent of the 16S ribosomal RNA 24681 24917 gene locus_tag LOCUS_00210 24681 24917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25475 24804 gene locus_tag LOCUS_00220 25475 24804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence0002 940 242 gene locus_tag LOCUS_00230 940 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 1347 994 gene locus_tag LOCUS_00240 1347 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 2176 2889 gene locus_tag LOCUS_00250 2176 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 3133 3333 gene locus_tag LOCUS_00260 3133 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00260 3826 3341 gene locus_tag LOCUS_00270 gene hisI 3826 3341 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400419.1 protein_id gnl|my_center|LOCUS_00270 4471 4151 gene locus_tag LOCUS_00280 4471 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 4875 4690 gene locus_tag LOCUS_00290 4875 4690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 6131 5241 gene locus_tag LOCUS_00300 6131 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 7400 6279 gene locus_tag LOCUS_00310 7400 6279 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124033.1 protein_id gnl|my_center|LOCUS_00310 10106 7962 gene locus_tag LOCUS_00320 10106 7962 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_00320 12231 10306 gene locus_tag LOCUS_00330 12231 10306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 12390 13463 gene locus_tag LOCUS_00340 12390 13463 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_00340 14064 13705 gene locus_tag LOCUS_00350 14064 13705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530020.1 protein_id gnl|my_center|LOCUS_00350 14554 14159 gene locus_tag LOCUS_00360 14554 14159 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_00360 15108 16433 gene locus_tag LOCUS_00370 15108 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 17369 16851 gene locus_tag LOCUS_00380 gene moaB 17369 16851 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000509705.1 protein_id gnl|my_center|LOCUS_00380 18145 17588 gene locus_tag LOCUS_00390 18145 17588 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143381.1 protein_id gnl|my_center|LOCUS_00390 18733 18332 gene locus_tag LOCUS_00400 18733 18332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 >Feature sequence0003 940 611 gene locus_tag LOCUS_00410 gene trxA 940 611 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162627.1 protein_id gnl|my_center|LOCUS_00410 1261 2298 gene locus_tag LOCUS_00420 gene glpX 1261 2298 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057116.1 protein_id gnl|my_center|LOCUS_00420 2802 4097 gene locus_tag LOCUS_00430 2802 4097 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057575.1 protein_id gnl|my_center|LOCUS_00430 4285 4998 gene locus_tag LOCUS_00440 4285 4998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5005 5439 gene locus_tag LOCUS_00450 5005 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5446 5589 gene locus_tag LOCUS_00460 5446 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 6120 6040 gene locus_tag LOCUS_t00060 6120 6040 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6616 6918 gene locus_tag LOCUS_00470 6616 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 7371 7096 gene locus_tag LOCUS_00480 7371 7096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 7809 7729 gene locus_tag LOCUS_t00070 7809 7729 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8140 9498 gene locus_tag LOCUS_00490 gene accC 8140 9498 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_00490 9883 9599 gene locus_tag LOCUS_00500 9883 9599 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_00500 11031 11750 gene locus_tag LOCUS_00510 11031 11750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 12273 13547 gene locus_tag LOCUS_00520 12273 13547 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057307.1 protein_id gnl|my_center|LOCUS_00520 14019 13606 gene locus_tag LOCUS_00530 14019 13606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 >Feature sequence0004 3780 2887 gene locus_tag LOCUS_00540 3780 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 3998 3777 gene locus_tag LOCUS_00550 3998 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4984 4361 gene locus_tag LOCUS_00560 4984 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00560 5181 4906 gene locus_tag LOCUS_00570 5181 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00570 5886 5332 gene locus_tag LOCUS_00580 5886 5332 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 protein_id gnl|my_center|LOCUS_00580 6379 6107 gene locus_tag LOCUS_00590 6379 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 6822 6592 gene locus_tag LOCUS_00600 6822 6592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 7251 6976 gene locus_tag LOCUS_00610 7251 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 7637 8500 gene locus_tag LOCUS_00620 gene gvpN 7637 8500 CDS product gas vesicle protein GvpN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904110.1 protein_id gnl|my_center|LOCUS_00620 9114 9599 gene locus_tag LOCUS_00630 9114 9599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 9803 9564 gene locus_tag LOCUS_00640 9803 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 11589 9952 gene locus_tag LOCUS_00650 11589 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 >Feature sequence0005 1562 2200 gene locus_tag LOCUS_00660 1562 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 2963 2403 gene locus_tag LOCUS_00670 2963 2403 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_00670 4194 3049 gene locus_tag LOCUS_00680 4194 3049 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_00680 5377 4715 gene locus_tag LOCUS_00690 gene nfi 5377 4715 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_00690 6047 5661 gene locus_tag LOCUS_00700 6047 5661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140108.1 protein_id gnl|my_center|LOCUS_00700 6746 7894 gene locus_tag LOCUS_00710 6746 7894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00710 8591 8932 gene locus_tag LOCUS_00720 8591 8932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 8952 9926 gene locus_tag LOCUS_00730 8952 9926 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227956.1 protein_id gnl|my_center|LOCUS_00730 10207 10662 gene locus_tag LOCUS_00740 10207 10662 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_00740 11776 10994 gene locus_tag LOCUS_00750 gene fabG 11776 10994 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_00750 12033 12413 gene locus_tag LOCUS_00760 12033 12413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 >Feature sequence0006 210 401 gene locus_tag LOCUS_00770 210 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 394 2433 gene locus_tag LOCUS_00780 394 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4215 3961 gene locus_tag LOCUS_00790 4215 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 5509 4376 gene locus_tag LOCUS_00800 5509 4376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 6710 5541 gene locus_tag LOCUS_00810 6710 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00810 6797 7048 gene locus_tag LOCUS_00820 6797 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9864 8005 gene locus_tag LOCUS_00830 9864 8005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 10531 10355 gene locus_tag LOCUS_00840 10531 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 12341 11964 gene locus_tag LOCUS_00850 12341 11964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 >Feature sequence0007 <1 827 gene locus_tag LOCUS_00860 <1 827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057808.1:signal recognition particle protein 970 1371 gene locus_tag LOCUS_00870 gene rpsP 970 1371 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125510.1 protein_id gnl|my_center|LOCUS_00870 1325 1810 gene locus_tag LOCUS_00880 1325 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2094 3047 gene locus_tag LOCUS_00890 2094 3047 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_00890 3311 3721 gene locus_tag LOCUS_00900 3311 3721 CDS product heme utilization protein HuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920696.1 protein_id gnl|my_center|LOCUS_00900 4392 4904 gene locus_tag LOCUS_00910 4392 4904 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920633.1 protein_id gnl|my_center|LOCUS_00910 6433 4982 gene locus_tag LOCUS_00920 6433 4982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 7128 6952 gene locus_tag LOCUS_00930 7128 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 7846 7418 gene locus_tag LOCUS_00940 7846 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 9450 7951 gene locus_tag LOCUS_00950 9450 7951 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055931.1 protein_id gnl|my_center|LOCUS_00950 10068 9553 gene locus_tag LOCUS_00960 10068 9553 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_00960 10971 10471 gene locus_tag LOCUS_00970 10971 10471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142229.1 protein_id gnl|my_center|LOCUS_00970 11954 10971 gene locus_tag LOCUS_00980 gene yidC 11954 10971 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056448.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence0008 994 2877 gene locus_tag LOCUS_00990 gene ltrA 994 2877 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_00990 3037 3186 gene locus_tag LOCUS_01000 3037 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 4506 3565 gene locus_tag LOCUS_01010 gene miaA 4506 3565 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_01010 4847 5752 gene locus_tag LOCUS_01020 4847 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 5749 8094 gene locus_tag LOCUS_01030 5749 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01030 9195 8599 gene locus_tag LOCUS_01040 9195 8599 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140402.1 protein_id gnl|my_center|LOCUS_01040 11893 10559 gene locus_tag LOCUS_01050 11893 10559 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056381.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence0009 1164 304 gene locus_tag LOCUS_01060 1164 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 1451 2017 gene locus_tag LOCUS_01070 1451 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 2129 2689 gene locus_tag LOCUS_01080 2129 2689 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_01080 2719 3135 gene locus_tag LOCUS_01090 2719 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 3123 3464 gene locus_tag LOCUS_01100 3123 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 6767 3834 gene locus_tag LOCUS_01110 6767 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 6872 7150 gene locus_tag LOCUS_01120 6872 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8216 7530 gene locus_tag LOCUS_01130 8216 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8906 8834 gene locus_tag LOCUS_t00080 8906 8834 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10451 9006 gene locus_tag LOCUS_01140 10451 9006 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057642.1 protein_id gnl|my_center|LOCUS_01140 11391 10522 gene locus_tag LOCUS_01150 11391 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 >Feature sequence0010 1129 620 gene locus_tag LOCUS_01160 1129 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 3269 1359 gene locus_tag LOCUS_01170 gene dnaK 3269 1359 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057570.1 protein_id gnl|my_center|LOCUS_01170 5205 4363 gene locus_tag LOCUS_01180 5205 4363 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01180 6741 5518 gene locus_tag LOCUS_01190 6741 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 8318 7785 gene locus_tag LOCUS_01200 8318 7785 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921523.1 protein_id gnl|my_center|LOCUS_01200 9116 9125 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 11449 10052 gene locus_tag LOCUS_01210 11449 10052 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058178.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence0011 1080 1163 gene locus_tag LOCUS_t00090 1080 1163 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1413 2198 gene locus_tag LOCUS_01220 1413 2198 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_01220 2580 2341 gene locus_tag LOCUS_01230 2580 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3508 4938 gene locus_tag LOCUS_01240 gene lpdA 3508 4938 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920772.1 protein_id gnl|my_center|LOCUS_01240 5569 6411 gene locus_tag LOCUS_01250 gene trpC 5569 6411 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_01250 7340 7570 gene locus_tag LOCUS_01260 7340 7570 CDS product DUF5340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058031.1 protein_id gnl|my_center|LOCUS_01260 7909 8376 gene locus_tag LOCUS_01270 7909 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 9040 8967 gene locus_tag LOCUS_t00100 9040 8967 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9705 9211 gene locus_tag LOCUS_01280 9705 9211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10986 10159 gene locus_tag LOCUS_01290 10986 10159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 >Feature sequence0012 288 1076 gene locus_tag LOCUS_01300 288 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 1158 1343 gene locus_tag LOCUS_01310 1158 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 5905 2948 gene locus_tag LOCUS_01320 gene uvrA 5905 2948 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866392.1 protein_id gnl|my_center|LOCUS_01320 6558 7118 gene locus_tag LOCUS_01330 6558 7118 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_01330 7865 7716 gene locus_tag LOCUS_01340 7865 7716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 7936 8460 gene locus_tag LOCUS_01350 7936 8460 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531560.1 protein_id gnl|my_center|LOCUS_01350 8812 9420 gene locus_tag LOCUS_01360 8812 9420 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123320.1 protein_id gnl|my_center|LOCUS_01360 9529 10806 gene locus_tag LOCUS_01370 9529 10806 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057961.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence0013 373 1416 gene locus_tag LOCUS_01380 373 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 2325 1540 gene locus_tag LOCUS_01390 2325 1540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057678.1 protein_id gnl|my_center|LOCUS_01390 4618 6777 gene locus_tag LOCUS_01400 gene glyS 4618 6777 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198128218.1 protein_id gnl|my_center|LOCUS_01400 7542 8909 gene locus_tag LOCUS_01410 gene murD 7542 8909 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_01410 9102 9653 gene locus_tag LOCUS_01420 9102 9653 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_01420 9920 10411 gene locus_tag LOCUS_01430 9920 10411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01430 >Feature sequence0014 2518 377 gene locus_tag LOCUS_01440 2518 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3301 2723 gene locus_tag LOCUS_01450 3301 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3543 3301 gene locus_tag LOCUS_01460 3543 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4131 3616 gene locus_tag LOCUS_01470 4131 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 4289 4131 gene locus_tag LOCUS_01480 4289 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 4593 4267 gene locus_tag LOCUS_01490 4593 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 5066 5293 gene locus_tag LOCUS_01500 5066 5293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 5679 5996 gene locus_tag LOCUS_01510 5679 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6760 7248 gene locus_tag LOCUS_01520 6760 7248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 7744 8199 gene locus_tag LOCUS_01530 7744 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 9364 9615 gene locus_tag LOCUS_01540 9364 9615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 9924 9622 gene locus_tag LOCUS_01550 9924 9622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence0015 557 928 gene locus_tag LOCUS_01560 557 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 928 1416 gene locus_tag LOCUS_01570 928 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3487 2267 gene locus_tag LOCUS_01580 gene chlP 3487 2267 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056005.1 protein_id gnl|my_center|LOCUS_01580 3902 4162 gene locus_tag LOCUS_01590 3902 4162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 5008 5145 gene locus_tag LOCUS_01600 5008 5145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5159 6094 gene locus_tag LOCUS_01610 5159 6094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 6726 6172 gene locus_tag LOCUS_01620 6726 6172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 7133 7360 gene locus_tag LOCUS_01630 7133 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 7988 7578 gene locus_tag LOCUS_01640 7988 7578 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144326.1 protein_id gnl|my_center|LOCUS_01640 8104 9648 gene locus_tag LOCUS_01650 gene ureC 8104 9648 CDS product urease subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055860.1 protein_id gnl|my_center|LOCUS_01650 9913 10287 gene locus_tag LOCUS_01660 9913 10287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 >Feature sequence0016 491 1369 gene locus_tag LOCUS_01670 491 1369 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057494.1 protein_id gnl|my_center|LOCUS_01670 1607 2527 gene locus_tag LOCUS_01680 1607 2527 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056037.1 protein_id gnl|my_center|LOCUS_01680 2868 4259 gene locus_tag LOCUS_01690 gene hisS 2868 4259 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036976.1 protein_id gnl|my_center|LOCUS_01690 4989 5315 gene locus_tag LOCUS_01700 4989 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 5617 6132 gene locus_tag LOCUS_01710 5617 6132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6878 6366 gene locus_tag LOCUS_01720 6878 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 7907 6948 gene locus_tag LOCUS_01730 7907 6948 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142395.1 protein_id gnl|my_center|LOCUS_01730 8644 8171 gene locus_tag LOCUS_01740 8644 8171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9064 9453 gene locus_tag LOCUS_01750 9064 9453 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144373.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence0017 <1 1802 gene locus_tag LOCUS_01760 <1 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144121.1:ABC transporter ATP-binding protein 1850 2041 gene locus_tag LOCUS_01770 1850 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2069 2512 gene locus_tag LOCUS_01780 2069 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 5055 3196 gene locus_tag LOCUS_01790 gene ftsH 5055 3196 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_01790 5897 6616 gene locus_tag LOCUS_01800 5897 6616 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141012.1 protein_id gnl|my_center|LOCUS_01800 8792 6909 gene locus_tag LOCUS_01810 gene ftsH 8792 6909 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056378.1 protein_id gnl|my_center|LOCUS_01810 9118 9894 gene locus_tag LOCUS_01820 9118 9894 CDS product AhpC/TSA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125038.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence0018 937 608 gene locus_tag LOCUS_01830 937 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2441 1386 gene locus_tag LOCUS_01840 gene ccsB 2441 1386 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057454.1 protein_id gnl|my_center|LOCUS_01840 3363 4289 gene locus_tag LOCUS_01850 3363 4289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 5821 5054 gene locus_tag LOCUS_01860 gene map 5821 5054 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142406.1 protein_id gnl|my_center|LOCUS_01860 8305 6311 gene locus_tag LOCUS_01870 8305 6311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8952 9848 gene locus_tag LOCUS_01880 8952 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 >Feature sequence0019 1152 1418 gene locus_tag LOCUS_01890 1152 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124299.1 protein_id gnl|my_center|LOCUS_01890 1415 2095 gene locus_tag LOCUS_01900 1415 2095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920717.1 protein_id gnl|my_center|LOCUS_01900 3067 3585 gene locus_tag LOCUS_01910 3067 3585 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142986.1 protein_id gnl|my_center|LOCUS_01910 3741 3814 gene locus_tag LOCUS_t00110 3741 3814 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4405 4590 gene locus_tag LOCUS_01920 4405 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01920 5032 4835 gene locus_tag LOCUS_01930 5032 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 6190 5291 gene locus_tag LOCUS_01940 6190 5291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 6156 7217 gene locus_tag LOCUS_01950 gene psbA 6156 7217 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_01950 8159 7824 gene locus_tag LOCUS_01960 8159 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 8578 8823 gene locus_tag LOCUS_01970 8578 8823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8835 9035 gene locus_tag LOCUS_01980 8835 9035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0020 346 122 gene locus_tag LOCUS_01990 346 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 1658 822 gene locus_tag LOCUS_02000 1658 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2864 1854 gene locus_tag LOCUS_02010 2864 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 4687 3467 gene locus_tag LOCUS_02020 4687 3467 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939181.1 protein_id gnl|my_center|LOCUS_02020 6055 5063 gene locus_tag LOCUS_02030 6055 5063 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106575.1 protein_id gnl|my_center|LOCUS_02030 7447 6467 gene locus_tag LOCUS_02040 7447 6467 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057867.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02040 8885 7692 gene locus_tag LOCUS_02050 8885 7692 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393360.1 protein_id gnl|my_center|LOCUS_02050 <9952 9446 gene locus_tag LOCUS_02060 <9952 9446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086172.1:SDR family oxidoreductase >Feature sequence0021 9 1034 gene locus_tag LOCUS_02070 9 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3098 1728 gene locus_tag LOCUS_02080 3098 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4327 3110 gene locus_tag LOCUS_02090 gene lysA 4327 3110 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939836.1 protein_id gnl|my_center|LOCUS_02090 5039 4614 gene locus_tag LOCUS_02100 5039 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 5855 5490 gene locus_tag LOCUS_02110 5855 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 6897 7148 gene locus_tag LOCUS_02120 6897 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02120 7695 7874 gene locus_tag LOCUS_02130 7695 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 8842 9384 gene locus_tag LOCUS_02140 8842 9384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 >Feature sequence0022 948 1295 gene locus_tag LOCUS_02150 948 1295 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057330.1 protein_id gnl|my_center|LOCUS_02150 2183 3499 gene locus_tag LOCUS_02160 2183 3499 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140609.1 protein_id gnl|my_center|LOCUS_02160 3502 4248 gene locus_tag LOCUS_02170 3502 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 4739 5113 gene locus_tag LOCUS_02180 4739 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 5332 6177 gene locus_tag LOCUS_02190 5332 6177 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_02190 6784 7941 gene locus_tag LOCUS_02200 6784 7941 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056459.1 protein_id gnl|my_center|LOCUS_02200 >Feature sequence0023 1356 589 gene locus_tag LOCUS_02210 1356 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 1764 2495 gene locus_tag LOCUS_02220 1764 2495 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057978.1 protein_id gnl|my_center|LOCUS_02220 2511 3056 gene locus_tag LOCUS_02230 2511 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 4007 3609 gene locus_tag LOCUS_02240 4007 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4658 4089 gene locus_tag LOCUS_02250 4658 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4956 6326 gene locus_tag LOCUS_02260 4956 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 7371 8435 gene locus_tag LOCUS_02270 gene hemE 7371 8435 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence0024 1085 591 gene locus_tag LOCUS_02280 1085 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 1307 1140 gene locus_tag LOCUS_02290 1307 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1353 1529 gene locus_tag LOCUS_02300 1353 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2268 1711 gene locus_tag LOCUS_02310 2268 1711 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_02310 2536 3705 gene locus_tag LOCUS_02320 2536 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3770 4084 gene locus_tag LOCUS_02330 3770 4084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4066 5007 gene locus_tag LOCUS_02340 4066 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 5028 5777 gene locus_tag LOCUS_02350 5028 5777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 5838 6122 gene locus_tag LOCUS_02360 5838 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6260 7015 gene locus_tag LOCUS_02370 6260 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7091 7837 gene locus_tag LOCUS_02380 7091 7837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence0025 1528 2745 gene locus_tag LOCUS_02390 gene tyrS 1528 2745 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055905.1 protein_id gnl|my_center|LOCUS_02390 3679 4383 gene locus_tag LOCUS_02400 gene pyrF 3679 4383 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_02400 5221 5784 gene locus_tag LOCUS_02410 5221 5784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 6149 6382 gene locus_tag LOCUS_02420 gene yggU 6149 6382 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277224.1 protein_id gnl|my_center|LOCUS_02420 7107 6379 gene locus_tag LOCUS_02430 7107 6379 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_02430 8636 7254 gene locus_tag LOCUS_02440 8636 7254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 >Feature sequence0026 2042 2902 gene locus_tag LOCUS_02450 2042 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3094 4602 gene locus_tag LOCUS_02460 3094 4602 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_02460 5391 7808 gene locus_tag LOCUS_02470 5391 7808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 8452 8524 gene locus_tag LOCUS_t00120 8452 8524 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0027 1322 105 gene locus_tag LOCUS_02480 1322 105 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_02480 2667 2113 gene locus_tag LOCUS_02490 2667 2113 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_02490 3227 4732 gene locus_tag LOCUS_02500 gene malQ 3227 4732 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_02500 5935 7593 gene locus_tag LOCUS_02510 5935 7593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8406 9182 gene locus_tag LOCUS_02520 8406 9182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence0028 <1 723 gene locus_tag LOCUS_02530 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140787.1:hemolysin family protein 1969 1535 gene locus_tag LOCUS_02540 gene queF 1969 1535 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_02540 2113 2691 gene locus_tag LOCUS_02550 2113 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 3650 3204 gene locus_tag LOCUS_02560 gene speD 3650 3204 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496461.1 protein_id gnl|my_center|LOCUS_02560 4868 3813 gene locus_tag LOCUS_02570 4868 3813 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_02570 6265 7317 gene locus_tag LOCUS_02580 6265 7317 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_02580 7761 8417 gene locus_tag LOCUS_02590 7761 8417 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057508.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence0029 <1 894 gene locus_tag LOCUS_02600 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058222.1:adenosylhomocysteinase 1760 2386 gene locus_tag LOCUS_02610 1760 2386 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920979.1 protein_id gnl|my_center|LOCUS_02610 2455 3201 gene locus_tag LOCUS_02620 2455 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 3635 6364 gene locus_tag LOCUS_02630 3635 6364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6433 7464 gene locus_tag LOCUS_02640 6433 7464 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057101.1 protein_id gnl|my_center|LOCUS_02640 7755 7594 gene locus_tag LOCUS_02650 7755 7594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 7819 8694 gene locus_tag LOCUS_02660 7819 8694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence0030 3230 1515 gene locus_tag LOCUS_02670 3230 1515 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928693.1 protein_id gnl|my_center|LOCUS_02670 3351 4241 gene locus_tag LOCUS_02680 3351 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5459 4755 gene locus_tag LOCUS_02690 5459 4755 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_02690 6261 5548 gene locus_tag LOCUS_02700 6261 5548 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141382.1 protein_id gnl|my_center|LOCUS_02700 6710 7726 gene locus_tag LOCUS_02710 6710 7726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 <9151 7993 gene locus_tag LOCUS_02720 <9151 7993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056559.1:argininosuccinate synthase >Feature sequence0031 284 3016 gene locus_tag LOCUS_02730 284 3016 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056370.1 protein_id gnl|my_center|LOCUS_02730 3261 3521 gene locus_tag LOCUS_02740 3261 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007358131.1 protein_id gnl|my_center|LOCUS_02740 4368 4685 gene locus_tag LOCUS_02750 4368 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 5427 4696 gene locus_tag LOCUS_02760 gene phnF 5427 4696 CDS product phosphonate metabolism transcriptional regulator PhnF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311161.1 protein_id gnl|my_center|LOCUS_02760 5531 5692 gene locus_tag LOCUS_02770 5531 5692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 6117 6560 gene locus_tag LOCUS_02780 gene phnG 6117 6560 CDS product phosphonate C-P lyase system protein PhnG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246944.1 protein_id gnl|my_center|LOCUS_02780 7506 7315 gene locus_tag LOCUS_02790 7506 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 8095 7601 gene locus_tag LOCUS_02800 8095 7601 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_02800 8791 8231 gene locus_tag LOCUS_02810 8791 8231 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence0032 1153 308 gene locus_tag LOCUS_02820 1153 308 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530214.1 protein_id gnl|my_center|LOCUS_02820 2014 1289 gene locus_tag LOCUS_02830 2014 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 2279 2031 gene locus_tag LOCUS_02840 2279 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 3226 2837 gene locus_tag LOCUS_02850 3226 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4864 3662 gene locus_tag LOCUS_02860 4864 3662 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461084.1 protein_id gnl|my_center|LOCUS_02860 4881 5180 gene locus_tag LOCUS_02870 4881 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 5959 7392 gene locus_tag LOCUS_02880 5959 7392 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929201.1 protein_id gnl|my_center|LOCUS_02880 7992 9023 gene locus_tag LOCUS_02890 7992 9023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence0033 501 52 gene locus_tag LOCUS_02900 501 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 932 1108 gene locus_tag LOCUS_02910 932 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 1095 1556 gene locus_tag LOCUS_02920 1095 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 1569 1751 gene locus_tag LOCUS_02930 1569 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2163 2420 gene locus_tag LOCUS_02940 2163 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 2456 2689 gene locus_tag LOCUS_02950 2456 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 2686 3102 gene locus_tag LOCUS_02960 2686 3102 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_02960 5105 3588 gene locus_tag LOCUS_02970 5105 3588 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_02970 6281 5667 gene locus_tag LOCUS_02980 6281 5667 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142159.1 protein_id gnl|my_center|LOCUS_02980 8224 6530 gene locus_tag LOCUS_02990 gene ctaD 8224 6530 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140742.1 protein_id gnl|my_center|LOCUS_02990 >Feature sequence0034 395 1393 gene locus_tag LOCUS_03000 gene egtD 395 1393 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088429091.1 protein_id gnl|my_center|LOCUS_03000 1761 3104 gene locus_tag LOCUS_03010 1761 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3197 3436 gene locus_tag LOCUS_03020 3197 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3535 3900 gene locus_tag LOCUS_03030 3535 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4029 4871 gene locus_tag LOCUS_03040 4029 4871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 4893 6248 gene locus_tag LOCUS_03050 4893 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6439 7383 gene locus_tag LOCUS_03060 6439 7383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7629 7859 gene locus_tag LOCUS_03070 7629 7859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence0035 2048 1089 gene locus_tag LOCUS_03080 2048 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2292 3086 gene locus_tag LOCUS_03090 gene phnC 2292 3086 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113118.1 protein_id gnl|my_center|LOCUS_03090 3328 4170 gene locus_tag LOCUS_03100 gene phnE 3328 4170 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091793.1 protein_id gnl|my_center|LOCUS_03100 6156 4447 gene locus_tag LOCUS_03110 6156 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03110 <8294 6205 gene locus_tag LOCUS_03120 <8294 6205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein note possible pseudo, internal stop codon >Feature sequence0036 <1 4252 gene locus_tag LOCUS_03130 <1 4252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence0037 702 1787 gene locus_tag LOCUS_03140 gene mraY 702 1787 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799153.1 protein_id gnl|my_center|LOCUS_03140 2011 2937 gene locus_tag LOCUS_03150 2011 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3455 3826 gene locus_tag LOCUS_03160 3455 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 4852 4355 gene locus_tag LOCUS_03170 4852 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 5244 6362 gene locus_tag LOCUS_03180 5244 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6362 7042 gene locus_tag LOCUS_03190 6362 7042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 <8191 7296 gene locus_tag LOCUS_03200 <8191 7296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141468.1:AarF/ABC1/UbiB kinase family protein >Feature sequence0038 161 1789 gene locus_tag LOCUS_03210 161 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03210 1949 2680 gene locus_tag LOCUS_03220 gene pflA 1949 2680 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799649.1 protein_id gnl|my_center|LOCUS_03220 2715 3032 gene locus_tag LOCUS_03230 2715 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 3372 3608 gene locus_tag LOCUS_03240 3372 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4350 7955 gene locus_tag LOCUS_03250 gene nifJ 4350 7955 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence0039 944 237 gene locus_tag LOCUS_03260 944 237 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_03260 2337 1612 gene locus_tag LOCUS_03270 2337 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 3673 2870 gene locus_tag LOCUS_03280 3673 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 6147 4216 gene locus_tag LOCUS_03290 6147 4216 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798165.1 protein_id gnl|my_center|LOCUS_03290 6688 6248 gene locus_tag LOCUS_03300 6688 6248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 7592 7263 gene locus_tag LOCUS_03310 7592 7263 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015154861.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence0040 951 1 gene locus_tag LOCUS_03320 951 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1819 1250 gene locus_tag LOCUS_03330 1819 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 2682 2047 gene locus_tag LOCUS_03340 2682 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3915 4532 gene locus_tag LOCUS_03350 3915 4532 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057873.1 protein_id gnl|my_center|LOCUS_03350 4621 4833 gene locus_tag LOCUS_03360 4621 4833 CDS product DUF2555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125484.1 protein_id gnl|my_center|LOCUS_03360 5519 6745 gene locus_tag LOCUS_03370 gene coaBC 5519 6745 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921057.1 protein_id gnl|my_center|LOCUS_03370 7466 6759 gene locus_tag LOCUS_03380 7466 6759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0041 96 302 gene locus_tag LOCUS_03390 96 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 5232 640 gene locus_tag LOCUS_03400 5232 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5750 6886 gene locus_tag LOCUS_03410 5750 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 7431 7147 gene locus_tag LOCUS_03420 7431 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 >Feature sequence0042 5203 2822 gene locus_tag LOCUS_03430 gene recJ 5203 2822 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056029.1 protein_id gnl|my_center|LOCUS_03430 7351 6155 gene locus_tag LOCUS_03440 7351 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence0043 1546 2709 gene locus_tag LOCUS_03450 gene corA 1546 2709 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_03450 3993 4862 gene locus_tag LOCUS_03460 3993 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 6038 5883 gene locus_tag LOCUS_03470 6038 5883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 6612 6451 gene locus_tag LOCUS_03480 6612 6451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 6759 7595 gene locus_tag LOCUS_03490 6759 7595 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055920.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence0044 <1 1336 gene locus_tag LOCUS_03500 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257763.1:carboxypeptidase M32 1948 2745 gene locus_tag LOCUS_03510 1948 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3756 7382 gene locus_tag LOCUS_03520 3756 7382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 7438 7521 gene locus_tag LOCUS_t00130 7438 7521 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0045 294 106 gene locus_tag LOCUS_03530 294 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03530 609 331 gene locus_tag LOCUS_03540 609 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03540 2171 1026 gene locus_tag LOCUS_03550 2171 1026 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058228.1 protein_id gnl|my_center|LOCUS_03550 3105 2380 gene locus_tag LOCUS_03560 3105 2380 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_03560 7508 4176 gene locus_tag LOCUS_03570 gene treS 7508 4176 CDS product maltose alpha-D-glucosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257046.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence0046 390 686 gene locus_tag LOCUS_03580 390 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 667 834 gene locus_tag LOCUS_03590 667 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 1023 1253 gene locus_tag LOCUS_03600 1023 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1283 2023 gene locus_tag LOCUS_03610 1283 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1995 3566 gene locus_tag LOCUS_03620 1995 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 3634 3933 gene locus_tag LOCUS_03630 3634 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3994 7200 gene locus_tag LOCUS_03640 3994 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7203 7514 gene locus_tag LOCUS_03650 7203 7514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence0047 143 892 gene locus_tag LOCUS_03660 143 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 928 1833 gene locus_tag LOCUS_03670 gene prmC 928 1833 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_03670 1929 2516 gene locus_tag LOCUS_03680 1929 2516 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_03680 2551 3498 gene locus_tag LOCUS_03690 2551 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 4384 3896 gene locus_tag LOCUS_03700 4384 3896 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_03700 5247 6305 gene locus_tag LOCUS_03710 5247 6305 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_03710 6445 7119 gene locus_tag LOCUS_03720 6445 7119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence0048 2402 1473 gene locus_tag LOCUS_03730 2402 1473 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141330.1 protein_id gnl|my_center|LOCUS_03730 2523 3284 gene locus_tag LOCUS_03740 2523 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 4641 3637 gene locus_tag LOCUS_03750 4641 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 5691 5029 gene locus_tag LOCUS_03760 5691 5029 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056895.1 protein_id gnl|my_center|LOCUS_03760 6860 7318 gene locus_tag LOCUS_03770 6860 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 >Feature sequence0049 <1 972 gene locus_tag LOCUS_03780 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056200.1:response regulator 1511 2710 gene locus_tag LOCUS_03790 1511 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2859 4265 gene locus_tag LOCUS_03800 gene fumC 2859 4265 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948622.1 protein_id gnl|my_center|LOCUS_03800 6594 4696 gene locus_tag LOCUS_03810 6594 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0050 <1 1627 gene locus_tag LOCUS_03820 <1 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969400.1:response regulator 2088 1780 gene locus_tag LOCUS_03830 2088 1780 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340579.1 protein_id gnl|my_center|LOCUS_03830 2500 2652 gene locus_tag LOCUS_03840 2500 2652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03840 2965 3663 gene locus_tag LOCUS_03850 2965 3663 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_03850 4810 3980 gene locus_tag LOCUS_03860 gene larB 4810 3980 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141462.1 protein_id gnl|my_center|LOCUS_03860 7221 5446 gene locus_tag LOCUS_03870 7221 5446 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_03870 >Feature sequence0051 3142 557 gene locus_tag LOCUS_03880 3142 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 3546 3295 gene locus_tag LOCUS_03890 3546 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3952 4896 gene locus_tag LOCUS_03900 3952 4896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 5719 4790 gene locus_tag LOCUS_03910 5719 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6699 6944 gene locus_tag LOCUS_03920 6699 6944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence0052 3577 2855 gene locus_tag LOCUS_03930 3577 2855 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_03930 4348 3653 gene locus_tag LOCUS_03940 4348 3653 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_03940 4389 4488 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6797 5025 gene locus_tag LOCUS_03950 6797 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence0053 2614 716 gene locus_tag LOCUS_03960 2614 716 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140584.1 protein_id gnl|my_center|LOCUS_03960 2970 3635 gene locus_tag LOCUS_03970 2970 3635 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056621.1 protein_id gnl|my_center|LOCUS_03970 3921 3757 gene locus_tag LOCUS_03980 3921 3757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4350 5681 gene locus_tag LOCUS_03990 4350 5681 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929187.1 protein_id gnl|my_center|LOCUS_03990 <7385 5897 gene locus_tag LOCUS_04000 <7385 5897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023004217.1:VCBS domain-containing protein >Feature sequence0054 1215 2489 gene locus_tag LOCUS_04010 1215 2489 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_04010 2817 4769 gene locus_tag LOCUS_04020 2817 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 4830 4997 gene locus_tag LOCUS_04030 4830 4997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5307 6071 gene locus_tag LOCUS_04040 5307 6071 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125923.1 protein_id gnl|my_center|LOCUS_04040 6437 6204 gene locus_tag LOCUS_04050 gene secG 6437 6204 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_04050 >Feature sequence0055 251 99 gene locus_tag LOCUS_04060 251 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 625 1344 gene locus_tag LOCUS_04070 gene tmpR 625 1344 CDS product bifunctional dihydropteridine reductase/dihydrofolate reductase TmpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172549.1 protein_id gnl|my_center|LOCUS_04070 1417 1863 gene locus_tag LOCUS_04080 gene queD 1417 1863 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_04080 2274 2543 gene locus_tag LOCUS_04090 2274 2543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 3505 2771 gene locus_tag LOCUS_04100 3505 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 5010 3838 gene locus_tag LOCUS_04110 gene sat 5010 3838 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056887.1 protein_id gnl|my_center|LOCUS_04110 5845 6159 gene locus_tag LOCUS_04120 5845 6159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 <7364 6355 gene locus_tag LOCUS_04130 <7364 6355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057128.1:NAD(P)H-quinone oxidoreductase subunit H >Feature sequence0056 325 3765 gene locus_tag LOCUS_04140 325 3765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 >Feature sequence0057 <1 1094 gene locus_tag LOCUS_04150 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020246.1:tetratricopeptide repeat protein 3246 1381 gene locus_tag LOCUS_04160 3246 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4640 3876 gene locus_tag LOCUS_04170 4640 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 7159 5339 gene locus_tag LOCUS_04180 7159 5339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence0058 198 1 gene locus_tag LOCUS_04190 198 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 624 292 gene locus_tag LOCUS_04200 624 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04200 1789 2694 gene locus_tag LOCUS_04210 1789 2694 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_04210 2983 3429 gene locus_tag LOCUS_04220 2983 3429 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928616.1 protein_id gnl|my_center|LOCUS_04220 4048 4725 gene locus_tag LOCUS_04230 4048 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 4890 6305 gene locus_tag LOCUS_04240 4890 6305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence0059 2169 427 gene locus_tag LOCUS_04250 2169 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 3380 2763 gene locus_tag LOCUS_04260 3380 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 4064 4300 gene locus_tag LOCUS_04270 4064 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 4631 4801 gene locus_tag LOCUS_04280 4631 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4991 5209 gene locus_tag LOCUS_04290 4991 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 5668 5877 gene locus_tag LOCUS_04300 5668 5877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 6846 6046 gene locus_tag LOCUS_04310 6846 6046 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_04310 >Feature sequence0060 <1 1527 gene locus_tag LOCUS_04320 <1 1527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258635.1:ExeM/NucH family extracellular endonuclease 1801 2352 gene locus_tag LOCUS_04330 1801 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3382 2630 gene locus_tag LOCUS_04340 3382 2630 CDS product cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390736.1 protein_id gnl|my_center|LOCUS_04340 5700 3682 gene locus_tag LOCUS_04350 5700 3682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 6513 6049 gene locus_tag LOCUS_04360 6513 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6914 6555 gene locus_tag LOCUS_04370 6914 6555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence0061 877 1311 gene locus_tag LOCUS_04380 877 1311 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056992.1 protein_id gnl|my_center|LOCUS_04380 2745 4295 gene locus_tag LOCUS_04390 2745 4295 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142479.1 protein_id gnl|my_center|LOCUS_04390 5116 5442 gene locus_tag LOCUS_04400 5116 5442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 5527 6141 gene locus_tag LOCUS_04410 5527 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04410 6277 6837 gene locus_tag LOCUS_04420 6277 6837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 >Feature sequence0062 2 694 gene locus_tag LOCUS_04430 2 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1329 1907 gene locus_tag LOCUS_04440 1329 1907 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243181.1 protein_id gnl|my_center|LOCUS_04440 2347 2994 gene locus_tag LOCUS_04450 2347 2994 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_04450 3757 3152 gene locus_tag LOCUS_04460 3757 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 4291 3833 gene locus_tag LOCUS_04470 4291 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4725 4937 gene locus_tag LOCUS_04480 4725 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4970 5188 gene locus_tag LOCUS_04490 4970 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5181 5606 gene locus_tag LOCUS_04500 5181 5606 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250136.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence0063 227 667 gene locus_tag LOCUS_04510 227 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 680 1105 gene locus_tag LOCUS_04520 680 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 1650 1399 gene locus_tag LOCUS_04530 1650 1399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2072 3208 gene locus_tag LOCUS_04540 2072 3208 CDS product saccharopine dehydrogenase NADP-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141720.1 protein_id gnl|my_center|LOCUS_04540 3333 3599 gene locus_tag LOCUS_04550 3333 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 4440 5066 gene locus_tag LOCUS_04560 4440 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 >Feature sequence0064 <1 2449 gene locus_tag LOCUS_04570 <1 2449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797887.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 2541 4289 gene locus_tag LOCUS_04580 2541 4289 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031064.1 protein_id gnl|my_center|LOCUS_04580 5318 4749 gene locus_tag LOCUS_04590 5318 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence0065 1646 753 gene locus_tag LOCUS_04600 1646 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2073 1744 gene locus_tag LOCUS_04610 2073 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3079 2666 gene locus_tag LOCUS_04620 3079 2666 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_04620 3541 5331 gene locus_tag LOCUS_04630 gene typA 3541 5331 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_04630 5716 6690 gene locus_tag LOCUS_04640 5716 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 >Feature sequence0066 1464 973 gene locus_tag LOCUS_04650 1464 973 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797565.1 protein_id gnl|my_center|LOCUS_04650 1568 2398 gene locus_tag LOCUS_04660 1568 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3462 3561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5160 4063 gene locus_tag LOCUS_04670 5160 4063 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057211.1 protein_id gnl|my_center|LOCUS_04670 <7103 6013 gene locus_tag LOCUS_04680 <7103 6013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057427.1:type I glutamate--ammonia ligase >Feature sequence0067 24 284 gene locus_tag LOCUS_04690 24 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 667 849 gene locus_tag LOCUS_04700 667 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1686 2072 gene locus_tag LOCUS_04710 1686 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 2088 2741 gene locus_tag LOCUS_04720 2088 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04720 4482 3052 gene locus_tag LOCUS_04730 4482 3052 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_04730 6561 5095 gene locus_tag LOCUS_04740 6561 5095 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0068 419 1171 gene locus_tag LOCUS_04750 419 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2054 1854 gene locus_tag LOCUS_04760 2054 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 3297 2281 gene locus_tag LOCUS_04770 3297 2281 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057591.1 protein_id gnl|my_center|LOCUS_04770 4766 5299 gene locus_tag LOCUS_04780 4766 5299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5333 5521 gene locus_tag LOCUS_04790 gene rpmG 5333 5521 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_04790 5597 5815 gene locus_tag LOCUS_04800 gene rpsR 5597 5815 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0069 473 30 gene locus_tag LOCUS_04810 473 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 1648 878 gene locus_tag LOCUS_04820 gene rutB 1648 878 CDS product peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014640125.1 protein_id gnl|my_center|LOCUS_04820 2768 2592 gene locus_tag LOCUS_04830 2768 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3050 2835 gene locus_tag LOCUS_04840 3050 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 3760 3536 gene locus_tag LOCUS_04850 3760 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 4232 5431 gene locus_tag LOCUS_04860 4232 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 >Feature sequence0070 748 1371 gene locus_tag LOCUS_04870 748 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2512 1421 gene locus_tag LOCUS_04880 gene thrC 2512 1421 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_04880 3247 3486 gene locus_tag LOCUS_04890 3247 3486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3821 4876 gene locus_tag LOCUS_04900 3821 4876 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_04900 5369 5563 gene locus_tag LOCUS_04910 5369 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 5615 6232 gene locus_tag LOCUS_04920 5615 6232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04920 6272 6577 gene locus_tag LOCUS_04930 6272 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence0071 381 229 gene locus_tag LOCUS_04940 381 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 1714 860 gene locus_tag LOCUS_04950 1714 860 CDS product CbiQ family ECF transporter T component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056139.1 protein_id gnl|my_center|LOCUS_04950 1617 1880 gene locus_tag LOCUS_04960 1617 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 3753 2392 gene locus_tag LOCUS_04970 gene der 3753 2392 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056722.1 protein_id gnl|my_center|LOCUS_04970 4229 4858 gene locus_tag LOCUS_04980 4229 4858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 6164 5271 gene locus_tag LOCUS_04990 gene prmA 6164 5271 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_04990 >Feature sequence0072 191 1570 gene locus_tag LOCUS_05000 191 1570 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_05000 1975 1730 gene locus_tag LOCUS_05010 1975 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 2195 2698 gene locus_tag LOCUS_05020 2195 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 2717 3166 gene locus_tag LOCUS_05030 2717 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168695229.1 protein_id gnl|my_center|LOCUS_05030 4452 3928 gene locus_tag LOCUS_05040 4452 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6584 4746 gene locus_tag LOCUS_05050 6584 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 >Feature sequence0073 811 362 gene locus_tag LOCUS_05060 811 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1510 1352 gene locus_tag LOCUS_05070 1510 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 1879 1691 gene locus_tag LOCUS_05080 1879 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3156 2365 gene locus_tag LOCUS_05090 3156 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 4014 4970 gene locus_tag LOCUS_05100 4014 4970 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329334.1 protein_id gnl|my_center|LOCUS_05100 6175 5516 gene locus_tag LOCUS_05110 6175 5516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 6628 6176 gene locus_tag LOCUS_05120 6628 6176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence0074 1299 1000 gene locus_tag LOCUS_05130 1299 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1374 2165 gene locus_tag LOCUS_05140 1374 2165 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920669.1 protein_id gnl|my_center|LOCUS_05140 2672 2415 gene locus_tag LOCUS_05150 2672 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 4551 3133 gene locus_tag LOCUS_05160 4551 3133 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056475.1 protein_id gnl|my_center|LOCUS_05160 6191 4728 gene locus_tag LOCUS_05170 6191 4728 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920854.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0075 539 2656 gene locus_tag LOCUS_05180 539 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 3140 2805 gene locus_tag LOCUS_05190 3140 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3539 3222 gene locus_tag LOCUS_05200 3539 3222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 3852 3556 gene locus_tag LOCUS_05210 3852 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 4202 5527 gene locus_tag LOCUS_05220 4202 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence0076 914 123 gene locus_tag LOCUS_05230 914 123 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142987.1 protein_id gnl|my_center|LOCUS_05230 2198 1263 gene locus_tag LOCUS_05240 2198 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3877 2375 gene locus_tag LOCUS_05250 3877 2375 CDS product bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141081.1 protein_id gnl|my_center|LOCUS_05250 4162 4950 gene locus_tag LOCUS_05260 4162 4950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4865 5077 gene locus_tag LOCUS_05270 4865 5077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5329 6159 gene locus_tag LOCUS_05280 5329 6159 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140468.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence0077 <1 1098 gene locus_tag LOCUS_05290 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073594983.1:competence/damage-inducible protein A 1391 1525 gene locus_tag LOCUS_05300 1391 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1554 2000 gene locus_tag LOCUS_05310 gene aroQ 1554 2000 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920703.1 protein_id gnl|my_center|LOCUS_05310 2875 4014 gene locus_tag LOCUS_05320 2875 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 4045 6552 gene locus_tag LOCUS_05330 4045 6552 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096663323.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0078 715 2589 gene locus_tag LOCUS_05340 gene uvrC 715 2589 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_05340 3827 3135 gene locus_tag LOCUS_05350 3827 3135 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057465.1 protein_id gnl|my_center|LOCUS_05350 5324 4476 gene locus_tag LOCUS_05360 5324 4476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05360 5699 5394 gene locus_tag LOCUS_05370 5699 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence0079 2510 468 gene locus_tag LOCUS_05380 2510 468 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962866.1 protein_id gnl|my_center|LOCUS_05380 3208 2546 gene locus_tag LOCUS_05390 3208 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 4467 3718 gene locus_tag LOCUS_05400 4467 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5860 4682 gene locus_tag LOCUS_05410 5860 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6047 5868 gene locus_tag LOCUS_05420 6047 5868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 >Feature sequence0080 400 107 gene locus_tag LOCUS_05430 400 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 601 888 gene locus_tag LOCUS_05440 601 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05440 1445 1200 gene locus_tag LOCUS_05450 1445 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4183 1571 gene locus_tag LOCUS_05460 gene clpB 4183 1571 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_05460 6331 4604 gene locus_tag LOCUS_05470 6331 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence0081 <1 950 gene locus_tag LOCUS_05480 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969639.1:ABC transporter permease 1338 2246 gene locus_tag LOCUS_05490 1338 2246 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583516.1 protein_id gnl|my_center|LOCUS_05490 3061 4629 gene locus_tag LOCUS_05500 gene lysS 3061 4629 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296055.1 protein_id gnl|my_center|LOCUS_05500 5330 5025 gene locus_tag LOCUS_05510 5330 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 5802 5527 gene locus_tag LOCUS_05520 5802 5527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6586 5945 gene locus_tag LOCUS_05530 6586 5945 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929078.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0082 17 286 gene locus_tag LOCUS_05540 17 286 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056832.1 protein_id gnl|my_center|LOCUS_05540 283 1404 gene locus_tag LOCUS_05550 gene rsgA 283 1404 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056831.1 protein_id gnl|my_center|LOCUS_05550 5384 2391 gene locus_tag LOCUS_05560 5384 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 >Feature sequence0083 910 2268 gene locus_tag LOCUS_05570 910 2268 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057372.1 protein_id gnl|my_center|LOCUS_05570 3430 4713 gene locus_tag LOCUS_05580 3430 4713 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088243667.1 protein_id gnl|my_center|LOCUS_05580 4861 5061 gene locus_tag LOCUS_05590 4861 5061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 5487 5287 gene locus_tag LOCUS_05600 5487 5287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 5565 5804 gene locus_tag LOCUS_05610 5565 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 >Feature sequence0084 234 455 gene locus_tag LOCUS_05620 234 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1208 1975 gene locus_tag LOCUS_05630 gene rsmG 1208 1975 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140710.1 protein_id gnl|my_center|LOCUS_05630 2124 2321 gene locus_tag LOCUS_05640 2124 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 2953 2519 gene locus_tag LOCUS_05650 2953 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388762.1 protein_id gnl|my_center|LOCUS_05650 3297 4070 gene locus_tag LOCUS_05660 3297 4070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089047.1 protein_id gnl|my_center|LOCUS_05660 4908 5576 gene locus_tag LOCUS_05670 4908 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 6131 5892 gene locus_tag LOCUS_05680 6131 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence0085 732 1736 gene locus_tag LOCUS_05690 732 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 2065 1820 gene locus_tag LOCUS_05700 2065 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2615 2106 gene locus_tag LOCUS_05710 2615 2106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3107 2814 gene locus_tag LOCUS_05720 3107 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 4638 3304 gene locus_tag LOCUS_05730 4638 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4815 6215 gene locus_tag LOCUS_05740 4815 6215 CDS product DICT sensory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929211.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence0086 1869 2099 gene locus_tag LOCUS_05750 1869 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2854 2261 gene locus_tag LOCUS_05760 2854 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 3090 2959 gene locus_tag LOCUS_05770 3090 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3219 3611 gene locus_tag LOCUS_05780 3219 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05780 3627 4418 gene locus_tag LOCUS_05790 3627 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05790 5193 4975 gene locus_tag LOCUS_05800 5193 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 6257 5772 gene locus_tag LOCUS_05810 6257 5772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence0087 762 511 gene locus_tag LOCUS_05820 762 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1305 964 gene locus_tag LOCUS_05830 1305 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 1427 2647 gene locus_tag LOCUS_05840 gene ispG 1427 2647 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056840.1 protein_id gnl|my_center|LOCUS_05840 3813 5105 gene locus_tag LOCUS_05850 3813 5105 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_05850 5319 5128 gene locus_tag LOCUS_05860 5319 5128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence0088 1574 675 gene locus_tag LOCUS_05870 1574 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2376 2125 gene locus_tag LOCUS_05880 2376 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2648 2403 gene locus_tag LOCUS_05890 2648 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2836 3363 gene locus_tag LOCUS_05900 gene cysC 2836 3363 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_05900 3390 5045 gene locus_tag LOCUS_05910 3390 5045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0089 1249 1566 gene locus_tag LOCUS_05920 1249 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1737 2282 gene locus_tag LOCUS_05930 1737 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 2939 3538 gene locus_tag LOCUS_05940 2939 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3751 4599 gene locus_tag LOCUS_05950 3751 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4779 5267 gene locus_tag LOCUS_05960 4779 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 5295 6158 gene locus_tag LOCUS_05970 5295 6158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence0090 897 2165 gene locus_tag LOCUS_05980 897 2165 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142580.1 protein_id gnl|my_center|LOCUS_05980 2378 3013 gene locus_tag LOCUS_05990 2378 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 3539 3204 gene locus_tag LOCUS_06000 3539 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 3943 3815 gene locus_tag LOCUS_06010 3943 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4081 5022 gene locus_tag LOCUS_06020 4081 5022 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976356.1 protein_id gnl|my_center|LOCUS_06020 5114 5431 gene locus_tag LOCUS_06030 5114 5431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 <6596 5693 gene locus_tag LOCUS_06040 <6596 5693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868784.1:AbgT family transporter >Feature sequence0091 1341 772 gene locus_tag LOCUS_06050 1341 772 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972294.1 protein_id gnl|my_center|LOCUS_06050 2397 1834 gene locus_tag LOCUS_06060 2397 1834 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_06060 3124 2582 gene locus_tag LOCUS_06070 gene psbP 3124 2582 CDS product photosystem II reaction center PsbP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057910.1 protein_id gnl|my_center|LOCUS_06070 3674 3522 gene locus_tag LOCUS_06080 3674 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3881 4078 gene locus_tag LOCUS_06090 3881 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6005 4725 gene locus_tag LOCUS_06100 6005 4725 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence0092 765 1532 gene locus_tag LOCUS_06110 765 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2579 4219 gene locus_tag LOCUS_06120 2579 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4460 5044 gene locus_tag LOCUS_06130 4460 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6077 5397 gene locus_tag LOCUS_06140 6077 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence0093 2544 3251 gene locus_tag LOCUS_06150 2544 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4126 5820 gene locus_tag LOCUS_06160 4126 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence0094 2391 3692 gene locus_tag LOCUS_06170 2391 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 3891 4256 gene locus_tag LOCUS_06180 3891 4256 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_06180 4442 6466 gene locus_tag LOCUS_06190 4442 6466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence0095 1775 591 gene locus_tag LOCUS_06200 gene corA 1775 591 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_06200 2121 2450 gene locus_tag LOCUS_06210 2121 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2674 2453 gene locus_tag LOCUS_06220 2674 2453 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057829.1 protein_id gnl|my_center|LOCUS_06220 2788 3012 gene locus_tag LOCUS_06230 2788 3012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3243 3401 gene locus_tag LOCUS_06240 3243 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3490 5508 gene locus_tag LOCUS_06250 gene dnaG 3490 5508 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057157.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence0096 2010 3104 gene locus_tag LOCUS_06260 2010 3104 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143227.1 protein_id gnl|my_center|LOCUS_06260 4140 4520 gene locus_tag LOCUS_06270 4140 4520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 4943 5042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5226 6314 gene locus_tag LOCUS_06280 5226 6314 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0097 82 336 gene locus_tag LOCUS_06290 82 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 711 1595 gene locus_tag LOCUS_06300 711 1595 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173997.1 protein_id gnl|my_center|LOCUS_06300 1741 2595 gene locus_tag LOCUS_06310 1741 2595 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173998.1 protein_id gnl|my_center|LOCUS_06310 5061 3076 gene locus_tag LOCUS_06320 5061 3076 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920652.1 protein_id gnl|my_center|LOCUS_06320 6393 5878 gene locus_tag LOCUS_06330 6393 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0098 <1 1346 gene locus_tag LOCUS_06340 <1 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057727.1:type II CAAX endopeptidase family protein 1663 2121 gene locus_tag LOCUS_06350 1663 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 2621 3529 gene locus_tag LOCUS_06360 2621 3529 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_06360 3682 4155 gene locus_tag LOCUS_06370 3682 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4080 4562 gene locus_tag LOCUS_06380 4080 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 5073 4873 gene locus_tag LOCUS_06390 5073 4873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5339 5073 gene locus_tag LOCUS_06400 5339 5073 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_06400 5803 5573 gene locus_tag LOCUS_06410 5803 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 6162 5890 gene locus_tag LOCUS_06420 6162 5890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence0099 414 1256 gene locus_tag LOCUS_06430 414 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06430 1410 1697 gene locus_tag LOCUS_06440 1410 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06440 1993 2553 gene locus_tag LOCUS_06450 1993 2553 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_06450 3251 3565 gene locus_tag LOCUS_06460 3251 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 3734 4003 gene locus_tag LOCUS_06470 3734 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 4602 3913 gene locus_tag LOCUS_06480 4602 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5759 4620 gene locus_tag LOCUS_06490 5759 4620 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011265811.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence0100 1095 4 gene locus_tag LOCUS_06500 gene aroB 1095 4 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056627.1 protein_id gnl|my_center|LOCUS_06500 1708 1992 gene locus_tag LOCUS_06510 1708 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5314 3347 gene locus_tag LOCUS_06520 5314 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence0101 <1 1546 gene locus_tag LOCUS_06530 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175552028.1:calcium-binding protein 2594 2349 gene locus_tag LOCUS_06540 2594 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 2750 4582 gene locus_tag LOCUS_06550 2750 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 5804 5073 gene locus_tag LOCUS_06560 5804 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892606.1 protein_id gnl|my_center|LOCUS_06560 >Feature sequence0102 713 2137 gene locus_tag LOCUS_06570 713 2137 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_06570 2655 3974 gene locus_tag LOCUS_06580 2655 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence0103 629 213 gene locus_tag LOCUS_06590 629 213 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174926.1 protein_id gnl|my_center|LOCUS_06590 2426 1221 gene locus_tag LOCUS_06600 2426 1221 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_06600 3295 3029 gene locus_tag LOCUS_06610 3295 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3648 4391 gene locus_tag LOCUS_06620 3648 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4394 4870 gene locus_tag LOCUS_06630 4394 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 5779 4886 gene locus_tag LOCUS_06640 5779 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence0104 2750 261 gene locus_tag LOCUS_06650 2750 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 3480 3100 gene locus_tag LOCUS_06660 3480 3100 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_06660 4503 3844 gene locus_tag LOCUS_06670 4503 3844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 4973 5542 gene locus_tag LOCUS_06680 4973 5542 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence0105 <1 845 gene locus_tag LOCUS_06690 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886513.1:polyketide synthase PksL 896 1663 gene locus_tag LOCUS_06700 896 1663 CDS product enoyl-CoA hydratase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886512.1 protein_id gnl|my_center|LOCUS_06700 >Feature sequence0106 1114 506 gene locus_tag LOCUS_06710 1114 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2051 1230 gene locus_tag LOCUS_06720 2051 1230 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138475095.1 protein_id gnl|my_center|LOCUS_06720 3228 2248 gene locus_tag LOCUS_06730 3228 2248 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819539.1 protein_id gnl|my_center|LOCUS_06730 5424 3478 gene locus_tag LOCUS_06740 5424 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence0107 1020 1685 gene locus_tag LOCUS_06750 gene ntcA 1020 1685 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920910.1 protein_id gnl|my_center|LOCUS_06750 1969 2601 gene locus_tag LOCUS_06760 1969 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 3170 3592 gene locus_tag LOCUS_06770 gene ruvX 3170 3592 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence0108 2254 965 gene locus_tag LOCUS_06780 2254 965 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057931.1 protein_id gnl|my_center|LOCUS_06780 2713 5103 gene locus_tag LOCUS_06790 2713 5103 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057093.1 protein_id gnl|my_center|LOCUS_06790 6131 5484 gene locus_tag LOCUS_06800 6131 5484 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929078.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence0109 2827 11 gene locus_tag LOCUS_06810 2827 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3542 4765 gene locus_tag LOCUS_06820 3542 4765 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_06820 5356 5892 gene locus_tag LOCUS_06830 5356 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence0110 446 291 gene locus_tag LOCUS_06840 446 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1043 501 gene locus_tag LOCUS_06850 1043 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2274 1075 gene locus_tag LOCUS_06860 2274 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4087 2291 gene locus_tag LOCUS_06870 4087 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 5405 4341 gene locus_tag LOCUS_06880 5405 4341 CDS product polysaccharide pyruvyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228270.1 protein_id gnl|my_center|LOCUS_06880 >Feature sequence0111 2281 176 gene locus_tag LOCUS_06890 2281 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 2779 2438 gene locus_tag LOCUS_06900 2779 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 4194 3091 gene locus_tag LOCUS_06910 4194 3091 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_06910 4866 5243 gene locus_tag LOCUS_06920 4866 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5386 6168 gene locus_tag LOCUS_06930 5386 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229185.1 protein_id gnl|my_center|LOCUS_06930 >Feature sequence0112 1902 502 gene locus_tag LOCUS_06940 1902 502 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_06940 3449 2094 gene locus_tag LOCUS_06950 3449 2094 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_06950 4064 3555 gene locus_tag LOCUS_06960 4064 3555 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962919.1 protein_id gnl|my_center|LOCUS_06960 6086 4323 gene locus_tag LOCUS_06970 6086 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 >Feature sequence0113 <1 1865 gene locus_tag LOCUS_06980 <1 1865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057688.1:preprotein translocase subunit SecA 2346 2696 gene locus_tag LOCUS_06990 2346 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3528 2749 gene locus_tag LOCUS_07000 3528 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 3863 4237 gene locus_tag LOCUS_07010 3863 4237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 4957 4313 gene locus_tag LOCUS_07020 4957 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence0114 1174 239 gene locus_tag LOCUS_07030 1174 239 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224412629.1 protein_id gnl|my_center|LOCUS_07030 1319 2485 gene locus_tag LOCUS_07040 1319 2485 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056246.1 protein_id gnl|my_center|LOCUS_07040 4095 2752 gene locus_tag LOCUS_07050 4095 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057293.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence0115 2086 689 gene locus_tag LOCUS_07060 2086 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 3530 2112 gene locus_tag LOCUS_07070 3530 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 5561 3936 gene locus_tag LOCUS_07080 5561 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence0116 1370 1579 gene locus_tag LOCUS_07090 1370 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1801 2073 gene locus_tag LOCUS_07100 1801 2073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_07100 2979 2743 gene locus_tag LOCUS_07110 2979 2743 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798862.1 protein_id gnl|my_center|LOCUS_07110 3731 3084 gene locus_tag LOCUS_07120 3731 3084 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056760.1 protein_id gnl|my_center|LOCUS_07120 4214 5977 gene locus_tag LOCUS_07130 4214 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence0117 378 536 gene locus_tag LOCUS_07140 378 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 1321 1058 gene locus_tag LOCUS_07150 1321 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07150 4645 1967 gene locus_tag LOCUS_07160 4645 1967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 <6157 5163 gene locus_tag LOCUS_07170 <6157 5163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582967.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence0118 55 705 gene locus_tag LOCUS_07180 55 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1560 1222 gene locus_tag LOCUS_07190 1560 1222 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883149.1 protein_id gnl|my_center|LOCUS_07190 2724 4547 gene locus_tag LOCUS_07200 2724 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 5735 5547 gene locus_tag LOCUS_07210 5735 5547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence0119 907 647 gene locus_tag LOCUS_07220 907 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2928 3977 gene locus_tag LOCUS_07230 2928 3977 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057238.1 protein_id gnl|my_center|LOCUS_07230 4306 4725 gene locus_tag LOCUS_07240 4306 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 4839 5177 gene locus_tag LOCUS_07250 4839 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 5199 5501 gene locus_tag LOCUS_07260 5199 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0120 <6137 3643 gene locus_tag LOCUS_07270 <6137 3643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005461251.1:response regulator >Feature sequence0121 646 3090 gene locus_tag LOCUS_07280 646 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 3062 3439 gene locus_tag LOCUS_07290 3062 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3537 4529 gene locus_tag LOCUS_07300 3537 4529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4531 5463 gene locus_tag LOCUS_07310 4531 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5497 5655 gene locus_tag LOCUS_07320 5497 5655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 5648 5824 gene locus_tag LOCUS_07330 5648 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 >Feature sequence0122 779 174 gene locus_tag LOCUS_07340 779 174 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_07340 2800 1253 gene locus_tag LOCUS_07350 2800 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 3858 3328 gene locus_tag LOCUS_07360 3858 3328 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_07360 5756 3867 gene locus_tag LOCUS_07370 5756 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence0123 848 12 gene locus_tag LOCUS_07380 848 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 2070 1108 gene locus_tag LOCUS_07390 2070 1108 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258627.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence0124 630 211 gene locus_tag LOCUS_07400 630 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 1116 6008 gene locus_tag LOCUS_07410 1116 6008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence0125 1425 2681 gene locus_tag LOCUS_07420 1425 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence0126 <1 1014 gene locus_tag LOCUS_07430 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143366.1:transaldolase 1347 2876 gene locus_tag LOCUS_07440 gene zwf 1347 2876 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056390.1 protein_id gnl|my_center|LOCUS_07440 3188 4510 gene locus_tag LOCUS_07450 gene opcA 3188 4510 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056389.1 protein_id gnl|my_center|LOCUS_07450 5546 5016 gene locus_tag LOCUS_07460 gene pyrR 5546 5016 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921232.1 protein_id gnl|my_center|LOCUS_07460 >Feature sequence0127 1586 663 gene locus_tag LOCUS_07470 1586 663 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056551.1 protein_id gnl|my_center|LOCUS_07470 2317 3783 gene locus_tag LOCUS_07480 2317 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4960 5763 gene locus_tag LOCUS_07490 4960 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 >Feature sequence0128 512 970 gene locus_tag LOCUS_07500 512 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 1689 1276 gene locus_tag LOCUS_07510 1689 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3649 2927 gene locus_tag LOCUS_07520 3649 2927 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_07520 5001 4531 gene locus_tag LOCUS_07530 5001 4531 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141055.1 protein_id gnl|my_center|LOCUS_07530 >Feature sequence0129 4187 507 gene locus_tag LOCUS_07540 gene smc 4187 507 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057762.1 protein_id gnl|my_center|LOCUS_07540 >Feature sequence0130 3553 176 gene locus_tag LOCUS_07550 3553 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 4793 4206 gene locus_tag LOCUS_07560 4793 4206 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_07560 <5969 4816 gene locus_tag LOCUS_07570 <5969 4816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:tetratricopeptide repeat protein >Feature sequence0131 2162 9 gene locus_tag LOCUS_07580 2162 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4046 2241 gene locus_tag LOCUS_07590 gene lepA 4046 2241 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056160.1 protein_id gnl|my_center|LOCUS_07590 5005 5232 gene locus_tag LOCUS_07600 5005 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5483 5956 gene locus_tag LOCUS_07610 5483 5956 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence0132 <1 694 gene locus_tag LOCUS_07620 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920816.1:ornithine carbamoyltransferase 1543 3354 gene locus_tag LOCUS_07630 1543 3354 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125785.1 protein_id gnl|my_center|LOCUS_07630 3735 3917 gene locus_tag LOCUS_07640 3735 3917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3999 4427 gene locus_tag LOCUS_07650 3999 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4948 4580 gene locus_tag LOCUS_07660 4948 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5225 5869 gene locus_tag LOCUS_07670 5225 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0133 457 834 gene locus_tag LOCUS_07680 457 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1605 1132 gene locus_tag LOCUS_07690 1605 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2102 3301 gene locus_tag LOCUS_07700 2102 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3320 3979 gene locus_tag LOCUS_07710 3320 3979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4477 5760 gene locus_tag LOCUS_07720 4477 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 >Feature sequence0134 2772 1426 gene locus_tag LOCUS_07730 2772 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861333.1 protein_id gnl|my_center|LOCUS_07730 3085 3279 gene locus_tag LOCUS_07740 3085 3279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3806 4267 gene locus_tag LOCUS_07750 3806 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07750 <5904 5277 gene locus_tag LOCUS_07760 <5904 5277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057843.1:DUF4079 domain-containing protein >Feature sequence0135 1227 2090 gene locus_tag LOCUS_07770 1227 2090 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_07770 2232 3317 gene locus_tag LOCUS_07780 2232 3317 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012163110.1 protein_id gnl|my_center|LOCUS_07780 3746 4051 gene locus_tag LOCUS_07790 3746 4051 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_07790 4381 5289 gene locus_tag LOCUS_07800 4381 5289 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057395.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence0136 <5894 1064 gene locus_tag LOCUS_07810 <5894 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence0137 1085 348 gene locus_tag LOCUS_07820 gene phnL 1085 348 CDS product phosphonate C-P lyase system protein PhnL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095104.1 protein_id gnl|my_center|LOCUS_07820 2992 2222 gene locus_tag LOCUS_07830 gene phnK 2992 2222 CDS product phosphonate C-P lyase system protein PhnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104085.1 protein_id gnl|my_center|LOCUS_07830 4485 3562 gene locus_tag LOCUS_07840 gene phnJ 4485 3562 CDS product alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095106.1 protein_id gnl|my_center|LOCUS_07840 <5889 4899 gene locus_tag LOCUS_07850 <5889 4899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091786.1:carbon-phosphorus lyase complex subunit PhnI >Feature sequence0138 693 505 gene locus_tag LOCUS_07860 693 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 1057 665 gene locus_tag LOCUS_07870 1057 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 1797 2270 gene locus_tag LOCUS_07880 1797 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 4650 3040 gene locus_tag LOCUS_07890 4650 3040 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057166.1 protein_id gnl|my_center|LOCUS_07890 >Feature sequence0139 573 1079 gene locus_tag LOCUS_07900 573 1079 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_07900 3022 1559 gene locus_tag LOCUS_07910 3022 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3267 4055 gene locus_tag LOCUS_07920 3267 4055 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973635.1 protein_id gnl|my_center|LOCUS_07920 5510 4563 gene locus_tag LOCUS_07930 gene pip 5510 4563 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence0140 607 706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 801 1241 gene locus_tag LOCUS_07940 801 1241 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_07940 1406 1846 gene locus_tag LOCUS_07950 1406 1846 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_07950 2285 1971 gene locus_tag LOCUS_07960 2285 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07960 2774 2508 gene locus_tag LOCUS_07970 2774 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2942 2805 gene locus_tag LOCUS_07980 2942 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3156 4013 gene locus_tag LOCUS_07990 3156 4013 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0141 183 1556 gene locus_tag LOCUS_08000 183 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1867 2553 gene locus_tag LOCUS_08010 1867 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence0142 650 564 gene locus_tag LOCUS_t00140 650 564 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3367 911 gene locus_tag LOCUS_08020 3367 911 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057539.1 protein_id gnl|my_center|LOCUS_08020 4173 3697 gene locus_tag LOCUS_08030 4173 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 5252 4353 gene locus_tag LOCUS_08040 gene glyQ 5252 4353 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920808.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence0143 1479 3197 gene locus_tag LOCUS_08050 1479 3197 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_08050 4013 3573 gene locus_tag LOCUS_08060 4013 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4375 5397 gene locus_tag LOCUS_08070 4375 5397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 >Feature sequence0144 1901 552 gene locus_tag LOCUS_08080 gene aroA 1901 552 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056198.1 protein_id gnl|my_center|LOCUS_08080 3827 4321 gene locus_tag LOCUS_08090 3827 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5098 4634 gene locus_tag LOCUS_08100 5098 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence0145 1709 282 gene locus_tag LOCUS_08110 1709 282 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_08110 1865 1710 gene locus_tag LOCUS_08120 1865 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 2480 3295 gene locus_tag LOCUS_08130 2480 3295 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109281.1 protein_id gnl|my_center|LOCUS_08130 <5800 3547 gene locus_tag LOCUS_08140 <5800 3547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056828.1:DUF3488 and DUF4129 domain-containing transglutaminase family protein >Feature sequence0146 1024 2025 gene locus_tag LOCUS_08150 gene galE 1024 2025 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_08150 2277 2627 gene locus_tag LOCUS_08160 2277 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2913 3620 gene locus_tag LOCUS_08170 2913 3620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 3635 5341 gene locus_tag LOCUS_08180 gene asnB 3635 5341 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0147 1281 508 gene locus_tag LOCUS_08190 1281 508 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_08190 2102 3094 gene locus_tag LOCUS_08200 2102 3094 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005091679.1 protein_id gnl|my_center|LOCUS_08200 3670 3185 gene locus_tag LOCUS_08210 3670 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 5111 3741 gene locus_tag LOCUS_08220 5111 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence0148 766 80 gene locus_tag LOCUS_08230 766 80 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_08230 1673 1176 gene locus_tag LOCUS_08240 1673 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 2168 2479 gene locus_tag LOCUS_08250 gene groES 2168 2479 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_08250 2797 3456 gene locus_tag LOCUS_08260 2797 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4343 3498 gene locus_tag LOCUS_08270 4343 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence0149 699 1856 gene locus_tag LOCUS_08280 699 1856 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_08280 3048 3794 gene locus_tag LOCUS_08290 3048 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4400 4152 gene locus_tag LOCUS_08300 4400 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4540 5715 gene locus_tag LOCUS_08310 gene urtC 4540 5715 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence0150 172 357 gene locus_tag LOCUS_08320 172 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 664 1155 gene locus_tag LOCUS_08330 664 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1195 2484 gene locus_tag LOCUS_08340 gene ectB 1195 2484 CDS product diaminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063970.1 protein_id gnl|my_center|LOCUS_08340 2497 2895 gene locus_tag LOCUS_08350 2497 2895 CDS product ectoine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637098.1 protein_id gnl|my_center|LOCUS_08350 2950 3963 gene locus_tag LOCUS_08360 2950 3963 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0151 1685 2083 gene locus_tag LOCUS_08370 1685 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 2858 2274 gene locus_tag LOCUS_08380 2858 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3949 2858 gene locus_tag LOCUS_08390 3949 2858 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_08390 4682 4410 gene locus_tag LOCUS_08400 4682 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence0152 915 616 gene locus_tag LOCUS_08410 915 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 970 1236 gene locus_tag LOCUS_08420 970 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1450 1740 gene locus_tag LOCUS_08430 1450 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1742 2224 gene locus_tag LOCUS_08440 1742 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2273 2701 gene locus_tag LOCUS_08450 2273 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3028 3459 gene locus_tag LOCUS_08460 3028 3459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3695 4231 gene locus_tag LOCUS_08470 3695 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5196 4288 gene locus_tag LOCUS_08480 5196 4288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence0153 189 803 gene locus_tag LOCUS_08490 189 803 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_08490 825 1136 gene locus_tag LOCUS_08500 gene nuoK 825 1136 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056517.1 protein_id gnl|my_center|LOCUS_08500 1560 1760 gene locus_tag LOCUS_08510 1560 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057624.1 protein_id gnl|my_center|LOCUS_08510 4125 3340 gene locus_tag LOCUS_08520 4125 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4166 4336 gene locus_tag LOCUS_08530 4166 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence0154 1438 335 gene locus_tag LOCUS_08540 1438 335 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055976.1 protein_id gnl|my_center|LOCUS_08540 3670 1499 gene locus_tag LOCUS_08550 3670 1499 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_08550 4631 5341 gene locus_tag LOCUS_08560 gene grpE 4631 5341 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence0155 852 226 gene locus_tag LOCUS_08570 852 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2359 893 gene locus_tag LOCUS_08580 2359 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2802 2356 gene locus_tag LOCUS_08590 2802 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929475.1 protein_id gnl|my_center|LOCUS_08590 5642 2964 gene locus_tag LOCUS_08600 5642 2964 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence0156 388 675 gene locus_tag LOCUS_08610 388 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 817 1635 gene locus_tag LOCUS_08620 817 1635 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218081317.1 protein_id gnl|my_center|LOCUS_08620 1813 2157 gene locus_tag LOCUS_08630 gene hypA 1813 2157 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_08630 2223 4178 gene locus_tag LOCUS_08640 2223 4178 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012407872.1 protein_id gnl|my_center|LOCUS_08640 4914 5276 gene locus_tag LOCUS_08650 4914 5276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08650 5281 5499 gene locus_tag LOCUS_08660 5281 5499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence0157 156 926 gene locus_tag LOCUS_08670 156 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1031 2104 gene locus_tag LOCUS_08680 gene rfbB 1031 2104 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_08680 3070 3495 gene locus_tag LOCUS_08690 3070 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 3996 3499 gene locus_tag LOCUS_08700 3996 3499 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_08700 4704 4090 gene locus_tag LOCUS_08710 4704 4090 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence0158 1682 540 gene locus_tag LOCUS_08720 1682 540 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003645896.1 protein_id gnl|my_center|LOCUS_08720 1763 1918 gene locus_tag LOCUS_08730 1763 1918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 2466 3560 gene locus_tag LOCUS_08740 2466 3560 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393453.1 protein_id gnl|my_center|LOCUS_08740 5468 4629 gene locus_tag LOCUS_08750 5468 4629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence0159 280 1941 gene locus_tag LOCUS_08760 280 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 3264 4691 gene locus_tag LOCUS_08770 3264 4691 CDS product PP2C family protein-serine/threonine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058070.1 protein_id gnl|my_center|LOCUS_08770 4696 4938 gene locus_tag LOCUS_08780 4696 4938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0160 <1 1014 gene locus_tag LOCUS_08790 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928934.1:SBBP repeat-containing protein 1503 2381 gene locus_tag LOCUS_08800 1503 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3001 2423 gene locus_tag LOCUS_08810 3001 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3522 4865 gene locus_tag LOCUS_08820 3522 4865 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135257956.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence0161 833 932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 933 1478 gene locus_tag LOCUS_08830 933 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 1496 1618 gene locus_tag LOCUS_08840 1496 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1648 2346 gene locus_tag LOCUS_08850 gene rnc 1648 2346 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989817.1 protein_id gnl|my_center|LOCUS_08850 4616 2670 gene locus_tag LOCUS_08860 4616 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 >Feature sequence0162 1442 240 gene locus_tag LOCUS_08870 gene nifS 1442 240 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937967.1 protein_id gnl|my_center|LOCUS_08870 3146 1764 gene locus_tag LOCUS_08880 gene nifB 3146 1764 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084568.1 protein_id gnl|my_center|LOCUS_08880 3986 3819 gene locus_tag LOCUS_08890 3986 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence0163 367 1512 gene locus_tag LOCUS_08900 367 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2167 1751 gene locus_tag LOCUS_08910 2167 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 2636 2118 gene locus_tag LOCUS_08920 2636 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 3102 3299 gene locus_tag LOCUS_08930 3102 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4068 3619 gene locus_tag LOCUS_08940 4068 3619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799825.1 protein_id gnl|my_center|LOCUS_08940 4631 4834 gene locus_tag LOCUS_08950 4631 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence0164 839 441 gene locus_tag LOCUS_08960 839 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 2101 1463 gene locus_tag LOCUS_08970 2101 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056166.1 protein_id gnl|my_center|LOCUS_08970 3394 2420 gene locus_tag LOCUS_08980 3394 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3959 3738 gene locus_tag LOCUS_08990 3959 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4152 4502 gene locus_tag LOCUS_09000 4152 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4667 4909 gene locus_tag LOCUS_09010 4667 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09010 >Feature sequence0165 1127 957 gene locus_tag LOCUS_09020 1127 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1718 2977 gene locus_tag LOCUS_09030 1718 2977 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447219.1 protein_id gnl|my_center|LOCUS_09030 3018 5009 gene locus_tag LOCUS_09040 3018 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence0166 1468 272 gene locus_tag LOCUS_09050 1468 272 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058101.1 protein_id gnl|my_center|LOCUS_09050 1606 2016 gene locus_tag LOCUS_09060 1606 2016 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 protein_id gnl|my_center|LOCUS_09060 4038 2332 gene locus_tag LOCUS_09070 4038 2332 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057980.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0167 875 141 gene locus_tag LOCUS_09080 875 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 2458 941 gene locus_tag LOCUS_09090 2458 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3009 2683 gene locus_tag LOCUS_09100 3009 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3812 3291 gene locus_tag LOCUS_09110 3812 3291 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056945.1 protein_id gnl|my_center|LOCUS_09110 4593 4267 gene locus_tag LOCUS_09120 4593 4267 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056944.1 protein_id gnl|my_center|LOCUS_09120 4711 5064 gene locus_tag LOCUS_09130 4711 5064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 >Feature sequence0168 384 1100 gene locus_tag LOCUS_09140 384 1100 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256704.1 protein_id gnl|my_center|LOCUS_09140 1474 1731 gene locus_tag LOCUS_09150 1474 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09150 2589 1786 gene locus_tag LOCUS_09160 2589 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3589 2666 gene locus_tag LOCUS_09170 3589 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 4528 3608 gene locus_tag LOCUS_09180 4528 3608 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947908.1 protein_id gnl|my_center|LOCUS_09180 5220 4591 gene locus_tag LOCUS_09190 5220 4591 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836866.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence0169 1198 14 gene locus_tag LOCUS_09200 gene cofH 1198 14 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057436.1 protein_id gnl|my_center|LOCUS_09200 1221 3284 gene locus_tag LOCUS_09210 1221 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 4590 3979 gene locus_tag LOCUS_09220 4590 3979 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_09220 5490 4927 gene locus_tag LOCUS_09230 5490 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence0170 969 2339 gene locus_tag LOCUS_09240 gene dnaA 969 2339 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_09240 2755 2414 gene locus_tag LOCUS_09250 2755 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 2840 3298 gene locus_tag LOCUS_09260 2840 3298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 3749 3399 gene locus_tag LOCUS_09270 3749 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <5487 3953 gene locus_tag LOCUS_09280 <5487 3953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057093.1:ATP-binding cassette domain-containing protein >Feature sequence0171 1260 274 gene locus_tag LOCUS_09290 1260 274 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_09290 2412 4064 gene locus_tag LOCUS_09300 2412 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence0172 2711 600 gene locus_tag LOCUS_09310 2711 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 <5455 3740 gene locus_tag LOCUS_09320 <5455 3740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase >Feature sequence0173 2241 2092 gene locus_tag LOCUS_09330 2241 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 3177 4325 gene locus_tag LOCUS_09340 3177 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 4854 4672 gene locus_tag LOCUS_09350 4854 4672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 4874 5173 gene locus_tag LOCUS_09360 4874 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence0174 1369 233 gene locus_tag LOCUS_09370 1369 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 5187 2737 gene locus_tag LOCUS_09380 gene pheT 5187 2737 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence0175 671 2881 gene locus_tag LOCUS_09390 671 2881 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_09390 3039 3794 gene locus_tag LOCUS_09400 3039 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09400 4476 4886 gene locus_tag LOCUS_09410 4476 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 5306 5085 gene locus_tag LOCUS_09420 5306 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence0176 2879 2094 gene locus_tag LOCUS_09430 2879 2094 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421621.1 protein_id gnl|my_center|LOCUS_09430 4055 3201 gene locus_tag LOCUS_09440 4055 3201 CDS product DUF547 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404636.1 protein_id gnl|my_center|LOCUS_09440 4352 4825 gene locus_tag LOCUS_09450 4352 4825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence0177 1666 548 gene locus_tag LOCUS_09460 1666 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142156.1 protein_id gnl|my_center|LOCUS_09460 2349 3305 gene locus_tag LOCUS_09470 2349 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3441 3256 gene locus_tag LOCUS_09480 3441 3256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 3506 4207 gene locus_tag LOCUS_09490 gene ubiE 3506 4207 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_09490 >Feature sequence0178 1612 140 gene locus_tag LOCUS_09500 1612 140 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_09500 3479 3814 gene locus_tag LOCUS_09510 3479 3814 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537521.1 protein_id gnl|my_center|LOCUS_09510 4154 3834 gene locus_tag LOCUS_09520 4154 3834 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence0179 5 1933 gene locus_tag LOCUS_09530 5 1933 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393690.1 protein_id gnl|my_center|LOCUS_09530 2182 2394 gene locus_tag LOCUS_09540 2182 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4251 2563 gene locus_tag LOCUS_09550 4251 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 5328 5107 gene locus_tag LOCUS_09560 5328 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 >Feature sequence0180 342 527 gene locus_tag LOCUS_09570 342 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09570 528 1406 gene locus_tag LOCUS_09580 528 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09580 1572 1354 gene locus_tag LOCUS_09590 1572 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2675 1818 gene locus_tag LOCUS_09600 2675 1818 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_09600 4765 2837 gene locus_tag LOCUS_09610 4765 2837 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001083788.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence0181 618 355 gene locus_tag LOCUS_09620 618 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1804 632 gene locus_tag LOCUS_09630 1804 632 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_09630 2564 1812 gene locus_tag LOCUS_09640 2564 1812 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_09640 3495 2932 gene locus_tag LOCUS_09650 3495 2932 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_09650 4442 5248 gene locus_tag LOCUS_09660 gene psbD 4442 5248 CDS product photosystem II D2 protein (photosystem q(a) protein) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056308.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence0182 245 1588 gene locus_tag LOCUS_09670 245 1588 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_09670 1795 1986 gene locus_tag LOCUS_09680 1795 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2989 3852 gene locus_tag LOCUS_09690 2989 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 3855 4865 gene locus_tag LOCUS_09700 3855 4865 CDS product sucrase ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013769.1 protein_id gnl|my_center|LOCUS_09700 5289 4819 gene locus_tag LOCUS_09710 5289 4819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 >Feature sequence0183 297 2687 gene locus_tag LOCUS_09720 gene hypF 297 2687 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_09720 2960 3208 gene locus_tag LOCUS_09730 gene hypC 2960 3208 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816727.1 protein_id gnl|my_center|LOCUS_09730 3836 5008 gene locus_tag LOCUS_09740 gene hypD 3836 5008 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728537.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence0184 3550 2534 gene locus_tag LOCUS_09750 3550 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 5161 3947 gene locus_tag LOCUS_09760 5161 3947 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0185 1906 503 gene locus_tag LOCUS_09770 1906 503 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058187.1 protein_id gnl|my_center|LOCUS_09770 2376 2005 gene locus_tag LOCUS_09780 2376 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056846.1 protein_id gnl|my_center|LOCUS_09780 2976 3128 gene locus_tag LOCUS_09790 2976 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 3302 4012 gene locus_tag LOCUS_09800 gene rpe 3302 4012 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_09800 <5308 4625 gene locus_tag LOCUS_09810 <5308 4625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928794.1:thioredoxin domain-containing protein >Feature sequence0186 2332 461 gene locus_tag LOCUS_09820 2332 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 4284 5102 gene locus_tag LOCUS_09830 4284 5102 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence0187 126 941 gene locus_tag LOCUS_09840 126 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2546 2109 gene locus_tag LOCUS_09850 2546 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence0188 1260 613 gene locus_tag LOCUS_09860 1260 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2193 1369 gene locus_tag LOCUS_09870 2193 1369 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_09870 5261 3822 gene locus_tag LOCUS_09880 gene mutL 5261 3822 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137908825.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0189 1440 895 gene locus_tag LOCUS_09890 1440 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 2479 1934 gene locus_tag LOCUS_09900 2479 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 2534 2633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3755 5050 gene locus_tag LOCUS_09910 3755 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence0190 236 1234 gene locus_tag LOCUS_09920 236 1234 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523980.1 protein_id gnl|my_center|LOCUS_09920 2406 1771 gene locus_tag LOCUS_09930 2406 1771 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057844.1 protein_id gnl|my_center|LOCUS_09930 4296 2557 gene locus_tag LOCUS_09940 gene ctaD 4296 2557 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057845.1 protein_id gnl|my_center|LOCUS_09940 <5251 4545 gene locus_tag LOCUS_09950 <5251 4545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057846.1:cytochrome c oxidase subunit II >Feature sequence0191 1809 448 gene locus_tag LOCUS_09960 gene sufD 1809 448 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_09960 2597 1815 gene locus_tag LOCUS_09970 gene sufC 2597 1815 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_09970 3142 2786 gene locus_tag LOCUS_09980 3142 2786 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_09980 4767 3331 gene locus_tag LOCUS_09990 gene sufB 4767 3331 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence0192 1410 1021 gene locus_tag LOCUS_10000 1410 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 2705 1413 gene locus_tag LOCUS_10010 gene lpxB 2705 1413 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_10010 3538 2741 gene locus_tag LOCUS_10020 gene lpxA 3538 2741 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921189.1 protein_id gnl|my_center|LOCUS_10020 4075 3551 gene locus_tag LOCUS_10030 gene fabZ 4075 3551 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_10030 4975 4301 gene locus_tag LOCUS_10040 4975 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence0193 2907 1063 gene locus_tag LOCUS_10050 2907 1063 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_10050 3083 3856 gene locus_tag LOCUS_10060 3083 3856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142832.1 protein_id gnl|my_center|LOCUS_10060 3990 4640 gene locus_tag LOCUS_10070 3990 4640 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106663664.1 protein_id gnl|my_center|LOCUS_10070 4612 4818 gene locus_tag LOCUS_10080 4612 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence0194 <1 1086 gene locus_tag LOCUS_10090 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022302.1:DUF1254 domain-containing protein 3537 1915 gene locus_tag LOCUS_10100 3537 1915 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141364.1 protein_id gnl|my_center|LOCUS_10100 4024 3590 gene locus_tag LOCUS_10110 4024 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4591 4268 gene locus_tag LOCUS_10120 4591 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10120 >Feature sequence0195 233 1705 gene locus_tag LOCUS_10130 gene cysS 233 1705 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920936.1 protein_id gnl|my_center|LOCUS_10130 1863 2843 gene locus_tag LOCUS_10140 1863 2843 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793108.1 protein_id gnl|my_center|LOCUS_10140 2985 3581 gene locus_tag LOCUS_10150 2985 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3623 4813 gene locus_tag LOCUS_10160 gene nifK 3623 4813 CDS product nitrogenase molybdenum-iron protein subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084553.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence0196 6 2888 gene locus_tag LOCUS_10170 6 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2897 3547 gene locus_tag LOCUS_10180 2897 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3612 4349 gene locus_tag LOCUS_10190 3612 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0197 190 756 gene locus_tag LOCUS_10200 190 756 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141894.1 protein_id gnl|my_center|LOCUS_10200 4806 2314 gene locus_tag LOCUS_10210 gene recG 4806 2314 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_10210 >Feature sequence0198 473 2053 gene locus_tag LOCUS_10220 473 2053 CDS product cryptochrome/photolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043195.1 protein_id gnl|my_center|LOCUS_10220 2786 3022 gene locus_tag LOCUS_10230 2786 3022 CDS product DUF2811 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056228.1 protein_id gnl|my_center|LOCUS_10230 3365 4801 gene locus_tag LOCUS_10240 gene hemG 3365 4801 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056229.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0199 1149 445 gene locus_tag LOCUS_10250 gene surE 1149 445 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence0200 501 707 gene locus_tag LOCUS_10260 501 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 919 1116 gene locus_tag LOCUS_10270 919 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1772 3091 gene locus_tag LOCUS_10280 1772 3091 CDS product glycerol acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141145.1 protein_id gnl|my_center|LOCUS_10280 3889 4710 gene locus_tag LOCUS_10290 3889 4710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence0201 2652 154 gene locus_tag LOCUS_10300 2652 154 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103760.1 protein_id gnl|my_center|LOCUS_10300 3162 3557 gene locus_tag LOCUS_10310 3162 3557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3968 4714 gene locus_tag LOCUS_10320 3968 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0202 701 495 gene locus_tag LOCUS_10330 701 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1408 2397 gene locus_tag LOCUS_10340 1408 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4585 3707 gene locus_tag LOCUS_10350 4585 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence0203 809 39 gene locus_tag LOCUS_10360 809 39 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057606.1 protein_id gnl|my_center|LOCUS_10360 2555 1410 gene locus_tag LOCUS_10370 2555 1410 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_10370 3051 2713 gene locus_tag LOCUS_10380 3051 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 <5175 3452 gene locus_tag LOCUS_10390 <5175 3452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057580.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0204 380 1591 gene locus_tag LOCUS_10400 380 1591 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_10400 2129 2833 gene locus_tag LOCUS_10410 2129 2833 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920819.1 protein_id gnl|my_center|LOCUS_10410 3789 4232 gene locus_tag LOCUS_10420 3789 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence0205 758 600 gene locus_tag LOCUS_10430 758 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1209 745 gene locus_tag LOCUS_10440 1209 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2994 1906 gene locus_tag LOCUS_10450 2994 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4145 3540 gene locus_tag LOCUS_10460 4145 3540 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_10460 4380 4892 gene locus_tag LOCUS_10470 4380 4892 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence0206 136 3885 gene locus_tag LOCUS_10480 136 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 4483 4689 gene locus_tag LOCUS_10490 4483 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4876 5076 gene locus_tag LOCUS_10500 4876 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence0207 2422 686 gene locus_tag LOCUS_10510 2422 686 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_10510 3166 5109 gene locus_tag LOCUS_10520 3166 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence0208 2890 1829 gene locus_tag LOCUS_10530 2890 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 3124 2972 gene locus_tag LOCUS_10540 3124 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3349 3618 gene locus_tag LOCUS_10550 3349 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 3734 4159 gene locus_tag LOCUS_10560 3734 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10560 4193 4477 gene locus_tag LOCUS_10570 4193 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10570 >Feature sequence0209 1471 62 gene locus_tag LOCUS_10580 1471 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2980 1550 gene locus_tag LOCUS_10590 2980 1550 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_10590 3514 4317 gene locus_tag LOCUS_10600 3514 4317 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084220.1 protein_id gnl|my_center|LOCUS_10600 4722 4913 gene locus_tag LOCUS_10610 4722 4913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence0210 2445 2627 gene locus_tag LOCUS_10620 2445 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3671 5029 gene locus_tag LOCUS_10630 3671 5029 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence0211 1095 670 gene locus_tag LOCUS_10640 gene rplK 1095 670 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_10640 1769 1095 gene locus_tag LOCUS_10650 gene nusG 1769 1095 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_10650 1990 1766 gene locus_tag LOCUS_10660 gene secE 1990 1766 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056148.1 protein_id gnl|my_center|LOCUS_10660 2469 2396 gene locus_tag LOCUS_t00150 2469 2396 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2953 2570 gene locus_tag LOCUS_10670 gene rplS 2953 2570 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057143.1 protein_id gnl|my_center|LOCUS_10670 3873 4427 gene locus_tag LOCUS_10680 3873 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 4704 4631 gene locus_tag LOCUS_t00160 4704 4631 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0212 1336 1049 gene locus_tag LOCUS_10690 1336 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1570 1430 gene locus_tag LOCUS_10700 1570 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2177 1707 gene locus_tag LOCUS_10710 2177 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 2439 3488 gene locus_tag LOCUS_10720 2439 3488 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_10720 3903 4130 gene locus_tag LOCUS_10730 3903 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4306 4722 gene locus_tag LOCUS_10740 4306 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence0213 822 283 gene locus_tag LOCUS_10750 822 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1071 1997 gene locus_tag LOCUS_10760 1071 1997 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142791.1 protein_id gnl|my_center|LOCUS_10760 2160 2381 gene locus_tag LOCUS_10770 2160 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 2433 2753 gene locus_tag LOCUS_10780 gene trxA 2433 2753 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405369.1 protein_id gnl|my_center|LOCUS_10780 4615 3806 gene locus_tag LOCUS_10790 4615 3806 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890768.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0214 590 1495 gene locus_tag LOCUS_10800 590 1495 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227993.1 protein_id gnl|my_center|LOCUS_10800 1573 2253 gene locus_tag LOCUS_10810 1573 2253 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533464.1 protein_id gnl|my_center|LOCUS_10810 2666 3595 gene locus_tag LOCUS_10820 2666 3595 CDS product 2-oxoglutarate and iron-dependent oxygenase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533468.1 protein_id gnl|my_center|LOCUS_10820 3909 4613 gene locus_tag LOCUS_10830 3909 4613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence0215 573 1814 gene locus_tag LOCUS_10840 573 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2863 3081 gene locus_tag LOCUS_10850 2863 3081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 <5092 4018 gene locus_tag LOCUS_10860 <5092 4018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056970.1:protein kinase >Feature sequence0216 581 2770 gene locus_tag LOCUS_10870 581 2770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3216 2905 gene locus_tag LOCUS_10880 3216 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 3480 3295 gene locus_tag LOCUS_10890 3480 3295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 <5080 3952 gene locus_tag LOCUS_10900 <5080 3952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056050.1:GAF domain-containing sensor histidine kinase >Feature sequence0217 1513 1635 gene locus_tag LOCUS_10910 1513 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 1713 2510 gene locus_tag LOCUS_10920 1713 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2572 3420 gene locus_tag LOCUS_10930 2572 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 3477 4946 gene locus_tag LOCUS_10940 3477 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence0218 2789 1854 gene locus_tag LOCUS_10950 2789 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3460 2786 gene locus_tag LOCUS_10960 3460 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 4427 4924 gene locus_tag LOCUS_10970 4427 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence0219 2005 986 gene locus_tag LOCUS_10980 2005 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 3473 3237 gene locus_tag LOCUS_10990 gene rpmB 3473 3237 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_10990 <5066 4370 gene locus_tag LOCUS_11000 <5066 4370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057033.1:molecular chaperone HtpG >Feature sequence0220 2090 4588 gene locus_tag LOCUS_11010 2090 4588 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056008.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0221 903 415 gene locus_tag LOCUS_11020 gene tsaE 903 415 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142985.1 protein_id gnl|my_center|LOCUS_11020 2336 906 gene locus_tag LOCUS_11030 2336 906 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_11030 3204 4028 gene locus_tag LOCUS_11040 3204 4028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_11040 >Feature sequence0222 1737 973 gene locus_tag LOCUS_11050 1737 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 2877 2518 gene locus_tag LOCUS_11060 2877 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3497 2949 gene locus_tag LOCUS_11070 3497 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3918 4355 gene locus_tag LOCUS_11080 3918 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4387 5007 gene locus_tag LOCUS_11090 4387 5007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0223 678 2360 gene locus_tag LOCUS_11100 678 2360 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406157.1 protein_id gnl|my_center|LOCUS_11100 2693 2947 gene locus_tag LOCUS_11110 2693 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 3055 4644 gene locus_tag LOCUS_11120 3055 4644 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000839957.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence0224 <5046 4077 gene locus_tag LOCUS_11130 <5046 4077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056203.1:methyl-accepting chemotaxis protein >Feature sequence0225 29 181 gene locus_tag LOCUS_11140 29 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 388 4722 gene locus_tag LOCUS_11150 388 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence0226 482 1771 gene locus_tag LOCUS_11160 482 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 1935 2594 gene locus_tag LOCUS_11170 1935 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 2594 2821 gene locus_tag LOCUS_11180 2594 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2822 3340 gene locus_tag LOCUS_11190 2822 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3342 3863 gene locus_tag LOCUS_11200 3342 3863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3893 4174 gene locus_tag LOCUS_11210 3893 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4161 4901 gene locus_tag LOCUS_11220 4161 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence0227 396 220 gene locus_tag LOCUS_11230 396 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2104 1121 gene locus_tag LOCUS_11240 2104 1121 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056059.1 protein_id gnl|my_center|LOCUS_11240 3532 2273 gene locus_tag LOCUS_11250 3532 2273 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_11250 3630 4997 gene locus_tag LOCUS_11260 gene dnaA 3630 4997 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056451.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence0228 4031 2787 gene locus_tag LOCUS_11270 4031 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence0229 677 1834 gene locus_tag LOCUS_11280 677 1834 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_11280 2661 2434 gene locus_tag LOCUS_11290 2661 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 4568 4047 gene locus_tag LOCUS_11300 4568 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence0230 926 546 gene locus_tag LOCUS_11310 926 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2344 926 gene locus_tag LOCUS_11320 2344 926 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892316.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence0231 145 378 gene locus_tag LOCUS_11330 145 378 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051141364.1 protein_id gnl|my_center|LOCUS_11330 520 1215 gene locus_tag LOCUS_11340 520 1215 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143833.1 protein_id gnl|my_center|LOCUS_11340 2765 1755 gene locus_tag LOCUS_11350 2765 1755 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_11350 3580 2912 gene locus_tag LOCUS_11360 3580 2912 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388953.1 protein_id gnl|my_center|LOCUS_11360 4643 3621 gene locus_tag LOCUS_11370 4643 3621 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533367.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0232 1570 674 gene locus_tag LOCUS_11380 1570 674 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_11380 1797 1648 gene locus_tag LOCUS_11390 1797 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2062 1766 gene locus_tag LOCUS_11400 2062 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 3058 2087 gene locus_tag LOCUS_11410 3058 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 3806 3066 gene locus_tag LOCUS_11420 3806 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4618 3815 gene locus_tag LOCUS_11430 4618 3815 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731597.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence0233 1161 226 gene locus_tag LOCUS_11440 1161 226 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096887.1 protein_id gnl|my_center|LOCUS_11440 1845 1312 gene locus_tag LOCUS_11450 1845 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_11450 1914 3068 gene locus_tag LOCUS_11460 gene ruvB 1914 3068 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_11460 3345 4550 gene locus_tag LOCUS_11470 3345 4550 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence0234 168 1235 gene locus_tag LOCUS_11480 168 1235 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056993.1 protein_id gnl|my_center|LOCUS_11480 1702 3342 gene locus_tag LOCUS_11490 1702 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3767 4690 gene locus_tag LOCUS_11500 3767 4690 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143466.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence0235 648 562 gene locus_tag LOCUS_t00170 648 562 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1764 832 gene locus_tag LOCUS_11510 1764 832 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_11510 1983 2612 gene locus_tag LOCUS_11520 1983 2612 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257183.1 protein_id gnl|my_center|LOCUS_11520 2954 3373 gene locus_tag LOCUS_11530 2954 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 3340 4836 gene locus_tag LOCUS_11540 3340 4836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0236 1639 1241 gene locus_tag LOCUS_11550 1639 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_11550 2057 2992 gene locus_tag LOCUS_11560 gene hslO 2057 2992 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056651.1 protein_id gnl|my_center|LOCUS_11560 3526 4983 gene locus_tag LOCUS_11570 3526 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence0237 969 1448 gene locus_tag LOCUS_11580 969 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057499.1 protein_id gnl|my_center|LOCUS_11580 2737 1766 gene locus_tag LOCUS_11590 gene sds 2737 1766 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057594.1 protein_id gnl|my_center|LOCUS_11590 3871 4032 gene locus_tag LOCUS_11600 3871 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0238 1868 243 gene locus_tag LOCUS_11610 1868 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 3811 2600 gene locus_tag LOCUS_11620 3811 2600 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence0239 260 1297 gene locus_tag LOCUS_11630 260 1297 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_11630 1656 2540 gene locus_tag LOCUS_11640 gene dapA 1656 2540 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057061.1 protein_id gnl|my_center|LOCUS_11640 3029 4846 gene locus_tag LOCUS_11650 3029 4846 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057062.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence0240 1514 1089 gene locus_tag LOCUS_11660 1514 1089 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920639.1 protein_id gnl|my_center|LOCUS_11660 1852 1658 gene locus_tag LOCUS_11670 1852 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2397 1909 gene locus_tag LOCUS_11680 2397 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3455 2565 gene locus_tag LOCUS_11690 3455 2565 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121449.1 protein_id gnl|my_center|LOCUS_11690 4285 3995 gene locus_tag LOCUS_11700 4285 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence0241 2162 471 gene locus_tag LOCUS_11710 2162 471 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088894694.1 protein_id gnl|my_center|LOCUS_11710 2627 2310 gene locus_tag LOCUS_11720 2627 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 >Feature sequence0242 980 1129 gene locus_tag LOCUS_11730 980 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1836 1552 gene locus_tag LOCUS_11740 gene minE 1836 1552 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057853.1 protein_id gnl|my_center|LOCUS_11740 2699 1893 gene locus_tag LOCUS_11750 gene minD 2699 1893 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057852.1 protein_id gnl|my_center|LOCUS_11750 3960 3178 gene locus_tag LOCUS_11760 gene minC 3960 3178 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141990.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence0243 2703 835 gene locus_tag LOCUS_11770 gene dndD 2703 835 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_11770 4833 3592 gene locus_tag LOCUS_11780 4833 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence0244 129 956 gene locus_tag LOCUS_11790 129 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 4607 1512 gene locus_tag LOCUS_11800 gene ppc 4607 1512 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057749.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0245 343 1752 gene locus_tag LOCUS_11810 343 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 2120 2605 gene locus_tag LOCUS_11820 2120 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 3114 2752 gene locus_tag LOCUS_11830 3114 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3217 3594 gene locus_tag LOCUS_11840 3217 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 3638 4348 gene locus_tag LOCUS_11850 3638 4348 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_11850 4405 4701 gene locus_tag LOCUS_11860 4405 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence0246 <1 715 gene locus_tag LOCUS_11870 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058198.1:phycobilisome rod-core linker polypeptide 1872 2201 gene locus_tag LOCUS_11880 1872 2201 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_11880 2413 2607 gene locus_tag LOCUS_11890 2413 2607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2758 3825 gene locus_tag LOCUS_11900 2758 3825 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056519.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence0247 1046 858 gene locus_tag LOCUS_11910 1046 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2075 1224 gene locus_tag LOCUS_11920 2075 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11920 2360 2088 gene locus_tag LOCUS_11930 2360 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11930 3400 2702 gene locus_tag LOCUS_11940 3400 2702 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141821.1 protein_id gnl|my_center|LOCUS_11940 3738 3502 gene locus_tag LOCUS_11950 3738 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3879 4232 gene locus_tag LOCUS_11960 gene hypR 3879 4232 CDS product transcriptional regulator HypR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242487.1 protein_id gnl|my_center|LOCUS_11960 4838 4254 gene locus_tag LOCUS_11970 4838 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence0248 1787 3850 gene locus_tag LOCUS_11980 1787 3850 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence0249 1981 992 gene locus_tag LOCUS_11990 gene gshB 1981 992 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056752.1 protein_id gnl|my_center|LOCUS_11990 2442 2182 gene locus_tag LOCUS_12000 gene grxC 2442 2182 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_12000 4353 2632 gene locus_tag LOCUS_12010 gene hflX 4353 2632 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144128.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence0250 185 6 gene locus_tag LOCUS_12020 185 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141741.1 protein_id gnl|my_center|LOCUS_12020 675 602 gene locus_tag LOCUS_t00180 675 602 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1464 748 gene locus_tag LOCUS_12030 1464 748 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056544.1 protein_id gnl|my_center|LOCUS_12030 2248 1511 gene locus_tag LOCUS_12040 2248 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 2951 2565 gene locus_tag LOCUS_12050 gene arsC 2951 2565 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_12050 3695 2952 gene locus_tag LOCUS_12060 3695 2952 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173416.1 protein_id gnl|my_center|LOCUS_12060 <4910 4355 gene locus_tag LOCUS_12070 <4910 4355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140016.1:PstS family phosphate ABC transporter substrate-binding protein >Feature sequence0251 971 636 gene locus_tag LOCUS_12080 971 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1258 959 gene locus_tag LOCUS_12090 1258 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2563 1784 gene locus_tag LOCUS_12100 2563 1784 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140394.1 protein_id gnl|my_center|LOCUS_12100 3435 2929 gene locus_tag LOCUS_12110 3435 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798166.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0252 196 1140 gene locus_tag LOCUS_12120 196 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 1862 1482 gene locus_tag LOCUS_12130 1862 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12130 2279 2025 gene locus_tag LOCUS_12140 2279 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12140 >Feature sequence0253 1500 2867 gene locus_tag LOCUS_12150 1500 2867 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142799.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence0254 97 255 gene locus_tag LOCUS_12160 97 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 310 1008 gene locus_tag LOCUS_12170 310 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1938 1600 gene locus_tag LOCUS_12180 1938 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 2433 2296 gene locus_tag LOCUS_12190 2433 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 2402 3709 gene locus_tag LOCUS_12200 2402 3709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393799.1 protein_id gnl|my_center|LOCUS_12200 3824 4270 gene locus_tag LOCUS_12210 3824 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence0255 2430 1843 gene locus_tag LOCUS_12220 2430 1843 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023174596.1 protein_id gnl|my_center|LOCUS_12220 3560 3051 gene locus_tag LOCUS_12230 3560 3051 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920902.1 protein_id gnl|my_center|LOCUS_12230 4338 3664 gene locus_tag LOCUS_12240 4338 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence0256 <1 4008 gene locus_tag LOCUS_12250 <1 4008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113356.1:type I polyketide synthase >Feature sequence0257 696 768 gene locus_tag LOCUS_t00190 696 768 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2029 1361 gene locus_tag LOCUS_12260 2029 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 2687 3334 gene locus_tag LOCUS_12270 2687 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 4360 3854 gene locus_tag LOCUS_12280 4360 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041243886.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence0258 465 1388 gene locus_tag LOCUS_12290 465 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1752 2972 gene locus_tag LOCUS_12300 1752 2972 CDS product DUF790 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141365.1 protein_id gnl|my_center|LOCUS_12300 4430 3141 gene locus_tag LOCUS_12310 4430 3141 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0259 145 1446 gene locus_tag LOCUS_12320 145 1446 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140425.1 protein_id gnl|my_center|LOCUS_12320 1722 1841 gene locus_tag LOCUS_12330 1722 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2018 3652 gene locus_tag LOCUS_12340 2018 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12340 3653 4801 gene locus_tag LOCUS_12350 3653 4801 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143115.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence0260 <1 868 gene locus_tag LOCUS_12360 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056886.1:hydrolase 1184 1408 gene locus_tag LOCUS_12370 1184 1408 CDS product DUF4327 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058280.1 protein_id gnl|my_center|LOCUS_12370 1925 1539 gene locus_tag LOCUS_12380 1925 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 3396 2149 gene locus_tag LOCUS_12390 3396 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 3719 3558 gene locus_tag LOCUS_12400 3719 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4365 4024 gene locus_tag LOCUS_12410 4365 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056501.1 protein_id gnl|my_center|LOCUS_12410 >Feature sequence0261 <1 2782 gene locus_tag LOCUS_12420 <1 2782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005113356.1:type I polyketide synthase >Feature sequence0262 <1 1156 gene locus_tag LOCUS_12430 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056767.1:protein phosphatase 2C domain-containing protein 1672 1893 gene locus_tag LOCUS_12440 1672 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2303 2061 gene locus_tag LOCUS_12450 2303 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3724 2996 gene locus_tag LOCUS_12460 3724 2996 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_12460 4052 3804 gene locus_tag LOCUS_12470 4052 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence0263 3467 591 gene locus_tag LOCUS_12480 3467 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence0264 2200 1463 gene locus_tag LOCUS_12490 2200 1463 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_12490 4192 4314 gene locus_tag LOCUS_12500 4192 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 4304 4444 gene locus_tag LOCUS_12510 4304 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence0265 701 138 gene locus_tag LOCUS_12520 701 138 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730082.1 protein_id gnl|my_center|LOCUS_12520 1598 1993 gene locus_tag LOCUS_12530 1598 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4559 2727 gene locus_tag LOCUS_12540 4559 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0266 2021 2329 gene locus_tag LOCUS_12550 2021 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 3607 4353 gene locus_tag LOCUS_12560 3607 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence0267 167 403 gene locus_tag LOCUS_12570 167 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 835 3045 gene locus_tag LOCUS_12580 835 3045 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890758.1 protein_id gnl|my_center|LOCUS_12580 3332 3655 gene locus_tag LOCUS_12590 3332 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence0268 1182 1107 gene locus_tag LOCUS_t00200 1182 1107 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2258 2929 gene locus_tag LOCUS_12600 2258 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 3251 4252 gene locus_tag LOCUS_12610 3251 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 4661 4254 gene locus_tag LOCUS_12620 4661 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0269 696 505 gene locus_tag LOCUS_12630 696 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 866 693 gene locus_tag LOCUS_12640 866 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181985033.1 protein_id gnl|my_center|LOCUS_12640 3051 1147 gene locus_tag LOCUS_12650 gene mnmG 3051 1147 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056385.1 protein_id gnl|my_center|LOCUS_12650 3386 3640 gene locus_tag LOCUS_12660 3386 3640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 3665 4249 gene locus_tag LOCUS_12670 3665 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 <4769 4246 gene locus_tag LOCUS_12680 <4769 4246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064385.1:site-specific DNA-methyltransferase >Feature sequence0270 100 1518 gene locus_tag LOCUS_12690 100 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1882 2094 gene locus_tag LOCUS_12700 1882 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3232 2441 gene locus_tag LOCUS_12710 3232 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3660 4415 gene locus_tag LOCUS_12720 3660 4415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence0271 537 1373 gene locus_tag LOCUS_12730 537 1373 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_12730 1747 2508 gene locus_tag LOCUS_12740 1747 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence0272 826 1041 gene locus_tag LOCUS_12750 826 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1367 1002 gene locus_tag LOCUS_12760 1367 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2038 2637 gene locus_tag LOCUS_12770 2038 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3068 2832 gene locus_tag LOCUS_12780 3068 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 4320 3268 gene locus_tag LOCUS_12790 4320 3268 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence0273 3 809 gene locus_tag LOCUS_12800 3 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 958 1197 gene locus_tag LOCUS_12810 958 1197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1360 1157 gene locus_tag LOCUS_12820 1360 1157 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_12820 1629 1420 gene locus_tag LOCUS_12830 1629 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2267 3118 gene locus_tag LOCUS_12840 2267 3118 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813616.1 protein_id gnl|my_center|LOCUS_12840 3150 4289 gene locus_tag LOCUS_12850 3150 4289 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195315.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence0274 305 147 gene locus_tag LOCUS_12860 305 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 864 1196 gene locus_tag LOCUS_12870 864 1196 CDS product DUF565 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057010.1 protein_id gnl|my_center|LOCUS_12870 1954 3027 gene locus_tag LOCUS_12880 1954 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 4430 4038 gene locus_tag LOCUS_12890 4430 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence0275 324 710 gene locus_tag LOCUS_12900 324 710 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001027458.1 protein_id gnl|my_center|LOCUS_12900 999 2264 gene locus_tag LOCUS_12910 999 2264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 3168 2590 gene locus_tag LOCUS_12920 3168 2590 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142405.1 protein_id gnl|my_center|LOCUS_12920 4466 3600 gene locus_tag LOCUS_12930 4466 3600 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920915.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0276 1885 422 gene locus_tag LOCUS_12940 1885 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 2670 4358 gene locus_tag LOCUS_12950 2670 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0277 582 1643 gene locus_tag LOCUS_12960 582 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3243 1738 gene locus_tag LOCUS_12970 3243 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 3547 4611 gene locus_tag LOCUS_12980 3547 4611 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 protein_id gnl|my_center|LOCUS_12980 >Feature sequence0278 87 590 gene locus_tag LOCUS_12990 87 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 992 2383 gene locus_tag LOCUS_13000 gene asnS 992 2383 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058304.1 protein_id gnl|my_center|LOCUS_13000 3012 3926 gene locus_tag LOCUS_13010 gene tnpB 3012 3926 CDS product IS200/IS605 family element RNA-guided endonuclease TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287525.1 protein_id gnl|my_center|LOCUS_13010 <4672 4094 gene locus_tag LOCUS_13020 <4672 4094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142241.1:caspase family protein >Feature sequence0279 633 151 gene locus_tag LOCUS_13030 633 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3207 1447 gene locus_tag LOCUS_13040 gene argS 3207 1447 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056669.1 protein_id gnl|my_center|LOCUS_13040 3726 4148 gene locus_tag LOCUS_13050 3726 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence0280 1469 564 gene locus_tag LOCUS_13060 1469 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence0281 819 2180 gene locus_tag LOCUS_13070 gene clpX 819 2180 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144180.1 protein_id gnl|my_center|LOCUS_13070 2473 2775 gene locus_tag LOCUS_13080 2473 2775 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_13080 4425 3247 gene locus_tag LOCUS_13090 4425 3247 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence0282 1252 41 gene locus_tag LOCUS_13100 1252 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1504 2970 gene locus_tag LOCUS_13110 1504 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 3562 3062 gene locus_tag LOCUS_13120 3562 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 4521 3595 gene locus_tag LOCUS_13130 4521 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence0283 984 400 gene locus_tag LOCUS_13140 984 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 2407 974 gene locus_tag LOCUS_13150 2407 974 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979630.1 protein_id gnl|my_center|LOCUS_13150 4224 2563 gene locus_tag LOCUS_13160 4224 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence0284 993 208 gene locus_tag LOCUS_13170 993 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1628 1167 gene locus_tag LOCUS_13180 1628 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2060 3520 gene locus_tag LOCUS_13190 gene gatA 2060 3520 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_13190 3911 4312 gene locus_tag LOCUS_13200 3911 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence0285 1941 499 gene locus_tag LOCUS_13210 1941 499 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_13210 3990 2368 gene locus_tag LOCUS_13220 3990 2368 CDS product DUF3352 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057437.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence0286 589 275 gene locus_tag LOCUS_13230 589 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1641 892 gene locus_tag LOCUS_13240 1641 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2810 2298 gene locus_tag LOCUS_13250 gene fldA 2810 2298 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_13250 3080 2892 gene locus_tag LOCUS_13260 3080 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence0287 <1 866 gene locus_tag LOCUS_13270 <1 866 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021927.1:type III-A CRISPR-associated protein Cas10/Csm1 872 1432 gene locus_tag LOCUS_13280 872 1432 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_13280 1441 1941 gene locus_tag LOCUS_13290 gene csm2 1441 1941 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546625.1 protein_id gnl|my_center|LOCUS_13290 1941 2927 gene locus_tag LOCUS_13300 gene csm3 1941 2927 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 protein_id gnl|my_center|LOCUS_13300 2931 4049 gene locus_tag LOCUS_13310 gene csm4 2931 4049 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082355.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence0288 967 1290 gene locus_tag LOCUS_13320 967 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 2360 1584 gene locus_tag LOCUS_13330 gene purQ 2360 1584 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141325.1 protein_id gnl|my_center|LOCUS_13330 2817 2506 gene locus_tag LOCUS_13340 gene purS 2817 2506 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_13340 2898 3281 gene locus_tag LOCUS_13350 2898 3281 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_13350 4431 3463 gene locus_tag LOCUS_13360 4431 3463 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058018.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence0289 273 1148 gene locus_tag LOCUS_13370 273 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 1370 3793 gene locus_tag LOCUS_13380 1370 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 4477 4157 gene locus_tag LOCUS_13390 4477 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0290 1334 123 gene locus_tag LOCUS_13400 1334 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 1665 1474 gene locus_tag LOCUS_13410 1665 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 3930 1840 gene locus_tag LOCUS_13420 3930 1840 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190697803.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence0291 158 607 gene locus_tag LOCUS_13430 158 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 903 736 gene locus_tag LOCUS_13440 903 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 975 1817 gene locus_tag LOCUS_13450 975 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2009 3040 gene locus_tag LOCUS_13460 2009 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 4544 3441 gene locus_tag LOCUS_13470 4544 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928715.1 protein_id gnl|my_center|LOCUS_13470 >Feature sequence0292 785 2260 gene locus_tag LOCUS_13480 785 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3413 2592 gene locus_tag LOCUS_13490 gene pstB 3413 2592 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence0293 1705 2871 gene locus_tag LOCUS_13500 gene rpoD 1705 2871 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_13500 4310 3729 gene locus_tag LOCUS_13510 4310 3729 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920714.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence0294 805 1713 gene locus_tag LOCUS_13520 805 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2765 2016 gene locus_tag LOCUS_13530 2765 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3948 3127 gene locus_tag LOCUS_13540 3948 3127 CDS product YaaW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920905.1 protein_id gnl|my_center|LOCUS_13540 >Feature sequence0295 1339 299 gene locus_tag LOCUS_13550 gene mtnA 1339 299 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056904.1 protein_id gnl|my_center|LOCUS_13550 2940 1654 gene locus_tag LOCUS_13560 2940 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 3433 3242 gene locus_tag LOCUS_13570 3433 3242 CDS product metallothionein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143419.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence0296 <1 748 gene locus_tag LOCUS_13580 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143072.1:AAA family ATPase 831 1229 gene locus_tag LOCUS_13590 831 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 2230 1784 gene locus_tag LOCUS_13600 2230 1784 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_13600 4246 2654 gene locus_tag LOCUS_13610 4246 2654 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0297 1216 296 gene locus_tag LOCUS_13620 1216 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2964 1777 gene locus_tag LOCUS_13630 2964 1777 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_13630 3276 4430 gene locus_tag LOCUS_13640 3276 4430 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496414.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence0298 985 1323 gene locus_tag LOCUS_13650 985 1323 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056439.1 protein_id gnl|my_center|LOCUS_13650 1788 1660 gene locus_tag LOCUS_13660 1788 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence0299 967 335 gene locus_tag LOCUS_13670 967 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 1260 2420 gene locus_tag LOCUS_13680 gene carA 1260 2420 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056605.1 protein_id gnl|my_center|LOCUS_13680 2748 2957 gene locus_tag LOCUS_13690 2748 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3217 3609 gene locus_tag LOCUS_13700 3217 3609 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056283.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence0300 <1 1917 gene locus_tag LOCUS_13710 <1 1917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005109925.1:DNA phosphorothioation-associated putative methyltransferase 2564 3139 gene locus_tag LOCUS_13720 2564 3139 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_13720 3601 3927 gene locus_tag LOCUS_13730 3601 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 3932 4429 gene locus_tag LOCUS_13740 3932 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence0301 97 3576 gene locus_tag LOCUS_13750 97 3576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4544 4122 gene locus_tag LOCUS_13760 4544 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence0302 716 1174 gene locus_tag LOCUS_13770 716 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 1415 1999 gene locus_tag LOCUS_13780 1415 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2973 3578 gene locus_tag LOCUS_13790 2973 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence0303 398 123 gene locus_tag LOCUS_13800 398 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 1653 1054 gene locus_tag LOCUS_13810 1653 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3932 1983 gene locus_tag LOCUS_13820 3932 1983 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence0304 454 1356 gene locus_tag LOCUS_13830 gene murI 454 1356 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_13830 2163 3533 gene locus_tag LOCUS_13840 2163 3533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence0305 256 471 gene locus_tag LOCUS_13850 256 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_13850 1198 1028 gene locus_tag LOCUS_13860 1198 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 protein_id gnl|my_center|LOCUS_13860 1320 1583 gene locus_tag LOCUS_13870 1320 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 1938 2489 gene locus_tag LOCUS_13880 1938 2489 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056635.1 protein_id gnl|my_center|LOCUS_13880 4002 3745 gene locus_tag LOCUS_13890 4002 3745 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124284.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence0306 1206 259 gene locus_tag LOCUS_13900 gene proX 1206 259 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477761.1 protein_id gnl|my_center|LOCUS_13900 2501 2019 gene locus_tag LOCUS_13910 2501 2019 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140032.1 protein_id gnl|my_center|LOCUS_13910 2558 4213 gene locus_tag LOCUS_13920 2558 4213 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056580.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence0307 289 1182 gene locus_tag LOCUS_13930 289 1182 CDS product DUF4058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259457.1 protein_id gnl|my_center|LOCUS_13930 1216 1815 gene locus_tag LOCUS_13940 1216 1815 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140824.1 protein_id gnl|my_center|LOCUS_13940 3403 1883 gene locus_tag LOCUS_13950 3403 1883 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058059.1 protein_id gnl|my_center|LOCUS_13950 4414 4127 gene locus_tag LOCUS_13960 4414 4127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0308 <4501 616 gene locus_tag LOCUS_13970 <4501 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002378512.1:glycosyltransferase family 2 protein >Feature sequence0309 <1 1542 gene locus_tag LOCUS_13980 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021650.1:PAS domain S-box protein 1850 2980 gene locus_tag LOCUS_13990 1850 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4021 3176 gene locus_tag LOCUS_14000 4021 3176 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_14000 >Feature sequence0310 <4495 1875 gene locus_tag LOCUS_14010 <4495 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190897490.1:glycosyltransferase family 61 protein >Feature sequence0311 <1 3252 gene locus_tag LOCUS_14020 <1 3252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057208.1:glutamate synthase-related protein 3737 4144 gene locus_tag LOCUS_14030 3737 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0312 1035 283 gene locus_tag LOCUS_14040 gene phnC 1035 283 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_14040 2069 2719 gene locus_tag LOCUS_14050 2069 2719 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838972.1 protein_id gnl|my_center|LOCUS_14050 3444 2980 gene locus_tag LOCUS_14060 3444 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14060 4393 3983 gene locus_tag LOCUS_14070 4393 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0313 2143 176 gene locus_tag LOCUS_14080 2143 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3569 2520 gene locus_tag LOCUS_14090 gene cax 3569 2520 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_14090 <4490 3708 gene locus_tag LOCUS_14100 <4490 3708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056008.1:HAD-IC family P-type ATPase >Feature sequence0314 200 1111 gene locus_tag LOCUS_14110 200 1111 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057737.1 protein_id gnl|my_center|LOCUS_14110 1707 2027 gene locus_tag LOCUS_14120 1707 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14120 2120 2251 gene locus_tag LOCUS_14130 2120 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 3894 3292 gene locus_tag LOCUS_14140 3894 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 >Feature sequence0315 423 1745 gene locus_tag LOCUS_14150 423 1745 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529438.1 protein_id gnl|my_center|LOCUS_14150 2472 1765 gene locus_tag LOCUS_14160 2472 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2688 2512 gene locus_tag LOCUS_14170 2688 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 3001 2747 gene locus_tag LOCUS_14180 3001 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 <4482 3066 gene locus_tag LOCUS_14190 <4482 3066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245563.1:polyketide synthase PksJ >Feature sequence0316 741 97 gene locus_tag LOCUS_14200 gene panB 741 97 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928599.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14200 1536 1066 gene locus_tag LOCUS_14210 1536 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2514 1852 gene locus_tag LOCUS_14220 2514 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14220 2790 3011 gene locus_tag LOCUS_14230 2790 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3279 3527 gene locus_tag LOCUS_14240 3279 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3535 3837 gene locus_tag LOCUS_14250 3535 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0317 <1 596 gene locus_tag LOCUS_14260 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920671.1:MotA/TolQ/ExbB proton channel family protein 831 1406 gene locus_tag LOCUS_14270 831 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2036 2332 gene locus_tag LOCUS_14280 2036 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2343 2615 gene locus_tag LOCUS_14290 2343 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence0318 3 785 gene locus_tag LOCUS_14300 gene htpX 3 785 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_14300 1844 3241 gene locus_tag LOCUS_14310 1844 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0319 1745 1933 gene locus_tag LOCUS_14320 1745 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1902 2129 gene locus_tag LOCUS_14330 1902 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14330 2457 3287 gene locus_tag LOCUS_14340 2457 3287 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_14340 4219 3962 gene locus_tag LOCUS_14350 4219 3962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0320 1011 190 gene locus_tag LOCUS_14360 1011 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1886 3007 gene locus_tag LOCUS_14370 1886 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 4195 3956 gene locus_tag LOCUS_14380 4195 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence0321 440 1009 gene locus_tag LOCUS_14390 440 1009 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430302.1 protein_id gnl|my_center|LOCUS_14390 1644 2216 gene locus_tag LOCUS_14400 1644 2216 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454531.1 protein_id gnl|my_center|LOCUS_14400 2677 3279 gene locus_tag LOCUS_14410 2677 3279 CDS product TerD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210396.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence0322 25 1152 gene locus_tag LOCUS_14420 gene proX 25 1152 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_14420 2274 1687 gene locus_tag LOCUS_14430 2274 1687 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530136.1 protein_id gnl|my_center|LOCUS_14430 2698 3534 gene locus_tag LOCUS_14440 2698 3534 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141258.1 protein_id gnl|my_center|LOCUS_14440 4353 3790 gene locus_tag LOCUS_14450 4353 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence0323 2355 2849 gene locus_tag LOCUS_14460 2355 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 <4456 3755 gene locus_tag LOCUS_14470 <4456 3755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144094.1:LL-diaminopimelate aminotransferase >Feature sequence0324 1238 888 gene locus_tag LOCUS_14480 1238 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14480 4070 1317 gene locus_tag LOCUS_14490 4070 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14490 >Feature sequence0325 392 1273 gene locus_tag LOCUS_14500 392 1273 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_14500 1528 2475 gene locus_tag LOCUS_14510 1528 2475 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173824.1 protein_id gnl|my_center|LOCUS_14510 2697 2536 gene locus_tag LOCUS_14520 2697 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 3932 2688 gene locus_tag LOCUS_14530 3932 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 4445 4266 gene locus_tag LOCUS_14540 4445 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence0326 679 149 gene locus_tag LOCUS_14550 679 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 700 799 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2283 1351 gene locus_tag LOCUS_14560 2283 1351 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_14560 2561 3922 gene locus_tag LOCUS_14570 2561 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence0327 1130 1480 gene locus_tag LOCUS_14580 1130 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1511 1945 gene locus_tag LOCUS_14590 1511 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2253 2906 gene locus_tag LOCUS_14600 2253 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 3224 3787 gene locus_tag LOCUS_14610 3224 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence0328 1908 361 gene locus_tag LOCUS_14620 1908 361 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141006.1 protein_id gnl|my_center|LOCUS_14620 <4437 2982 gene locus_tag LOCUS_14630 <4437 2982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141005.1:NAD(P)H-quinone oxidoreductase subunit F >Feature sequence0329 2202 601 gene locus_tag LOCUS_14640 2202 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 2540 2397 gene locus_tag LOCUS_14650 2540 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 3302 3790 gene locus_tag LOCUS_14660 3302 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14660 3958 4254 gene locus_tag LOCUS_14670 3958 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence0330 >Feature sequence0331 105 557 gene locus_tag LOCUS_14680 105 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1427 1549 gene locus_tag LOCUS_14690 1427 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1751 2803 gene locus_tag LOCUS_14700 1751 2803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 4110 3508 gene locus_tag LOCUS_14710 4110 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence0332 296 69 gene locus_tag LOCUS_14720 296 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2098 293 gene locus_tag LOCUS_14730 2098 293 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928808.1 protein_id gnl|my_center|LOCUS_14730 2868 2497 gene locus_tag LOCUS_14740 2868 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 3033 3758 gene locus_tag LOCUS_14750 3033 3758 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112457.1 protein_id gnl|my_center|LOCUS_14750 <4428 3855 gene locus_tag LOCUS_14760 <4428 3855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728381.1:Xaa-Pro peptidase family protein >Feature sequence0333 1207 434 gene locus_tag LOCUS_14770 gene hisA 1207 434 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056071.1 protein_id gnl|my_center|LOCUS_14770 1950 1243 gene locus_tag LOCUS_14780 1950 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2708 2085 gene locus_tag LOCUS_14790 2708 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 3119 3598 gene locus_tag LOCUS_14800 3119 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 4064 3747 gene locus_tag LOCUS_14810 4064 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence0334 3931 836 gene locus_tag LOCUS_14820 3931 836 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057035.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence0335 686 3439 gene locus_tag LOCUS_14830 686 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence0336 167 2197 gene locus_tag LOCUS_14840 167 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056981.1 protein_id gnl|my_center|LOCUS_14840 3478 4128 gene locus_tag LOCUS_14850 3478 4128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence0337 22 669 gene locus_tag LOCUS_14860 22 669 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_14860 690 1022 gene locus_tag LOCUS_14870 690 1022 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_14870 1594 983 gene locus_tag LOCUS_14880 1594 983 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124316.1 protein_id gnl|my_center|LOCUS_14880 2028 1953 gene locus_tag LOCUS_t00210 2028 1953 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2593 2228 gene locus_tag LOCUS_14890 2593 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 3244 2597 gene locus_tag LOCUS_14900 3244 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3528 3277 gene locus_tag LOCUS_14910 3528 3277 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141619.1 protein_id gnl|my_center|LOCUS_14910 3839 3764 gene locus_tag LOCUS_t00220 3839 3764 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4313 3936 gene locus_tag LOCUS_14920 4313 3936 CDS product DUF1818 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057286.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0338 822 256 gene locus_tag LOCUS_14930 822 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 975 3509 gene locus_tag LOCUS_14940 975 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0339 1444 1058 gene locus_tag LOCUS_14950 1444 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045052736.1 protein_id gnl|my_center|LOCUS_14950 2815 1829 gene locus_tag LOCUS_14960 gene secF 2815 1829 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_14960 <4408 3604 gene locus_tag LOCUS_14970 <4408 3604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056058.1:protein translocase subunit SecD >Feature sequence0340 85 1878 gene locus_tag LOCUS_14980 gene glgX 85 1878 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_14980 2419 2213 gene locus_tag LOCUS_14990 2419 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 3229 3819 gene locus_tag LOCUS_15000 3229 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 3929 4402 gene locus_tag LOCUS_15010 3929 4402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence0341 <1 1305 gene locus_tag LOCUS_15020 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022224.1:tetratricopeptide repeat protein 1612 4068 gene locus_tag LOCUS_15030 1612 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence0342 1959 202 gene locus_tag LOCUS_15040 gene menD 1959 202 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055985.1 protein_id gnl|my_center|LOCUS_15040 2780 2235 gene locus_tag LOCUS_15050 2780 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 3682 3413 gene locus_tag LOCUS_15060 3682 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15060 4124 3825 gene locus_tag LOCUS_15070 4124 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence0343 147 2792 gene locus_tag LOCUS_15080 147 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2981 4012 gene locus_tag LOCUS_15090 2981 4012 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056452.1 protein_id gnl|my_center|LOCUS_15090 4069 4275 gene locus_tag LOCUS_15100 4069 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence0344 1079 606 gene locus_tag LOCUS_15110 1079 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1680 1069 gene locus_tag LOCUS_15120 gene pyrE 1680 1069 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057665.1 protein_id gnl|my_center|LOCUS_15120 1954 2355 gene locus_tag LOCUS_15130 1954 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 <4373 2884 gene locus_tag LOCUS_15140 <4373 2884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057147.1:precorrin-3B C(17)-methyltransferase >Feature sequence0345 1473 1066 gene locus_tag LOCUS_15150 1473 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 3247 1445 gene locus_tag LOCUS_15160 3247 1445 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208105.1 protein_id gnl|my_center|LOCUS_15160 <4371 3279 gene locus_tag LOCUS_15170 <4371 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928895.1:fatty acyl-AMP ligase >Feature sequence0346 1339 173 gene locus_tag LOCUS_15180 1339 173 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462207.1 protein_id gnl|my_center|LOCUS_15180 2157 1390 gene locus_tag LOCUS_15190 2157 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3219 2188 gene locus_tag LOCUS_15200 3219 2188 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_15200 3975 3250 gene locus_tag LOCUS_15210 3975 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence0347 2428 335 gene locus_tag LOCUS_15220 2428 335 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124327.1 protein_id gnl|my_center|LOCUS_15220 3047 2706 gene locus_tag LOCUS_15230 3047 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15230 4082 3864 gene locus_tag LOCUS_15240 4082 3864 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143533.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence0348 2109 1942 gene locus_tag LOCUS_15250 2109 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15250 2333 2187 gene locus_tag LOCUS_15260 2333 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 2655 2320 gene locus_tag LOCUS_15270 2655 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15270 3442 2783 gene locus_tag LOCUS_15280 3442 2783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence0349 1344 880 gene locus_tag LOCUS_15290 1344 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1853 1605 gene locus_tag LOCUS_15300 1853 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 2246 1911 gene locus_tag LOCUS_15310 2246 1911 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_15310 3078 3857 gene locus_tag LOCUS_15320 3078 3857 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404953.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence0350 1649 351 gene locus_tag LOCUS_15330 1649 351 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_15330 2139 1921 gene locus_tag LOCUS_15340 2139 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15340 2289 2558 gene locus_tag LOCUS_15350 2289 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 >Feature sequence0351 107 733 gene locus_tag LOCUS_15360 107 733 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057020.1 protein_id gnl|my_center|LOCUS_15360 703 1428 gene locus_tag LOCUS_15370 703 1428 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057021.1 protein_id gnl|my_center|LOCUS_15370 1688 1503 gene locus_tag LOCUS_15380 1688 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2313 3152 gene locus_tag LOCUS_15390 2313 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 <4358 3195 gene locus_tag LOCUS_15400 <4358 3195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106459194.1:tetratricopeptide repeat protein >Feature sequence0352 837 4265 gene locus_tag LOCUS_15410 837 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0353 2020 965 gene locus_tag LOCUS_15420 2020 965 CDS product WG repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358861.1 protein_id gnl|my_center|LOCUS_15420 3391 2138 gene locus_tag LOCUS_15430 3391 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 4290 3433 gene locus_tag LOCUS_15440 4290 3433 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546697.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence0354 824 3136 gene locus_tag LOCUS_15450 824 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 >Feature sequence0355 1879 2886 gene locus_tag LOCUS_15460 1879 2886 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523980.1 protein_id gnl|my_center|LOCUS_15460 4161 3283 gene locus_tag LOCUS_15470 4161 3283 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence0356 593 1474 gene locus_tag LOCUS_15480 593 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1774 3099 gene locus_tag LOCUS_15490 1774 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3423 4241 gene locus_tag LOCUS_15500 3423 4241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0357 <1 535 gene locus_tag LOCUS_15510 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868366.1:glycosyltransferase family 4 protein 545 2554 gene locus_tag LOCUS_15520 545 2554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928959.1 protein_id gnl|my_center|LOCUS_15520 3674 2559 gene locus_tag LOCUS_15530 3674 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence0358 2928 2194 gene locus_tag LOCUS_15540 2928 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3744 3499 gene locus_tag LOCUS_15550 3744 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0359 287 439 gene locus_tag LOCUS_15560 287 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 1651 791 gene locus_tag LOCUS_15570 1651 791 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_15570 2956 3114 gene locus_tag LOCUS_15580 2956 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3320 3478 gene locus_tag LOCUS_15590 3320 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 >Feature sequence0360 123 530 gene locus_tag LOCUS_15600 123 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 744 1874 gene locus_tag LOCUS_15610 744 1874 CDS product glutathionylspermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098746.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence0361 1581 1174 gene locus_tag LOCUS_15620 1581 1174 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141388.1 protein_id gnl|my_center|LOCUS_15620 2326 1643 gene locus_tag LOCUS_15630 2326 1643 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141387.1 protein_id gnl|my_center|LOCUS_15630 3228 2656 gene locus_tag LOCUS_15640 3228 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence0362 1115 159 gene locus_tag LOCUS_15650 1115 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1822 1274 gene locus_tag LOCUS_15660 1822 1274 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_15660 2226 1882 gene locus_tag LOCUS_15670 2226 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140556.1 protein_id gnl|my_center|LOCUS_15670 2461 3090 gene locus_tag LOCUS_15680 2461 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3314 4219 gene locus_tag LOCUS_15690 3314 4219 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence0363 85 831 gene locus_tag LOCUS_15700 85 831 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142845.1 protein_id gnl|my_center|LOCUS_15700 1016 2056 gene locus_tag LOCUS_15710 1016 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2410 3627 gene locus_tag LOCUS_15720 2410 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence0364 372 139 gene locus_tag LOCUS_15730 372 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2494 1199 gene locus_tag LOCUS_15740 gene purB 2494 1199 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_15740 3567 3229 gene locus_tag LOCUS_15750 3567 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15750 3952 3740 gene locus_tag LOCUS_15760 3952 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15760 >Feature sequence0365 1 354 gene locus_tag LOCUS_15770 1 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 1364 405 gene locus_tag LOCUS_15780 1364 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 4066 2369 gene locus_tag LOCUS_15790 4066 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0366 1215 34 gene locus_tag LOCUS_15800 1215 34 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057699.1 protein_id gnl|my_center|LOCUS_15800 2285 1773 gene locus_tag LOCUS_15810 2285 1773 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15810 2798 2454 gene locus_tag LOCUS_15820 2798 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 3440 2868 gene locus_tag LOCUS_15830 3440 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 3879 3457 gene locus_tag LOCUS_15840 3879 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence0367 78 785 gene locus_tag LOCUS_15850 78 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 979 1419 gene locus_tag LOCUS_15860 979 1419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 1679 2674 gene locus_tag LOCUS_15870 1679 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3001 3438 gene locus_tag LOCUS_15880 3001 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3604 4101 gene locus_tag LOCUS_15890 3604 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0368 366 1034 gene locus_tag LOCUS_15900 gene nth 366 1034 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_15900 1353 1640 gene locus_tag LOCUS_15910 gene rpsN 1353 1640 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_15910 2333 1962 gene locus_tag LOCUS_15920 2333 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056249.1 protein_id gnl|my_center|LOCUS_15920 2332 2910 gene locus_tag LOCUS_15930 gene aat 2332 2910 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920768.1 protein_id gnl|my_center|LOCUS_15930 <4278 3168 gene locus_tag LOCUS_15940 <4278 3168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928745.1:alpha/beta hydrolase >Feature sequence0369 1027 56 gene locus_tag LOCUS_15950 1027 56 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329334.1 protein_id gnl|my_center|LOCUS_15950 2557 1448 gene locus_tag LOCUS_15960 2557 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 <4272 3298 gene locus_tag LOCUS_15970 <4272 3298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969981.1:DMT family transporter >Feature sequence0370 1021 635 gene locus_tag LOCUS_15980 1021 635 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057973.1 protein_id gnl|my_center|LOCUS_15980 1279 1067 gene locus_tag LOCUS_15990 1279 1067 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987300.1 protein_id gnl|my_center|LOCUS_15990 2142 3146 gene locus_tag LOCUS_16000 2142 3146 CDS product saccharopine dehydrogenase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928537.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence0371 2181 619 gene locus_tag LOCUS_16010 gene kaiC 2181 619 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056334.1 protein_id gnl|my_center|LOCUS_16010 2599 2285 gene locus_tag LOCUS_16020 gene kaiB 2599 2285 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_16020 3484 2684 gene locus_tag LOCUS_16030 3484 2684 CDS product circadian clock protein KaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056332.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence0372 4073 87 gene locus_tag LOCUS_16040 4073 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0373 1070 648 gene locus_tag LOCUS_16050 1070 648 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_16050 1587 1084 gene locus_tag LOCUS_16060 1587 1084 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_16060 1679 3133 gene locus_tag LOCUS_16070 1679 3133 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142768.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence0374 445 122 gene locus_tag LOCUS_16080 445 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2904 1156 gene locus_tag LOCUS_16090 2904 1156 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_16090 3802 4056 gene locus_tag LOCUS_16100 3802 4056 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965024.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0375 875 1534 gene locus_tag LOCUS_16110 gene hisIE 875 1534 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_16110 1992 2435 gene locus_tag LOCUS_16120 1992 2435 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209946.1 protein_id gnl|my_center|LOCUS_16120 2618 4087 gene locus_tag LOCUS_16130 2618 4087 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence0376 31 822 gene locus_tag LOCUS_16140 31 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 890 1624 gene locus_tag LOCUS_16150 890 1624 CDS product branched chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338794.1 protein_id gnl|my_center|LOCUS_16150 1761 2639 gene locus_tag LOCUS_16160 gene lipA 1761 2639 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921111.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence0377 2490 13 gene locus_tag LOCUS_16170 gene ppsA 2490 13 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250243.1 protein_id gnl|my_center|LOCUS_16170 2847 3596 gene locus_tag LOCUS_16180 2847 3596 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057176.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence0378 561 82 gene locus_tag LOCUS_16190 561 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16190 1248 739 gene locus_tag LOCUS_16200 1248 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16200 1499 1221 gene locus_tag LOCUS_16210 1499 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 2531 1959 gene locus_tag LOCUS_16220 2531 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence0379 796 401 gene locus_tag LOCUS_16230 796 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2203 845 gene locus_tag LOCUS_16240 2203 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 2433 3788 gene locus_tag LOCUS_16250 2433 3788 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531130.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence0380 623 1378 gene locus_tag LOCUS_16260 623 1378 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000590206.1 protein_id gnl|my_center|LOCUS_16260 2283 1528 gene locus_tag LOCUS_16270 2283 1528 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_16270 3031 3285 gene locus_tag LOCUS_16280 3031 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3712 3377 gene locus_tag LOCUS_16290 gene grxD 3712 3377 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_16290 4187 3930 gene locus_tag LOCUS_16300 4187 3930 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056719.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0381 235 849 gene locus_tag LOCUS_16310 235 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16310 1292 1882 gene locus_tag LOCUS_16320 1292 1882 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_16320 2227 1916 gene locus_tag LOCUS_16330 2227 1916 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_16330 2578 2276 gene locus_tag LOCUS_16340 gene ureA 2578 2276 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_16340 2881 3006 gene locus_tag LOCUS_16350 2881 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence0382 892 314 gene locus_tag LOCUS_16360 892 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16360 1792 998 gene locus_tag LOCUS_16370 1792 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16370 2958 3815 gene locus_tag LOCUS_16380 2958 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence0383 <4234 5 gene locus_tag LOCUS_16390 <4234 5 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_040384744.1:glycerophosphodiester phosphodiesterase family protein >Feature sequence0384 1080 754 gene locus_tag LOCUS_16400 1080 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 1265 3226 gene locus_tag LOCUS_16410 1265 3226 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057141.1 protein_id gnl|my_center|LOCUS_16410 3348 3797 gene locus_tag LOCUS_16420 3348 3797 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166277356.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence0385 2776 878 gene locus_tag LOCUS_16430 2776 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 <4230 3442 gene locus_tag LOCUS_16440 <4230 3442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836919.1:type I secretion system permease/ATPase >Feature sequence0386 623 24 gene locus_tag LOCUS_16450 gene yfkM 623 24 CDS product general stress protein 18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243504.1 protein_id gnl|my_center|LOCUS_16450 1508 900 gene locus_tag LOCUS_16460 1508 900 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_16460 2175 1609 gene locus_tag LOCUS_16470 2175 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2787 2440 gene locus_tag LOCUS_16480 2787 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 3609 3941 gene locus_tag LOCUS_16490 3609 3941 CDS product putative quinol monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262048.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence0387 1173 175 gene locus_tag LOCUS_16500 1173 175 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057983.1 protein_id gnl|my_center|LOCUS_16500 3428 1413 gene locus_tag LOCUS_16510 gene dnaK 3428 1413 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920992.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence0388 619 191 gene locus_tag LOCUS_16520 619 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 833 1081 gene locus_tag LOCUS_16530 833 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_16530 1576 1169 gene locus_tag LOCUS_16540 1576 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 2505 1555 gene locus_tag LOCUS_16550 2505 1555 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_16550 3261 2533 gene locus_tag LOCUS_16560 3261 2533 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306683.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence0389 2272 1148 gene locus_tag LOCUS_16570 2272 1148 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546476.1 protein_id gnl|my_center|LOCUS_16570 2943 4061 gene locus_tag LOCUS_16580 gene recA 2943 4061 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057924.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence0390 1624 593 gene locus_tag LOCUS_16590 gene pdhA 1624 593 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057011.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence0391 156 1517 gene locus_tag LOCUS_16600 156 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1782 3455 gene locus_tag LOCUS_16610 1782 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3913 4080 gene locus_tag LOCUS_16620 3913 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence0392 110 958 gene locus_tag LOCUS_16630 gene potI 110 958 CDS product putrescine ABC transporter permease PotI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001061643.1 protein_id gnl|my_center|LOCUS_16630 1681 3105 gene locus_tag LOCUS_16640 1681 3105 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence0393 931 272 gene locus_tag LOCUS_16650 931 272 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_16650 1042 1842 gene locus_tag LOCUS_16660 1042 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 2168 2926 gene locus_tag LOCUS_16670 2168 2926 CDS product DUF4336 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837011.1 protein_id gnl|my_center|LOCUS_16670 2975 3598 gene locus_tag LOCUS_16680 2975 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16680 >Feature sequence0394 874 110 gene locus_tag LOCUS_16690 874 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 1482 2177 gene locus_tag LOCUS_16700 1482 2177 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_16700 2194 2700 gene locus_tag LOCUS_16710 gene rfaE2 2194 2700 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057432.1 protein_id gnl|my_center|LOCUS_16710 2969 3688 gene locus_tag LOCUS_16720 2969 3688 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057433.1 protein_id gnl|my_center|LOCUS_16720 >Feature sequence0395 743 426 gene locus_tag LOCUS_16730 743 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16730 1961 1479 gene locus_tag LOCUS_16740 1961 1479 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124513.1 protein_id gnl|my_center|LOCUS_16740 2126 2920 gene locus_tag LOCUS_16750 2126 2920 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_16750 3702 3397 gene locus_tag LOCUS_16760 3702 3397 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057369.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence0396 <1 841 gene locus_tag LOCUS_16770 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226677.1:DUF4255 domain-containing protein 870 2330 gene locus_tag LOCUS_16780 870 2330 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_16780 2367 2792 gene locus_tag LOCUS_16790 2367 2792 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_16790 3075 3464 gene locus_tag LOCUS_16800 3075 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941644.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence0397 718 1554 gene locus_tag LOCUS_16810 718 1554 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057694.1 protein_id gnl|my_center|LOCUS_16810 2283 2077 gene locus_tag LOCUS_16820 2283 2077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 3201 4073 gene locus_tag LOCUS_16830 3201 4073 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_16830 >Feature sequence0398 1474 554 gene locus_tag LOCUS_16840 1474 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 2367 2561 gene locus_tag LOCUS_16850 2367 2561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 4014 2728 gene locus_tag LOCUS_16860 gene gudB 4014 2728 CDS product NAD-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000225172.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence0399 <1 692 gene locus_tag LOCUS_16870 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058039.1:peptide chain release factor 3 3233 1482 gene locus_tag LOCUS_16880 3233 1482 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048348.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence0400 434 1270 gene locus_tag LOCUS_16890 434 1270 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_16890 1825 1376 gene locus_tag LOCUS_16900 1825 1376 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_16900 2730 1840 gene locus_tag LOCUS_16910 2730 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_16910 3573 3064 gene locus_tag LOCUS_16920 3573 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_16920 >Feature sequence0401 <1 594 gene locus_tag LOCUS_16930 <1 594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057404.1:30S ribosomal protein S12 methylthiotransferase RimO 1944 3428 gene locus_tag LOCUS_16940 1944 3428 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142503.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence0402 420 932 gene locus_tag LOCUS_16950 420 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1329 910 gene locus_tag LOCUS_16960 1329 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2353 1616 gene locus_tag LOCUS_16970 2353 1616 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057263.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence0403 239 892 gene locus_tag LOCUS_16980 239 892 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_16980 917 1612 gene locus_tag LOCUS_16990 917 1612 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141809.1 protein_id gnl|my_center|LOCUS_16990 2166 2534 gene locus_tag LOCUS_17000 2166 2534 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056500.1 protein_id gnl|my_center|LOCUS_17000 2740 3186 gene locus_tag LOCUS_17010 2740 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 3348 3647 gene locus_tag LOCUS_17020 3348 3647 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055881.1 protein_id gnl|my_center|LOCUS_17020 3821 4030 gene locus_tag LOCUS_17030 3821 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17030 3970 4131 gene locus_tag LOCUS_17040 3970 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17040 >Feature sequence0404 <1 555 gene locus_tag LOCUS_17050 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765612.1:phosphatidylinositol-4-phosphate 5-kinase 2626 1046 gene locus_tag LOCUS_17060 2626 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2971 4026 gene locus_tag LOCUS_17070 2971 4026 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259661.1 protein_id gnl|my_center|LOCUS_17070 >Feature sequence0405 2958 1645 gene locus_tag LOCUS_17080 2958 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 <4171 3596 gene locus_tag LOCUS_17090 <4171 3596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056935.1:Ycf51 family protein >Feature sequence0406 1500 826 gene locus_tag LOCUS_17100 1500 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3088 1688 gene locus_tag LOCUS_17110 3088 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3199 3372 gene locus_tag LOCUS_17120 3199 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 4023 3829 gene locus_tag LOCUS_17130 4023 3829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence0407 <4154 1181 gene locus_tag LOCUS_17140 <4154 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence0408 1139 1396 gene locus_tag LOCUS_17150 1139 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17150 2127 2831 gene locus_tag LOCUS_17160 2127 2831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17160 >Feature sequence0409 1548 151 gene locus_tag LOCUS_17170 1548 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 2253 1849 gene locus_tag LOCUS_17180 2253 1849 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_17180 3381 2632 gene locus_tag LOCUS_17190 3381 2632 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141808.1 protein_id gnl|my_center|LOCUS_17190 3527 3916 gene locus_tag LOCUS_17200 3527 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence0410 <4146 3093 gene locus_tag LOCUS_17210 <4146 3093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057166.1:serine/threonine-protein kinase >Feature sequence0411 1025 129 gene locus_tag LOCUS_17220 gene sucD 1025 129 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_17220 2264 1047 gene locus_tag LOCUS_17230 gene sucC 2264 1047 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_17230 3769 2291 gene locus_tag LOCUS_17240 3769 2291 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057691.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence0412 408 2054 gene locus_tag LOCUS_17250 408 2054 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_17250 2219 2464 gene locus_tag LOCUS_17260 2219 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2699 3142 gene locus_tag LOCUS_17270 2699 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 3876 3199 gene locus_tag LOCUS_17280 3876 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_17280 >Feature sequence0413 875 426 gene locus_tag LOCUS_17290 875 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1188 3566 gene locus_tag LOCUS_17300 1188 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 3630 3905 gene locus_tag LOCUS_17310 3630 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence0414 1635 1315 gene locus_tag LOCUS_17320 1635 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 3062 2172 gene locus_tag LOCUS_17330 3062 2172 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_17330 3936 3235 gene locus_tag LOCUS_17340 3936 3235 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_17340 >Feature sequence0415 162 1292 gene locus_tag LOCUS_17350 162 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 2073 3854 gene locus_tag LOCUS_17360 2073 3854 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056653.1 protein_id gnl|my_center|LOCUS_17360 >Feature sequence0416 176 511 gene locus_tag LOCUS_17370 176 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 508 867 gene locus_tag LOCUS_17380 508 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 1272 1550 gene locus_tag LOCUS_17390 1272 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1547 2041 gene locus_tag LOCUS_17400 1547 2041 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027607744.1 protein_id gnl|my_center|LOCUS_17400 2362 3897 gene locus_tag LOCUS_17410 2362 3897 CDS product ShlB/FhaC/HecB family hemolysin secretion/activation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799342.1 protein_id gnl|my_center|LOCUS_17410 >Feature sequence0417 1058 2059 gene locus_tag LOCUS_17420 1058 2059 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143656.1 protein_id gnl|my_center|LOCUS_17420 3335 2814 gene locus_tag LOCUS_17430 3335 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0418 674 24 gene locus_tag LOCUS_17440 674 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3070 1514 gene locus_tag LOCUS_17450 3070 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 3104 3955 gene locus_tag LOCUS_17460 3104 3955 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0419 1898 147 gene locus_tag LOCUS_17470 1898 147 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057022.1 protein_id gnl|my_center|LOCUS_17470 2607 2918 gene locus_tag LOCUS_17480 2607 2918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17480 2959 3177 gene locus_tag LOCUS_17490 2959 3177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17490 3228 3491 gene locus_tag LOCUS_17500 3228 3491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17500 4000 3674 gene locus_tag LOCUS_17510 4000 3674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence0420 2406 1444 gene locus_tag LOCUS_17520 2406 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812250.1 protein_id gnl|my_center|LOCUS_17520 2869 3906 gene locus_tag LOCUS_17530 gene pstS 2869 3906 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530168.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence0421 1004 2950 gene locus_tag LOCUS_17540 1004 2950 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141921.1 protein_id gnl|my_center|LOCUS_17540 3555 4115 gene locus_tag LOCUS_17550 3555 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence0422 2701 2045 gene locus_tag LOCUS_17560 2701 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17560 3204 2749 gene locus_tag LOCUS_17570 3204 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17570 3479 3940 gene locus_tag LOCUS_17580 3479 3940 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence0423 2839 2132 gene locus_tag LOCUS_17590 2839 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence0424 357 788 gene locus_tag LOCUS_17600 357 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920753.1 protein_id gnl|my_center|LOCUS_17600 1123 899 gene locus_tag LOCUS_17610 1123 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1576 1268 gene locus_tag LOCUS_17620 1576 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 2269 1619 gene locus_tag LOCUS_17630 gene upp 2269 1619 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_17630 >Feature sequence0425 480 1715 gene locus_tag LOCUS_17640 480 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 2634 1759 gene locus_tag LOCUS_17650 2634 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 3893 2634 gene locus_tag LOCUS_17660 3893 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence0426 741 295 gene locus_tag LOCUS_17670 741 295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 1110 2567 gene locus_tag LOCUS_17680 gene gatA 1110 2567 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_17680 2767 3546 gene locus_tag LOCUS_17690 2767 3546 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929219.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence0427 923 234 gene locus_tag LOCUS_17700 923 234 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_17700 1529 1729 gene locus_tag LOCUS_17710 1529 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17710 2589 3863 gene locus_tag LOCUS_17720 2589 3863 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056027.1 protein_id gnl|my_center|LOCUS_17720 3881 4018 gene locus_tag LOCUS_17730 3881 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence0428 1001 1642 gene locus_tag LOCUS_17740 1001 1642 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_17740 1699 2211 gene locus_tag LOCUS_17750 1699 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 2427 3116 gene locus_tag LOCUS_17760 2427 3116 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921911.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0429 2973 589 gene locus_tag LOCUS_17770 2973 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 3649 3837 gene locus_tag LOCUS_17780 3649 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence0430 735 151 gene locus_tag LOCUS_17790 735 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 1281 1099 gene locus_tag LOCUS_17800 1281 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 1670 2041 gene locus_tag LOCUS_17810 1670 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2895 2389 gene locus_tag LOCUS_17820 2895 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 2998 3642 gene locus_tag LOCUS_17830 gene hisH 2998 3642 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057376.1 protein_id gnl|my_center|LOCUS_17830 >Feature sequence0431 <1 979 gene locus_tag LOCUS_17840 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056290.1:F0F1 ATP synthase subunit alpha 1305 2252 gene locus_tag LOCUS_17850 1305 2252 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056240.1 protein_id gnl|my_center|LOCUS_17850 2584 3465 gene locus_tag LOCUS_17860 2584 3465 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_17860 >Feature sequence0432 1291 296 gene locus_tag LOCUS_17870 1291 296 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_17870 3072 1450 gene locus_tag LOCUS_17880 3072 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence0433 790 140 gene locus_tag LOCUS_17890 gene upp 790 140 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_17890 1016 2566 gene locus_tag LOCUS_17900 gene crtH 1016 2566 CDS product carotene isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891794.1 protein_id gnl|my_center|LOCUS_17900 >Feature sequence0434 2559 1531 gene locus_tag LOCUS_17910 gene gmd 2559 1531 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_17910 3664 2933 gene locus_tag LOCUS_17920 3664 2933 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence0435 2203 320 gene locus_tag LOCUS_17930 2203 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 <4069 2654 gene locus_tag LOCUS_17940 <4069 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence0436 1572 934 gene locus_tag LOCUS_17950 gene bluB 1572 934 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339137.1 protein_id gnl|my_center|LOCUS_17950 1776 3515 gene locus_tag LOCUS_17960 gene ribBA 1776 3515 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence0437 <1 1024 gene locus_tag LOCUS_17970 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000024498.1:glycosyltransferase 2345 1080 gene locus_tag LOCUS_17980 2345 1080 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730216.1 protein_id gnl|my_center|LOCUS_17980 3329 2505 gene locus_tag LOCUS_17990 3329 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 <4058 3386 gene locus_tag LOCUS_18000 <4058 3386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135257956.1:MFS transporter >Feature sequence0438 1 1035 gene locus_tag LOCUS_18010 1 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 1181 2038 gene locus_tag LOCUS_18020 1181 2038 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142777.1 protein_id gnl|my_center|LOCUS_18020 4001 2994 gene locus_tag LOCUS_18030 4001 2994 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173962.1 protein_id gnl|my_center|LOCUS_18030 >Feature sequence0439 1622 492 gene locus_tag LOCUS_18040 1622 492 CDS product ISAzo13 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218132780.1 protein_id gnl|my_center|LOCUS_18040 2205 2804 gene locus_tag LOCUS_18050 2205 2804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 3693 3028 gene locus_tag LOCUS_18060 3693 3028 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057170.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence0440 1331 1023 gene locus_tag LOCUS_18070 1331 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 2696 1743 gene locus_tag LOCUS_18080 2696 1743 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989618.1 protein_id gnl|my_center|LOCUS_18080 3295 3597 gene locus_tag LOCUS_18090 3295 3597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 3706 3894 gene locus_tag LOCUS_18100 3706 3894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 >Feature sequence0441 1646 1191 gene locus_tag LOCUS_18110 1646 1191 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_18110 <4051 1930 gene locus_tag LOCUS_18120 <4051 1930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943024.1:PAS domain S-box protein >Feature sequence0442 174 593 gene locus_tag LOCUS_18130 174 593 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876951.1 protein_id gnl|my_center|LOCUS_18130 1768 842 gene locus_tag LOCUS_18140 1768 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 3336 2212 gene locus_tag LOCUS_18150 3336 2212 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144029.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence0443 <1 562 gene locus_tag LOCUS_18160 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056426.1:1,4-alpha-glucan branching enzyme 773 1597 gene locus_tag LOCUS_18170 773 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1666 3708 gene locus_tag LOCUS_18180 1666 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_18180 >Feature sequence0444 78 1439 gene locus_tag LOCUS_18190 78 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 1526 1798 gene locus_tag LOCUS_18200 1526 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 1933 3948 gene locus_tag LOCUS_18210 1933 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence0445 261 189 gene locus_tag LOCUS_t00230 261 189 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 892 392 gene locus_tag LOCUS_18220 892 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 1422 1231 gene locus_tag LOCUS_18230 1422 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 2742 1621 gene locus_tag LOCUS_18240 2742 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 3008 2775 gene locus_tag LOCUS_18250 3008 2775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 <4031 3300 gene locus_tag LOCUS_18260 <4031 3300 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144168.1:chloride channel protein >Feature sequence0446 584 934 gene locus_tag LOCUS_18270 584 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 1680 2171 gene locus_tag LOCUS_18280 1680 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 3944 3093 gene locus_tag LOCUS_18290 3944 3093 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726830.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence0447 3533 3000 gene locus_tag LOCUS_18300 gene infC 3533 3000 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence0448 73 1509 gene locus_tag LOCUS_18310 73 1509 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_18310 1506 2960 gene locus_tag LOCUS_18320 1506 2960 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920933.1 protein_id gnl|my_center|LOCUS_18320 3202 3804 gene locus_tag LOCUS_18330 3202 3804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence0449 <1 3768 gene locus_tag LOCUS_18340 <1 3768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140727.1:caspase family protein >Feature sequence0450 30 1862 gene locus_tag LOCUS_18350 30 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 3673 1988 gene locus_tag LOCUS_18360 3673 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 >Feature sequence0451 625 2523 gene locus_tag LOCUS_18370 625 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 >Feature sequence0452 1002 1961 gene locus_tag LOCUS_18380 1002 1961 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029699.1 protein_id gnl|my_center|LOCUS_18380 3311 3733 gene locus_tag LOCUS_18390 3311 3733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 >Feature sequence0453 1624 1971 gene locus_tag LOCUS_18400 1624 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 3497 2577 gene locus_tag LOCUS_18410 3497 2577 CDS product 2-keto-4-pentenoate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485218.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence0454 <1 889 gene locus_tag LOCUS_18420 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973686.1:FAD-dependent oxidoreductase 2311 3837 gene locus_tag LOCUS_18430 gene bchB 2311 3837 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0455 1116 1751 gene locus_tag LOCUS_18440 gene coaE 1116 1751 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_18440 2941 3450 gene locus_tag LOCUS_18450 2941 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence0456 437 204 gene locus_tag LOCUS_18460 437 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 2177 813 gene locus_tag LOCUS_18470 2177 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 <3977 3069 gene locus_tag LOCUS_18480 <3977 3069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950374.1:PD40 domain-containing protein >Feature sequence0457 580 221 gene locus_tag LOCUS_18490 580 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1380 1225 gene locus_tag LOCUS_18500 1380 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 2270 1752 gene locus_tag LOCUS_18510 2270 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 3758 2568 gene locus_tag LOCUS_18520 3758 2568 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057053.1 protein_id gnl|my_center|LOCUS_18520 >Feature sequence0458 <1 1909 gene locus_tag LOCUS_18530 <1 1909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144413.1:DUF839 domain-containing protein 3278 2496 gene locus_tag LOCUS_18540 3278 2496 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048869675.1 protein_id gnl|my_center|LOCUS_18540 <3975 3332 gene locus_tag LOCUS_18550 <3975 3332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein >Feature sequence0459 <1 845 gene locus_tag LOCUS_18560 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058306.1:tryptophan synthase subunit beta 1656 1024 gene locus_tag LOCUS_18570 1656 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2007 1765 gene locus_tag LOCUS_18580 2007 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 2571 2140 gene locus_tag LOCUS_18590 2571 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2858 3088 gene locus_tag LOCUS_18600 2858 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 3181 3729 gene locus_tag LOCUS_18610 3181 3729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0460 2010 892 gene locus_tag LOCUS_18620 2010 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 3038 2814 gene locus_tag LOCUS_18630 3038 2814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 3061 3387 gene locus_tag LOCUS_18640 3061 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 >Feature sequence0461 695 210 gene locus_tag LOCUS_18650 695 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1607 1104 gene locus_tag LOCUS_18660 1607 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 <3971 3148 gene locus_tag LOCUS_18670 <3971 3148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108596.1:Na+:solute symporter >Feature sequence0462 820 3657 gene locus_tag LOCUS_18680 820 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence0463 426 590 gene locus_tag LOCUS_18690 426 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 870 1427 gene locus_tag LOCUS_18700 870 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18700 1654 1935 gene locus_tag LOCUS_18710 1654 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18710 2125 2769 gene locus_tag LOCUS_18720 2125 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18720 >Feature sequence0464 364 1335 gene locus_tag LOCUS_18730 gene nadA 364 1335 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_18730 1597 1962 gene locus_tag LOCUS_18740 1597 1962 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402827.1 protein_id gnl|my_center|LOCUS_18740 1893 2063 gene locus_tag LOCUS_18750 1893 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2333 3448 gene locus_tag LOCUS_18760 2333 3448 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533459.1 protein_id gnl|my_center|LOCUS_18760 3488 3901 gene locus_tag LOCUS_18770 3488 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence0465 409 882 gene locus_tag LOCUS_18780 409 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1179 2159 gene locus_tag LOCUS_18790 gene accD 1179 2159 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057480.1 protein_id gnl|my_center|LOCUS_18790 2214 2399 gene locus_tag LOCUS_18800 2214 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 2531 3022 gene locus_tag LOCUS_18810 gene psbV 2531 3022 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_18810 3176 3679 gene locus_tag LOCUS_18820 gene psbV2 3176 3679 CDS product photosystem II cytochrome PsbV2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057124.1 protein_id gnl|my_center|LOCUS_18820 >Feature sequence0466 1142 2554 gene locus_tag LOCUS_18830 1142 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 >Feature sequence0467 560 105 gene locus_tag LOCUS_18840 560 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 974 756 gene locus_tag LOCUS_18850 974 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 2270 1050 gene locus_tag LOCUS_18860 2270 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 3433 2351 gene locus_tag LOCUS_18870 3433 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence0468 21 380 gene locus_tag LOCUS_18880 21 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 1074 2372 gene locus_tag LOCUS_18890 1074 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329014.1 protein_id gnl|my_center|LOCUS_18890 2854 3315 gene locus_tag LOCUS_18900 gene rimP 2854 3315 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920953.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence0469 489 1220 gene locus_tag LOCUS_18910 489 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 1384 1512 gene locus_tag LOCUS_18920 1384 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2299 2466 gene locus_tag LOCUS_18930 2299 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 3394 2507 gene locus_tag LOCUS_18940 gene rpoD 3394 2507 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023173878.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0470 1828 671 gene locus_tag LOCUS_18950 1828 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2363 2983 gene locus_tag LOCUS_18960 2363 2983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 3124 3345 gene locus_tag LOCUS_18970 3124 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence0471 1814 483 gene locus_tag LOCUS_18980 1814 483 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_18980 2612 2863 gene locus_tag LOCUS_18990 2612 2863 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144349.1 protein_id gnl|my_center|LOCUS_18990 >Feature sequence0472 387 1394 gene locus_tag LOCUS_19000 387 1394 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_19000 2035 2544 gene locus_tag LOCUS_19010 2035 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence0473 2019 1228 gene locus_tag LOCUS_19020 2019 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 >Feature sequence0474 451 780 gene locus_tag LOCUS_19030 451 780 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144391.1 protein_id gnl|my_center|LOCUS_19030 1993 2202 gene locus_tag LOCUS_19040 1993 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2267 3232 gene locus_tag LOCUS_19050 2267 3232 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948164.1 protein_id gnl|my_center|LOCUS_19050 >Feature sequence0475 262 903 gene locus_tag LOCUS_19060 262 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 934 1131 gene locus_tag LOCUS_19070 934 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 2255 1263 gene locus_tag LOCUS_19080 2255 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2434 3750 gene locus_tag LOCUS_19090 2434 3750 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence0476 632 186 gene locus_tag LOCUS_19100 632 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 903 661 gene locus_tag LOCUS_19110 903 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 2679 913 gene locus_tag LOCUS_19120 2679 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 3261 2683 gene locus_tag LOCUS_19130 3261 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence0477 345 857 gene locus_tag LOCUS_19140 345 857 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_19140 1941 1315 gene locus_tag LOCUS_19150 1941 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3650 2412 gene locus_tag LOCUS_19160 3650 2412 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461038.1 protein_id gnl|my_center|LOCUS_19160 >Feature sequence0478 1940 2272 gene locus_tag LOCUS_19170 1940 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 2819 3703 gene locus_tag LOCUS_19180 2819 3703 CDS product three-Cys-motif partner protein TcmP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142948.1 protein_id gnl|my_center|LOCUS_19180 3845 3681 gene locus_tag LOCUS_19190 3845 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 >Feature sequence0479 1758 1321 gene locus_tag LOCUS_19200 1758 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 <3921 2948 gene locus_tag LOCUS_19210 <3921 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056167.1:ATP-dependent helicase >Feature sequence0480 969 2078 gene locus_tag LOCUS_19220 969 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 2316 2972 gene locus_tag LOCUS_19230 2316 2972 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144237.1 protein_id gnl|my_center|LOCUS_19230 >Feature sequence0481 1044 2069 gene locus_tag LOCUS_19240 1044 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 3166 2771 gene locus_tag LOCUS_19250 3166 2771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057511.1 protein_id gnl|my_center|LOCUS_19250 <3911 3207 gene locus_tag LOCUS_19260 <3911 3207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014877983.1:GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase >Feature sequence0482 520 3168 gene locus_tag LOCUS_19270 520 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 >Feature sequence0483 2040 13 gene locus_tag LOCUS_19280 2040 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence0484 <1 2354 gene locus_tag LOCUS_19290 <1 2354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797719.1:GH116 family glycosyl hydrolase 3011 3796 gene locus_tag LOCUS_19300 gene xth 3011 3796 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence0485 685 257 gene locus_tag LOCUS_19310 685 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19310 1022 648 gene locus_tag LOCUS_19320 1022 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19320 2147 1821 gene locus_tag LOCUS_19330 2147 1821 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_19330 2656 3021 gene locus_tag LOCUS_19340 2656 3021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 >Feature sequence0486 1245 568 gene locus_tag LOCUS_19350 1245 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 1654 1364 gene locus_tag LOCUS_19360 1654 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 2076 1651 gene locus_tag LOCUS_19370 2076 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19370 2215 2054 gene locus_tag LOCUS_19380 2215 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 2530 2255 gene locus_tag LOCUS_19390 2530 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19390 3615 2623 gene locus_tag LOCUS_19400 3615 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 >Feature sequence0487 213 2750 gene locus_tag LOCUS_19410 gene ppsA 213 2750 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_19410 3625 3059 gene locus_tag LOCUS_19420 3625 3059 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_19420 >Feature sequence0488 439 1035 gene locus_tag LOCUS_19430 439 1035 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228796.1 protein_id gnl|my_center|LOCUS_19430 1771 2490 gene locus_tag LOCUS_19440 1771 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 3522 2824 gene locus_tag LOCUS_19450 3522 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 >Feature sequence0489 1695 559 gene locus_tag LOCUS_19460 1695 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 2288 2995 gene locus_tag LOCUS_19470 gene pgl 2288 2995 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056919.1 protein_id gnl|my_center|LOCUS_19470 >Feature sequence0490 66 632 gene locus_tag LOCUS_19480 66 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 <3882 712 gene locus_tag LOCUS_19490 <3882 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929131.1:esterase-like activity of phytase family protein >Feature sequence0491 1644 235 gene locus_tag LOCUS_19500 1644 235 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057393.1 protein_id gnl|my_center|LOCUS_19500 2266 3591 gene locus_tag LOCUS_19510 2266 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_19510 >Feature sequence0492 <1 1380 gene locus_tag LOCUS_19520 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012502785.1:tetratricopeptide repeat protein 1712 2197 gene locus_tag LOCUS_19530 1712 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19530 2779 2207 gene locus_tag LOCUS_19540 2779 2207 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_19540 3277 2798 gene locus_tag LOCUS_19550 3277 2798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137906819.1 protein_id gnl|my_center|LOCUS_19550 3759 3331 gene locus_tag LOCUS_19560 3759 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 >Feature sequence0493 257 1786 gene locus_tag LOCUS_19570 257 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 2462 2151 gene locus_tag LOCUS_19580 2462 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2642 2478 gene locus_tag LOCUS_19590 2642 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 3249 3097 gene locus_tag LOCUS_19600 3249 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 >Feature sequence0494 394 1218 gene locus_tag LOCUS_19610 394 1218 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812528.1 protein_id gnl|my_center|LOCUS_19610 3411 2203 gene locus_tag LOCUS_19620 gene bioF 3411 2203 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140400.1 protein_id gnl|my_center|LOCUS_19620 >Feature sequence0495 948 1616 gene locus_tag LOCUS_19630 948 1616 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_19630 1781 2413 gene locus_tag LOCUS_19640 1781 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3275 3096 gene locus_tag LOCUS_19650 3275 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3512 3670 gene locus_tag LOCUS_19660 3512 3670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 >Feature sequence0496 1070 189 gene locus_tag LOCUS_19670 1070 189 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026311868.1 protein_id gnl|my_center|LOCUS_19670 3320 1551 gene locus_tag LOCUS_19680 3320 1551 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967491.1 protein_id gnl|my_center|LOCUS_19680 >Feature sequence0497 2192 1977 gene locus_tag LOCUS_19690 2192 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 3017 2733 gene locus_tag LOCUS_19700 3017 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 >Feature sequence0498 2194 3570 gene locus_tag LOCUS_19710 2194 3570 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190570100.1 protein_id gnl|my_center|LOCUS_19710 >Feature sequence0499 282 1946 gene locus_tag LOCUS_19720 282 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1951 2376 gene locus_tag LOCUS_19730 1951 2376 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_19730 2931 3365 gene locus_tag LOCUS_19740 2931 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056629.1 protein_id gnl|my_center|LOCUS_19740 >Feature sequence0500 3676 548 gene locus_tag LOCUS_19750 3676 548 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921798.1 protein_id gnl|my_center|LOCUS_19750 >Feature sequence0501 <1 1312 gene locus_tag LOCUS_19760 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140275.1:DNA repair protein RecN 2160 2011 gene locus_tag LOCUS_19770 2160 2011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 2478 2263 gene locus_tag LOCUS_19780 2478 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 3174 3836 gene locus_tag LOCUS_19790 3174 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 >Feature sequence0502 1098 2141 gene locus_tag LOCUS_19800 1098 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 2405 3442 gene locus_tag LOCUS_19810 gene fni 2405 3442 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence0503 820 431 gene locus_tag LOCUS_19820 820 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 984 865 gene locus_tag LOCUS_19830 984 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 2251 995 gene locus_tag LOCUS_19840 2251 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2948 2286 gene locus_tag LOCUS_19850 2948 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 3326 2967 gene locus_tag LOCUS_19860 3326 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19860 >Feature sequence0504 3205 2024 gene locus_tag LOCUS_19870 3205 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 3432 3250 gene locus_tag LOCUS_19880 3432 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence0505 1635 460 gene locus_tag LOCUS_19890 1635 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence0506 731 333 gene locus_tag LOCUS_19900 731 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 1683 1159 gene locus_tag LOCUS_19910 1683 1159 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798827.1 protein_id gnl|my_center|LOCUS_19910 2983 1898 gene locus_tag LOCUS_19920 2983 1898 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887674.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence0507 2160 3455 gene locus_tag LOCUS_19930 2160 3455 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442178.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence0508 324 2414 gene locus_tag LOCUS_19940 gene fusA 324 2414 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071132.1 protein_id gnl|my_center|LOCUS_19940 >Feature sequence0509 1582 146 gene locus_tag LOCUS_19950 1582 146 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766054.1 protein_id gnl|my_center|LOCUS_19950 2484 2209 gene locus_tag LOCUS_19960 2484 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 2946 2722 gene locus_tag LOCUS_19970 2946 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 >Feature sequence0510 1062 757 gene locus_tag LOCUS_19980 1062 757 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_19980 1340 1062 gene locus_tag LOCUS_19990 1340 1062 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529822.1 protein_id gnl|my_center|LOCUS_19990 2105 1446 gene locus_tag LOCUS_20000 2105 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence0511 3345 295 gene locus_tag LOCUS_20010 3345 295 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_20010 >Feature sequence0512 70 1365 gene locus_tag LOCUS_20020 70 1365 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_20020 2004 3500 gene locus_tag LOCUS_20030 2004 3500 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056673.1 protein_id gnl|my_center|LOCUS_20030 >Feature sequence0513 <1 1454 gene locus_tag LOCUS_20040 <1 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144225.1:B12-binding domain-containing radical SAM protein 2917 2315 gene locus_tag LOCUS_20050 2917 2315 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366888.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0514 1583 408 gene locus_tag LOCUS_20060 1583 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 2635 1673 gene locus_tag LOCUS_20070 2635 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 <3808 3222 gene locus_tag LOCUS_20080 <3808 3222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence0515 137 1579 gene locus_tag LOCUS_20090 137 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 2556 2993 gene locus_tag LOCUS_20100 2556 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 >Feature sequence0516 <1 2312 gene locus_tag LOCUS_20110 <1 2312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence0517 584 246 gene locus_tag LOCUS_20120 584 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 954 3377 gene locus_tag LOCUS_20130 954 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 >Feature sequence0518 63 239 gene locus_tag LOCUS_20140 63 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 2218 1076 gene locus_tag LOCUS_20150 2218 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 <3799 3184 gene locus_tag LOCUS_20160 <3799 3184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124684.1:S1 RNA-binding domain-containing protein >Feature sequence0519 1679 3478 gene locus_tag LOCUS_20170 1679 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 >Feature sequence0520 <1 3640 gene locus_tag LOCUS_20180 <1 3640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920715.1:methyl-accepting chemotaxis protein >Feature sequence0521 218 409 gene locus_tag LOCUS_20190 218 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 <3793 887 gene locus_tag LOCUS_20200 <3793 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022007.1:PAS domain-containing protein >Feature sequence0522 202 834 gene locus_tag LOCUS_20210 202 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 887 1624 gene locus_tag LOCUS_20220 887 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20220 1784 2530 gene locus_tag LOCUS_20230 1784 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20230 3522 2809 gene locus_tag LOCUS_20240 3522 2809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 >Feature sequence0523 55 1293 gene locus_tag LOCUS_20250 55 1293 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_20250 1846 1337 gene locus_tag LOCUS_20260 1846 1337 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921201.1 protein_id gnl|my_center|LOCUS_20260 2667 2278 gene locus_tag LOCUS_20270 2667 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 <3790 3075 gene locus_tag LOCUS_20280 <3790 3075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001291001.1:CHASE2 domain-containing protein >Feature sequence0524 1211 198 gene locus_tag LOCUS_20290 1211 198 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_20290 2433 1468 gene locus_tag LOCUS_20300 gene hemE 2433 1468 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_20300 3206 2646 gene locus_tag LOCUS_20310 3206 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 <3787 3249 gene locus_tag LOCUS_20320 <3787 3249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057978.1:DUF429 domain-containing protein >Feature sequence0525 2924 9 gene locus_tag LOCUS_20330 2924 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 >Feature sequence0526 462 923 gene locus_tag LOCUS_20340 462 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797617.1 protein_id gnl|my_center|LOCUS_20340 1008 1895 gene locus_tag LOCUS_20350 1008 1895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_20350 1917 2339 gene locus_tag LOCUS_20360 1917 2339 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799827.1 protein_id gnl|my_center|LOCUS_20360 3481 2711 gene locus_tag LOCUS_20370 3481 2711 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142238.1 protein_id gnl|my_center|LOCUS_20370 >Feature sequence0527 488 27 gene locus_tag LOCUS_20380 488 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 720 1475 gene locus_tag LOCUS_20390 720 1475 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920693.1 protein_id gnl|my_center|LOCUS_20390 2174 3577 gene locus_tag LOCUS_20400 2174 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 >Feature sequence0528 5 964 gene locus_tag LOCUS_20410 5 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 1227 1502 gene locus_tag LOCUS_20420 1227 1502 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_20420 1815 1982 gene locus_tag LOCUS_20430 1815 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2967 2206 gene locus_tag LOCUS_20440 2967 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 <3771 3210 gene locus_tag LOCUS_20450 <3771 3210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143183.1:pentapeptide repeat-containing protein >Feature sequence0529 1339 995 gene locus_tag LOCUS_20460 1339 995 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_20460 2283 1882 gene locus_tag LOCUS_20470 gene petE 2283 1882 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_20470 2509 2931 gene locus_tag LOCUS_20480 2509 2931 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140769.1 protein_id gnl|my_center|LOCUS_20480 >Feature sequence0530 997 635 gene locus_tag LOCUS_20490 997 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 2682 2092 gene locus_tag LOCUS_20500 2682 2092 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_20500 >Feature sequence0531 766 449 gene locus_tag LOCUS_20510 766 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 1672 1247 gene locus_tag LOCUS_20520 1672 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20520 1856 1662 gene locus_tag LOCUS_20530 1856 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 3334 2849 gene locus_tag LOCUS_20540 3334 2849 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058236.1 protein_id gnl|my_center|LOCUS_20540 >Feature sequence0532 1372 227 gene locus_tag LOCUS_20550 gene dprA 1372 227 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_20550 2188 3135 gene locus_tag LOCUS_20560 2188 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 >Feature sequence0533 238 930 gene locus_tag LOCUS_20570 238 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 1665 1838 gene locus_tag LOCUS_20580 1665 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 2093 3511 gene locus_tag LOCUS_20590 2093 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 >Feature sequence0534 185 2341 gene locus_tag LOCUS_20600 185 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3020 2631 gene locus_tag LOCUS_20610 3020 2631 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140146.1 protein_id gnl|my_center|LOCUS_20610 3110 3649 gene locus_tag LOCUS_20620 3110 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 >Feature sequence0535 1689 2495 gene locus_tag LOCUS_20630 1689 2495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 3090 2761 gene locus_tag LOCUS_20640 3090 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3289 3498 gene locus_tag LOCUS_20650 3289 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 >Feature sequence0536 1176 565 gene locus_tag LOCUS_20660 1176 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2134 1538 gene locus_tag LOCUS_20670 2134 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2280 3476 gene locus_tag LOCUS_20680 2280 3476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 >Feature sequence0537 1605 1291 gene locus_tag LOCUS_20690 1605 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 2428 1991 gene locus_tag LOCUS_20700 2428 1991 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057581.1 protein_id gnl|my_center|LOCUS_20700 3268 2783 gene locus_tag LOCUS_20710 3268 2783 CDS product TIGR02652 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058200.1 protein_id gnl|my_center|LOCUS_20710 >Feature sequence0538 874 2370 gene locus_tag LOCUS_20720 874 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2690 2998 gene locus_tag LOCUS_20730 2690 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3020 3331 gene locus_tag LOCUS_20740 3020 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3372 3521 gene locus_tag LOCUS_20750 3372 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 >Feature sequence0539 1357 218 gene locus_tag LOCUS_20760 1357 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 1527 1608 gene locus_tag LOCUS_t00240 1527 1608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <3753 2519 gene locus_tag LOCUS_20770 <3753 2519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057509.1:anthranilate synthase component I >Feature sequence0540 27 413 gene locus_tag LOCUS_20780 27 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20780 388 831 gene locus_tag LOCUS_20790 388 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_20790 990 2339 gene locus_tag LOCUS_20800 gene lysA 990 2339 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057598.1 protein_id gnl|my_center|LOCUS_20800 >Feature sequence0541 <1 975 gene locus_tag LOCUS_20810 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056632.1:tetratricopeptide repeat protein 1478 1047 gene locus_tag LOCUS_20820 1478 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 1949 2578 gene locus_tag LOCUS_20830 1949 2578 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125221.1 protein_id gnl|my_center|LOCUS_20830 2893 2681 gene locus_tag LOCUS_20840 2893 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20840 3100 2897 gene locus_tag LOCUS_20850 3100 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20850 >Feature sequence0542 427 954 gene locus_tag LOCUS_20860 gene hoxE 427 954 CDS product bidirectional hydrogenase complex protein HoxE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257070.1 protein_id gnl|my_center|LOCUS_20860 1581 3200 gene locus_tag LOCUS_20870 1581 3200 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257071.1 protein_id gnl|my_center|LOCUS_20870 >Feature sequence0543 2194 3537 gene locus_tag LOCUS_20880 gene aroB 2194 3537 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262699.1 protein_id gnl|my_center|LOCUS_20880 >Feature sequence0544 1192 482 gene locus_tag LOCUS_20890 1192 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 2314 1700 gene locus_tag LOCUS_20900 2314 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 3159 2365 gene locus_tag LOCUS_20910 3159 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 3711 3292 gene locus_tag LOCUS_20920 3711 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence0545 <1 1283 gene locus_tag LOCUS_20930 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein 1409 1624 gene locus_tag LOCUS_20940 1409 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 2282 1965 gene locus_tag LOCUS_20950 2282 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 3468 2800 gene locus_tag LOCUS_20960 3468 2800 CDS product DUF3747 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920952.1 protein_id gnl|my_center|LOCUS_20960 >Feature sequence0546 1458 2267 gene locus_tag LOCUS_20970 1458 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3221 2490 gene locus_tag LOCUS_20980 3221 2490 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444002.1 protein_id gnl|my_center|LOCUS_20980 3421 3630 gene locus_tag LOCUS_20990 3421 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 >Feature sequence0547 1557 352 gene locus_tag LOCUS_21000 1557 352 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140500.1 protein_id gnl|my_center|LOCUS_21000 2322 1771 gene locus_tag LOCUS_21010 2322 1771 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909489.1 protein_id gnl|my_center|LOCUS_21010 2825 2989 gene locus_tag LOCUS_21020 2825 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 <3726 3061 gene locus_tag LOCUS_21030 <3726 3061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056822.1:methionine adenosyltransferase >Feature sequence0548 <1 633 gene locus_tag LOCUS_21040 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057921.1:DUF58 domain-containing protein 1123 1434 gene locus_tag LOCUS_21050 1123 1434 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_21050 1928 2326 gene locus_tag LOCUS_21060 1928 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 2887 2603 gene locus_tag LOCUS_21070 2887 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 >Feature sequence0549 1600 1376 gene locus_tag LOCUS_21080 1600 1376 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_21080 <3721 1887 gene locus_tag LOCUS_21090 <3721 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921151.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence0550 2057 363 gene locus_tag LOCUS_21100 2057 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 3377 2451 gene locus_tag LOCUS_21110 3377 2451 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143217.1 protein_id gnl|my_center|LOCUS_21110 >Feature sequence0551 809 243 gene locus_tag LOCUS_21120 809 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 1496 1236 gene locus_tag LOCUS_21130 1496 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 3629 1920 gene locus_tag LOCUS_21140 gene nadB 3629 1920 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_21140 >Feature sequence0552 1375 2847 gene locus_tag LOCUS_21150 1375 2847 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057573.1 protein_id gnl|my_center|LOCUS_21150 3478 2939 gene locus_tag LOCUS_21160 3478 2939 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122936.1 protein_id gnl|my_center|LOCUS_21160 >Feature sequence0553 67 639 gene locus_tag LOCUS_21170 67 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 692 1714 gene locus_tag LOCUS_21180 692 1714 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_21180 1725 2021 gene locus_tag LOCUS_21190 1725 2021 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929371.1 protein_id gnl|my_center|LOCUS_21190 2817 2281 gene locus_tag LOCUS_21200 2817 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0554 596 718 gene locus_tag LOCUS_21210 596 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 2282 3202 gene locus_tag LOCUS_21220 2282 3202 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920864.1 protein_id gnl|my_center|LOCUS_21220 >Feature sequence0555 1837 560 gene locus_tag LOCUS_21230 gene serS 1837 560 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057392.1 protein_id gnl|my_center|LOCUS_21230 2370 2089 gene locus_tag LOCUS_21240 2370 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 2514 2873 gene locus_tag LOCUS_21250 2514 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 >Feature sequence0556 91 591 gene locus_tag LOCUS_21260 91 591 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384184.1 protein_id gnl|my_center|LOCUS_21260 3509 765 gene locus_tag LOCUS_21270 3509 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 >Feature sequence0557 210 560 gene locus_tag LOCUS_21280 210 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 655 774 gene locus_tag LOCUS_21290 655 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 928 1107 gene locus_tag LOCUS_21300 928 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 1383 1078 gene locus_tag LOCUS_21310 1383 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 2375 1572 gene locus_tag LOCUS_21320 2375 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 3258 2419 gene locus_tag LOCUS_21330 3258 2419 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023395.1 protein_id gnl|my_center|LOCUS_21330 >Feature sequence0558 893 1933 gene locus_tag LOCUS_21340 gene rlmN 893 1933 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_21340 <3692 2346 gene locus_tag LOCUS_21350 <3692 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022528.1:HEAT repeat domain-containing protein >Feature sequence0559 <1 744 gene locus_tag LOCUS_21360 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057741.1:Fe-S cluster assembly ATPase SufC 748 2109 gene locus_tag LOCUS_21370 gene sufD 748 2109 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057742.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence0560 1027 461 gene locus_tag LOCUS_21380 1027 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 1420 1965 gene locus_tag LOCUS_21390 1420 1965 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056276.1 protein_id gnl|my_center|LOCUS_21390 2138 3163 gene locus_tag LOCUS_21400 gene tilS 2138 3163 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057455.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence0561 <1 1715 gene locus_tag LOCUS_21410 <1 1715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143241.1:ParA family protein 2774 2214 gene locus_tag LOCUS_21420 2774 2214 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928679.1 protein_id gnl|my_center|LOCUS_21420 2799 3065 gene locus_tag LOCUS_21430 2799 3065 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence0562 473 192 gene locus_tag LOCUS_21440 473 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 <3678 785 gene locus_tag LOCUS_21450 <3678 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence0563 1286 1098 gene locus_tag LOCUS_21460 1286 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21460 1557 1243 gene locus_tag LOCUS_21470 1557 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21470 2512 1772 gene locus_tag LOCUS_21480 2512 1772 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0564 <1 1060 gene locus_tag LOCUS_21490 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase >Feature sequence0565 1385 516 gene locus_tag LOCUS_21500 1385 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 2134 1454 gene locus_tag LOCUS_21510 2134 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 2797 2261 gene locus_tag LOCUS_21520 2797 2261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 3672 2794 gene locus_tag LOCUS_21530 3672 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 >Feature sequence0566 368 296 gene locus_tag LOCUS_t00250 368 296 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 555 1223 gene locus_tag LOCUS_21540 555 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928626.1 protein_id gnl|my_center|LOCUS_21540 2383 2592 gene locus_tag LOCUS_21550 2383 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21550 2935 3615 gene locus_tag LOCUS_21560 2935 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 >Feature sequence0567 2412 775 gene locus_tag LOCUS_21570 2412 775 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029529.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0568 2813 1077 gene locus_tag LOCUS_21580 2813 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 3178 2837 gene locus_tag LOCUS_21590 3178 2837 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966108.1 protein_id gnl|my_center|LOCUS_21590 3443 3276 gene locus_tag LOCUS_21600 3443 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence0569 596 2707 gene locus_tag LOCUS_21610 596 2707 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence0570 780 1994 gene locus_tag LOCUS_21620 780 1994 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057505.1 protein_id gnl|my_center|LOCUS_21620 2599 2841 gene locus_tag LOCUS_21630 2599 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 >Feature sequence0571 1564 278 gene locus_tag LOCUS_21640 1564 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055996.1 protein_id gnl|my_center|LOCUS_21640 <3663 1853 gene locus_tag LOCUS_21650 <3663 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence0572 <1 830 gene locus_tag LOCUS_21660 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125209.1:DUF4336 domain-containing protein 925 1647 gene locus_tag LOCUS_21670 925 1647 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144387.1 protein_id gnl|my_center|LOCUS_21670 2080 1898 gene locus_tag LOCUS_21680 2080 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2980 2636 gene locus_tag LOCUS_21690 2980 2636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3251 3072 gene locus_tag LOCUS_21700 3251 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0573 2858 1233 gene locus_tag LOCUS_21710 2858 1233 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920921.1 protein_id gnl|my_center|LOCUS_21710 >Feature sequence0574 399 1358 gene locus_tag LOCUS_21720 399 1358 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728642.1 protein_id gnl|my_center|LOCUS_21720 2569 2898 gene locus_tag LOCUS_21730 2569 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21730 >Feature sequence0575 196 726 gene locus_tag LOCUS_21740 196 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21740 >Feature sequence0576 <1 606 gene locus_tag LOCUS_21750 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000503026.1:non-ribosomal peptide synthetase note possible pseudo, frameshifted 603 2168 gene locus_tag LOCUS_21760 603 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21760 2438 3613 gene locus_tag LOCUS_21770 2438 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 >Feature sequence0577 376 1140 gene locus_tag LOCUS_21780 376 1140 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_21780 1744 1574 gene locus_tag LOCUS_21790 1744 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 1984 2574 gene locus_tag LOCUS_21800 1984 2574 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_21800 2781 3536 gene locus_tag LOCUS_21810 2781 3536 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence0578 382 942 gene locus_tag LOCUS_21820 382 942 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125724.1 protein_id gnl|my_center|LOCUS_21820 1735 932 gene locus_tag LOCUS_21830 1735 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144039.1 protein_id gnl|my_center|LOCUS_21830 1978 2823 gene locus_tag LOCUS_21840 1978 2823 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928799.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0579 930 2813 gene locus_tag LOCUS_21850 930 2813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence0580 788 576 gene locus_tag LOCUS_21860 788 576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 1524 1156 gene locus_tag LOCUS_21870 1524 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3255 2176 gene locus_tag LOCUS_21880 3255 2176 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681956.1 protein_id gnl|my_center|LOCUS_21880 >Feature sequence0581 <1 3535 gene locus_tag LOCUS_21890 <1 3535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208353729.1:amino acid adenylation domain-containing protein >Feature sequence0582 <1 1140 gene locus_tag LOCUS_21900 <1 1140 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058142.1:squalene--hopene cyclase 1892 1212 gene locus_tag LOCUS_21910 1892 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 3307 2813 gene locus_tag LOCUS_21920 gene lspA 3307 2813 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140076.1 protein_id gnl|my_center|LOCUS_21920 >Feature sequence0583 170 1888 gene locus_tag LOCUS_21930 170 1888 CDS product tryptophan 7-halogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198349.1 protein_id gnl|my_center|LOCUS_21930 >Feature sequence0584 1124 1924 gene locus_tag LOCUS_21940 1124 1924 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140481.1 protein_id gnl|my_center|LOCUS_21940 1989 2225 gene locus_tag LOCUS_21950 1989 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3486 2551 gene locus_tag LOCUS_21960 3486 2551 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433818.1 protein_id gnl|my_center|LOCUS_21960 >Feature sequence0585 333 130 gene locus_tag LOCUS_21970 333 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21970 819 409 gene locus_tag LOCUS_21980 819 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21980 1496 855 gene locus_tag LOCUS_21990 1496 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 1490 2176 gene locus_tag LOCUS_22000 1490 2176 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_22000 >Feature sequence0586 1083 2081 gene locus_tag LOCUS_22010 gene phnD 1083 2081 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113119.1 protein_id gnl|my_center|LOCUS_22010 2390 2890 gene locus_tag LOCUS_22020 2390 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22020 >Feature sequence0587 801 1859 gene locus_tag LOCUS_22030 801 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 2274 3302 gene locus_tag LOCUS_22040 2274 3302 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928494.1 protein_id gnl|my_center|LOCUS_22040 >Feature sequence0588 2716 260 gene locus_tag LOCUS_22050 2716 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 3002 2929 gene locus_tag LOCUS_t00260 3002 2929 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0589 410 622 gene locus_tag LOCUS_22060 410 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1627 2412 gene locus_tag LOCUS_22070 1627 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence0590 731 2281 gene locus_tag LOCUS_22080 gene radA 731 2281 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_22080 2961 3437 gene locus_tag LOCUS_22090 2961 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 >Feature sequence0591 2513 456 gene locus_tag LOCUS_22100 2513 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 3154 3498 gene locus_tag LOCUS_22110 3154 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143346.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence0592 957 139 gene locus_tag LOCUS_22120 gene proC 957 139 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140706.1 protein_id gnl|my_center|LOCUS_22120 2054 1413 gene locus_tag LOCUS_22130 2054 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 3496 2783 gene locus_tag LOCUS_22140 3496 2783 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence0593 795 1070 gene locus_tag LOCUS_22150 795 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1355 1080 gene locus_tag LOCUS_22160 1355 1080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 2240 2926 gene locus_tag LOCUS_22170 2240 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 >Feature sequence0594 2468 720 gene locus_tag LOCUS_22180 2468 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22180 3174 2926 gene locus_tag LOCUS_22190 3174 2926 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_22190 >Feature sequence0595 2327 690 gene locus_tag LOCUS_22200 2327 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence0596 2308 3165 gene locus_tag LOCUS_22210 2308 3165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 3146 3379 gene locus_tag LOCUS_22220 3146 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0597 365 1228 gene locus_tag LOCUS_22230 365 1228 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003692220.1 protein_id gnl|my_center|LOCUS_22230 <3598 2485 gene locus_tag LOCUS_22240 <3598 2485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057931.1:D-alanyl-D-alanine carboxypeptidase >Feature sequence0598 <1 2087 gene locus_tag LOCUS_22250 <1 2087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973240.1:thioester reductase domain-containing protein 2306 2064 gene locus_tag LOCUS_22260 2306 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 2678 2502 gene locus_tag LOCUS_22270 2678 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 3326 3003 gene locus_tag LOCUS_22280 3326 3003 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_22280 >Feature sequence0599 1112 93 gene locus_tag LOCUS_22290 1112 93 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920628.1 protein_id gnl|my_center|LOCUS_22290 1573 2835 gene locus_tag LOCUS_22300 1573 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 2845 3003 gene locus_tag LOCUS_22310 2845 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 >Feature sequence0600 2674 1757 gene locus_tag LOCUS_22320 2674 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 3110 2685 gene locus_tag LOCUS_22330 3110 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence0601 189 1493 gene locus_tag LOCUS_22340 189 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 1626 1817 gene locus_tag LOCUS_22350 1626 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22350 2406 2768 gene locus_tag LOCUS_22360 2406 2768 CDS product STAS/SEC14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021993.1 protein_id gnl|my_center|LOCUS_22360 3386 3057 gene locus_tag LOCUS_22370 3386 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0602 1354 401 gene locus_tag LOCUS_22380 1354 401 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233159.1 protein_id gnl|my_center|LOCUS_22380 <3571 1526 gene locus_tag LOCUS_22390 <3571 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144873981.1:TonB-dependent siderophore receptor >Feature sequence0603 3249 1855 gene locus_tag LOCUS_22400 3249 1855 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057470.1 protein_id gnl|my_center|LOCUS_22400 >Feature sequence0604 464 880 gene locus_tag LOCUS_22410 464 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 1843 2898 gene locus_tag LOCUS_22420 1843 2898 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence0605 3559 326 gene locus_tag LOCUS_22430 3559 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 >Feature sequence0606 3177 2647 gene locus_tag LOCUS_22440 3177 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence0607 2091 598 gene locus_tag LOCUS_22450 2091 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 <3561 2264 gene locus_tag LOCUS_22460 <3561 2264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010886437.1:rhamnogalacturonan exolyase >Feature sequence0608 43 471 gene locus_tag LOCUS_22470 43 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 740 901 gene locus_tag LOCUS_22480 740 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 1199 1639 gene locus_tag LOCUS_22490 1199 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 >Feature sequence0609 2282 807 gene locus_tag LOCUS_22500 2282 807 CDS product alanine/glycine:cation symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_189099273.1 protein_id gnl|my_center|LOCUS_22500 >Feature sequence0610 454 1098 gene locus_tag LOCUS_22510 454 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 1899 2069 gene locus_tag LOCUS_22520 1899 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 2806 2525 gene locus_tag LOCUS_22530 2806 2525 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929371.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence0611 454 167 gene locus_tag LOCUS_22540 454 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 636 439 gene locus_tag LOCUS_22550 636 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 <3558 1746 gene locus_tag LOCUS_22560 <3558 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_216087114.1:threonine--tRNA ligase >Feature sequence0612 590 1267 gene locus_tag LOCUS_22570 590 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1748 2668 gene locus_tag LOCUS_22580 gene moaA 1748 2668 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143017.1 protein_id gnl|my_center|LOCUS_22580 >Feature sequence0613 1596 2552 gene locus_tag LOCUS_22590 gene acsF 1596 2552 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057559.1 protein_id gnl|my_center|LOCUS_22590 <3547 2654 gene locus_tag LOCUS_22600 <3547 2654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057880.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence0614 180 698 gene locus_tag LOCUS_22610 gene pgsA 180 698 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140305.1 protein_id gnl|my_center|LOCUS_22610 1377 3305 gene locus_tag LOCUS_22620 1377 3305 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140600.1 protein_id gnl|my_center|LOCUS_22620 >Feature sequence0615 52 3003 gene locus_tag LOCUS_22630 52 3003 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208353729.1 protein_id gnl|my_center|LOCUS_22630 3008 3496 gene locus_tag LOCUS_22640 3008 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence0616 542 81 gene locus_tag LOCUS_22650 542 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2260 872 gene locus_tag LOCUS_22660 2260 872 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_22660 3397 2954 gene locus_tag LOCUS_22670 3397 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 >Feature sequence0617 1716 376 gene locus_tag LOCUS_22680 1716 376 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003415988.1 protein_id gnl|my_center|LOCUS_22680 3089 1809 gene locus_tag LOCUS_22690 3089 1809 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946627.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0618 1486 227 gene locus_tag LOCUS_22700 1486 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458963.1 protein_id gnl|my_center|LOCUS_22700 2682 3368 gene locus_tag LOCUS_22710 gene bchM 2682 3368 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056304.1 protein_id gnl|my_center|LOCUS_22710 >Feature sequence0619 474 2141 gene locus_tag LOCUS_22720 474 2141 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056162.1 protein_id gnl|my_center|LOCUS_22720 2584 2721 gene locus_tag LOCUS_22730 2584 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 2786 3439 gene locus_tag LOCUS_22740 2786 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence0620 436 89 gene locus_tag LOCUS_22750 436 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 614 3106 gene locus_tag LOCUS_22760 614 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 >Feature sequence0621 2381 1683 gene locus_tag LOCUS_22770 2381 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 >Feature sequence0622 623 210 gene locus_tag LOCUS_22780 623 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 3189 1498 gene locus_tag LOCUS_22790 3189 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence0623 3039 2596 gene locus_tag LOCUS_22800 3039 2596 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence0624 635 2782 gene locus_tag LOCUS_22810 635 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 >Feature sequence0625 <1 734 gene locus_tag LOCUS_22820 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065428.1:SIR2 family protein 2640 787 gene locus_tag LOCUS_22830 2640 787 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012407872.1 protein_id gnl|my_center|LOCUS_22830 <3507 2943 gene locus_tag LOCUS_22840 <3507 2943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022506.1:HEAT repeat domain-containing protein >Feature sequence0626 1499 609 gene locus_tag LOCUS_22850 1499 609 CDS product MnmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920906.1 protein_id gnl|my_center|LOCUS_22850 1543 2802 gene locus_tag LOCUS_22860 1543 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence0627 146 1027 gene locus_tag LOCUS_22870 gene fabD 146 1027 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920631.1 protein_id gnl|my_center|LOCUS_22870 1085 1324 gene locus_tag LOCUS_22880 1085 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 1431 2003 gene locus_tag LOCUS_22890 1431 2003 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_22890 2047 2481 gene locus_tag LOCUS_22900 2047 2481 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143885.1 protein_id gnl|my_center|LOCUS_22900 2493 2942 gene locus_tag LOCUS_22910 2493 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 >Feature sequence0628 386 189 gene locus_tag LOCUS_22920 386 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1707 928 gene locus_tag LOCUS_22930 1707 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 2907 1975 gene locus_tag LOCUS_22940 2907 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 >Feature sequence0629 <1 3503 gene locus_tag LOCUS_22950 <1 3503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390546.1:glycosyltransferase >Feature sequence0630 596 1393 gene locus_tag LOCUS_22960 596 1393 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_22960 2691 2173 gene locus_tag LOCUS_22970 2691 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 >Feature sequence0631 454 999 gene locus_tag LOCUS_22980 454 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 1169 1645 gene locus_tag LOCUS_22990 1169 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 2810 2445 gene locus_tag LOCUS_23000 2810 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 >Feature sequence0632 954 2822 gene locus_tag LOCUS_23010 954 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 >Feature sequence0633 <3501 932 gene locus_tag LOCUS_23020 <3501 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009936446.1:class I SAM-dependent methyltransferase >Feature sequence0634 1823 864 gene locus_tag LOCUS_23030 1823 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 3204 2599 gene locus_tag LOCUS_23040 3204 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 >Feature sequence0635 1032 220 gene locus_tag LOCUS_23050 1032 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 2831 1920 gene locus_tag LOCUS_23060 2831 1920 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057997.1 protein_id gnl|my_center|LOCUS_23060 >Feature sequence0636 <1 825 gene locus_tag LOCUS_23070 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056318.1:TIGR01777 family oxidoreductase 1291 1073 gene locus_tag LOCUS_23080 1291 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 2691 2269 gene locus_tag LOCUS_23090 2691 2269 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_23090 3259 2903 gene locus_tag LOCUS_23100 3259 2903 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence0637 1434 187 gene locus_tag LOCUS_23110 1434 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 2901 2215 gene locus_tag LOCUS_23120 2901 2215 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920873.1 protein_id gnl|my_center|LOCUS_23120 >Feature sequence0638 2952 1267 gene locus_tag LOCUS_23130 2952 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23130 >Feature sequence0639 2630 1413 gene locus_tag LOCUS_23140 gene alr 2630 1413 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_23140 >Feature sequence0640 203 934 gene locus_tag LOCUS_23150 203 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 958 1338 gene locus_tag LOCUS_23160 958 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 1415 3166 gene locus_tag LOCUS_23170 1415 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence0641 563 144 gene locus_tag LOCUS_23180 563 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1045 2508 gene locus_tag LOCUS_23190 gene dacB 1045 2508 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057215.1 protein_id gnl|my_center|LOCUS_23190 >Feature sequence0642 <1 1718 gene locus_tag LOCUS_23200 <1 1718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143485742.1:ATP-dependent helicase 2495 1917 gene locus_tag LOCUS_23210 2495 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 2740 2564 gene locus_tag LOCUS_23220 2740 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 2729 3070 gene locus_tag LOCUS_23230 2729 3070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 3396 3208 gene locus_tag LOCUS_23240 3396 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence0643 741 1280 gene locus_tag LOCUS_23250 741 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 1582 1283 gene locus_tag LOCUS_23260 1582 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 2167 2598 gene locus_tag LOCUS_23270 gene rbfA 2167 2598 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057468.1 protein_id gnl|my_center|LOCUS_23270 >Feature sequence0644 1632 1862 gene locus_tag LOCUS_23280 1632 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 2696 1914 gene locus_tag LOCUS_23290 2696 1914 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921210.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence0645 260 787 gene locus_tag LOCUS_23300 260 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 793 2073 gene locus_tag LOCUS_23310 793 2073 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948836.1 protein_id gnl|my_center|LOCUS_23310 2857 2531 gene locus_tag LOCUS_23320 2857 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence0646 <1 1830 gene locus_tag LOCUS_23330 <1 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057958.1:NAD(P)H-quinone oxidoreductase subunit F >Feature sequence0647 <3465 2346 gene locus_tag LOCUS_23340 <3465 2346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001292843.1:class I SAM-dependent methyltransferase >Feature sequence0648 <1 610 gene locus_tag LOCUS_23350 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141510.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase 1395 967 gene locus_tag LOCUS_23360 1395 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 2019 1627 gene locus_tag LOCUS_23370 gene dndE 2019 1627 CDS product DNA sulfur modification protein DndE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296384.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence0649 748 134 gene locus_tag LOCUS_23380 748 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 2118 733 gene locus_tag LOCUS_23390 2118 733 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_23390 2578 2177 gene locus_tag LOCUS_23400 2578 2177 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920821.1 protein_id gnl|my_center|LOCUS_23400 2726 3304 gene locus_tag LOCUS_23410 2726 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057012.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence0650 216 494 gene locus_tag LOCUS_23420 216 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 542 745 gene locus_tag LOCUS_23430 542 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 1413 2510 gene locus_tag LOCUS_23440 1413 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 >Feature sequence0651 1768 1124 gene locus_tag LOCUS_23450 1768 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 2200 2811 gene locus_tag LOCUS_23460 2200 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 3449 3120 gene locus_tag LOCUS_23470 3449 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 >Feature sequence0652 1170 181 gene locus_tag LOCUS_23480 1170 181 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068986.1 protein_id gnl|my_center|LOCUS_23480 2194 1262 gene locus_tag LOCUS_23490 2194 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 >Feature sequence0653 <3450 1358 gene locus_tag LOCUS_23500 <3450 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence0654 1883 2194 gene locus_tag LOCUS_23510 1883 2194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3143 2292 gene locus_tag LOCUS_23520 3143 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0655 2462 2076 gene locus_tag LOCUS_23530 2462 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 >Feature sequence0656 814 287 gene locus_tag LOCUS_23540 814 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 1087 821 gene locus_tag LOCUS_23550 1087 821 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_23550 <3443 2095 gene locus_tag LOCUS_23560 <3443 2095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257074.1:Ni/Fe hydrogenase subunit alpha >Feature sequence0657 1648 296 gene locus_tag LOCUS_23570 1648 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 >Feature sequence0658 752 2356 gene locus_tag LOCUS_23580 gene metG 752 2356 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056597.1 protein_id gnl|my_center|LOCUS_23580 2475 3089 gene locus_tag LOCUS_23590 2475 3089 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056598.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence0659 566 1156 gene locus_tag LOCUS_23600 566 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 1993 1220 gene locus_tag LOCUS_23610 gene cysE 1993 1220 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0660 684 1097 gene locus_tag LOCUS_23620 684 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1543 1211 gene locus_tag LOCUS_23630 1543 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 2134 1718 gene locus_tag LOCUS_23640 2134 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2567 2127 gene locus_tag LOCUS_23650 2567 2127 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695998.1 protein_id gnl|my_center|LOCUS_23650 >Feature sequence0661 1114 1443 gene locus_tag LOCUS_23660 1114 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 <3433 1887 gene locus_tag LOCUS_23670 <3433 1887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056566.1:photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 >Feature sequence0662 3155 420 gene locus_tag LOCUS_23680 3155 420 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057343.1 protein_id gnl|my_center|LOCUS_23680 >Feature sequence0663 1610 1191 gene locus_tag LOCUS_23690 1610 1191 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_23690 1922 2365 gene locus_tag LOCUS_23700 1922 2365 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_23700 >Feature sequence0664 <1 606 gene locus_tag LOCUS_23710 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056213.1:3-deoxy-7-phosphoheptulonate synthase 1941 826 gene locus_tag LOCUS_23720 1941 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence0665 466 101 gene locus_tag LOCUS_23730 466 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 625 488 gene locus_tag LOCUS_23740 625 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 1271 636 gene locus_tag LOCUS_23750 1271 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 <3423 1732 gene locus_tag LOCUS_23760 <3423 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224463.1:glycogen debranching protein GlgX >Feature sequence0666 1204 257 gene locus_tag LOCUS_23770 1204 257 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057378.1 protein_id gnl|my_center|LOCUS_23770 1310 2389 gene locus_tag LOCUS_23780 1310 2389 CDS product DUF3616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141362.1 protein_id gnl|my_center|LOCUS_23780 2415 2549 gene locus_tag LOCUS_23790 2415 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence0667 537 109 gene locus_tag LOCUS_23800 537 109 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_23800 1184 1513 gene locus_tag LOCUS_23810 1184 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 <3422 1523 gene locus_tag LOCUS_23820 <3422 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057496.1:DICT sensory domain-containing protein >Feature sequence0668 <1 1813 gene locus_tag LOCUS_23830 <1 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057891.1:trans-splicing intein-formed DNA polymerase III subunit alpha N-terminal partner DnaE-N 1789 2571 gene locus_tag LOCUS_23840 1789 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence0669 2992 1199 gene locus_tag LOCUS_23850 2992 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 >Feature sequence0670 398 3 gene locus_tag LOCUS_23860 398 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 1384 428 gene locus_tag LOCUS_23870 1384 428 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124394.1 protein_id gnl|my_center|LOCUS_23870 2326 1775 gene locus_tag LOCUS_23880 2326 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 2990 3286 gene locus_tag LOCUS_23890 2990 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 >Feature sequence0671 916 1980 gene locus_tag LOCUS_23900 916 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 3030 2050 gene locus_tag LOCUS_23910 3030 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 >Feature sequence0672 1933 143 gene locus_tag LOCUS_23920 gene typA 1933 143 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058116.1 protein_id gnl|my_center|LOCUS_23920 2526 2981 gene locus_tag LOCUS_23930 2526 2981 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015159351.1 protein_id gnl|my_center|LOCUS_23930 >Feature sequence0673 125 349 gene locus_tag LOCUS_23940 125 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 <3412 1612 gene locus_tag LOCUS_23950 <3412 1612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929118.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0674 1314 1925 gene locus_tag LOCUS_23960 1314 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 2714 3214 gene locus_tag LOCUS_23970 2714 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 >Feature sequence0675 2223 1105 gene locus_tag LOCUS_23980 2223 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 <3408 2705 gene locus_tag LOCUS_23990 <3408 2705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441295.1:4-hydroxybenzoate 3-monooxygenase >Feature sequence0676 970 29 gene locus_tag LOCUS_24000 gene rlmB 970 29 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056885.1 protein_id gnl|my_center|LOCUS_24000 1476 1054 gene locus_tag LOCUS_24010 1476 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 2182 1898 gene locus_tag LOCUS_24020 2182 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 <3406 2491 gene locus_tag LOCUS_24030 <3406 2491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056605.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence0677 792 1499 gene locus_tag LOCUS_24040 gene cysE 792 1499 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_24040 2139 1531 gene locus_tag LOCUS_24050 2139 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 3326 2424 gene locus_tag LOCUS_24060 3326 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence0678 819 1070 gene locus_tag LOCUS_24070 819 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1161 1781 gene locus_tag LOCUS_24080 1161 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 1785 2144 gene locus_tag LOCUS_24090 1785 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 >Feature sequence0679 229 2 gene locus_tag LOCUS_24100 229 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1660 233 gene locus_tag LOCUS_24110 1660 233 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096456532.1 protein_id gnl|my_center|LOCUS_24110 1908 2489 gene locus_tag LOCUS_24120 gene cysC 1908 2489 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256588.1 protein_id gnl|my_center|LOCUS_24120 >Feature sequence0680 806 2098 gene locus_tag LOCUS_24130 gene sbcD 806 2098 CDS product exonuclease subunit SbcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057812.1 protein_id gnl|my_center|LOCUS_24130 3176 2436 gene locus_tag LOCUS_24140 3176 2436 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056437.1 protein_id gnl|my_center|LOCUS_24140 >Feature sequence0681 <3403 2071 gene locus_tag LOCUS_24150 <3403 2071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190897490.1:glycosyltransferase family 61 protein >Feature sequence0682 186 1163 gene locus_tag LOCUS_24160 186 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 1777 2130 gene locus_tag LOCUS_24170 1777 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 2152 2322 gene locus_tag LOCUS_24180 2152 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 2477 3265 gene locus_tag LOCUS_24190 2477 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 >Feature sequence0683 1829 1116 gene locus_tag LOCUS_24200 1829 1116 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143593.1 protein_id gnl|my_center|LOCUS_24200 2249 2755 gene locus_tag LOCUS_24210 2249 2755 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence0684 776 567 gene locus_tag LOCUS_24220 776 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 1162 1575 gene locus_tag LOCUS_24230 1162 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 3290 1932 gene locus_tag LOCUS_24240 3290 1932 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140772.1 protein_id gnl|my_center|LOCUS_24240 >Feature sequence0685 1029 169 gene locus_tag LOCUS_24250 1029 169 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142163.1 protein_id gnl|my_center|LOCUS_24250 2603 1689 gene locus_tag LOCUS_24260 2603 1689 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_24260 >Feature sequence0686 1469 120 gene locus_tag LOCUS_24270 1469 120 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056064.1 protein_id gnl|my_center|LOCUS_24270 1961 2248 gene locus_tag LOCUS_24280 1961 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 >Feature sequence0687 537 241 gene locus_tag LOCUS_24290 537 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 592 1005 gene locus_tag LOCUS_24300 592 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 1099 1362 gene locus_tag LOCUS_24310 1099 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 1405 1707 gene locus_tag LOCUS_24320 1405 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1867 3264 gene locus_tag LOCUS_24330 1867 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence0688 256 1293 gene locus_tag LOCUS_24340 256 1293 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_24340 2013 3332 gene locus_tag LOCUS_24350 2013 3332 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058123.1 protein_id gnl|my_center|LOCUS_24350 >Feature sequence0689 1117 134 gene locus_tag LOCUS_24360 1117 134 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397112.1 protein_id gnl|my_center|LOCUS_24360 2234 1545 gene locus_tag LOCUS_24370 2234 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 >Feature sequence0690 741 472 gene locus_tag LOCUS_24380 741 472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 909 2264 gene locus_tag LOCUS_24390 909 2264 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404998.1 protein_id gnl|my_center|LOCUS_24390 2261 2914 gene locus_tag LOCUS_24400 2261 2914 CDS product TIGR02646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266385.1 protein_id gnl|my_center|LOCUS_24400 >Feature sequence0691 468 1571 gene locus_tag LOCUS_24410 gene thiO 468 1571 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921239.1 protein_id gnl|my_center|LOCUS_24410 3139 3318 gene locus_tag LOCUS_24420 3139 3318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence0692 2014 797 gene locus_tag LOCUS_24430 2014 797 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142821.1 protein_id gnl|my_center|LOCUS_24430 2519 2007 gene locus_tag LOCUS_24440 2519 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 >Feature sequence0693 329 967 gene locus_tag LOCUS_24450 gene fsa 329 967 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_24450 1108 1524 gene locus_tag LOCUS_24460 1108 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 1512 1841 gene locus_tag LOCUS_24470 1512 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 2397 2002 gene locus_tag LOCUS_24480 2397 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24480 3326 2754 gene locus_tag LOCUS_24490 gene terD 3326 2754 CDS product tellurium resistance membrane protein TerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116677.1 protein_id gnl|my_center|LOCUS_24490 >Feature sequence0694 736 2262 gene locus_tag LOCUS_24500 736 2262 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142080.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence0695 <1 793 gene locus_tag LOCUS_24510 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455892.1:diguanylate cyclase 790 2556 gene locus_tag LOCUS_24520 790 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 2947 2588 gene locus_tag LOCUS_24530 2947 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 3182 2937 gene locus_tag LOCUS_24540 3182 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 >Feature sequence0696 570 253 gene locus_tag LOCUS_24550 570 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 2013 955 gene locus_tag LOCUS_24560 2013 955 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_24560 >Feature sequence0697 <1 1610 gene locus_tag LOCUS_24570 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208353729.1:amino acid adenylation domain-containing protein 2057 3094 gene locus_tag LOCUS_24580 2057 3094 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_24580 >Feature sequence0698 1006 1587 gene locus_tag LOCUS_24590 1006 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 2726 2142 gene locus_tag LOCUS_24600 2726 2142 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_24600 >Feature sequence0699 362 1186 gene locus_tag LOCUS_24610 362 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 1212 2276 gene locus_tag LOCUS_24620 1212 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24620 2475 2405 gene locus_tag LOCUS_t00270 2475 2405 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2953 2498 gene locus_tag LOCUS_24630 2953 2498 CDS product NADAR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058296.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence0700 901 260 gene locus_tag LOCUS_24640 901 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1448 2881 gene locus_tag LOCUS_24650 1448 2881 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence0701 654 520 gene locus_tag LOCUS_24660 654 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 3083 2721 gene locus_tag LOCUS_24670 3083 2721 CDS product Lin0512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086800.1 protein_id gnl|my_center|LOCUS_24670 >Feature sequence0702 245 18 gene locus_tag LOCUS_24680 245 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 874 518 gene locus_tag LOCUS_24690 gene mazF6 874 518 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410010.1 protein_id gnl|my_center|LOCUS_24690 1122 868 gene locus_tag LOCUS_24700 1122 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 1872 3323 gene locus_tag LOCUS_24710 1872 3323 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_24710 >Feature sequence0703 1191 274 gene locus_tag LOCUS_24720 1191 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 <3362 1481 gene locus_tag LOCUS_24730 <3362 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044205562.1:CHAT domain-containing protein >Feature sequence0704 1556 762 gene locus_tag LOCUS_24740 gene pstB 1556 762 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_24740 2494 1550 gene locus_tag LOCUS_24750 gene pstA 2494 1550 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence0705 276 97 gene locus_tag LOCUS_24760 276 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 788 561 gene locus_tag LOCUS_24770 788 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1072 851 gene locus_tag LOCUS_24780 1072 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1348 1175 gene locus_tag LOCUS_24790 1348 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 1798 2166 gene locus_tag LOCUS_24800 1798 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence0706 2753 429 gene locus_tag LOCUS_24810 gene selD 2753 429 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891662.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence0707 978 1217 gene locus_tag LOCUS_24820 978 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 1309 2580 gene locus_tag LOCUS_24830 1309 2580 CDS product 2-deoxy-scyllo-inosose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986649.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence0708 562 1770 gene locus_tag LOCUS_24840 562 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 2111 2359 gene locus_tag LOCUS_24850 2111 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2432 3022 gene locus_tag LOCUS_24860 2432 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 >Feature sequence0709 <1 507 gene locus_tag LOCUS_24870 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057861.1:phosphotransacetylase family protein 679 1182 gene locus_tag LOCUS_24880 679 1182 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920769.1 protein_id gnl|my_center|LOCUS_24880 1189 1608 gene locus_tag LOCUS_24890 1189 1608 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056937.1 protein_id gnl|my_center|LOCUS_24890 1651 2142 gene locus_tag LOCUS_24900 1651 2142 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056636.1 protein_id gnl|my_center|LOCUS_24900 3099 2200 gene locus_tag LOCUS_24910 3099 2200 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017012.1 protein_id gnl|my_center|LOCUS_24910 >Feature sequence0710 86 427 gene locus_tag LOCUS_24920 86 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 432 686 gene locus_tag LOCUS_24930 432 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 794 1342 gene locus_tag LOCUS_24940 794 1342 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259197.1 protein_id gnl|my_center|LOCUS_24940 1333 1881 gene locus_tag LOCUS_24950 1333 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2215 2127 gene locus_tag LOCUS_t00280 2215 2127 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2691 3059 gene locus_tag LOCUS_24960 2691 3059 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_24960 >Feature sequence0711 273 1238 gene locus_tag LOCUS_24970 273 1238 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057897.1 protein_id gnl|my_center|LOCUS_24970 1235 1996 gene locus_tag LOCUS_24980 1235 1996 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057898.1 protein_id gnl|my_center|LOCUS_24980 2329 3147 gene locus_tag LOCUS_24990 2329 3147 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056352.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence0712 426 262 gene locus_tag LOCUS_25000 426 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 <3344 1108 gene locus_tag LOCUS_25010 <3344 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058103.1:DUF3536 domain-containing protein >Feature sequence0713 2884 1796 gene locus_tag LOCUS_25020 2884 1796 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799067.1 protein_id gnl|my_center|LOCUS_25020 >Feature sequence0714 1199 426 gene locus_tag LOCUS_25030 1199 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058125.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence0715 1145 858 gene locus_tag LOCUS_25040 1145 858 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942007.1 protein_id gnl|my_center|LOCUS_25040 1330 1142 gene locus_tag LOCUS_25050 1330 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 2112 1747 gene locus_tag LOCUS_25060 2112 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 2933 2199 gene locus_tag LOCUS_25070 2933 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence0716 2001 358 gene locus_tag LOCUS_25080 2001 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2507 2196 gene locus_tag LOCUS_25090 2507 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 2781 2491 gene locus_tag LOCUS_25100 2781 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence0717 909 1496 gene locus_tag LOCUS_25110 909 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 1589 2176 gene locus_tag LOCUS_25120 1589 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 2252 2398 gene locus_tag LOCUS_25130 2252 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 2422 2835 gene locus_tag LOCUS_25140 2422 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 2941 3126 gene locus_tag LOCUS_25150 2941 3126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 >Feature sequence0718 1421 21 gene locus_tag LOCUS_25160 1421 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 2923 1508 gene locus_tag LOCUS_25170 2923 1508 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053221433.1 protein_id gnl|my_center|LOCUS_25170 >Feature sequence0719 1258 656 gene locus_tag LOCUS_25180 1258 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 1472 1341 gene locus_tag LOCUS_25190 1472 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 2747 2526 gene locus_tag LOCUS_25200 2747 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25200 3002 2862 gene locus_tag LOCUS_25210 3002 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 >Feature sequence0720 172 444 gene locus_tag LOCUS_25220 172 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 733 978 gene locus_tag LOCUS_25230 733 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 971 1228 gene locus_tag LOCUS_25240 971 1228 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129080272.1 protein_id gnl|my_center|LOCUS_25240 >Feature sequence0721 325 155 gene locus_tag LOCUS_25250 325 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 908 642 gene locus_tag LOCUS_25260 908 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 1597 2484 gene locus_tag LOCUS_25270 gene lipA 1597 2484 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence0722 911 1141 gene locus_tag LOCUS_25280 911 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence0723 1279 2622 gene locus_tag LOCUS_25290 1279 2622 CDS product cytosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531129.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence0724 47 223 gene locus_tag LOCUS_25300 47 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 382 819 gene locus_tag LOCUS_25310 382 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 819 1430 gene locus_tag LOCUS_25320 819 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 1544 2191 gene locus_tag LOCUS_25330 1544 2191 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_25330 2784 2176 gene locus_tag LOCUS_25340 2784 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 >Feature sequence0725 998 93 gene locus_tag LOCUS_25350 998 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 3132 1129 gene locus_tag LOCUS_25360 3132 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 >Feature sequence0726 907 2028 gene locus_tag LOCUS_25370 907 2028 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330337.1 protein_id gnl|my_center|LOCUS_25370 3293 2292 gene locus_tag LOCUS_25380 3293 2292 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_25380 >Feature sequence0727 3221 195 gene locus_tag LOCUS_25390 3221 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence0728 <1 1366 gene locus_tag LOCUS_25400 <1 1366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143057.1:cytochrome P450 2257 1793 gene locus_tag LOCUS_25410 2257 1793 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058205.1 protein_id gnl|my_center|LOCUS_25410 >Feature sequence0729 1003 1731 gene locus_tag LOCUS_25420 gene lptB 1003 1731 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045053120.1 protein_id gnl|my_center|LOCUS_25420 3018 2239 gene locus_tag LOCUS_25430 3018 2239 CDS product PP2C family serine/threonine-protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119062.1 protein_id gnl|my_center|LOCUS_25430 >Feature sequence0730 <1 1844 gene locus_tag LOCUS_25440 <1 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056407.1:ABC transporter ATP-binding protein >Feature sequence0731 1029 655 gene locus_tag LOCUS_25450 1029 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1361 3142 gene locus_tag LOCUS_25460 1361 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 >Feature sequence0732 482 1114 gene locus_tag LOCUS_25470 482 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 1206 1688 gene locus_tag LOCUS_25480 1206 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 1758 2102 gene locus_tag LOCUS_25490 1758 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 2281 3039 gene locus_tag LOCUS_25500 2281 3039 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156015917.1 protein_id gnl|my_center|LOCUS_25500 3043 3258 gene locus_tag LOCUS_25510 3043 3258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0733 2121 811 gene locus_tag LOCUS_25520 2121 811 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_25520 <3309 2676 gene locus_tag LOCUS_25530 <3309 2676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056581.1:ATP-dependent zinc metalloprotease FtsH2 >Feature sequence0734 802 20 gene locus_tag LOCUS_25540 802 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 1708 833 gene locus_tag LOCUS_25550 1708 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 <3308 1815 gene locus_tag LOCUS_25560 <3308 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920748.1:photosystem I core protein PsaA >Feature sequence0735 1437 2435 gene locus_tag LOCUS_25570 gene fmt 1437 2435 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_25570 >Feature sequence0736 991 362 gene locus_tag LOCUS_25580 991 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 1531 2127 gene locus_tag LOCUS_25590 1531 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 2533 2285 gene locus_tag LOCUS_25600 2533 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0737 1505 246 gene locus_tag LOCUS_25610 1505 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 1578 2138 gene locus_tag LOCUS_25620 1578 2138 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence0738 918 385 gene locus_tag LOCUS_25630 918 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 <3304 2364 gene locus_tag LOCUS_25640 <3304 2364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846818.1:SMP-30/gluconolactonase/LRE family protein >Feature sequence0739 2057 1827 gene locus_tag LOCUS_25650 2057 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0740 2282 123 gene locus_tag LOCUS_25660 2282 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25660 <3301 2322 gene locus_tag LOCUS_25670 <3301 2322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245563.1:polyketide synthase PksJ note possible pseudo, internal stop codon >Feature sequence0741 <1 1004 gene locus_tag LOCUS_25680 <1 1004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779460.1:DEAD/DEAH box helicase family protein 1034 1288 gene locus_tag LOCUS_25690 1034 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 >Feature sequence0742 734 219 gene locus_tag LOCUS_25700 734 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 1202 2275 gene locus_tag LOCUS_25710 gene dhaK 1202 2275 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938278.1 protein_id gnl|my_center|LOCUS_25710 >Feature sequence0743 <1 1945 gene locus_tag LOCUS_25720 <1 1945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390885.1:bifunctional diguanylate cyclase/phosphodiesterase 1923 3032 gene locus_tag LOCUS_25730 1923 3032 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546841.1 protein_id gnl|my_center|LOCUS_25730 >Feature sequence0744 239 2029 gene locus_tag LOCUS_25740 239 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 <3295 2151 gene locus_tag LOCUS_25750 <3295 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144196.1:PAS domain S-box protein >Feature sequence0745 2014 1655 gene locus_tag LOCUS_25760 2014 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 >Feature sequence0746 2616 853 gene locus_tag LOCUS_25770 2616 853 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058157.1 protein_id gnl|my_center|LOCUS_25770 >Feature sequence0747 3084 76 gene locus_tag LOCUS_25780 3084 76 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057287.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence0748 2224 1490 gene locus_tag LOCUS_25790 2224 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2729 2418 gene locus_tag LOCUS_25800 2729 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 >Feature sequence0749 2703 196 gene locus_tag LOCUS_25810 2703 196 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184012.1 protein_id gnl|my_center|LOCUS_25810 >Feature sequence0750 628 113 gene locus_tag LOCUS_25820 628 113 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141212.1 protein_id gnl|my_center|LOCUS_25820 1443 964 gene locus_tag LOCUS_25830 1443 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 2505 2254 gene locus_tag LOCUS_25840 2505 2254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 >Feature sequence0751 360 1658 gene locus_tag LOCUS_25850 360 1658 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057139.1 protein_id gnl|my_center|LOCUS_25850 2301 2570 gene locus_tag LOCUS_25860 2301 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence0752 206 481 gene locus_tag LOCUS_25870 206 481 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675561.1 protein_id gnl|my_center|LOCUS_25870 1120 605 gene locus_tag LOCUS_25880 1120 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 1671 1381 gene locus_tag LOCUS_25890 1671 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1869 3050 gene locus_tag LOCUS_25900 1869 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence0753 478 801 gene locus_tag LOCUS_25910 478 801 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_25910 <3284 2099 gene locus_tag LOCUS_25920 <3284 2099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797673.1:penicillin-binding protein 1A >Feature sequence0754 2948 696 gene locus_tag LOCUS_25930 gene recQ 2948 696 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929065.1 protein_id gnl|my_center|LOCUS_25930 >Feature sequence0755 1056 571 gene locus_tag LOCUS_25940 1056 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1998 2285 gene locus_tag LOCUS_25950 1998 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 3104 2484 gene locus_tag LOCUS_25960 3104 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 >Feature sequence0756 907 2667 gene locus_tag LOCUS_25970 907 2667 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140923.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence0757 708 241 gene locus_tag LOCUS_25980 708 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 <3283 1028 gene locus_tag LOCUS_25990 <3283 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393311.1:malto-oligosyltrehalose synthase >Feature sequence0758 864 1109 gene locus_tag LOCUS_26000 864 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 1216 1575 gene locus_tag LOCUS_26010 1216 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 2012 2779 gene locus_tag LOCUS_26020 2012 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence0759 835 1104 gene locus_tag LOCUS_26030 835 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 1376 2845 gene locus_tag LOCUS_26040 gene zds 1376 2845 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056192.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence0760 1736 660 gene locus_tag LOCUS_26050 1736 660 CDS product tocopherol cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530023.1 protein_id gnl|my_center|LOCUS_26050 3132 1969 gene locus_tag LOCUS_26060 3132 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 >Feature sequence0761 <1 530 gene locus_tag LOCUS_26070 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141560.1:Uma2 family endonuclease 1689 730 gene locus_tag LOCUS_26080 1689 730 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530028.1 protein_id gnl|my_center|LOCUS_26080 1772 2527 gene locus_tag LOCUS_26090 1772 2527 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_26090 >Feature sequence0762 1400 324 gene locus_tag LOCUS_26100 1400 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 1495 1776 gene locus_tag LOCUS_26110 1495 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 3177 1984 gene locus_tag LOCUS_26120 3177 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0763 189 1223 gene locus_tag LOCUS_26130 189 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 1679 3244 gene locus_tag LOCUS_26140 1679 3244 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058282.1 protein_id gnl|my_center|LOCUS_26140 >Feature sequence0764 580 1563 gene locus_tag LOCUS_26150 580 1563 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140012.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence0765 263 1171 gene locus_tag LOCUS_26160 263 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 <3268 1273 gene locus_tag LOCUS_26170 <3268 1273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933392.1:DEAD/DEAH box helicase family protein >Feature sequence0766 458 147 gene locus_tag LOCUS_26180 458 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 553 2532 gene locus_tag LOCUS_26190 553 2532 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095509668.1 protein_id gnl|my_center|LOCUS_26190 >Feature sequence0767 319 65 gene locus_tag LOCUS_26200 319 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 905 1903 gene locus_tag LOCUS_26210 gene purM 905 1903 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057648.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence0768 838 398 gene locus_tag LOCUS_26220 838 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 1136 2662 gene locus_tag LOCUS_26230 gene bchB 1136 2662 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058224.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence0769 781 1002 gene locus_tag LOCUS_26240 781 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1021 1413 gene locus_tag LOCUS_26250 1021 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 1800 1991 gene locus_tag LOCUS_26260 1800 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2175 2756 gene locus_tag LOCUS_26270 gene ribH 2175 2756 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055922.1 protein_id gnl|my_center|LOCUS_26270 2850 2921 gene locus_tag LOCUS_t00290 2850 2921 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0770 3052 107 gene locus_tag LOCUS_26280 3052 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 >Feature sequence0771 1491 325 gene locus_tag LOCUS_26290 1491 325 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140589.1 protein_id gnl|my_center|LOCUS_26290 1808 2542 gene locus_tag LOCUS_26300 1808 2542 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_26300 2611 3237 gene locus_tag LOCUS_26310 2611 3237 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056907.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence0772 1376 711 gene locus_tag LOCUS_26320 1376 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2277 1417 gene locus_tag LOCUS_26330 2277 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3074 2493 gene locus_tag LOCUS_26340 3074 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 >Feature sequence0773 1434 1733 gene locus_tag LOCUS_26350 1434 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 2987 2382 gene locus_tag LOCUS_26360 2987 2382 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143467.1 protein_id gnl|my_center|LOCUS_26360 >Feature sequence0774 841 1740 gene locus_tag LOCUS_26370 841 1740 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_26370 2522 1761 gene locus_tag LOCUS_26380 2522 1761 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_26380 2601 3161 gene locus_tag LOCUS_26390 2601 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26390 >Feature sequence0775 1400 1573 gene locus_tag LOCUS_26400 1400 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26400 2342 2130 gene locus_tag LOCUS_26410 2342 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 >Feature sequence0776 679 2382 gene locus_tag LOCUS_26420 679 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 >Feature sequence0777 398 973 gene locus_tag LOCUS_26430 398 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 1972 1625 gene locus_tag LOCUS_26440 1972 1625 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056614.1 protein_id gnl|my_center|LOCUS_26440 2419 1979 gene locus_tag LOCUS_26450 2419 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 >Feature sequence0778 2662 1172 gene locus_tag LOCUS_26460 2662 1172 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042464373.1 protein_id gnl|my_center|LOCUS_26460 >Feature sequence0779 664 882 gene locus_tag LOCUS_26470 664 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530057.1 protein_id gnl|my_center|LOCUS_26470 1824 1060 gene locus_tag LOCUS_26480 1824 1060 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_26480 2562 2795 gene locus_tag LOCUS_26490 2562 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence0780 833 12 gene locus_tag LOCUS_26500 833 12 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550718.1 protein_id gnl|my_center|LOCUS_26500 2820 1486 gene locus_tag LOCUS_26510 2820 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 >Feature sequence0781 1196 456 gene locus_tag LOCUS_26520 1196 456 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081985.1 protein_id gnl|my_center|LOCUS_26520 1931 1293 gene locus_tag LOCUS_26530 1931 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 2563 3213 gene locus_tag LOCUS_26540 gene trmB 2563 3213 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_26540 >Feature sequence0782 321 665 gene locus_tag LOCUS_26550 321 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 2157 1945 gene locus_tag LOCUS_26560 2157 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 2332 2177 gene locus_tag LOCUS_26570 2332 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 3157 2447 gene locus_tag LOCUS_26580 3157 2447 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058023.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence0783 340 1284 gene locus_tag LOCUS_26590 340 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 1498 2787 gene locus_tag LOCUS_26600 1498 2787 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966351.1 protein_id gnl|my_center|LOCUS_26600 >Feature sequence0784 <1 818 gene locus_tag LOCUS_26610 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583812.1:polyamine aminopropyltransferase 867 1034 gene locus_tag LOCUS_26620 867 1034 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_26620 1966 3042 gene locus_tag LOCUS_26630 1966 3042 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246499.1 protein_id gnl|my_center|LOCUS_26630 >Feature sequence0785 847 134 gene locus_tag LOCUS_26640 847 134 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_26640 1422 946 gene locus_tag LOCUS_26650 gene tadA 1422 946 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056032.1 protein_id gnl|my_center|LOCUS_26650 1473 2321 gene locus_tag LOCUS_26660 gene menB 1473 2321 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_26660 >Feature sequence0786 1972 2988 gene locus_tag LOCUS_26670 gene proX 1972 2988 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418240.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence0787 973 287 gene locus_tag LOCUS_26680 973 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26680 1589 993 gene locus_tag LOCUS_26690 1589 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 >Feature sequence0788 281 772 gene locus_tag LOCUS_26700 gene purE 281 772 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056434.1 protein_id gnl|my_center|LOCUS_26700 958 2415 gene locus_tag LOCUS_26710 958 2415 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920960.1 protein_id gnl|my_center|LOCUS_26710 >Feature sequence0789 425 2206 gene locus_tag LOCUS_26720 425 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2184 3170 gene locus_tag LOCUS_26730 2184 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 >Feature sequence0790 <1 1567 gene locus_tag LOCUS_26740 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143976.1:efflux RND transporter permease subunit 2488 1904 gene locus_tag LOCUS_26750 2488 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 >Feature sequence0791 261 1025 gene locus_tag LOCUS_26760 261 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 2131 1382 gene locus_tag LOCUS_26770 2131 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 2177 2506 gene locus_tag LOCUS_26780 2177 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_26780 2645 2821 gene locus_tag LOCUS_26790 2645 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 3182 2979 gene locus_tag LOCUS_26800 3182 2979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence0792 266 123 gene locus_tag LOCUS_26810 266 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26810 827 342 gene locus_tag LOCUS_26820 827 342 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_26820 2698 2868 gene locus_tag LOCUS_26830 2698 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence0793 961 1692 gene locus_tag LOCUS_26840 gene sfsA 961 1692 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_26840 2176 3024 gene locus_tag LOCUS_26850 2176 3024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence0794 107 358 gene locus_tag LOCUS_26860 107 358 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_26860 2318 483 gene locus_tag LOCUS_26870 2318 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 >Feature sequence0795 307 687 gene locus_tag LOCUS_26880 307 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 1717 1881 gene locus_tag LOCUS_26890 1717 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 1882 2442 gene locus_tag LOCUS_26900 1882 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 >Feature sequence0796 894 76 gene locus_tag LOCUS_26910 894 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26910 1940 1014 gene locus_tag LOCUS_26920 1940 1014 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920795.1 protein_id gnl|my_center|LOCUS_26920 2081 3211 gene locus_tag LOCUS_26930 2081 3211 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056559.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence0797 993 52 gene locus_tag LOCUS_26940 993 52 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 1636 1019 gene locus_tag LOCUS_26950 1636 1019 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920984.1 protein_id gnl|my_center|LOCUS_26950 2588 1683 gene locus_tag LOCUS_26960 gene prmC 2588 1683 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172187304.1 protein_id gnl|my_center|LOCUS_26960 >Feature sequence0798 1127 2233 gene locus_tag LOCUS_26970 gene bchI 1127 2233 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920887.1 protein_id gnl|my_center|LOCUS_26970 2887 3099 gene locus_tag LOCUS_26980 2887 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 >Feature sequence0799 <1 586 gene locus_tag LOCUS_26990 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein 845 1993 gene locus_tag LOCUS_27000 gene arsB 845 1993 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118066.1 protein_id gnl|my_center|LOCUS_27000 2008 2430 gene locus_tag LOCUS_27010 2008 2430 CDS product ArsI/CadI family heavy metal resistance metalloenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001271000.1 protein_id gnl|my_center|LOCUS_27010 >Feature sequence0800 <1 936 gene locus_tag LOCUS_27020 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056606.1:heat-inducible transcriptional repressor HrcA 1697 1053 gene locus_tag LOCUS_27030 1697 1053 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_27030 1873 1697 gene locus_tag LOCUS_27040 1873 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 2037 1909 gene locus_tag LOCUS_27050 2037 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 2308 2030 gene locus_tag LOCUS_27060 2308 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 <3208 2369 gene locus_tag LOCUS_27070 <3208 2369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056871.1:glycoside hydrolase family protein >Feature sequence0801 <3206 1174 gene locus_tag LOCUS_27080 <3206 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013226861.1:non-ribosomal peptide synthetase >Feature sequence0802 2623 1922 gene locus_tag LOCUS_27090 2623 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 <3202 2690 gene locus_tag LOCUS_27100 <3202 2690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705135.1:glycosyltransferase family 2 protein >Feature sequence0803 965 2311 gene locus_tag LOCUS_27110 965 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence0804 369 1325 gene locus_tag LOCUS_27120 369 1325 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056589.1 protein_id gnl|my_center|LOCUS_27120 3089 2130 gene locus_tag LOCUS_27130 3089 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence0805 416 1447 gene locus_tag LOCUS_27140 416 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 1450 3015 gene locus_tag LOCUS_27150 1450 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 >Feature sequence0806 <1 1299 gene locus_tag LOCUS_27160 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein 2544 1945 gene locus_tag LOCUS_27170 2544 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence0807 1845 853 gene locus_tag LOCUS_27180 1845 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2807 2148 gene locus_tag LOCUS_27190 2807 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0808 787 131 gene locus_tag LOCUS_27200 gene folE 787 131 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_27200 1860 817 gene locus_tag LOCUS_27210 1860 817 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058109.1 protein_id gnl|my_center|LOCUS_27210 2983 2171 gene locus_tag LOCUS_27220 2983 2171 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125718.1 protein_id gnl|my_center|LOCUS_27220 >Feature sequence0809 2616 937 gene locus_tag LOCUS_27230 2616 937 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058118.1 protein_id gnl|my_center|LOCUS_27230 >Feature sequence0810 <1 1308 gene locus_tag LOCUS_27240 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143056.1:cytochrome P450 2575 1538 gene locus_tag LOCUS_27250 2575 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 2924 2637 gene locus_tag LOCUS_27260 gene clpS 2924 2637 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence0811 323 736 gene locus_tag LOCUS_27270 gene atpC 323 736 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056376.1 protein_id gnl|my_center|LOCUS_27270 1037 741 gene locus_tag LOCUS_27280 1037 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_27280 1996 1376 gene locus_tag LOCUS_27290 1996 1376 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057787.1 protein_id gnl|my_center|LOCUS_27290 2407 2180 gene locus_tag LOCUS_27300 2407 2180 CDS product Calvin cycle protein CP12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057657.1 protein_id gnl|my_center|LOCUS_27300 >Feature sequence0812 844 1548 gene locus_tag LOCUS_27310 844 1548 CDS product phosphonatase-like hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878023.1 protein_id gnl|my_center|LOCUS_27310 1862 3001 gene locus_tag LOCUS_27320 1862 3001 CDS product TIGR03364 family FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073077526.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0813 1794 1066 gene locus_tag LOCUS_27330 1794 1066 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057336.1 protein_id gnl|my_center|LOCUS_27330 2013 2417 gene locus_tag LOCUS_27340 2013 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 >Feature sequence0814 1684 509 gene locus_tag LOCUS_27350 1684 509 CDS product F420-0:Gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921060.1 protein_id gnl|my_center|LOCUS_27350 >Feature sequence0815 1813 584 gene locus_tag LOCUS_27360 1813 584 CDS product damage-control phosphatase ARMT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404091.1 protein_id gnl|my_center|LOCUS_27360 2355 3101 gene locus_tag LOCUS_27370 2355 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 >Feature sequence0816 461 823 gene locus_tag LOCUS_27380 461 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 1938 2255 gene locus_tag LOCUS_27390 1938 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 2340 3089 gene locus_tag LOCUS_27400 2340 3089 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141607.1 protein_id gnl|my_center|LOCUS_27400 >Feature sequence0817 154 492 gene locus_tag LOCUS_27410 154 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 896 765 gene locus_tag LOCUS_27420 896 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 1331 924 gene locus_tag LOCUS_27430 1331 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2266 1430 gene locus_tag LOCUS_27440 2266 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 2351 3082 gene locus_tag LOCUS_27450 2351 3082 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence0818 2112 1993 gene locus_tag LOCUS_27460 2112 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 2392 2273 gene locus_tag LOCUS_27470 2392 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 >Feature sequence0819 <1 616 gene locus_tag LOCUS_27480 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058038.1:recombination mediator RecR 1246 1875 gene locus_tag LOCUS_27490 1246 1875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0820 1454 135 gene locus_tag LOCUS_27500 1454 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 2879 2052 gene locus_tag LOCUS_27510 2879 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence0821 355 11 gene locus_tag LOCUS_27520 355 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 1028 738 gene locus_tag LOCUS_27530 1028 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 2597 1188 gene locus_tag LOCUS_27540 2597 1188 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144195.1 protein_id gnl|my_center|LOCUS_27540 <3175 2627 gene locus_tag LOCUS_27550 <3175 2627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258618.1:hydrogenase formation protein HypD >Feature sequence0822 374 2248 gene locus_tag LOCUS_27560 374 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2911 2357 gene locus_tag LOCUS_27570 2911 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence0823 <1 1602 gene locus_tag LOCUS_27580 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057988.1:M23 family metallopeptidase 1754 1827 gene locus_tag LOCUS_t00300 1754 1827 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2464 2892 gene locus_tag LOCUS_27590 gene gloA 2464 2892 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence0824 56 610 gene locus_tag LOCUS_27600 56 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 1286 1696 gene locus_tag LOCUS_27610 1286 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence0825 <1 790 gene locus_tag LOCUS_27620 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140097.1:aminopeptidase P family protein 998 1690 gene locus_tag LOCUS_27630 998 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 1697 3100 gene locus_tag LOCUS_27640 1697 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27640 >Feature sequence0826 1198 332 gene locus_tag LOCUS_27650 1198 332 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920913.1 protein_id gnl|my_center|LOCUS_27650 1653 1312 gene locus_tag LOCUS_27660 1653 1312 CDS product LapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920916.1 protein_id gnl|my_center|LOCUS_27660 2559 1765 gene locus_tag LOCUS_27670 2559 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 >Feature sequence0827 1478 705 gene locus_tag LOCUS_27680 1478 705 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_27680 2504 1509 gene locus_tag LOCUS_27690 2504 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 2995 2501 gene locus_tag LOCUS_27700 2995 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 >Feature sequence0828 493 1605 gene locus_tag LOCUS_27710 493 1605 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_27710 >Feature sequence0829 3 353 gene locus_tag LOCUS_27720 3 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 1741 854 gene locus_tag LOCUS_27730 1741 854 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_27730 2805 2530 gene locus_tag LOCUS_27740 2805 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2988 2821 gene locus_tag LOCUS_27750 2988 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_27750 >Feature sequence0830 292 38 gene locus_tag LOCUS_27760 292 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 1036 305 gene locus_tag LOCUS_27770 1036 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2055 1033 gene locus_tag LOCUS_27780 2055 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 2344 2443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0831 2518 1226 gene locus_tag LOCUS_27790 2518 1226 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence0832 1781 147 gene locus_tag LOCUS_27800 1781 147 CDS product HD family phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056336.1 protein_id gnl|my_center|LOCUS_27800 2431 2138 gene locus_tag LOCUS_27810 2431 2138 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_27810 >Feature sequence0833 2634 2873 gene locus_tag LOCUS_27820 2634 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0834 1256 168 gene locus_tag LOCUS_27830 1256 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 1308 1733 gene locus_tag LOCUS_27840 1308 1733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871913.1 protein_id gnl|my_center|LOCUS_27840 >Feature sequence0835 634 326 gene locus_tag LOCUS_27850 634 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 1803 781 gene locus_tag LOCUS_27860 1803 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 2372 2683 gene locus_tag LOCUS_27870 2372 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence0836 1978 947 gene locus_tag LOCUS_27880 gene tgt 1978 947 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055935.1 protein_id gnl|my_center|LOCUS_27880 2599 2150 gene locus_tag LOCUS_27890 2599 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140803.1 protein_id gnl|my_center|LOCUS_27890 >Feature sequence0837 >Feature sequence0838 96 341 gene locus_tag LOCUS_27900 96 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 2272 737 gene locus_tag LOCUS_27910 2272 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence0839 988 1752 gene locus_tag LOCUS_27920 988 1752 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_27920 2056 2853 gene locus_tag LOCUS_27930 2056 2853 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058253.1 protein_id gnl|my_center|LOCUS_27930 >Feature sequence0840 2364 1315 gene locus_tag LOCUS_27940 2364 1315 CDS product homogentisate phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140287.1 protein_id gnl|my_center|LOCUS_27940 3053 2790 gene locus_tag LOCUS_27950 3053 2790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 >Feature sequence0841 1323 1682 gene locus_tag LOCUS_27960 1323 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 1798 1995 gene locus_tag LOCUS_27970 1798 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 >Feature sequence0842 1488 865 gene locus_tag LOCUS_27980 1488 865 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017653748.1 protein_id gnl|my_center|LOCUS_27980 >Feature sequence0843 185 541 gene locus_tag LOCUS_27990 185 541 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_27990 617 1981 gene locus_tag LOCUS_28000 617 1981 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0844 542 1000 gene locus_tag LOCUS_28010 542 1000 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_28010 1195 1866 gene locus_tag LOCUS_28020 gene bioD 1195 1866 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_28020 2051 3136 gene locus_tag LOCUS_28030 2051 3136 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_28030 >Feature sequence0845 2732 1542 gene locus_tag LOCUS_28040 2732 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence0846 716 1336 gene locus_tag LOCUS_28050 716 1336 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141193.1 protein_id gnl|my_center|LOCUS_28050 1381 1686 gene locus_tag LOCUS_28060 1381 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 >Feature sequence0847 <1 1630 gene locus_tag LOCUS_28070 <1 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024768457.1:VCBS repeat-containing protein >Feature sequence0848 63 2219 gene locus_tag LOCUS_28080 63 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence0849 2618 357 gene locus_tag LOCUS_28090 2618 357 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_28090 >Feature sequence0850 1034 798 gene locus_tag LOCUS_28100 1034 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28100 1125 2288 gene locus_tag LOCUS_28110 1125 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 >Feature sequence0851 407 1330 gene locus_tag LOCUS_28120 407 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_28120 2145 1369 gene locus_tag LOCUS_28130 2145 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28130 >Feature sequence0852 624 238 gene locus_tag LOCUS_28140 624 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1036 677 gene locus_tag LOCUS_28150 1036 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1511 1089 gene locus_tag LOCUS_28160 1511 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1970 1659 gene locus_tag LOCUS_28170 1970 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 2485 2117 gene locus_tag LOCUS_28180 2485 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence0853 1371 250 gene locus_tag LOCUS_28190 1371 250 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684147.1 protein_id gnl|my_center|LOCUS_28190 1913 1494 gene locus_tag LOCUS_28200 1913 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2115 1858 gene locus_tag LOCUS_28210 2115 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 <3124 2563 gene locus_tag LOCUS_28220 <3124 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141377.1:precorrin-4 C(11)-methyltransferase >Feature sequence0854 2197 713 gene locus_tag LOCUS_28230 gene gatB 2197 713 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058226.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence0855 <1 604 gene locus_tag LOCUS_28240 <1 604 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein 799 951 gene locus_tag LOCUS_28250 799 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2776 1925 gene locus_tag LOCUS_28260 gene hypB 2776 1925 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence0856 1195 203 gene locus_tag LOCUS_28270 1195 203 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056617.1 protein_id gnl|my_center|LOCUS_28270 1668 2486 gene locus_tag LOCUS_28280 gene sppA 1668 2486 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057641.1 protein_id gnl|my_center|LOCUS_28280 2524 2901 gene locus_tag LOCUS_28290 gene aroH 2524 2901 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057640.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence0857 927 1439 gene locus_tag LOCUS_28300 927 1439 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056026.1 protein_id gnl|my_center|LOCUS_28300 2098 3096 gene locus_tag LOCUS_28310 gene ilvC 2098 3096 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_28310 >Feature sequence0858 643 1377 gene locus_tag LOCUS_28320 643 1377 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_28320 1403 2158 gene locus_tag LOCUS_28330 gene cmoA 1403 2158 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_28330 >Feature sequence0859 <1 853 gene locus_tag LOCUS_28340 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897221.1:RNA-guided endonuclease TnpB family protein 1763 1011 gene locus_tag LOCUS_28350 gene urtE 1763 1011 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_28350 1827 2321 gene locus_tag LOCUS_28360 1827 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 >Feature sequence0860 287 1324 gene locus_tag LOCUS_28370 gene hpnH 287 1324 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056444.1 protein_id gnl|my_center|LOCUS_28370 2976 2020 gene locus_tag LOCUS_28380 2976 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence0861 210 2960 gene locus_tag LOCUS_28390 210 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence0862 669 199 gene locus_tag LOCUS_28400 669 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 1204 1935 gene locus_tag LOCUS_28410 1204 1935 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140670.1 protein_id gnl|my_center|LOCUS_28410 2335 2132 gene locus_tag LOCUS_28420 2335 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 2914 2522 gene locus_tag LOCUS_28430 2914 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence0863 150 1070 gene locus_tag LOCUS_28440 150 1070 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809044.1 protein_id gnl|my_center|LOCUS_28440 1269 1721 gene locus_tag LOCUS_28450 1269 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1788 2990 gene locus_tag LOCUS_28460 1788 2990 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057867.1 protein_id gnl|my_center|LOCUS_28460 >Feature sequence0864 336 1439 gene locus_tag LOCUS_28470 336 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2375 1974 gene locus_tag LOCUS_28480 2375 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence0865 1822 689 gene locus_tag LOCUS_28490 1822 689 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000721699.1 protein_id gnl|my_center|LOCUS_28490 2846 2058 gene locus_tag LOCUS_28500 2846 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0866 359 2860 gene locus_tag LOCUS_28510 359 2860 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921058.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence0867 1874 747 gene locus_tag LOCUS_28520 1874 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 2744 2484 gene locus_tag LOCUS_28530 2744 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2975 2745 gene locus_tag LOCUS_28540 2975 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28540 >Feature sequence0868 1546 239 gene locus_tag LOCUS_28550 1546 239 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166117.1 protein_id gnl|my_center|LOCUS_28550 2069 2635 gene locus_tag LOCUS_28560 gene def 2069 2635 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057513.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0869 1499 1846 gene locus_tag LOCUS_28570 gene ndhM 1499 1846 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056300.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence0870 702 259 gene locus_tag LOCUS_28580 702 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 3042 1129 gene locus_tag LOCUS_28590 3042 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28590 >Feature sequence0871 454 1302 gene locus_tag LOCUS_28600 gene recO 454 1302 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_28600 1533 2918 gene locus_tag LOCUS_28610 1533 2918 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140087.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence0872 976 614 gene locus_tag LOCUS_28620 976 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 1375 1094 gene locus_tag LOCUS_28630 1375 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 2719 1724 gene locus_tag LOCUS_28640 2719 1724 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence0873 1398 385 gene locus_tag LOCUS_28650 1398 385 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255924.1 protein_id gnl|my_center|LOCUS_28650 2094 1645 gene locus_tag LOCUS_28660 2094 1645 CDS product dual specificity protein phosphatase 23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140010.1 protein_id gnl|my_center|LOCUS_28660 2231 2097 gene locus_tag LOCUS_28670 2231 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 2708 2538 gene locus_tag LOCUS_28680 2708 2538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_28680 >Feature sequence0874 1699 1995 gene locus_tag LOCUS_28690 1699 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 >Feature sequence0875 509 288 gene locus_tag LOCUS_28700 509 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 636 1847 gene locus_tag LOCUS_28710 636 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence0876 >Feature sequence0877 <1 1244 gene locus_tag LOCUS_28720 <1 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143241.1:ParA family protein 1493 3001 gene locus_tag LOCUS_28730 1493 3001 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence0878 960 148 gene locus_tag LOCUS_28740 960 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 1403 1215 gene locus_tag LOCUS_28750 1403 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1928 1644 gene locus_tag LOCUS_28760 1928 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28760 2140 2385 gene locus_tag LOCUS_28770 2140 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence0879 2509 431 gene locus_tag LOCUS_28780 2509 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28780 2993 2733 gene locus_tag LOCUS_28790 2993 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28790 >Feature sequence0880 250 1068 gene locus_tag LOCUS_28800 gene rsmA 250 1068 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056506.1 protein_id gnl|my_center|LOCUS_28800 1830 1609 gene locus_tag LOCUS_28810 1830 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence0881 <1 820 gene locus_tag LOCUS_28820 <1 820 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015445522.1:three-Cys-motif partner protein TcmP 1175 1600 gene locus_tag LOCUS_28830 1175 1600 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172237.1 protein_id gnl|my_center|LOCUS_28830 1697 2026 gene locus_tag LOCUS_28840 1697 2026 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_28840 2382 2753 gene locus_tag LOCUS_28850 gene rpsL 2382 2753 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence0882 <1 1003 gene locus_tag LOCUS_28860 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921467.1:choice-of-anchor I family protein >Feature sequence0883 629 318 gene locus_tag LOCUS_28870 629 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 1300 758 gene locus_tag LOCUS_28880 1300 758 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141192.1 protein_id gnl|my_center|LOCUS_28880 2294 1533 gene locus_tag LOCUS_28890 2294 1533 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_28890 <3074 2559 gene locus_tag LOCUS_28900 <3074 2559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057794.1:phycobilisome linker polypeptide >Feature sequence0884 1974 529 gene locus_tag LOCUS_28910 1974 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 <3074 2295 gene locus_tag LOCUS_28920 <3074 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055863.1:PIN/TRAM domain-containing protein >Feature sequence0885 483 923 gene locus_tag LOCUS_28930 483 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 2370 1462 gene locus_tag LOCUS_28940 2370 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 2485 2970 gene locus_tag LOCUS_28950 2485 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 >Feature sequence0886 517 729 gene locus_tag LOCUS_28960 517 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 1244 2890 gene locus_tag LOCUS_28970 1244 2890 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057717.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence0887 <1 1015 gene locus_tag LOCUS_28980 <1 1015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257149.1:ATP phosphoribosyltransferase regulatory subunit 1492 2508 gene locus_tag LOCUS_28990 gene hisG 1492 2508 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257147.1 protein_id gnl|my_center|LOCUS_28990 >Feature sequence0888 894 583 gene locus_tag LOCUS_29000 894 583 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055938.1 protein_id gnl|my_center|LOCUS_29000 1516 878 gene locus_tag LOCUS_29010 gene rplD 1516 878 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_29010 2222 1539 gene locus_tag LOCUS_29020 gene rplC 2222 1539 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence0889 1283 285 gene locus_tag LOCUS_29030 1283 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928596.1 protein_id gnl|my_center|LOCUS_29030 1902 2780 gene locus_tag LOCUS_29040 1902 2780 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_29040 >Feature sequence0890 1963 1544 gene locus_tag LOCUS_29050 1963 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29050 2148 1960 gene locus_tag LOCUS_29060 2148 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 2478 2972 gene locus_tag LOCUS_29070 2478 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence0891 966 427 gene locus_tag LOCUS_29080 966 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 <3067 921 gene locus_tag LOCUS_29090 <3067 921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390546.1:glycosyltransferase >Feature sequence0892 972 79 gene locus_tag LOCUS_29100 gene pstA 972 79 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_29100 2046 1066 gene locus_tag LOCUS_29110 gene pstC 2046 1066 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_29110 3033 2239 gene locus_tag LOCUS_29120 3033 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 >Feature sequence0893 1588 1010 gene locus_tag LOCUS_29130 1588 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 2653 2231 gene locus_tag LOCUS_29140 2653 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence0894 2251 2700 gene locus_tag LOCUS_29150 gene ndk 2251 2700 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056122.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence0895 99 1691 gene locus_tag LOCUS_29160 99 1691 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058049.1 protein_id gnl|my_center|LOCUS_29160 1809 2384 gene locus_tag LOCUS_29170 1809 2384 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057036.1 protein_id gnl|my_center|LOCUS_29170 >Feature sequence0896 1124 2428 gene locus_tag LOCUS_29180 1124 2428 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143057.1 protein_id gnl|my_center|LOCUS_29180 2556 2846 gene locus_tag LOCUS_29190 2556 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0897 1249 326 gene locus_tag LOCUS_29200 gene queG 1249 326 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920720.1 protein_id gnl|my_center|LOCUS_29200 1679 2185 gene locus_tag LOCUS_29210 1679 2185 CDS product orange carotenoid protein N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057109.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence0898 <1 747 gene locus_tag LOCUS_29220 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922226.1:SdrD B-like domain-containing protein 2712 1111 gene locus_tag LOCUS_29230 2712 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 >Feature sequence0899 814 338 gene locus_tag LOCUS_29240 814 338 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_29240 1488 811 gene locus_tag LOCUS_29250 1488 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 2923 1607 gene locus_tag LOCUS_29260 gene purB 2923 1607 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057666.1 protein_id gnl|my_center|LOCUS_29260 >Feature sequence0900 3015 1912 gene locus_tag LOCUS_29270 3015 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 >Feature sequence0901 2154 1027 gene locus_tag LOCUS_29280 2154 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 >Feature sequence0902 35 769 gene locus_tag LOCUS_29290 35 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29290 812 949 gene locus_tag LOCUS_29300 812 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 1240 1632 gene locus_tag LOCUS_29310 1240 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 1806 2138 gene locus_tag LOCUS_29320 1806 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29320 <3051 2371 gene locus_tag LOCUS_29330 <3051 2371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142872.1:FAD-dependent oxidoreductase >Feature sequence0903 2599 2904 gene locus_tag LOCUS_29340 2599 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29340 >Feature sequence0904 1852 1517 gene locus_tag LOCUS_29350 1852 1517 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_29350 2394 1894 gene locus_tag LOCUS_29360 2394 1894 CDS product DUF3122 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056141.1 protein_id gnl|my_center|LOCUS_29360 >Feature sequence0905 61 198 gene locus_tag LOCUS_29370 61 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29370 195 743 gene locus_tag LOCUS_29380 gene frr 195 743 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_29380 1005 2120 gene locus_tag LOCUS_29390 1005 2120 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_29390 2797 2522 gene locus_tag LOCUS_29400 2797 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 >Feature sequence0906 1506 682 gene locus_tag LOCUS_29410 1506 682 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_29410 2023 2982 gene locus_tag LOCUS_29420 2023 2982 CDS product 3'(2'),5'-bisphosphate nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404078.1 protein_id gnl|my_center|LOCUS_29420 >Feature sequence0907 246 4 gene locus_tag LOCUS_29430 246 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 654 2096 gene locus_tag LOCUS_29440 654 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 2098 2634 gene locus_tag LOCUS_29450 2098 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 >Feature sequence0908 525 334 gene locus_tag LOCUS_29460 525 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29460 2846 591 gene locus_tag LOCUS_29470 2846 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 >Feature sequence0909 414 1544 gene locus_tag LOCUS_29480 414 1544 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0910 >Feature sequence0911 2858 2574 gene locus_tag LOCUS_29490 2858 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 >Feature sequence0912 <1 1235 gene locus_tag LOCUS_29500 <1 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055884.1:histidine kinase 1650 1252 gene locus_tag LOCUS_29510 1650 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 2033 1695 gene locus_tag LOCUS_29520 2033 1695 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_29520 2577 2203 gene locus_tag LOCUS_29530 2577 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 3035 2688 gene locus_tag LOCUS_29540 3035 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 >Feature sequence0913 930 1211 gene locus_tag LOCUS_29550 930 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2363 1989 gene locus_tag LOCUS_29560 2363 1989 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_29560 <3034 2432 gene locus_tag LOCUS_29570 <3034 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920736.1:oxygen-dependent coproporphyrinogen oxidase >Feature sequence0914 236 114 gene locus_tag LOCUS_29580 236 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 876 325 gene locus_tag LOCUS_29590 876 325 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_29590 2374 944 gene locus_tag LOCUS_29600 2374 944 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_29600 >Feature sequence0915 138 383 gene locus_tag LOCUS_29610 138 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 423 584 gene locus_tag LOCUS_29620 423 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 634 1167 gene locus_tag LOCUS_29630 634 1167 CDS product CPBP family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920910.1 protein_id gnl|my_center|LOCUS_29630 1852 1586 gene locus_tag LOCUS_29640 1852 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29640 2693 2163 gene locus_tag LOCUS_29650 2693 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 >Feature sequence0916 1504 728 gene locus_tag LOCUS_29660 1504 728 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058255.1 protein_id gnl|my_center|LOCUS_29660 2831 2076 gene locus_tag LOCUS_29670 2831 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29670 >Feature sequence0917 935 360 gene locus_tag LOCUS_29680 935 360 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083435038.1 protein_id gnl|my_center|LOCUS_29680 <3024 1542 gene locus_tag LOCUS_29690 <3024 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056502.1:ABC transporter ATP-binding protein >Feature sequence0918 1260 2030 gene locus_tag LOCUS_29700 gene cobA 1260 2030 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055999.1 protein_id gnl|my_center|LOCUS_29700 >Feature sequence0919 3013 26 gene locus_tag LOCUS_29710 3013 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29710 >Feature sequence0920 304 747 gene locus_tag LOCUS_29720 304 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 840 2051 gene locus_tag LOCUS_29730 840 2051 CDS product DUF2330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072721720.1 protein_id gnl|my_center|LOCUS_29730 2239 2520 gene locus_tag LOCUS_29740 2239 2520 CDS product YiaA/YiaB family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090339.1 protein_id gnl|my_center|LOCUS_29740 2938 2645 gene locus_tag LOCUS_29750 2938 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29750 >Feature sequence0921 681 202 gene locus_tag LOCUS_29760 681 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29760 2172 1600 gene locus_tag LOCUS_29770 2172 1600 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888695.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence0922 >Feature sequence0923 2726 105 gene locus_tag LOCUS_29780 2726 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 >Feature sequence0924 193 1041 gene locus_tag LOCUS_29790 193 1041 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142803.1 protein_id gnl|my_center|LOCUS_29790 1674 1150 gene locus_tag LOCUS_29800 1674 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29800 2144 1599 gene locus_tag LOCUS_29810 2144 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29810 2326 2991 gene locus_tag LOCUS_29820 2326 2991 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057728.1 protein_id gnl|my_center|LOCUS_29820 >Feature sequence0925 1412 66 gene locus_tag LOCUS_29830 1412 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056550.1 protein_id gnl|my_center|LOCUS_29830 2221 2820 gene locus_tag LOCUS_29840 2221 2820 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence0926 852 1094 gene locus_tag LOCUS_29850 852 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 2105 1392 gene locus_tag LOCUS_29860 2105 1392 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966718.1 protein_id gnl|my_center|LOCUS_29860 2259 2492 gene locus_tag LOCUS_29870 2259 2492 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141619.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0927 <1 768 gene locus_tag LOCUS_29880 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase 1911 2234 gene locus_tag LOCUS_29890 1911 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29890 >Feature sequence0928 1644 130 gene locus_tag LOCUS_29900 gene lnt 1644 130 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057504.1 protein_id gnl|my_center|LOCUS_29900 2781 1894 gene locus_tag LOCUS_29910 2781 1894 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929260.1 protein_id gnl|my_center|LOCUS_29910 >Feature sequence0929 338 661 gene locus_tag LOCUS_29920 338 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 658 1893 gene locus_tag LOCUS_29930 658 1893 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258620.1 protein_id gnl|my_center|LOCUS_29930 2406 2053 gene locus_tag LOCUS_29940 2406 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence0930 1127 2068 gene locus_tag LOCUS_29950 1127 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2097 2810 gene locus_tag LOCUS_29960 gene ubiE 2097 2810 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_29960 >Feature sequence0931 <1 1889 gene locus_tag LOCUS_29970 <1 1889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000849131.1:adenylate/guanylate cyclase domain-containing protein 2078 2731 gene locus_tag LOCUS_29980 2078 2731 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_29980 >Feature sequence0932 1591 2460 gene locus_tag LOCUS_29990 1591 2460 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144144.1 protein_id gnl|my_center|LOCUS_29990 >Feature sequence0933 2164 584 gene locus_tag LOCUS_30000 2164 584 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055900.1 protein_id gnl|my_center|LOCUS_30000 >Feature sequence0934 <2986 404 gene locus_tag LOCUS_30010 <2986 404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002724361.1:calcium-binding protein >Feature sequence0935 <1 1150 gene locus_tag LOCUS_30020 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245287.1:polyketide biosynthesis malonyl-ACP decarboxylase PksF 1155 2414 gene locus_tag LOCUS_30030 gene pksG 1155 2414 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 protein_id gnl|my_center|LOCUS_30030 >Feature sequence0936 498 800 gene locus_tag LOCUS_30040 498 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_30040 1970 795 gene locus_tag LOCUS_30050 1970 795 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165448192.1 protein_id gnl|my_center|LOCUS_30050 >Feature sequence0937 <2981 1181 gene locus_tag LOCUS_30060 <2981 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056852.1:glycosyltransferase >Feature sequence0938 >Feature sequence0939 599 102 gene locus_tag LOCUS_30070 599 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 1928 789 gene locus_tag LOCUS_30080 gene dnaN 1928 789 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124156.1 protein_id gnl|my_center|LOCUS_30080 2412 2023 gene locus_tag LOCUS_30090 2412 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30090 >Feature sequence0940 1401 274 gene locus_tag LOCUS_30100 1401 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0941 575 102 gene locus_tag LOCUS_30110 575 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30110 1681 1214 gene locus_tag LOCUS_30120 1681 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2246 2638 gene locus_tag LOCUS_30130 2246 2638 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974312.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence0942 1141 632 gene locus_tag LOCUS_30140 1141 632 CDS product DUF3611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056251.1 protein_id gnl|my_center|LOCUS_30140 1421 1591 gene locus_tag LOCUS_30150 1421 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057753.1 protein_id gnl|my_center|LOCUS_30150 1778 2068 gene locus_tag LOCUS_30160 1778 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 2077 2508 gene locus_tag LOCUS_30170 2077 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 >Feature sequence0943 <1 651 gene locus_tag LOCUS_30180 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057130.1:DUF697 domain-containing protein 1573 701 gene locus_tag LOCUS_30190 1573 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 2397 2053 gene locus_tag LOCUS_30200 2397 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311963.1 protein_id gnl|my_center|LOCUS_30200 >Feature sequence0944 1444 617 gene locus_tag LOCUS_30210 1444 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0945 1522 101 gene locus_tag LOCUS_30220 1522 101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532721.1 protein_id gnl|my_center|LOCUS_30220 2622 1774 gene locus_tag LOCUS_30230 2622 1774 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294698.1 protein_id gnl|my_center|LOCUS_30230 >Feature sequence0946 2643 256 gene locus_tag LOCUS_30240 2643 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 >Feature sequence0947 301 1416 gene locus_tag LOCUS_30250 gene aroC 301 1416 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_30250 1857 2765 gene locus_tag LOCUS_30260 1857 2765 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_30260 >Feature sequence0948 <1 1280 gene locus_tag LOCUS_30270 <1 1280 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052729532.1:DNA methyltransferase 1273 2391 gene locus_tag LOCUS_30280 1273 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 <2963 2437 gene locus_tag LOCUS_30290 <2963 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057055.1:isochorismate synthase >Feature sequence0949 2037 1906 gene locus_tag LOCUS_30300 2037 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2384 2256 gene locus_tag LOCUS_30310 2384 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 2568 2392 gene locus_tag LOCUS_30320 2568 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 >Feature sequence0950 1295 846 gene locus_tag LOCUS_30330 1295 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 1626 1489 gene locus_tag LOCUS_30340 1626 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 2547 1909 gene locus_tag LOCUS_30350 gene folE 2547 1909 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_30350 >Feature sequence0951 1340 2467 gene locus_tag LOCUS_30360 gene dnaJ 1340 2467 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920758.1 protein_id gnl|my_center|LOCUS_30360 >Feature sequence0952 157 2883 gene locus_tag LOCUS_30370 157 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30370 >Feature sequence0953 1392 166 gene locus_tag LOCUS_30380 1392 166 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_30380 1483 2580 gene locus_tag LOCUS_30390 gene pilM 1483 2580 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921030.1 protein_id gnl|my_center|LOCUS_30390 >Feature sequence0954 <1 989 gene locus_tag LOCUS_30400 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057179.1:DNA polymerase I note possible pseudo, internal stop codon 1038 2564 gene locus_tag LOCUS_30410 1038 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30410 2694 2849 gene locus_tag LOCUS_30420 2694 2849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30420 >Feature sequence0955 822 166 gene locus_tag LOCUS_30430 822 166 CDS product 4Fe-4S single cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948683.1 protein_id gnl|my_center|LOCUS_30430 1813 1019 gene locus_tag LOCUS_30440 1813 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence0956 1647 634 gene locus_tag LOCUS_30450 1647 634 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057751.1 protein_id gnl|my_center|LOCUS_30450 >Feature sequence0957 635 1213 gene locus_tag LOCUS_30460 635 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30460 1618 1962 gene locus_tag LOCUS_30470 1618 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 2758 1979 gene locus_tag LOCUS_30480 2758 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 >Feature sequence0958 286 804 gene locus_tag LOCUS_30490 286 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 1448 1642 gene locus_tag LOCUS_30500 1448 1642 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_30500 2187 2408 gene locus_tag LOCUS_30510 2187 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30510 2686 2925 gene locus_tag LOCUS_30520 2686 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30520 >Feature sequence0959 263 2302 gene locus_tag LOCUS_30530 263 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0960 842 2527 gene locus_tag LOCUS_30540 gene ilvD 842 2527 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_30540 >Feature sequence0961 100 1344 gene locus_tag LOCUS_30550 100 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 1707 2327 gene locus_tag LOCUS_30560 1707 2327 CDS product PAP/fibrillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056274.1 protein_id gnl|my_center|LOCUS_30560 2520 2789 gene locus_tag LOCUS_30570 2520 2789 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_30570 >Feature sequence0962 901 1161 gene locus_tag LOCUS_30580 901 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 1492 2532 gene locus_tag LOCUS_30590 1492 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30590 >Feature sequence0963 306 539 gene locus_tag LOCUS_30600 306 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30600 555 1499 gene locus_tag LOCUS_30610 555 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30610 1630 2811 gene locus_tag LOCUS_30620 1630 2811 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091709.1 protein_id gnl|my_center|LOCUS_30620 >Feature sequence0964 1538 363 gene locus_tag LOCUS_30630 1538 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30630 >Feature sequence0965 2028 1405 gene locus_tag LOCUS_30640 2028 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 <2938 2031 gene locus_tag LOCUS_30650 <2938 2031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404780.1:ATP-binding protein >Feature sequence0966 1268 981 gene locus_tag LOCUS_30660 1268 981 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172914.1 protein_id gnl|my_center|LOCUS_30660 >Feature sequence0967 816 421 gene locus_tag LOCUS_30670 816 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 1164 1586 gene locus_tag LOCUS_30680 1164 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 1610 2401 gene locus_tag LOCUS_30690 gene minC 1610 2401 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057851.1 protein_id gnl|my_center|LOCUS_30690 >Feature sequence0968 329 1636 gene locus_tag LOCUS_30700 329 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 >Feature sequence0969 1301 1636 gene locus_tag LOCUS_30710 1301 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 2465 1728 gene locus_tag LOCUS_30720 2465 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30720 >Feature sequence0970 667 212 gene locus_tag LOCUS_30730 667 212 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_30730 2708 1503 gene locus_tag LOCUS_30740 2708 1503 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986860.1 protein_id gnl|my_center|LOCUS_30740 >Feature sequence0971 1605 241 gene locus_tag LOCUS_30750 1605 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 2063 2917 gene locus_tag LOCUS_30760 gene tatC 2063 2917 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141910.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0972 149 931 gene locus_tag LOCUS_30770 149 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 1714 2181 gene locus_tag LOCUS_30780 1714 2181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence0973 297 1199 gene locus_tag LOCUS_30790 297 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 1316 2875 gene locus_tag LOCUS_30800 1316 2875 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144225.1 protein_id gnl|my_center|LOCUS_30800 >Feature sequence0974 1310 21 gene locus_tag LOCUS_30810 1310 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 2213 2842 gene locus_tag LOCUS_30820 gene rimM 2213 2842 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence0975 521 1714 gene locus_tag LOCUS_30830 521 1714 CDS product glycine betaine/L-proline ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287805.1 protein_id gnl|my_center|LOCUS_30830 >Feature sequence0976 1484 1119 gene locus_tag LOCUS_30840 1484 1119 CDS product DUF1815 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987665.1 protein_id gnl|my_center|LOCUS_30840 2593 2381 gene locus_tag LOCUS_30850 2593 2381 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_30850 >Feature sequence0977 171 527 gene locus_tag LOCUS_30860 171 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 >Feature sequence0978 342 695 gene locus_tag LOCUS_30870 342 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30870 1757 987 gene locus_tag LOCUS_30880 gene fetB 1757 987 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_30880 2300 2061 gene locus_tag LOCUS_30890 2300 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 >Feature sequence0979 666 160 gene locus_tag LOCUS_30900 666 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 1028 2416 gene locus_tag LOCUS_30910 1028 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence0980 772 1839 gene locus_tag LOCUS_30920 772 1839 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064307.1 protein_id gnl|my_center|LOCUS_30920 >Feature sequence0981 604 146 gene locus_tag LOCUS_30930 gene rplI 604 146 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058245.1 protein_id gnl|my_center|LOCUS_30930 875 1894 gene locus_tag LOCUS_30940 gene proX 875 1894 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173041.1 protein_id gnl|my_center|LOCUS_30940 2589 2413 gene locus_tag LOCUS_30950 2589 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30950 >Feature sequence0982 121 924 gene locus_tag LOCUS_30960 121 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 906 2846 gene locus_tag LOCUS_30970 906 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence0983 2093 2500 gene locus_tag LOCUS_30980 2093 2500 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_30980 >Feature sequence0984 2 421 gene locus_tag LOCUS_30990 2 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30990 <2908 559 gene locus_tag LOCUS_31000 <2908 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057120.1:ABC transporter substrate-binding protein >Feature sequence0985 815 264 gene locus_tag LOCUS_31010 815 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31010 >Feature sequence0986 <2903 247 gene locus_tag LOCUS_31020 <2903 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence0987 1978 329 gene locus_tag LOCUS_31030 1978 329 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113630057.1 protein_id gnl|my_center|LOCUS_31030 >Feature sequence0988 1730 831 gene locus_tag LOCUS_31040 1730 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2121 2249 gene locus_tag LOCUS_31050 2121 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 2284 2412 gene locus_tag LOCUS_31060 2284 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 >Feature sequence0989 2452 1787 gene locus_tag LOCUS_31070 2452 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143006.1 protein_id gnl|my_center|LOCUS_31070 >Feature sequence0990 1828 227 gene locus_tag LOCUS_31080 1828 227 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056997.1 protein_id gnl|my_center|LOCUS_31080 2477 2055 gene locus_tag LOCUS_31090 2477 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 2708 2866 gene locus_tag LOCUS_31100 2708 2866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence0991 853 164 gene locus_tag LOCUS_31110 853 164 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143627.1 protein_id gnl|my_center|LOCUS_31110 1180 1019 gene locus_tag LOCUS_31120 1180 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 1725 1273 gene locus_tag LOCUS_31130 1725 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 2050 1763 gene locus_tag LOCUS_31140 2050 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 <2895 2193 gene locus_tag LOCUS_31150 <2895 2193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000635999.1:family 10 glycosylhydrolase >Feature sequence0992 677 1504 gene locus_tag LOCUS_31160 677 1504 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_31160 >Feature sequence0993 1187 402 gene locus_tag LOCUS_31170 1187 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2208 1204 gene locus_tag LOCUS_31180 2208 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 >Feature sequence0994 1855 428 gene locus_tag LOCUS_31190 1855 428 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_31190 2685 2368 gene locus_tag LOCUS_31200 gene trxA 2685 2368 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence0995 914 429 gene locus_tag LOCUS_31210 914 429 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056672.1 protein_id gnl|my_center|LOCUS_31210 1816 1166 gene locus_tag LOCUS_31220 1816 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence0996 452 577 gene locus_tag LOCUS_31230 452 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31230 766 1263 gene locus_tag LOCUS_31240 766 1263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 2494 1418 gene locus_tag LOCUS_31250 2494 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31250 >Feature sequence0997 622 80 gene locus_tag LOCUS_31260 622 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 808 2367 gene locus_tag LOCUS_31270 808 2367 CDS product TM0106 family RecB-like putative nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124464.1 protein_id gnl|my_center|LOCUS_31270 >Feature sequence0998 498 373 gene locus_tag LOCUS_31280 498 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31280 2380 938 gene locus_tag LOCUS_31290 gene ltrA 2380 938 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140181.1 protein_id gnl|my_center|LOCUS_31290 >Feature sequence0999 200 595 gene locus_tag LOCUS_31300 200 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 829 1263 gene locus_tag LOCUS_31310 829 1263 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003025263.1 protein_id gnl|my_center|LOCUS_31310 2089 1664 gene locus_tag LOCUS_31320 2089 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 >Feature sequence1000 187 462 gene locus_tag LOCUS_31330 187 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 466 891 gene locus_tag LOCUS_31340 466 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 957 1349 gene locus_tag LOCUS_31350 957 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 1700 1912 gene locus_tag LOCUS_31360 1700 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 1906 2280 gene locus_tag LOCUS_31370 1906 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31370 2442 2675 gene locus_tag LOCUS_31380 2442 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 >Feature sequence1001 1552 1695 gene locus_tag LOCUS_31390 1552 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 1755 1928 gene locus_tag LOCUS_31400 1755 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 >Feature sequence1002 1215 2660 gene locus_tag LOCUS_31410 1215 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31410 >Feature sequence1003 201 395 gene locus_tag LOCUS_31420 201 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 1353 1808 gene locus_tag LOCUS_31430 1353 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31430 >Feature sequence1004 750 493 gene locus_tag LOCUS_31440 750 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31440 >Feature sequence1005 923 1123 gene locus_tag LOCUS_31450 923 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 1316 2380 gene locus_tag LOCUS_31460 1316 2380 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142617.1 protein_id gnl|my_center|LOCUS_31460 >Feature sequence1006 148 390 gene locus_tag LOCUS_31470 148 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31470 500 1435 gene locus_tag LOCUS_31480 500 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31480 2799 1531 gene locus_tag LOCUS_31490 2799 1531 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_31490 >Feature sequence1007 542 787 gene locus_tag LOCUS_31500 542 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 784 2850 gene locus_tag LOCUS_31510 784 2850 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016398.1 protein_id gnl|my_center|LOCUS_31510 >Feature sequence1008 1285 815 gene locus_tag LOCUS_31520 gene rpsG 1285 815 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057585.1 protein_id gnl|my_center|LOCUS_31520 1784 1410 gene locus_tag LOCUS_31530 gene rpsL 1784 1410 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057584.1 protein_id gnl|my_center|LOCUS_31530 2676 2353 gene locus_tag LOCUS_31540 2676 2353 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142103.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence1009 <1 2214 gene locus_tag LOCUS_31550 <1 2214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010865234.1:alpha-2-macroglobulin >Feature sequence1010 1175 243 gene locus_tag LOCUS_31560 1175 243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 2369 1350 gene locus_tag LOCUS_31570 2369 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 >Feature sequence1011 759 935 gene locus_tag LOCUS_31580 759 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 1253 2314 gene locus_tag LOCUS_31590 1253 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence1012 878 1123 gene locus_tag LOCUS_31600 878 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31600 1244 1498 gene locus_tag LOCUS_31610 1244 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 >Feature sequence1013 394 999 gene locus_tag LOCUS_31620 394 999 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496365.1 protein_id gnl|my_center|LOCUS_31620 1208 2245 gene locus_tag LOCUS_31630 gene plsX 1208 2245 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056688.1 protein_id gnl|my_center|LOCUS_31630 >Feature sequence1014 <2858 1786 gene locus_tag LOCUS_31640 <2858 1786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence1015 377 1111 gene locus_tag LOCUS_31650 377 1111 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057310.1 protein_id gnl|my_center|LOCUS_31650 1299 1162 gene locus_tag LOCUS_31660 1299 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence1016 456 893 gene locus_tag LOCUS_31670 456 893 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_31670 1569 1033 gene locus_tag LOCUS_31680 1569 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 <2857 1572 gene locus_tag LOCUS_31690 <2857 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920917.1:ParA family protein >Feature sequence1017 633 1223 gene locus_tag LOCUS_31700 633 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31700 <2856 1477 gene locus_tag LOCUS_31710 <2856 1477 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056673.1:mechanosensitive ion channel >Feature sequence1018 614 1519 gene locus_tag LOCUS_31720 614 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 2775 1888 gene locus_tag LOCUS_31730 2775 1888 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601375.1 protein_id gnl|my_center|LOCUS_31730 >Feature sequence1019 358 486 gene locus_tag LOCUS_31740 358 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 587 2311 gene locus_tag LOCUS_31750 587 2311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056806.1 protein_id gnl|my_center|LOCUS_31750 >Feature sequence1020 1 957 gene locus_tag LOCUS_31760 1 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 <2854 954 gene locus_tag LOCUS_31770 <2854 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044393613.1:ATP-binding protein >Feature sequence1021 347 946 gene locus_tag LOCUS_31780 347 946 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_31780 1076 1639 gene locus_tag LOCUS_31790 1076 1639 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_31790 2081 2221 gene locus_tag LOCUS_31800 2081 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31800 2393 2518 gene locus_tag LOCUS_31810 2393 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence1022 <2853 260 gene locus_tag LOCUS_31820 <2853 260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence1023 1952 513 gene locus_tag LOCUS_31830 gene tig 1952 513 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence1024 435 97 gene locus_tag LOCUS_31840 435 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 900 517 gene locus_tag LOCUS_31850 900 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1255 1025 gene locus_tag LOCUS_31860 1255 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 1894 1568 gene locus_tag LOCUS_31870 1894 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 2298 1879 gene locus_tag LOCUS_31880 2298 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 >Feature sequence1025 <1 973 gene locus_tag LOCUS_31890 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057189.1:ferredoxin--nitrite reductase 1118 1804 gene locus_tag LOCUS_31900 1118 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence1026 617 1489 gene locus_tag LOCUS_31910 617 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_31910 1651 2661 gene locus_tag LOCUS_31920 1651 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 >Feature sequence1027 124 1638 gene locus_tag LOCUS_31930 gene malQ 124 1638 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_31930 2541 1642 gene locus_tag LOCUS_31940 2541 1642 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057337.1 protein_id gnl|my_center|LOCUS_31940 >Feature sequence1028 <1 1037 gene locus_tag LOCUS_31950 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141899.1:sulfotransferase >Feature sequence1029 541 1104 gene locus_tag LOCUS_31960 541 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 1498 1701 gene locus_tag LOCUS_31970 1498 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 >Feature sequence1030 88 603 gene locus_tag LOCUS_31980 88 603 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056371.1 protein_id gnl|my_center|LOCUS_31980 1000 1323 gene locus_tag LOCUS_31990 1000 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 1780 2796 gene locus_tag LOCUS_32000 gene mnmH 1780 2796 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_32000 >Feature sequence1031 1367 192 gene locus_tag LOCUS_32010 1367 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 2300 2443 gene locus_tag LOCUS_32020 2300 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 >Feature sequence1032 <1 1588 gene locus_tag LOCUS_32030 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012548770.1:flippase-like domain-containing protein 1868 2176 gene locus_tag LOCUS_32040 1868 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 >Feature sequence1033 180 1 gene locus_tag LOCUS_32050 180 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 1759 1935 gene locus_tag LOCUS_32060 1759 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 2027 2332 gene locus_tag LOCUS_32070 2027 2332 CDS product DUF4090 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125696.1 protein_id gnl|my_center|LOCUS_32070 >Feature sequence1034 1313 18 gene locus_tag LOCUS_32080 1313 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 1515 2480 gene locus_tag LOCUS_32090 1515 2480 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945412.1 protein_id gnl|my_center|LOCUS_32090 2571 2816 gene locus_tag LOCUS_32100 2571 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence1035 1407 181 gene locus_tag LOCUS_32110 1407 181 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399256.1 protein_id gnl|my_center|LOCUS_32110 2390 1506 gene locus_tag LOCUS_32120 gene galU 2390 1506 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002097988.1 protein_id gnl|my_center|LOCUS_32120 >Feature sequence1036 <1 770 gene locus_tag LOCUS_32130 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528765.1:tail fiber protein 1270 1803 gene locus_tag LOCUS_32140 gene msrA 1270 1803 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434146.1 protein_id gnl|my_center|LOCUS_32140 2710 2081 gene locus_tag LOCUS_32150 2710 2081 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922137.1 protein_id gnl|my_center|LOCUS_32150 >Feature sequence1037 1789 827 gene locus_tag LOCUS_32160 gene holA 1789 827 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_32160 1862 2644 gene locus_tag LOCUS_32170 1862 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32170 >Feature sequence1038 871 167 gene locus_tag LOCUS_32180 871 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 1492 1370 gene locus_tag LOCUS_32190 1492 1370 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071823295.1 protein_id gnl|my_center|LOCUS_32190 1783 1658 gene locus_tag LOCUS_32200 1783 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 1927 1793 gene locus_tag LOCUS_32210 gene psbF 1927 1793 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_32210 2204 1953 gene locus_tag LOCUS_32220 gene psbE 2204 1953 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_32220 >Feature sequence1039 2087 2338 gene locus_tag LOCUS_32230 2087 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056812.1 protein_id gnl|my_center|LOCUS_32230 >Feature sequence1040 >Feature sequence1041 635 2035 gene locus_tag LOCUS_32240 635 2035 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193345479.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence1042 646 53 gene locus_tag LOCUS_32250 646 53 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_32250 1533 829 gene locus_tag LOCUS_32260 1533 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 2536 2015 gene locus_tag LOCUS_32270 2536 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 >Feature sequence1043 1378 452 gene locus_tag LOCUS_32280 1378 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1460 2428 gene locus_tag LOCUS_32290 1460 2428 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056901.1 protein_id gnl|my_center|LOCUS_32290 >Feature sequence1044 1131 724 gene locus_tag LOCUS_32300 1131 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 <2822 1400 gene locus_tag LOCUS_32310 <2822 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012548770.1:flippase-like domain-containing protein >Feature sequence1045 895 1119 gene locus_tag LOCUS_32320 895 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 1606 1788 gene locus_tag LOCUS_32330 1606 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 1837 2571 gene locus_tag LOCUS_32340 1837 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence1046 64 1314 gene locus_tag LOCUS_32350 64 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 1377 1562 gene locus_tag LOCUS_32360 1377 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 1728 2267 gene locus_tag LOCUS_32370 1728 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 2273 2671 gene locus_tag LOCUS_32380 2273 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32380 >Feature sequence1047 <1 1168 gene locus_tag LOCUS_32390 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase 2133 1489 gene locus_tag LOCUS_32400 2133 1489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 <2820 2130 gene locus_tag LOCUS_32410 <2820 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054879778.1:AAA family ATPase >Feature sequence1048 1408 1010 gene locus_tag LOCUS_32420 1408 1010 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_32420 <2819 1615 gene locus_tag LOCUS_32430 <2819 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_189099273.1:alanine/glycine:cation symporter family protein >Feature sequence1049 <1 2310 gene locus_tag LOCUS_32440 <1 2310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence1050 2526 334 gene locus_tag LOCUS_32450 2526 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence1051 1505 519 gene locus_tag LOCUS_32460 1505 519 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057151.1 protein_id gnl|my_center|LOCUS_32460 2024 1719 gene locus_tag LOCUS_32470 2024 1719 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_32470 <2817 2261 gene locus_tag LOCUS_32480 <2817 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144180.1:ATP-dependent protease ATP-binding subunit ClpX >Feature sequence1052 234 551 gene locus_tag LOCUS_32490 234 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 544 801 gene locus_tag LOCUS_32500 544 801 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_32500 879 2513 gene locus_tag LOCUS_32510 879 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence1053 534 767 gene locus_tag LOCUS_32520 534 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2527 1271 gene locus_tag LOCUS_32530 2527 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918446.1 protein_id gnl|my_center|LOCUS_32530 >Feature sequence1054 964 497 gene locus_tag LOCUS_32540 964 497 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_32540 1055 2545 gene locus_tag LOCUS_32550 1055 2545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 >Feature sequence1055 1377 514 gene locus_tag LOCUS_32560 1377 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 2237 1401 gene locus_tag LOCUS_32570 2237 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 >Feature sequence1056 55 1860 gene locus_tag LOCUS_32580 55 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence1057 1546 2343 gene locus_tag LOCUS_32590 1546 2343 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970102.1 protein_id gnl|my_center|LOCUS_32590 >Feature sequence1058 730 1278 gene locus_tag LOCUS_32600 730 1278 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141034.1 protein_id gnl|my_center|LOCUS_32600 1375 2172 gene locus_tag LOCUS_32610 1375 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence1059 208 1005 gene locus_tag LOCUS_32620 208 1005 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973816.1 protein_id gnl|my_center|LOCUS_32620 2025 1354 gene locus_tag LOCUS_32630 2025 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 2188 2373 gene locus_tag LOCUS_32640 2188 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 >Feature sequence1060 1881 1255 gene locus_tag LOCUS_32650 gene rnhB 1881 1255 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221870.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence1061 73 1803 gene locus_tag LOCUS_32660 73 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32660 >Feature sequence1062 488 102 gene locus_tag LOCUS_32670 488 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 1878 811 gene locus_tag LOCUS_32680 1878 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 >Feature sequence1063 1029 172 gene locus_tag LOCUS_32690 1029 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 >Feature sequence1064 690 136 gene locus_tag LOCUS_32700 690 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 1937 1287 gene locus_tag LOCUS_32710 1937 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 >Feature sequence1065 1770 2489 gene locus_tag LOCUS_32720 1770 2489 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_32720 >Feature sequence1066 <2802 673 gene locus_tag LOCUS_32730 <2802 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015921365.1:transglutaminase family protein >Feature sequence1067 735 2540 gene locus_tag LOCUS_32740 735 2540 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056620.1 protein_id gnl|my_center|LOCUS_32740 >Feature sequence1068 122 1066 gene locus_tag LOCUS_32750 122 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 2360 1680 gene locus_tag LOCUS_32760 2360 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 >Feature sequence1069 2617 698 gene locus_tag LOCUS_32770 2617 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32770 >Feature sequence1070 1454 285 gene locus_tag LOCUS_32780 1454 285 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence1071 2054 618 gene locus_tag LOCUS_32790 gene pds 2054 618 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_32790 <2797 2217 gene locus_tag LOCUS_32800 <2797 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435038.1:Uma2 family endonuclease >Feature sequence1072 1933 827 gene locus_tag LOCUS_32810 1933 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 >Feature sequence1073 912 391 gene locus_tag LOCUS_32820 912 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 2363 933 gene locus_tag LOCUS_32830 2363 933 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057316.1 protein_id gnl|my_center|LOCUS_32830 >Feature sequence1074 471 172 gene locus_tag LOCUS_32840 471 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 1923 778 gene locus_tag LOCUS_32850 1923 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 2554 1934 gene locus_tag LOCUS_32860 2554 1934 CDS product IS607-like element ISTko1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249606.1 protein_id gnl|my_center|LOCUS_32860 >Feature sequence1075 1407 874 gene locus_tag LOCUS_32870 gene def 1407 874 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071316.1 protein_id gnl|my_center|LOCUS_32870 2653 2345 gene locus_tag LOCUS_32880 2653 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence1076 <1 1573 gene locus_tag LOCUS_32890 <1 1573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056669.1:arginine--tRNA ligase <2791 1755 gene locus_tag LOCUS_32900 <2791 1755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence1077 2195 1293 gene locus_tag LOCUS_32910 2195 1293 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence1078 1064 213 gene locus_tag LOCUS_32920 1064 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1986 1048 gene locus_tag LOCUS_32930 1986 1048 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273465.1 protein_id gnl|my_center|LOCUS_32930 >Feature sequence1079 <1 752 gene locus_tag LOCUS_32940 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036534662.1:ABC transporter substrate-binding protein 1641 1030 gene locus_tag LOCUS_32950 1641 1030 CDS product CPP1-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058181.1 protein_id gnl|my_center|LOCUS_32950 <2785 2223 gene locus_tag LOCUS_32960 <2785 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799068.1:peptidoglycan editing factor PgeF >Feature sequence1080 600 749 gene locus_tag LOCUS_32970 600 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 2197 863 gene locus_tag LOCUS_32980 2197 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32980 >Feature sequence1081 343 1941 gene locus_tag LOCUS_32990 343 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 >Feature sequence1082 663 1886 gene locus_tag LOCUS_33000 gene nagA 663 1886 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057928.1 protein_id gnl|my_center|LOCUS_33000 >Feature sequence1083 269 418 gene locus_tag LOCUS_33010 269 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 430 741 gene locus_tag LOCUS_33020 430 741 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_33020 1176 1517 gene locus_tag LOCUS_33030 1176 1517 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_33030 2073 2375 gene locus_tag LOCUS_33040 2073 2375 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence1084 <2777 850 gene locus_tag LOCUS_33050 <2777 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058092.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence1085 77 1168 gene locus_tag LOCUS_33060 77 1168 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057388.1 protein_id gnl|my_center|LOCUS_33060 1928 1680 gene locus_tag LOCUS_33070 1928 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 2392 2078 gene locus_tag LOCUS_33080 2392 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence1086 1314 727 gene locus_tag LOCUS_33090 1314 727 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140085.1 protein_id gnl|my_center|LOCUS_33090 1414 1971 gene locus_tag LOCUS_33100 1414 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 >Feature sequence1087 2357 189 gene locus_tag LOCUS_33110 2357 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 >Feature sequence1088 <1 538 gene locus_tag LOCUS_33120 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015184994.1:pentapeptide repeat-containing protein 1260 781 gene locus_tag LOCUS_33130 1260 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 <2774 2248 gene locus_tag LOCUS_33140 <2774 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056003.1:peptide chain release factor 1 >Feature sequence1089 313 444 gene locus_tag LOCUS_33150 313 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 423 569 gene locus_tag LOCUS_33160 423 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 860 1054 gene locus_tag LOCUS_33170 860 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 1648 2148 gene locus_tag LOCUS_33180 1648 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 >Feature sequence1090 826 1698 gene locus_tag LOCUS_33190 826 1698 CDS product aldose epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920915.1 protein_id gnl|my_center|LOCUS_33190 2103 2175 gene locus_tag LOCUS_t00310 2103 2175 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1091 283 1314 gene locus_tag LOCUS_33200 283 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 1452 2321 gene locus_tag LOCUS_33210 1452 2321 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056458.1 protein_id gnl|my_center|LOCUS_33210 >Feature sequence1092 593 144 gene locus_tag LOCUS_33220 593 144 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125638.1 protein_id gnl|my_center|LOCUS_33220 1792 830 gene locus_tag LOCUS_33230 1792 830 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643856.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence1093 1336 593 gene locus_tag LOCUS_33240 1336 593 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_33240 1877 2632 gene locus_tag LOCUS_33250 1877 2632 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141260.1 protein_id gnl|my_center|LOCUS_33250 >Feature sequence1094 949 275 gene locus_tag LOCUS_33260 949 275 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_33260 2625 1663 gene locus_tag LOCUS_33270 gene cysK 2625 1663 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056355.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence1095 435 1892 gene locus_tag LOCUS_33280 435 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence1096 <1 2156 gene locus_tag LOCUS_33290 <1 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein >Feature sequence1097 1436 372 gene locus_tag LOCUS_33300 1436 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence1098 1309 1698 gene locus_tag LOCUS_33310 1309 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 1688 1819 gene locus_tag LOCUS_33320 1688 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 2455 1973 gene locus_tag LOCUS_33330 2455 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 >Feature sequence1099 1345 653 gene locus_tag LOCUS_33340 gene tpiA 1345 653 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798681.1 protein_id gnl|my_center|LOCUS_33340 1694 1509 gene locus_tag LOCUS_33350 1694 1509 CDS product PCP reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143955.1 protein_id gnl|my_center|LOCUS_33350 >Feature sequence1100 391 101 gene locus_tag LOCUS_33360 391 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 721 1371 gene locus_tag LOCUS_33370 gene purN 721 1371 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_33370 2556 1555 gene locus_tag LOCUS_33380 gene galT 2556 1555 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258726.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence1101 877 2652 gene locus_tag LOCUS_33390 gene ggt 877 2652 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000805086.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence1102 238 801 gene locus_tag LOCUS_33400 238 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 1782 1372 gene locus_tag LOCUS_33410 1782 1372 CDS product nuclease A inhibitor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142296.1 protein_id gnl|my_center|LOCUS_33410 2252 1809 gene locus_tag LOCUS_33420 2252 1809 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_33420 2436 2678 gene locus_tag LOCUS_33430 2436 2678 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056230.1 protein_id gnl|my_center|LOCUS_33430 >Feature sequence1103 569 1291 gene locus_tag LOCUS_33440 569 1291 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_33440 1986 1783 gene locus_tag LOCUS_33450 1986 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 2222 2070 gene locus_tag LOCUS_33460 2222 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence1104 2004 1486 gene locus_tag LOCUS_33470 2004 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33470 >Feature sequence1105 1302 562 gene locus_tag LOCUS_33480 1302 562 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007353051.1 protein_id gnl|my_center|LOCUS_33480 1468 2613 gene locus_tag LOCUS_33490 1468 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 >Feature sequence1106 <1 1789 gene locus_tag LOCUS_33500 <1 1789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140564.1:PhoX family protein >Feature sequence1107 1388 600 gene locus_tag LOCUS_33510 1388 600 CDS product circadian clock KaiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920713.1 protein_id gnl|my_center|LOCUS_33510 <2752 1524 gene locus_tag LOCUS_33520 <2752 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056402.1:type IV pilus twitching motility protein PilT >Feature sequence1108 268 2355 gene locus_tag LOCUS_33530 268 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33530 >Feature sequence1109 1846 2742 gene locus_tag LOCUS_33540 1846 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence1110 457 1659 gene locus_tag LOCUS_33550 457 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33550 >Feature sequence1111 407 706 gene locus_tag LOCUS_33560 407 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 716 907 gene locus_tag LOCUS_33570 716 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 965 1174 gene locus_tag LOCUS_33580 965 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 <2750 1659 gene locus_tag LOCUS_33590 <2750 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056931.1:diflavin flavoprotein >Feature sequence1112 <1 724 gene locus_tag LOCUS_33600 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942605.1:glycosyltransferase 770 1480 gene locus_tag LOCUS_33610 770 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33610 1522 2226 gene locus_tag LOCUS_33620 1522 2226 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122393.1 protein_id gnl|my_center|LOCUS_33620 2244 2747 gene locus_tag LOCUS_33630 2244 2747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33630 >Feature sequence1113 1112 1303 gene locus_tag LOCUS_33640 1112 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 1394 1804 gene locus_tag LOCUS_33650 1394 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_33650 >Feature sequence1114 434 84 gene locus_tag LOCUS_33660 434 84 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_33660 881 576 gene locus_tag LOCUS_33670 881 576 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence1115 1713 1360 gene locus_tag LOCUS_33680 1713 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33680 2666 1950 gene locus_tag LOCUS_33690 2666 1950 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941936.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence1116 1775 6 gene locus_tag LOCUS_33700 1775 6 CDS product fatty acyl-AMP ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928895.1 protein_id gnl|my_center|LOCUS_33700 >Feature sequence1117 724 236 gene locus_tag LOCUS_33710 724 236 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140128.1 protein_id gnl|my_center|LOCUS_33710 <2741 1181 gene locus_tag LOCUS_33720 <2741 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458930.1:NHLP bacteriocin export ABC transporter permease/ATPase subunit >Feature sequence1118 165 740 gene locus_tag LOCUS_33730 165 740 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_33730 748 1434 gene locus_tag LOCUS_33740 gene nfi 748 1434 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_33740 1601 1855 gene locus_tag LOCUS_33750 1601 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33750 2209 2496 gene locus_tag LOCUS_33760 2209 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 >Feature sequence1119 372 124 gene locus_tag LOCUS_33770 372 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 704 459 gene locus_tag LOCUS_33780 704 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 1817 708 gene locus_tag LOCUS_33790 1817 708 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_33790 <2739 1810 gene locus_tag LOCUS_33800 <2739 1810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202567.1:DUF262 domain-containing protein >Feature sequence1120 <1 2109 gene locus_tag LOCUS_33810 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056163.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence1121 1510 1049 gene locus_tag LOCUS_33820 1510 1049 CDS product ABA4-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143823.1 protein_id gnl|my_center|LOCUS_33820 >Feature sequence1122 539 1468 gene locus_tag LOCUS_33830 539 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 2541 1465 gene locus_tag LOCUS_33840 2541 1465 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_33840 >Feature sequence1123 214 696 gene locus_tag LOCUS_33850 214 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 1954 1247 gene locus_tag LOCUS_33860 1954 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155662648.1 protein_id gnl|my_center|LOCUS_33860 >Feature sequence1124 1802 1080 gene locus_tag LOCUS_33870 1802 1080 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_33870 2034 2312 gene locus_tag LOCUS_33880 2034 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33880 >Feature sequence1125 >Feature sequence1126 <2724 276 gene locus_tag LOCUS_33890 <2724 276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence1127 167 613 gene locus_tag LOCUS_33900 gene ureE 167 613 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_33900 662 1375 gene locus_tag LOCUS_33910 662 1375 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_33910 1718 2320 gene locus_tag LOCUS_33920 gene ureG 1718 2320 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055912.1 protein_id gnl|my_center|LOCUS_33920 >Feature sequence1128 944 2665 gene locus_tag LOCUS_33930 944 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 >Feature sequence1129 634 2538 gene locus_tag LOCUS_33940 634 2538 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920876.1 protein_id gnl|my_center|LOCUS_33940 >Feature sequence1130 <1 1567 gene locus_tag LOCUS_33950 <1 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391777.1:AarF/ABC1/UbiB kinase family protein >Feature sequence1131 535 1551 gene locus_tag LOCUS_33960 535 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 2107 1739 gene locus_tag LOCUS_33970 gene mazF 2107 1739 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_33970 2342 2091 gene locus_tag LOCUS_33980 2342 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 >Feature sequence1132 878 57 gene locus_tag LOCUS_33990 878 57 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056927.1 protein_id gnl|my_center|LOCUS_33990 >Feature sequence1133 1586 105 gene locus_tag LOCUS_34000 1586 105 CDS product 2-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920832.1 protein_id gnl|my_center|LOCUS_34000 >Feature sequence1134 <1 863 gene locus_tag LOCUS_34010 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057329.1:RNA-guided endonuclease TnpB family protein 1335 937 gene locus_tag LOCUS_34020 1335 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34020 >Feature sequence1135 272 117 gene locus_tag LOCUS_34030 272 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34030 1783 344 gene locus_tag LOCUS_34040 1783 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 2361 1897 gene locus_tag LOCUS_34050 2361 1897 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532101.1 protein_id gnl|my_center|LOCUS_34050 >Feature sequence1136 1576 1187 gene locus_tag LOCUS_34060 1576 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1763 2239 gene locus_tag LOCUS_34070 1763 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence1137 <1 2580 gene locus_tag LOCUS_34080 <1 2580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142684.1:glycerol-3-phosphate acyltransferase >Feature sequence1138 1871 726 gene locus_tag LOCUS_34090 gene murA 1871 726 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_34090 >Feature sequence1139 1242 112 gene locus_tag LOCUS_34100 1242 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34100 1737 1420 gene locus_tag LOCUS_34110 1737 1420 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_34110 1982 2521 gene locus_tag LOCUS_34120 1982 2521 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056803.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence1140 1263 202 gene locus_tag LOCUS_34130 gene tsaD 1263 202 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056353.1 protein_id gnl|my_center|LOCUS_34130 1407 1895 gene locus_tag LOCUS_34140 1407 1895 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_34140 2043 2168 gene locus_tag LOCUS_34150 gene psaJ 2043 2168 CDS product photosystem I reaction center subunit IX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058244.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence1141 219 467 gene locus_tag LOCUS_34160 219 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34160 403 642 gene locus_tag LOCUS_34170 403 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34170 1936 1106 gene locus_tag LOCUS_34180 1936 1106 CDS product capsular polysaccharide synthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153423751.1 protein_id gnl|my_center|LOCUS_34180 >Feature sequence1142 81 1589 gene locus_tag LOCUS_34190 81 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 <2703 1576 gene locus_tag LOCUS_34200 <2703 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1143 135 419 gene locus_tag LOCUS_34210 135 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34210 423 1004 gene locus_tag LOCUS_34220 423 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34220 1448 2410 gene locus_tag LOCUS_34230 1448 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence1144 433 1272 gene locus_tag LOCUS_34240 433 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 2594 1485 gene locus_tag LOCUS_34250 2594 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34250 >Feature sequence1145 280 540 gene locus_tag LOCUS_34260 280 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34260 2362 617 gene locus_tag LOCUS_34270 2362 617 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057930.1 protein_id gnl|my_center|LOCUS_34270 >Feature sequence1146 228 386 gene locus_tag LOCUS_34280 228 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 2249 936 gene locus_tag LOCUS_34290 2249 936 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_34290 >Feature sequence1147 <1 565 gene locus_tag LOCUS_34300 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920873.1:J domain-containing protein 715 1971 gene locus_tag LOCUS_34310 715 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 2249 2121 gene locus_tag LOCUS_34320 2249 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 >Feature sequence1148 3 230 gene locus_tag LOCUS_34330 3 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 535 1341 gene locus_tag LOCUS_34340 535 1341 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_34340 >Feature sequence1149 1820 687 gene locus_tag LOCUS_34350 1820 687 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056273.1 protein_id gnl|my_center|LOCUS_34350 >Feature sequence1150 1616 714 gene locus_tag LOCUS_34360 1616 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_34360 1831 2433 gene locus_tag LOCUS_34370 1831 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34370 >Feature sequence1151 446 144 gene locus_tag LOCUS_34380 446 144 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143981.1 protein_id gnl|my_center|LOCUS_34380 654 1553 gene locus_tag LOCUS_34390 654 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 >Feature sequence1152 961 1446 gene locus_tag LOCUS_34400 gene apcA 961 1446 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_34400 1620 2105 gene locus_tag LOCUS_34410 gene apcB 1620 2105 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_34410 2480 2683 gene locus_tag LOCUS_34420 2480 2683 CDS product phycobilisome linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056799.1 protein_id gnl|my_center|LOCUS_34420 >Feature sequence1153 2597 1494 gene locus_tag LOCUS_34430 2597 1494 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214433169.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence1154 1180 1617 gene locus_tag LOCUS_34440 1180 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 2446 1835 gene locus_tag LOCUS_34450 2446 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34450 >Feature sequence1155 2323 935 gene locus_tag LOCUS_34460 2323 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 >Feature sequence1156 231 716 gene locus_tag LOCUS_34470 231 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 1013 1180 gene locus_tag LOCUS_34480 1013 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34480 >Feature sequence1157 431 1525 gene locus_tag LOCUS_34490 431 1525 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141227.1 protein_id gnl|my_center|LOCUS_34490 >Feature sequence1158 356 919 gene locus_tag LOCUS_34500 356 919 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392284.1 protein_id gnl|my_center|LOCUS_34500 >Feature sequence1159 1973 738 gene locus_tag LOCUS_34510 1973 738 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056989.1 protein_id gnl|my_center|LOCUS_34510 2467 2303 gene locus_tag LOCUS_34520 2467 2303 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_34520 >Feature sequence1160 580 2442 gene locus_tag LOCUS_34530 580 2442 CDS product DUF3685 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058156.1 protein_id gnl|my_center|LOCUS_34530 >Feature sequence1161 665 273 gene locus_tag LOCUS_34540 665 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_34540 1756 1442 gene locus_tag LOCUS_34550 1756 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 <2676 1932 gene locus_tag LOCUS_34560 <2676 1932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459021.1:NarK family nitrate/nitrite MFS transporter >Feature sequence1162 <1 612 gene locus_tag LOCUS_34570 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122761.1:oligosaccharide flippase family protein 1424 705 gene locus_tag LOCUS_34580 1424 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 2302 1493 gene locus_tag LOCUS_34590 2302 1493 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257980.1 protein_id gnl|my_center|LOCUS_34590 >Feature sequence1163 550 477 gene locus_tag LOCUS_t00320 550 477 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2290 878 gene locus_tag LOCUS_34600 2290 878 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_34600 >Feature sequence1164 708 1811 gene locus_tag LOCUS_34610 708 1811 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_34610 >Feature sequence1165 1162 440 gene locus_tag LOCUS_34620 gene folE 1162 440 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015079151.1 protein_id gnl|my_center|LOCUS_34620 >Feature sequence1166 1176 187 gene locus_tag LOCUS_34630 gene pheS 1176 187 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056537.1 protein_id gnl|my_center|LOCUS_34630 1442 1798 gene locus_tag LOCUS_34640 1442 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 1791 2096 gene locus_tag LOCUS_34650 1791 2096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34650 >Feature sequence1167 266 51 gene locus_tag LOCUS_34660 266 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 2393 270 gene locus_tag LOCUS_34670 2393 270 CDS product Na-K-Cl cotransporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404985.1 protein_id gnl|my_center|LOCUS_34670 >Feature sequence1168 1759 1316 gene locus_tag LOCUS_34680 1759 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 >Feature sequence1169 2014 1508 gene locus_tag LOCUS_34690 2014 1508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 >Feature sequence1170 2188 548 gene locus_tag LOCUS_34700 2188 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34700 >Feature sequence1171 <2670 464 gene locus_tag LOCUS_34710 <2670 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence1172 1154 789 gene locus_tag LOCUS_34720 1154 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 <2669 1530 gene locus_tag LOCUS_34730 <2669 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056884.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase >Feature sequence1173 <1 1082 gene locus_tag LOCUS_34740 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027390899.1:InlB B-repeat-containing protein 2117 1794 gene locus_tag LOCUS_34750 2117 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 2391 2567 gene locus_tag LOCUS_34760 2391 2567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 >Feature sequence1174 <1 917 gene locus_tag LOCUS_34770 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase 1130 1420 gene locus_tag LOCUS_34780 1130 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 1578 2267 gene locus_tag LOCUS_34790 1578 2267 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141522.1 protein_id gnl|my_center|LOCUS_34790 >Feature sequence1175 515 2065 gene locus_tag LOCUS_34800 515 2065 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_34800 >Feature sequence1176 144 560 gene locus_tag LOCUS_34810 144 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34810 616 1461 gene locus_tag LOCUS_34820 616 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence1177 1371 436 gene locus_tag LOCUS_34830 1371 436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2573 1605 gene locus_tag LOCUS_34840 2573 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 >Feature sequence1178 635 1930 gene locus_tag LOCUS_34850 635 1930 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057446.1 protein_id gnl|my_center|LOCUS_34850 2663 2244 gene locus_tag LOCUS_34860 2663 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence1179 877 1725 gene locus_tag LOCUS_34870 877 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 >Feature sequence1180 455 784 gene locus_tag LOCUS_34880 455 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 2071 1172 gene locus_tag LOCUS_34890 2071 1172 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142331.1 protein_id gnl|my_center|LOCUS_34890 >Feature sequence1181 1120 2325 gene locus_tag LOCUS_34900 1120 2325 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_34900 >Feature sequence1182 918 247 gene locus_tag LOCUS_34910 918 247 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057788.1 protein_id gnl|my_center|LOCUS_34910 >Feature sequence1183 450 2330 gene locus_tag LOCUS_34920 450 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence1184 <1 576 gene locus_tag LOCUS_34930 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_126986764.1:methylenetetrahydrofolate reductase 1138 686 gene locus_tag LOCUS_34940 1138 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 2525 1329 gene locus_tag LOCUS_34950 2525 1329 CDS product DUF3095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258404.1 protein_id gnl|my_center|LOCUS_34950 >Feature sequence1185 39 509 gene locus_tag LOCUS_34960 39 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34960 610 852 gene locus_tag LOCUS_34970 610 852 CDS product TIGR02450 family Trp-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142102.1 protein_id gnl|my_center|LOCUS_34970 1026 1640 gene locus_tag LOCUS_34980 1026 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34980 2017 1739 gene locus_tag LOCUS_34990 2017 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 <2656 2156 gene locus_tag LOCUS_35000 <2656 2156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109278575.1:RNA-guided endonuclease TnpB family protein >Feature sequence1186 <1 1259 gene locus_tag LOCUS_35010 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921083.1:homoserine dehydrogenase 1980 1822 gene locus_tag LOCUS_35020 1980 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence1187 <1 2505 gene locus_tag LOCUS_35030 <1 2505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence1188 554 871 gene locus_tag LOCUS_35040 554 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35040 >Feature sequence1189 <2647 1224 gene locus_tag LOCUS_35050 <2647 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011229107.1:FdhF/YdeP family oxidoreductase >Feature sequence1190 809 189 gene locus_tag LOCUS_35060 809 189 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967596.1 protein_id gnl|my_center|LOCUS_35060 <2647 1966 gene locus_tag LOCUS_35070 <2647 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058290.1:DNA helicase PcrA >Feature sequence1191 1444 227 gene locus_tag LOCUS_35080 1444 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35080 1757 2521 gene locus_tag LOCUS_35090 1757 2521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35090 >Feature sequence1192 1496 885 gene locus_tag LOCUS_35100 1496 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 2327 1845 gene locus_tag LOCUS_35110 2327 1845 CDS product DUF2656 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142941.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence1193 2405 1920 gene locus_tag LOCUS_35120 2405 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35120 >Feature sequence1194 621 1532 gene locus_tag LOCUS_35130 621 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 1895 2509 gene locus_tag LOCUS_35140 1895 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35140 >Feature sequence1195 2262 895 gene locus_tag LOCUS_35150 2262 895 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_35150 >Feature sequence1196 <1 915 gene locus_tag LOCUS_35160 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056385.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 2073 1024 gene locus_tag LOCUS_35170 2073 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35170 >Feature sequence1197 228 998 gene locus_tag LOCUS_35180 gene fetB 228 998 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_35180 1442 2515 gene locus_tag LOCUS_35190 gene rsgA 1442 2515 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143435.1 protein_id gnl|my_center|LOCUS_35190 >Feature sequence1198 1643 2548 gene locus_tag LOCUS_35200 1643 2548 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_35200 >Feature sequence1199 296 1771 gene locus_tag LOCUS_35210 296 1771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057120.1 protein_id gnl|my_center|LOCUS_35210 1835 2617 gene locus_tag LOCUS_35220 1835 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35220 >Feature sequence1200 >Feature sequence1201 202 354 gene locus_tag LOCUS_35230 202 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 762 472 gene locus_tag LOCUS_35240 gene gatC 762 472 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057364.1 protein_id gnl|my_center|LOCUS_35240 1327 806 gene locus_tag LOCUS_35250 1327 806 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_35250 2184 1666 gene locus_tag LOCUS_35260 2184 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence1202 205 327 gene locus_tag LOCUS_35270 205 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 >Feature sequence1203 2389 1412 gene locus_tag LOCUS_35280 2389 1412 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057199.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence1204 1182 889 gene locus_tag LOCUS_35290 1182 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 1489 1205 gene locus_tag LOCUS_35300 gene psbE 1489 1205 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_35300 >Feature sequence1205 <1 567 gene locus_tag LOCUS_35310 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921052.1:amidohydrolase 1177 1827 gene locus_tag LOCUS_35320 1177 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 2111 2548 gene locus_tag LOCUS_35330 2111 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 >Feature sequence1206 1111 215 gene locus_tag LOCUS_35340 1111 215 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922471.1 protein_id gnl|my_center|LOCUS_35340 1482 2450 gene locus_tag LOCUS_35350 1482 2450 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142351.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence1207 <2626 1129 gene locus_tag LOCUS_35360 <2626 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875999.1:histidine kinase dimerization/phosphoacceptor domain -containing protein >Feature sequence1208 491 1957 gene locus_tag LOCUS_35370 491 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 >Feature sequence1209 1278 52 gene locus_tag LOCUS_35380 1278 52 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254458.1 protein_id gnl|my_center|LOCUS_35380 <2624 1819 gene locus_tag LOCUS_35390 <2624 1819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263137.1:choloylglycine hydrolase family protein >Feature sequence1210 <1 855 gene locus_tag LOCUS_35400 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012166094.1:aminomethyl-transferring glycine dehydrogenase 1276 1683 gene locus_tag LOCUS_35410 1276 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 1684 1887 gene locus_tag LOCUS_35420 1684 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 <2623 2078 gene locus_tag LOCUS_35430 <2623 2078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057636.1:Uma2 family endonuclease >Feature sequence1211 465 1169 gene locus_tag LOCUS_35440 465 1169 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126987297.1 protein_id gnl|my_center|LOCUS_35440 1566 2225 gene locus_tag LOCUS_35450 1566 2225 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057242.1 protein_id gnl|my_center|LOCUS_35450 >Feature sequence1212 1267 464 gene locus_tag LOCUS_35460 gene phnE 1267 464 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_35460 2438 1515 gene locus_tag LOCUS_35470 2438 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence1213 421 993 gene locus_tag LOCUS_35480 421 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 <2619 1516 gene locus_tag LOCUS_35490 <2619 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056136.1:histidinol-phosphate transaminase >Feature sequence1214 <1 2287 gene locus_tag LOCUS_35500 <1 2287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057114.1:alpha/beta hydrolase >Feature sequence1215 943 818 gene locus_tag LOCUS_35510 943 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 1208 1083 gene locus_tag LOCUS_35520 1208 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 2412 1327 gene locus_tag LOCUS_35530 2412 1327 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence1216 618 1826 gene locus_tag LOCUS_35540 gene istA 618 1826 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082936577.1 protein_id gnl|my_center|LOCUS_35540 1726 2541 gene locus_tag LOCUS_35550 gene istB 1726 2541 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144054.1 protein_id gnl|my_center|LOCUS_35550 >Feature sequence1217 356 2224 gene locus_tag LOCUS_35560 356 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 >Feature sequence1218 170 18 gene locus_tag LOCUS_35570 170 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 434 264 gene locus_tag LOCUS_35580 434 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35580 1641 799 gene locus_tag LOCUS_35590 1641 799 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929171.1 protein_id gnl|my_center|LOCUS_35590 >Feature sequence1219 814 443 gene locus_tag LOCUS_35600 814 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 2549 819 gene locus_tag LOCUS_35610 2549 819 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022425.1 protein_id gnl|my_center|LOCUS_35610 >Feature sequence1220 <1 562 gene locus_tag LOCUS_35620 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165444156.1:superoxide dismutase >Feature sequence1221 470 775 gene locus_tag LOCUS_35630 470 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 784 1089 gene locus_tag LOCUS_35640 784 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 1683 2063 gene locus_tag LOCUS_35650 1683 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35650 2023 2244 gene locus_tag LOCUS_35660 2023 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 >Feature sequence1222 441 1340 gene locus_tag LOCUS_35670 441 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence1223 523 1200 gene locus_tag LOCUS_35680 523 1200 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407919.1 protein_id gnl|my_center|LOCUS_35680 1623 2303 gene locus_tag LOCUS_35690 1623 2303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055990.1 protein_id gnl|my_center|LOCUS_35690 >Feature sequence1224 1902 2585 gene locus_tag LOCUS_35700 1902 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 >Feature sequence1225 946 1737 gene locus_tag LOCUS_35710 946 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35710 <2607 1758 gene locus_tag LOCUS_35720 <2607 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204368676.1:CHASE2 domain-containing serine/threonine-protein kinase >Feature sequence1226 1730 1203 gene locus_tag LOCUS_35730 1730 1203 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_35730 <2605 1737 gene locus_tag LOCUS_35740 <2605 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000023794.1:OmpA family protein >Feature sequence1227 93 2570 gene locus_tag LOCUS_35750 93 2570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 >Feature sequence1228 1205 558 gene locus_tag LOCUS_35760 1205 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_35760 2261 1386 gene locus_tag LOCUS_35770 2261 1386 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459437.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence1229 287 1192 gene locus_tag LOCUS_35780 gene coxB 287 1192 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928955.1 protein_id gnl|my_center|LOCUS_35780 >Feature sequence1230 721 176 gene locus_tag LOCUS_35790 721 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35790 1488 841 gene locus_tag LOCUS_35800 1488 841 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_35800 <2602 1666 gene locus_tag LOCUS_35810 <2602 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056240.1:F0F1 ATP synthase subunit gamma >Feature sequence1231 2371 800 gene locus_tag LOCUS_35820 2371 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 >Feature sequence1232 196 2145 gene locus_tag LOCUS_35830 196 2145 CDS product arachidonate 15-lipoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895542.1 protein_id gnl|my_center|LOCUS_35830 >Feature sequence1233 1084 311 gene locus_tag LOCUS_35840 gene gloB 1084 311 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_35840 1265 1486 gene locus_tag LOCUS_35850 1265 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1234 >Feature sequence1235 1252 665 gene locus_tag LOCUS_35860 1252 665 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence1236 81 8 gene locus_tag LOCUS_t00330 81 8 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 170 96 gene locus_tag LOCUS_t00340 170 96 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 249 176 gene locus_tag LOCUS_t00350 249 176 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 414 340 gene locus_tag LOCUS_t00360 414 340 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 497 425 gene locus_tag LOCUS_t00370 497 425 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 598 511 gene locus_tag LOCUS_t00380 598 511 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 691 602 gene locus_tag LOCUS_t00390 691 602 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 827 753 gene locus_tag LOCUS_t00400 827 753 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 903 830 gene locus_tag LOCUS_t00410 903 830 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 987 915 gene locus_tag LOCUS_t00420 987 915 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1064 988 gene locus_tag LOCUS_t00430 1064 988 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2021 1551 gene locus_tag LOCUS_35870 2021 1551 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_35870 >Feature sequence1237 555 1286 gene locus_tag LOCUS_35880 555 1286 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_35880 1346 1999 gene locus_tag LOCUS_35890 1346 1999 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056532.1 protein_id gnl|my_center|LOCUS_35890 >Feature sequence1238 1120 1974 gene locus_tag LOCUS_35900 1120 1974 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921020.1 protein_id gnl|my_center|LOCUS_35900 >Feature sequence1239 2509 2069 gene locus_tag LOCUS_35910 2509 2069 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_35910 >Feature sequence1240 370 753 gene locus_tag LOCUS_35920 370 753 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929212.1 protein_id gnl|my_center|LOCUS_35920 1281 2540 gene locus_tag LOCUS_35930 gene rodA 1281 2540 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920901.1 protein_id gnl|my_center|LOCUS_35930 >Feature sequence1241 375 151 gene locus_tag LOCUS_35940 375 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 828 703 gene locus_tag LOCUS_35950 828 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35950 2440 1358 gene locus_tag LOCUS_35960 gene rfaE1 2440 1358 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence1242 2369 1260 gene locus_tag LOCUS_35970 2369 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35970 >Feature sequence1243 826 278 gene locus_tag LOCUS_35980 826 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 1023 2396 gene locus_tag LOCUS_35990 1023 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 >Feature sequence1244 1613 192 gene locus_tag LOCUS_36000 gene bchE 1613 192 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083675.1 protein_id gnl|my_center|LOCUS_36000 1827 2498 gene locus_tag LOCUS_36010 1827 2498 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944031.1 protein_id gnl|my_center|LOCUS_36010 >Feature sequence1245 370 747 gene locus_tag LOCUS_36020 370 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36020 2070 1771 gene locus_tag LOCUS_36030 2070 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36030 >Feature sequence1246 >Feature sequence1247 341 2401 gene locus_tag LOCUS_36040 341 2401 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920751.1 protein_id gnl|my_center|LOCUS_36040 >Feature sequence1248 2388 274 gene locus_tag LOCUS_36050 2388 274 CDS product NHLP family bacteriocin export ABC transporter peptidase/permease/ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814910.1 protein_id gnl|my_center|LOCUS_36050 >Feature sequence1249 <1 548 gene locus_tag LOCUS_36060 <1 548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057114.1:alpha/beta hydrolase 1490 732 gene locus_tag LOCUS_36070 1490 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence1250 263 1285 gene locus_tag LOCUS_36080 263 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 2177 1314 gene locus_tag LOCUS_36090 gene nadC 2177 1314 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057550.1 protein_id gnl|my_center|LOCUS_36090 2420 2187 gene locus_tag LOCUS_36100 2420 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 >Feature sequence1251 1273 593 gene locus_tag LOCUS_36110 1273 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 1882 1439 gene locus_tag LOCUS_36120 1882 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 2118 2504 gene locus_tag LOCUS_36130 2118 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36130 >Feature sequence1252 <1 816 gene locus_tag LOCUS_36140 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920924.1:Gfo/Idh/MocA family oxidoreductase 2266 1910 gene locus_tag LOCUS_36150 2266 1910 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125356.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence1253 434 1534 gene locus_tag LOCUS_36160 434 1534 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428415.1 protein_id gnl|my_center|LOCUS_36160 1690 2538 gene locus_tag LOCUS_36170 1690 2538 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020826.1 protein_id gnl|my_center|LOCUS_36170 >Feature sequence1254 1725 562 gene locus_tag LOCUS_36180 1725 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 1831 2310 gene locus_tag LOCUS_36190 1831 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 >Feature sequence1255 1154 129 gene locus_tag LOCUS_36200 1154 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 2279 1659 gene locus_tag LOCUS_36210 2279 1659 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144355.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence1256 303 1325 gene locus_tag LOCUS_36220 303 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 1500 2273 gene locus_tag LOCUS_36230 1500 2273 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057759.1 protein_id gnl|my_center|LOCUS_36230 >Feature sequence1257 2027 162 gene locus_tag LOCUS_36240 2027 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 >Feature sequence1258 657 1976 gene locus_tag LOCUS_36250 657 1976 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932301.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence1259 52 612 gene locus_tag LOCUS_36260 52 612 CDS product late competence development ComFB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056693.1 protein_id gnl|my_center|LOCUS_36260 1551 844 gene locus_tag LOCUS_36270 gene psb29 1551 844 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_36270 >Feature sequence1260 650 510 gene locus_tag LOCUS_36280 650 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 1139 852 gene locus_tag LOCUS_36290 1139 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36290 <2571 1827 gene locus_tag LOCUS_36300 <2571 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090620535.1:patatin-like phospholipase family protein >Feature sequence1261 >Feature sequence1262 <1 534 gene locus_tag LOCUS_36310 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096391.1:IS5-like element IS903B family transposase 800 1255 gene locus_tag LOCUS_36320 800 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36320 1637 1855 gene locus_tag LOCUS_36330 1637 1855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 >Feature sequence1263 1060 1311 gene locus_tag LOCUS_36340 1060 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36340 2417 1695 gene locus_tag LOCUS_36350 2417 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_36350 >Feature sequence1264 535 269 gene locus_tag LOCUS_36360 535 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 1372 635 gene locus_tag LOCUS_36370 1372 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_36370 >Feature sequence1265 1050 88 gene locus_tag LOCUS_36380 gene hemC 1050 88 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057483.1 protein_id gnl|my_center|LOCUS_36380 <2568 1785 gene locus_tag LOCUS_36390 <2568 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence1266 573 1136 gene locus_tag LOCUS_36400 573 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 >Feature sequence1267 961 230 gene locus_tag LOCUS_36410 961 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 1978 974 gene locus_tag LOCUS_36420 1978 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36420 >Feature sequence1268 402 869 gene locus_tag LOCUS_36430 402 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 2040 991 gene locus_tag LOCUS_36440 2040 991 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_36440 >Feature sequence1269 1578 289 gene locus_tag LOCUS_36450 gene urtA 1578 289 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_36450 >Feature sequence1270 <1 1149 gene locus_tag LOCUS_36460 <1 1149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012165757.1:glycosyltransferase >Feature sequence1271 598 1077 gene locus_tag LOCUS_36470 598 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 1976 1098 gene locus_tag LOCUS_36480 1976 1098 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015184994.1 protein_id gnl|my_center|LOCUS_36480 2488 2000 gene locus_tag LOCUS_36490 2488 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36490 >Feature sequence1272 1247 1657 gene locus_tag LOCUS_36500 1247 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36500 >Feature sequence1273 239 1396 gene locus_tag LOCUS_36510 239 1396 CDS product DUF819 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967022.1 protein_id gnl|my_center|LOCUS_36510 <2561 1648 gene locus_tag LOCUS_36520 <2561 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929004.1:metallophosphoesterase >Feature sequence1274 1983 1027 gene locus_tag LOCUS_36530 1983 1027 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056119.1 protein_id gnl|my_center|LOCUS_36530 >Feature sequence1275 <1 1746 gene locus_tag LOCUS_36540 <1 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057604.1:polysaccharide biosynthesis tyrosine autokinase >Feature sequence1276 1090 707 gene locus_tag LOCUS_36550 1090 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_36550 >Feature sequence1277 1860 133 gene locus_tag LOCUS_36560 1860 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 >Feature sequence1278 245 874 gene locus_tag LOCUS_36570 gene lepB 245 874 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920934.1 protein_id gnl|my_center|LOCUS_36570 2076 898 gene locus_tag LOCUS_36580 2076 898 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_36580 >Feature sequence1279 1795 332 gene locus_tag LOCUS_36590 1795 332 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_36590 >Feature sequence1280 1458 1826 gene locus_tag LOCUS_36600 1458 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 1930 2307 gene locus_tag LOCUS_36610 1930 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 >Feature sequence1281 <1 1525 gene locus_tag LOCUS_36620 <1 1525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140924.1:sigma 54-interacting transcriptional regulator 1737 1928 gene locus_tag LOCUS_36630 1737 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36630 >Feature sequence1282 443 919 gene locus_tag LOCUS_36640 gene ndhN 443 919 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_36640 996 2222 gene locus_tag LOCUS_36650 996 2222 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056586.1 protein_id gnl|my_center|LOCUS_36650 >Feature sequence1283 1280 408 gene locus_tag LOCUS_36660 1280 408 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058003.1 protein_id gnl|my_center|LOCUS_36660 1532 2218 gene locus_tag LOCUS_36670 gene trmD 1532 2218 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057450.1 protein_id gnl|my_center|LOCUS_36670 >Feature sequence1284 259 645 gene locus_tag LOCUS_36680 259 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 648 1022 gene locus_tag LOCUS_36690 648 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36690 1576 1361 gene locus_tag LOCUS_36700 1576 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36700 >Feature sequence1285 2542 728 gene locus_tag LOCUS_36710 2542 728 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142199.1 protein_id gnl|my_center|LOCUS_36710 >Feature sequence1286 <1 622 gene locus_tag LOCUS_36720 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530922.1:ribonuclease T(2) 626 1609 gene locus_tag LOCUS_36730 626 1609 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920860.1 protein_id gnl|my_center|LOCUS_36730 2376 2035 gene locus_tag LOCUS_36740 2376 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 >Feature sequence1287 <2546 241 gene locus_tag LOCUS_36750 <2546 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938707.1:EAL domain-containing protein >Feature sequence1288 56 1876 gene locus_tag LOCUS_36760 56 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 2031 2198 gene locus_tag LOCUS_36770 2031 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36770 >Feature sequence1289 1441 536 gene locus_tag LOCUS_36780 1441 536 CDS product glutaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056446.1 protein_id gnl|my_center|LOCUS_36780 >Feature sequence1290 <1 1073 gene locus_tag LOCUS_36790 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066867760.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 1087 2130 gene locus_tag LOCUS_36800 gene neuB 1087 2130 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066398080.1 protein_id gnl|my_center|LOCUS_36800 >Feature sequence1291 803 300 gene locus_tag LOCUS_36810 803 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36810 1401 895 gene locus_tag LOCUS_36820 gene ybeY 1401 895 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928724.1 protein_id gnl|my_center|LOCUS_36820 1623 1429 gene locus_tag LOCUS_36830 1623 1429 CDS product DUF3285 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057423.1 protein_id gnl|my_center|LOCUS_36830 2011 1769 gene locus_tag LOCUS_36840 2011 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 >Feature sequence1292 991 1473 gene locus_tag LOCUS_36850 991 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 >Feature sequence1293 969 337 gene locus_tag LOCUS_36860 gene tenA 969 337 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979013.1 protein_id gnl|my_center|LOCUS_36860 >Feature sequence1294 961 596 gene locus_tag LOCUS_36870 961 596 CDS product DUF5615 family PIN-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190909147.1 protein_id gnl|my_center|LOCUS_36870 1257 964 gene locus_tag LOCUS_36880 1257 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1887 1477 gene locus_tag LOCUS_36890 1887 1477 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_36890 >Feature sequence1295 397 1248 gene locus_tag LOCUS_36900 397 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36900 >Feature sequence1296 1771 653 gene locus_tag LOCUS_36910 gene rfbE 1771 653 CDS product GDP-perosamine synthase RfbE/PerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000875215.1 protein_id gnl|my_center|LOCUS_36910 2334 1903 gene locus_tag LOCUS_36920 2334 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 >Feature sequence1297 2157 367 gene locus_tag LOCUS_36930 2157 367 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975336.1 protein_id gnl|my_center|LOCUS_36930 >Feature sequence1298 1085 648 gene locus_tag LOCUS_36940 1085 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056982.1 protein_id gnl|my_center|LOCUS_36940 1357 2223 gene locus_tag LOCUS_36950 1357 2223 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142171.1 protein_id gnl|my_center|LOCUS_36950 >Feature sequence1299 1572 1348 gene locus_tag LOCUS_36960 1572 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_36960 2306 2001 gene locus_tag LOCUS_36970 2306 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36970 >Feature sequence1300 2297 888 gene locus_tag LOCUS_36980 2297 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 >Feature sequence1301 1074 826 gene locus_tag LOCUS_36990 gene acpP 1074 826 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_36990 >Feature sequence1302 <2531 256 gene locus_tag LOCUS_37000 <2531 256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence1303 888 157 gene locus_tag LOCUS_37010 888 157 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173676.1 protein_id gnl|my_center|LOCUS_37010 1179 940 gene locus_tag LOCUS_37020 1179 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 1819 1448 gene locus_tag LOCUS_37030 1819 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37030 <2530 1867 gene locus_tag LOCUS_37040 <2530 1867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056001.1:NnrU family protein >Feature sequence1304 385 1872 gene locus_tag LOCUS_37050 gene pap 385 1872 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869086.1 protein_id gnl|my_center|LOCUS_37050 >Feature sequence1305 1844 1473 gene locus_tag LOCUS_37060 1844 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057860.1 protein_id gnl|my_center|LOCUS_37060 >Feature sequence1306 357 1790 gene locus_tag LOCUS_37070 357 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37070 >Feature sequence1307 331 1317 gene locus_tag LOCUS_37080 gene msrP 331 1317 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196774.1 protein_id gnl|my_center|LOCUS_37080 1845 2039 gene locus_tag LOCUS_37090 1845 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence1308 260 868 gene locus_tag LOCUS_37100 260 868 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929250.1 protein_id gnl|my_center|LOCUS_37100 1259 1032 gene locus_tag LOCUS_37110 1259 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37110 2142 1150 gene locus_tag LOCUS_37120 2142 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37120 >Feature sequence1309 268 1752 gene locus_tag LOCUS_37130 268 1752 CDS product DASH family cryptochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140837.1 protein_id gnl|my_center|LOCUS_37130 1891 2094 gene locus_tag LOCUS_37140 1891 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37140 2101 2436 gene locus_tag LOCUS_37150 2101 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37150 >Feature sequence1310 185 550 gene locus_tag LOCUS_37160 185 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37160 733 1071 gene locus_tag LOCUS_37170 733 1071 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103126030.1 protein_id gnl|my_center|LOCUS_37170 1622 1389 gene locus_tag LOCUS_37180 1622 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37180 1962 1807 gene locus_tag LOCUS_37190 1962 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 >Feature sequence1311 1833 2294 gene locus_tag LOCUS_37200 1833 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37200 >Feature sequence1312 423 860 gene locus_tag LOCUS_37210 423 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 <2520 1086 gene locus_tag LOCUS_37220 <2520 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence1313 470 2077 gene locus_tag LOCUS_37230 470 2077 CDS product iron uptake porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920919.1 protein_id gnl|my_center|LOCUS_37230 >Feature sequence1314 337 777 gene locus_tag LOCUS_37240 337 777 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056936.1 protein_id gnl|my_center|LOCUS_37240 1133 1468 gene locus_tag LOCUS_37250 1133 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 >Feature sequence1315 1734 535 gene locus_tag LOCUS_37260 gene lpxB 1734 535 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056176.1 protein_id gnl|my_center|LOCUS_37260 >Feature sequence1316 1231 425 gene locus_tag LOCUS_37270 1231 425 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920815.1 protein_id gnl|my_center|LOCUS_37270 >Feature sequence1317 971 444 gene locus_tag LOCUS_37280 971 444 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_37280 1169 1498 gene locus_tag LOCUS_37290 1169 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37290 >Feature sequence1318 1906 2064 gene locus_tag LOCUS_37300 1906 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37300 >Feature sequence1319 343 1617 gene locus_tag LOCUS_37310 343 1617 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383518.1 protein_id gnl|my_center|LOCUS_37310 2420 2004 gene locus_tag LOCUS_37320 2420 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37320 >Feature sequence1320 <1 1780 gene locus_tag LOCUS_37330 <1 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein <2516 1918 gene locus_tag LOCUS_37340 <2516 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142619.1:glycoside hydrolase >Feature sequence1321 1186 2193 gene locus_tag LOCUS_37350 1186 2193 CDS product RNA polymerase sigma factor, RpoD/SigA family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193329020.1 protein_id gnl|my_center|LOCUS_37350 >Feature sequence1322 1764 676 gene locus_tag LOCUS_37360 gene mltG 1764 676 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141130.1 protein_id gnl|my_center|LOCUS_37360 2476 1904 gene locus_tag LOCUS_37370 2476 1904 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057704.1 protein_id gnl|my_center|LOCUS_37370 >Feature sequence1323 596 1513 gene locus_tag LOCUS_37380 596 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37380 >Feature sequence1324 1473 790 gene locus_tag LOCUS_37390 1473 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 >Feature sequence1325 166 2403 gene locus_tag LOCUS_37400 166 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 >Feature sequence1326 141 1322 gene locus_tag LOCUS_37410 141 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 1368 1496 gene locus_tag LOCUS_37420 1368 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37420 1499 2098 gene locus_tag LOCUS_37430 1499 2098 CDS product tRNA isopentenyl-2-thiomethyl-A-37 hydroxylase MiaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058204.1 protein_id gnl|my_center|LOCUS_37430 >Feature sequence1327 1524 175 gene locus_tag LOCUS_37440 1524 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence1328 80 445 gene locus_tag LOCUS_37450 80 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37450 1061 678 gene locus_tag LOCUS_37460 1061 678 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_37460 1585 1370 gene locus_tag LOCUS_37470 1585 1370 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_37470 2060 2299 gene locus_tag LOCUS_37480 2060 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37480 >Feature sequence1329 147 779 gene locus_tag LOCUS_37490 147 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37490 809 1285 gene locus_tag LOCUS_37500 809 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37500 1309 1749 gene locus_tag LOCUS_37510 1309 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 1746 2186 gene locus_tag LOCUS_37520 1746 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37520 >Feature sequence1330 2189 18 gene locus_tag LOCUS_37530 2189 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 >Feature sequence1331 1863 796 gene locus_tag LOCUS_37540 1863 796 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_37540 >Feature sequence1332 245 1876 gene locus_tag LOCUS_37550 245 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 >Feature sequence1333 2147 774 gene locus_tag LOCUS_37560 2147 774 CDS product cytochrome c biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056530.1 protein_id gnl|my_center|LOCUS_37560 >Feature sequence1334 906 1568 gene locus_tag LOCUS_37570 906 1568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37570 1659 2408 gene locus_tag LOCUS_37580 1659 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37580 >Feature sequence1335 2209 980 gene locus_tag LOCUS_37590 2209 980 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_37590 >Feature sequence1336 <1 924 gene locus_tag LOCUS_37600 <1 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943358.1:protein-methionine-sulfoxide reductase catalytic subunit MsrP 1065 1259 gene locus_tag LOCUS_37610 1065 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37610 <2487 1535 gene locus_tag LOCUS_37620 <2487 1535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141800.1:family 10 glycosylhydrolase >Feature sequence1337 <1 988 gene locus_tag LOCUS_37630 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein 1286 2455 gene locus_tag LOCUS_37640 1286 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence1338 <1 2036 gene locus_tag LOCUS_37650 <1 2036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1339 109 801 gene locus_tag LOCUS_37660 109 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37660 1063 1986 gene locus_tag LOCUS_37670 1063 1986 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_37670 >Feature sequence1340 822 1091 gene locus_tag LOCUS_37680 822 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 1252 1593 gene locus_tag LOCUS_37690 1252 1593 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_37690 1583 1936 gene locus_tag LOCUS_37700 1583 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 >Feature sequence1341 1170 25 gene locus_tag LOCUS_37710 1170 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 2005 1472 gene locus_tag LOCUS_37720 2005 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 >Feature sequence1342 923 1474 gene locus_tag LOCUS_37730 923 1474 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932300.1 protein_id gnl|my_center|LOCUS_37730 1799 1542 gene locus_tag LOCUS_37740 1799 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37740 >Feature sequence1343 1046 1474 gene locus_tag LOCUS_37750 1046 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37750 1471 2061 gene locus_tag LOCUS_37760 1471 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37760 >Feature sequence1344 <2477 1029 gene locus_tag LOCUS_37770 <2477 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058108.1:pyruvate kinase >Feature sequence1345 876 1955 gene locus_tag LOCUS_37780 876 1955 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055863.1 protein_id gnl|my_center|LOCUS_37780 >Feature sequence1346 956 363 gene locus_tag LOCUS_37790 956 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 <2475 1208 gene locus_tag LOCUS_37800 <2475 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084554.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifE >Feature sequence1347 <2474 912 gene locus_tag LOCUS_37810 <2474 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056986.1:aspartate--tRNA ligase >Feature sequence1348 709 975 gene locus_tag LOCUS_37820 709 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 938 1804 gene locus_tag LOCUS_37830 938 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 <2474 1918 gene locus_tag LOCUS_37840 <2474 1918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056308.1:photosystem II D2 protein (photosystem q(a) protein) >Feature sequence1349 <1 566 gene locus_tag LOCUS_37850 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057691.1:glycosyltransferase family 2 protein 1089 2306 gene locus_tag LOCUS_37860 gene sucC 1089 2306 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941719.1 protein_id gnl|my_center|LOCUS_37860 >Feature sequence1350 1339 278 gene locus_tag LOCUS_37870 1339 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37870 <2472 1428 gene locus_tag LOCUS_37880 <2472 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056643.1:RecQ family ATP-dependent DNA helicase >Feature sequence1351 >Feature sequence1352 2387 990 gene locus_tag LOCUS_37890 2387 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37890 >Feature sequence1353 1301 1104 gene locus_tag LOCUS_37900 1301 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_37900 <2467 1659 gene locus_tag LOCUS_37910 <2467 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143083.1:methyltransferase domain-containing protein >Feature sequence1354 1506 2072 gene locus_tag LOCUS_37920 1506 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_37920 2341 2466 gene locus_tag LOCUS_37930 2341 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 >Feature sequence1355 <1 2411 gene locus_tag LOCUS_37940 <1 2411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057813.1:CHAT domain-containing protein >Feature sequence1356 165 293 gene locus_tag LOCUS_37950 165 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37950 628 930 gene locus_tag LOCUS_37960 628 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37960 971 1432 gene locus_tag LOCUS_37970 971 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 1910 1701 gene locus_tag LOCUS_37980 1910 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 1933 2058 gene locus_tag LOCUS_37990 1933 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 >Feature sequence1357 <2460 528 gene locus_tag LOCUS_38000 <2460 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081188.1:glycosyltransferase >Feature sequence1358 798 118 gene locus_tag LOCUS_38010 798 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38010 1832 2170 gene locus_tag LOCUS_38020 1832 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 >Feature sequence1359 >Feature sequence1360 >Feature sequence1361 <2456 257 gene locus_tag LOCUS_38030 <2456 257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence1362 522 989 gene locus_tag LOCUS_38040 522 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38040 2119 983 gene locus_tag LOCUS_38050 2119 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 >Feature sequence1363 912 343 gene locus_tag LOCUS_38060 912 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 1223 2308 gene locus_tag LOCUS_38070 1223 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 >Feature sequence1364 1708 1304 gene locus_tag LOCUS_38080 1708 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38080 2224 1778 gene locus_tag LOCUS_38090 2224 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 >Feature sequence1365 674 198 gene locus_tag LOCUS_38100 674 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38100 1832 1194 gene locus_tag LOCUS_38110 1832 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 >Feature sequence1366 1940 2272 gene locus_tag LOCUS_38120 1940 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38120 >Feature sequence1367 >Feature sequence1368 908 2041 gene locus_tag LOCUS_38130 908 2041 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058078.1 protein_id gnl|my_center|LOCUS_38130 >Feature sequence1369 321 55 gene locus_tag LOCUS_38140 321 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 718 314 gene locus_tag LOCUS_38150 718 314 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000356374.1 protein_id gnl|my_center|LOCUS_38150 2258 828 gene locus_tag LOCUS_38160 2258 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 >Feature sequence1370 438 650 gene locus_tag LOCUS_38170 438 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_38170 1473 1201 gene locus_tag LOCUS_38180 1473 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38180 >Feature sequence1371 1248 817 gene locus_tag LOCUS_38190 1248 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38190 <2444 1808 gene locus_tag LOCUS_38200 <2444 1808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140771.1:imidazoleglycerol-phosphate dehydratase HisB >Feature sequence1372 1373 468 gene locus_tag LOCUS_38210 1373 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38210 >Feature sequence1373 1806 1327 gene locus_tag LOCUS_38220 1806 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38220 <2441 1844 gene locus_tag LOCUS_38230 <2441 1844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920808.1:glycine--tRNA ligase subunit alpha >Feature sequence1374 998 2260 gene locus_tag LOCUS_38240 998 2260 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798996.1 protein_id gnl|my_center|LOCUS_38240 >Feature sequence1375 248 394 gene locus_tag LOCUS_38250 248 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 841 503 gene locus_tag LOCUS_38260 841 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 1748 2413 gene locus_tag LOCUS_38270 gene tmk 1748 2413 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057890.1 protein_id gnl|my_center|LOCUS_38270 >Feature sequence1376 1381 50 gene locus_tag LOCUS_38280 1381 50 CDS product proton extrusion protein PcxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226578028.1 protein_id gnl|my_center|LOCUS_38280 1802 1485 gene locus_tag LOCUS_38290 gene trxA 1802 1485 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921014.1 protein_id gnl|my_center|LOCUS_38290 >Feature sequence1377 665 66 gene locus_tag LOCUS_38300 665 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38300 1747 1025 gene locus_tag LOCUS_38310 1747 1025 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_38310 >Feature sequence1378 1049 195 gene locus_tag LOCUS_38320 1049 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 1277 1110 gene locus_tag LOCUS_38330 1277 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38330 1956 1588 gene locus_tag LOCUS_38340 1956 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence1379 <2432 96 gene locus_tag LOCUS_38350 <2432 96 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007358327.1:DNA-directed RNA polymerase subunit beta' >Feature sequence1380 2276 1026 gene locus_tag LOCUS_38360 2276 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 >Feature sequence1381 <1 2340 gene locus_tag LOCUS_38370 <1 2340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225863.1:BTAD domain-containing putative transcriptional regulator >Feature sequence1382 1302 202 gene locus_tag LOCUS_38380 1302 202 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964062.1 protein_id gnl|my_center|LOCUS_38380 2403 1579 gene locus_tag LOCUS_38390 2403 1579 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_38390 >Feature sequence1383 188 322 gene locus_tag LOCUS_38400 188 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 845 1273 gene locus_tag LOCUS_38410 gene psbU 845 1273 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_38410 >Feature sequence1384 558 292 gene locus_tag LOCUS_38420 558 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38420 >Feature sequence1385 225 2018 gene locus_tag LOCUS_38430 225 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_38430 >Feature sequence1386 590 517 gene locus_tag LOCUS_t00440 590 517 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 834 1319 gene locus_tag LOCUS_38440 834 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 2274 1828 gene locus_tag LOCUS_38450 2274 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38450 >Feature sequence1387 32 1735 gene locus_tag LOCUS_38460 32 1735 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228221.1 protein_id gnl|my_center|LOCUS_38460 >Feature sequence1388 407 132 gene locus_tag LOCUS_38470 407 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 951 454 gene locus_tag LOCUS_38480 951 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence1389 1614 1225 gene locus_tag LOCUS_38490 1614 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38490 2312 1938 gene locus_tag LOCUS_38500 2312 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38500 >Feature sequence1390 <2420 1643 gene locus_tag LOCUS_38510 <2420 1643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275506.1:phosphodiester glycosidase family protein >Feature sequence1391 1312 158 gene locus_tag LOCUS_38520 1312 158 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058195.1 protein_id gnl|my_center|LOCUS_38520 <2417 1516 gene locus_tag LOCUS_38530 <2417 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799453.1:AI-2E family transporter >Feature sequence1392 124 663 gene locus_tag LOCUS_38540 124 663 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228308.1 protein_id gnl|my_center|LOCUS_38540 1832 942 gene locus_tag LOCUS_38550 1832 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 >Feature sequence1393 205 537 gene locus_tag LOCUS_38560 205 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 >Feature sequence1394 209 949 gene locus_tag LOCUS_38570 209 949 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057289.1 protein_id gnl|my_center|LOCUS_38570 >Feature sequence1395 585 271 gene locus_tag LOCUS_38580 585 271 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_38580 966 619 gene locus_tag LOCUS_38590 966 619 CDS product DUF2605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_38590 >Feature sequence1396 1739 729 gene locus_tag LOCUS_38600 1739 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38600 >Feature sequence1397 <1 884 gene locus_tag LOCUS_38610 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403590.1:DUF1460 domain-containing protein >Feature sequence1398 1306 1836 gene locus_tag LOCUS_38620 gene infC 1306 1836 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106456574.1 protein_id gnl|my_center|LOCUS_38620 >Feature sequence1399 <1 919 gene locus_tag LOCUS_38630 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057137.1:glycoside hydrolase family 10 protein 1323 1931 gene locus_tag LOCUS_38640 1323 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140189.1 protein_id gnl|my_center|LOCUS_38640 >Feature sequence1400 158 685 gene locus_tag LOCUS_38650 158 685 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_38650 >Feature sequence1401 <2404 1553 gene locus_tag LOCUS_38660 <2404 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228102.1:AEC family transporter >Feature sequence1402 <1 663 gene locus_tag LOCUS_38670 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056285.1:F0F1 ATP synthase subunit A 787 1032 gene locus_tag LOCUS_38680 gene atpE 787 1032 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_38680 1223 1714 gene locus_tag LOCUS_38690 1223 1714 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_38690 >Feature sequence1403 415 1614 gene locus_tag LOCUS_38700 415 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 >Feature sequence1404 >Feature sequence1405 <2401 932 gene locus_tag LOCUS_38710 <2401 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545601.1:hybrid sensor histidine kinase/response regulator >Feature sequence1406 330 563 gene locus_tag LOCUS_38720 330 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_38720 788 633 gene locus_tag LOCUS_38730 788 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 <2401 1009 gene locus_tag LOCUS_38740 <2401 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143667.1:tetratricopeptide repeat protein >Feature sequence1407 628 14 gene locus_tag LOCUS_38750 628 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 1661 648 gene locus_tag LOCUS_38760 1661 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 2061 1651 gene locus_tag LOCUS_38770 2061 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38770 >Feature sequence1408 2130 955 gene locus_tag LOCUS_38780 2130 955 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000942660.1 protein_id gnl|my_center|LOCUS_38780 >Feature sequence1409 <1 1127 gene locus_tag LOCUS_38790 <1 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143065.1:heterodisulfide reductase-related iron-sulfur binding cluster >Feature sequence1410 1655 741 gene locus_tag LOCUS_38800 1655 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 >Feature sequence1411 1 2076 gene locus_tag LOCUS_38810 1 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38810 >Feature sequence1412 <1 1801 gene locus_tag LOCUS_38820 <1 1801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921274.1:DUF4347 domain-containing protein >Feature sequence1413 <2394 142 gene locus_tag LOCUS_38830 <2394 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence1414 459 97 gene locus_tag LOCUS_38840 459 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 797 459 gene locus_tag LOCUS_38850 797 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 1457 1609 gene locus_tag LOCUS_38860 1457 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38860 1739 2266 gene locus_tag LOCUS_38870 1739 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 >Feature sequence1415 233 703 gene locus_tag LOCUS_38880 233 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_38880 725 1528 gene locus_tag LOCUS_38890 725 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 >Feature sequence1416 <1 1763 gene locus_tag LOCUS_38900 <1 1763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141921.1:FAD-dependent oxidoreductase >Feature sequence1417 41 1132 gene locus_tag LOCUS_38910 41 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 1379 1744 gene locus_tag LOCUS_38920 1379 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38920 >Feature sequence1418 408 722 gene locus_tag LOCUS_38930 408 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 667 903 gene locus_tag LOCUS_38940 667 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 1941 2192 gene locus_tag LOCUS_38950 1941 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 >Feature sequence1419 715 281 gene locus_tag LOCUS_38960 715 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 968 666 gene locus_tag LOCUS_38970 968 666 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_38970 1204 974 gene locus_tag LOCUS_38980 1204 974 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014628886.1 protein_id gnl|my_center|LOCUS_38980 1694 1287 gene locus_tag LOCUS_38990 1694 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 <2390 1727 gene locus_tag LOCUS_39000 <2390 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249628.1:zinc metalloprotease HtpX >Feature sequence1420 2094 760 gene locus_tag LOCUS_39010 2094 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 >Feature sequence1421 >Feature sequence1422 2180 357 gene locus_tag LOCUS_39020 2180 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39020 >Feature sequence1423 721 1425 gene locus_tag LOCUS_39030 721 1425 CDS product TenA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883398.1 protein_id gnl|my_center|LOCUS_39030 <2388 1536 gene locus_tag LOCUS_39040 <2388 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817430.1:2-hydroxyacid dehydrogenase family protein >Feature sequence1424 <2388 1035 gene locus_tag LOCUS_39050 <2388 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055986.1:ATP-dependent zinc metalloprotease FtsH3 >Feature sequence1425 2386 1124 gene locus_tag LOCUS_39060 2386 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 >Feature sequence1426 <2384 269 gene locus_tag LOCUS_39070 <2384 269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence1427 512 1753 gene locus_tag LOCUS_39080 512 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39080 >Feature sequence1428 585 112 gene locus_tag LOCUS_39090 585 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39090 1688 741 gene locus_tag LOCUS_39100 1688 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 1687 2151 gene locus_tag LOCUS_39110 1687 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39110 >Feature sequence1429 708 2069 gene locus_tag LOCUS_39120 708 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39120 >Feature sequence1430 >Feature sequence1431 >Feature sequence1432 <1 1296 gene locus_tag LOCUS_39130 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056786.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 1436 1729 gene locus_tag LOCUS_39140 1436 1729 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_39140 >Feature sequence1433 <1 1002 gene locus_tag LOCUS_39150 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026311868.1:formylglycine-generating enzyme family protein >Feature sequence1434 >Feature sequence1435 1990 1166 gene locus_tag LOCUS_39160 1990 1166 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_39160 >Feature sequence1436 288 1367 gene locus_tag LOCUS_39170 gene mnmA 288 1367 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058089.1 protein_id gnl|my_center|LOCUS_39170 >Feature sequence1437 >Feature sequence1438 1418 2149 gene locus_tag LOCUS_39180 1418 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39180 >Feature sequence1439 657 1616 gene locus_tag LOCUS_39190 657 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39190 >Feature sequence1440 1560 1901 gene locus_tag LOCUS_39200 1560 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39200 1938 2081 gene locus_tag LOCUS_39210 1938 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39210 >Feature sequence1441 778 44 gene locus_tag LOCUS_39220 778 44 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259517.1 protein_id gnl|my_center|LOCUS_39220 1590 790 gene locus_tag LOCUS_39230 1590 790 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920686.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence1442 2217 982 gene locus_tag LOCUS_39240 2217 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39240 >Feature sequence1443 <1 1427 gene locus_tag LOCUS_39250 <1 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence1444 <1 536 gene locus_tag LOCUS_39260 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140097.1:aminopeptidase P family protein 1956 622 gene locus_tag LOCUS_39270 1956 622 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_39270 >Feature sequence1445 1290 553 gene locus_tag LOCUS_39280 1290 553 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891922.1 protein_id gnl|my_center|LOCUS_39280 2339 2037 gene locus_tag LOCUS_39290 2339 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39290 >Feature sequence1446 2213 225 gene locus_tag LOCUS_39300 2213 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39300 >Feature sequence1447 186 611 gene locus_tag LOCUS_39310 186 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 793 1518 gene locus_tag LOCUS_39320 793 1518 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056259.1 protein_id gnl|my_center|LOCUS_39320 1957 1574 gene locus_tag LOCUS_39330 1957 1574 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140855.1 protein_id gnl|my_center|LOCUS_39330 >Feature sequence1448 2287 1763 gene locus_tag LOCUS_39340 2287 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_39340 >Feature sequence1449 716 1555 gene locus_tag LOCUS_39350 gene fdhD 716 1555 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003891497.1 protein_id gnl|my_center|LOCUS_39350 2064 2195 gene locus_tag LOCUS_39360 2064 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 >Feature sequence1450 58 948 gene locus_tag LOCUS_39370 58 948 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143051.1 protein_id gnl|my_center|LOCUS_39370 1220 1101 gene locus_tag LOCUS_39380 1220 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 >Feature sequence1451 651 750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1322 2026 gene locus_tag LOCUS_39390 1322 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39390 >Feature sequence1452 117 1055 gene locus_tag LOCUS_39400 117 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39400 1410 2051 gene locus_tag LOCUS_39410 1410 2051 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144255.1 protein_id gnl|my_center|LOCUS_39410 2134 2358 gene locus_tag LOCUS_39420 2134 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 >Feature sequence1453 614 1729 gene locus_tag LOCUS_39430 614 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 >Feature sequence1454 1152 550 gene locus_tag LOCUS_39440 1152 550 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144254.1 protein_id gnl|my_center|LOCUS_39440 >Feature sequence1455 548 775 gene locus_tag LOCUS_39450 548 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 1328 2344 gene locus_tag LOCUS_39460 1328 2344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 >Feature sequence1456 1819 986 gene locus_tag LOCUS_39470 1819 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 <2352 1850 gene locus_tag LOCUS_39480 <2352 1850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037395250.1:ABC transporter permease subunit >Feature sequence1457 >Feature sequence1458 403 2256 gene locus_tag LOCUS_39490 403 2256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39490 >Feature sequence1459 >Feature sequence1460 1230 577 gene locus_tag LOCUS_39500 1230 577 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057562.1 protein_id gnl|my_center|LOCUS_39500 2068 1604 gene locus_tag LOCUS_39510 2068 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 >Feature sequence1461 <2347 287 gene locus_tag LOCUS_39520 <2347 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001130104.1:ATP-binding protein >Feature sequence1462 530 2149 gene locus_tag LOCUS_39530 530 2149 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_39530 >Feature sequence1463 2075 873 gene locus_tag LOCUS_39540 2075 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 >Feature sequence1464 812 1288 gene locus_tag LOCUS_39550 812 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 1555 1409 gene locus_tag LOCUS_39560 1555 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 1740 1546 gene locus_tag LOCUS_39570 1740 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39570 >Feature sequence1465 6 371 gene locus_tag LOCUS_39580 6 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39580 2109 589 gene locus_tag LOCUS_39590 2109 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39590 >Feature sequence1466 668 865 gene locus_tag LOCUS_39600 gene rpmI 668 865 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_39600 884 1240 gene locus_tag LOCUS_39610 gene rplT 884 1240 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_39610 1363 1893 gene locus_tag LOCUS_39620 1363 1893 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921042.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence1467 1961 1302 gene locus_tag LOCUS_39630 1961 1302 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056880.1 protein_id gnl|my_center|LOCUS_39630 >Feature sequence1468 <1 695 gene locus_tag LOCUS_39640 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528360.1:TauD/TfdA family dioxygenase 715 1056 gene locus_tag LOCUS_39650 715 1056 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391689.1 protein_id gnl|my_center|LOCUS_39650 1176 1982 gene locus_tag LOCUS_39660 1176 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 >Feature sequence1469 <1 1155 gene locus_tag LOCUS_39670 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056513.1:dihydroorotase 1413 1664 gene locus_tag LOCUS_39680 1413 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 1725 1997 gene locus_tag LOCUS_39690 1725 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 >Feature sequence1470 1253 1798 gene locus_tag LOCUS_39700 1253 1798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101141.1 protein_id gnl|my_center|LOCUS_39700 >Feature sequence1471 164 1000 gene locus_tag LOCUS_39710 164 1000 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731542.1 protein_id gnl|my_center|LOCUS_39710 1033 1365 gene locus_tag LOCUS_39720 1033 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 1352 1480 gene locus_tag LOCUS_39730 1352 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39730 1571 1852 gene locus_tag LOCUS_39740 1571 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39740 >Feature sequence1472 787 524 gene locus_tag LOCUS_39750 787 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_39750 1238 771 gene locus_tag LOCUS_39760 1238 771 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057653.1 protein_id gnl|my_center|LOCUS_39760 <2340 1235 gene locus_tag LOCUS_39770 <2340 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920933.1:cation:proton antiporter >Feature sequence1473 291 172 gene locus_tag LOCUS_39780 291 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 1644 505 gene locus_tag LOCUS_39790 gene pseC 1644 505 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_39790 <2339 1666 gene locus_tag LOCUS_39800 <2339 1666 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868297.1:dTDP-4-dehydrorhamnose 3,5-epimerase >Feature sequence1474 <1 2129 gene locus_tag LOCUS_39810 <1 2129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence1475 <1 1502 gene locus_tag LOCUS_39820 <1 1502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967491.1:arylsulfatase >Feature sequence1476 218 27 gene locus_tag LOCUS_39830 218 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39830 722 312 gene locus_tag LOCUS_39840 722 312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39840 973 719 gene locus_tag LOCUS_39850 973 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39850 >Feature sequence1477 <1 1490 gene locus_tag LOCUS_39860 <1 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025269720.1:CocE/NonD family hydrolase 1817 2290 gene locus_tag LOCUS_39870 1817 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39870 >Feature sequence1478 284 1129 gene locus_tag LOCUS_39880 284 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 1606 1923 gene locus_tag LOCUS_39890 1606 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 >Feature sequence1479 <1 922 gene locus_tag LOCUS_39900 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037071209.1:transposase 1159 1857 gene locus_tag LOCUS_39910 1159 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 >Feature sequence1480 198 2123 gene locus_tag LOCUS_39920 198 2123 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_39920 2331 2191 gene locus_tag LOCUS_39930 2331 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 >Feature sequence1481 1287 211 gene locus_tag LOCUS_39940 gene acsF 1287 211 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_39940 1605 2084 gene locus_tag LOCUS_39950 1605 2084 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798827.1 protein_id gnl|my_center|LOCUS_39950 >Feature sequence1482 1540 212 gene locus_tag LOCUS_39960 1540 212 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197065.1 protein_id gnl|my_center|LOCUS_39960 >Feature sequence1483 1329 211 gene locus_tag LOCUS_39970 gene wecB 1329 211 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_39970 >Feature sequence1484 130 1296 gene locus_tag LOCUS_39980 gene hpnI 130 1296 CDS product bacteriohopanetetrol glucosamine biosynthesis glycosyltransferase HpnI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941358.1 protein_id gnl|my_center|LOCUS_39980 1527 2048 gene locus_tag LOCUS_39990 1527 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 >Feature sequence1485 1421 750 gene locus_tag LOCUS_40000 1421 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40000 >Feature sequence1486 477 1424 gene locus_tag LOCUS_40010 gene pip 477 1424 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141435.1 protein_id gnl|my_center|LOCUS_40010 >Feature sequence1487 1676 672 gene locus_tag LOCUS_40020 1676 672 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_40020 >Feature sequence1488 625 1302 gene locus_tag LOCUS_40030 625 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 1362 1979 gene locus_tag LOCUS_40040 1362 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence1489 400 693 gene locus_tag LOCUS_40050 400 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40050 836 1681 gene locus_tag LOCUS_40060 836 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 1877 2284 gene locus_tag LOCUS_40070 1877 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40070 >Feature sequence1490 211 630 gene locus_tag LOCUS_40080 211 630 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_40080 1362 661 gene locus_tag LOCUS_40090 1362 661 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057103.1 protein_id gnl|my_center|LOCUS_40090 2235 1447 gene locus_tag LOCUS_40100 2235 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40100 >Feature sequence1491 1454 252 gene locus_tag LOCUS_40110 1454 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40110 1990 1826 gene locus_tag LOCUS_40120 1990 1826 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_40120 >Feature sequence1492 275 1276 gene locus_tag LOCUS_40130 275 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 1355 1645 gene locus_tag LOCUS_40140 1355 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence1493 >Feature sequence1494 <1 814 gene locus_tag LOCUS_40150 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287033.1:ABC transporter substrate-binding protein 1109 2023 gene locus_tag LOCUS_40160 gene potB 1109 2023 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_40160 >Feature sequence1495 2085 742 gene locus_tag LOCUS_40170 2085 742 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093155.1 protein_id gnl|my_center|LOCUS_40170 >Feature sequence1496 1365 868 gene locus_tag LOCUS_40180 gene rplO 1365 868 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055953.1 protein_id gnl|my_center|LOCUS_40180 2059 1526 gene locus_tag LOCUS_40190 gene rpsE 2059 1526 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055952.1 protein_id gnl|my_center|LOCUS_40190 >Feature sequence1497 <1 1073 gene locus_tag LOCUS_40200 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256879.1:glycosyltransferase family 4 protein >Feature sequence1498 <1 2050 gene locus_tag LOCUS_40210 <1 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883927.1:DNA methyltransferase >Feature sequence1499 741 1904 gene locus_tag LOCUS_40220 gene hemH 741 1904 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920998.1 protein_id gnl|my_center|LOCUS_40220 >Feature sequence1500 508 2289 gene locus_tag LOCUS_40230 508 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40230 >Feature sequence1501 1285 2187 gene locus_tag LOCUS_40240 1285 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 >Feature sequence1502 1488 811 gene locus_tag LOCUS_40250 1488 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 >Feature sequence1503 973 200 gene locus_tag LOCUS_40260 973 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40260 >Feature sequence1504 <1 1654 gene locus_tag LOCUS_40270 <1 1654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein >Feature sequence1505 355 1443 gene locus_tag LOCUS_40280 gene cheB 355 1443 CDS product chemotaxis-specific protein-glutamate methyltransferase CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257541.1 protein_id gnl|my_center|LOCUS_40280 1834 1451 gene locus_tag LOCUS_40290 1834 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 >Feature sequence1506 267 1937 gene locus_tag LOCUS_40300 267 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40300 >Feature sequence1507 169 2 gene locus_tag LOCUS_40310 169 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 344 874 gene locus_tag LOCUS_40320 344 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 1762 1223 gene locus_tag LOCUS_40330 1762 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 >Feature sequence1508 528 1196 gene locus_tag LOCUS_40340 528 1196 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142018.1 protein_id gnl|my_center|LOCUS_40340 >Feature sequence1509 1285 467 gene locus_tag LOCUS_40350 1285 467 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920927.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence1510 743 303 gene locus_tag LOCUS_40360 743 303 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057040.1 protein_id gnl|my_center|LOCUS_40360 1103 1510 gene locus_tag LOCUS_40370 1103 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_40370 >Feature sequence1511 234 328 gene locus_tag LOCUS_t00450 234 328 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 844 1740 gene locus_tag LOCUS_40380 844 1740 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 protein_id gnl|my_center|LOCUS_40380 >Feature sequence1512 399 923 gene locus_tag LOCUS_40390 399 923 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527197.1 protein_id gnl|my_center|LOCUS_40390 2192 1347 gene locus_tag LOCUS_40400 2192 1347 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140798.1 protein_id gnl|my_center|LOCUS_40400 >Feature sequence1513 <2294 863 gene locus_tag LOCUS_40410 <2294 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081403079.1:formylglycine-generating enzyme family protein >Feature sequence1514 <1 1803 gene locus_tag LOCUS_40420 <1 1803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143530.1:PDZ domain-containing protein 1886 2290 gene locus_tag LOCUS_40430 1886 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 >Feature sequence1515 212 754 gene locus_tag LOCUS_40440 212 754 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057259.1 protein_id gnl|my_center|LOCUS_40440 870 1514 gene locus_tag LOCUS_40450 gene cbiM 870 1514 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920867.1 protein_id gnl|my_center|LOCUS_40450 >Feature sequence1516 >Feature sequence1517 2091 817 gene locus_tag LOCUS_40460 2091 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 >Feature sequence1518 1755 1024 gene locus_tag LOCUS_40470 gene radC 1755 1024 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920920.1 protein_id gnl|my_center|LOCUS_40470 >Feature sequence1519 613 50 gene locus_tag LOCUS_40480 613 50 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_40480 1519 986 gene locus_tag LOCUS_40490 1519 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 >Feature sequence1520 <2286 1359 gene locus_tag LOCUS_40500 <2286 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010976052.1:calcium-binding protein >Feature sequence1521 <1 956 gene locus_tag LOCUS_40510 <1 956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798653.1:MoxR family ATPase >Feature sequence1522 1678 395 gene locus_tag LOCUS_40520 1678 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40520 <2285 1695 gene locus_tag LOCUS_40530 <2285 1695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545378.1:response regulator >Feature sequence1523 1576 62 gene locus_tag LOCUS_40540 1576 62 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057032.1 protein_id gnl|my_center|LOCUS_40540 >Feature sequence1524 1807 1139 gene locus_tag LOCUS_40550 1807 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40550 2235 1810 gene locus_tag LOCUS_40560 2235 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40560 >Feature sequence1525 1504 1731 gene locus_tag LOCUS_40570 gene yidD 1504 1731 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229076.1 protein_id gnl|my_center|LOCUS_40570 >Feature sequence1526 548 841 gene locus_tag LOCUS_40580 548 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 831 1700 gene locus_tag LOCUS_40590 831 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 >Feature sequence1527 1603 1085 gene locus_tag LOCUS_40600 1603 1085 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024413.1 protein_id gnl|my_center|LOCUS_40600 >Feature sequence1528 935 2005 gene locus_tag LOCUS_40610 935 2005 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_40610 >Feature sequence1529 454 98 gene locus_tag LOCUS_40620 454 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40620 770 1738 gene locus_tag LOCUS_40630 gene choE 770 1738 CDS product cholinesterase ChoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100000.1 protein_id gnl|my_center|LOCUS_40630 >Feature sequence1530 1251 16 gene locus_tag LOCUS_40640 1251 16 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_40640 >Feature sequence1531 717 1673 gene locus_tag LOCUS_40650 717 1673 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_40650 >Feature sequence1532 343 546 gene locus_tag LOCUS_40660 343 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40660 509 1579 gene locus_tag LOCUS_40670 509 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40670 1588 1908 gene locus_tag LOCUS_40680 1588 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40680 >Feature sequence1533 157 1074 gene locus_tag LOCUS_40690 gene rbsK 157 1074 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_40690 <2276 1408 gene locus_tag LOCUS_40700 <2276 1408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529652.1:tetratricopeptide repeat protein >Feature sequence1534 2033 690 gene locus_tag LOCUS_40710 gene guaD 2033 690 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207678.1 protein_id gnl|my_center|LOCUS_40710 >Feature sequence1535 1028 1996 gene locus_tag LOCUS_40720 1028 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_40720 >Feature sequence1536 1276 686 gene locus_tag LOCUS_40730 1276 686 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_40730 >Feature sequence1537 1028 1798 gene locus_tag LOCUS_40740 1028 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40740 >Feature sequence1538 1398 2210 gene locus_tag LOCUS_40750 1398 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40750 >Feature sequence1539 1258 134 gene locus_tag LOCUS_40760 1258 134 CDS product DUF4350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057368.1 protein_id gnl|my_center|LOCUS_40760 1856 1245 gene locus_tag LOCUS_40770 1856 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 >Feature sequence1540 <1 740 gene locus_tag LOCUS_40780 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056964.1:urea ABC transporter permease subunit UrtC 760 1194 gene locus_tag LOCUS_40790 760 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40790 1329 2078 gene locus_tag LOCUS_40800 gene urtD 1329 2078 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_40800 >Feature sequence1541 271 648 gene locus_tag LOCUS_40810 271 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40810 778 2211 gene locus_tag LOCUS_40820 778 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence1542 <1 532 gene locus_tag LOCUS_40830 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000881300.1:peptidoglycan O-acetyltransferase 539 1651 gene locus_tag LOCUS_40840 539 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40840 >Feature sequence1543 997 167 gene locus_tag LOCUS_40850 997 167 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_40850 2210 1698 gene locus_tag LOCUS_40860 gene kdsC 2210 1698 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369496.1 protein_id gnl|my_center|LOCUS_40860 >Feature sequence1544 40 1308 gene locus_tag LOCUS_40870 40 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40870 >Feature sequence1545 101 1513 gene locus_tag LOCUS_40880 101 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_40880 1585 2130 gene locus_tag LOCUS_40890 1585 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 >Feature sequence1546 <1 512 gene locus_tag LOCUS_40900 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162146334.1:restriction endonuclease subunit S 706 2136 gene locus_tag LOCUS_40910 706 2136 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_40910 >Feature sequence1547 1343 324 gene locus_tag LOCUS_40920 1343 324 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643768.1 protein_id gnl|my_center|LOCUS_40920 >Feature sequence1548 294 785 gene locus_tag LOCUS_40930 294 785 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530702.1 protein_id gnl|my_center|LOCUS_40930 772 1752 gene locus_tag LOCUS_40940 772 1752 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268938.1 protein_id gnl|my_center|LOCUS_40940 >Feature sequence1549 1119 502 gene locus_tag LOCUS_40950 1119 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 1503 1207 gene locus_tag LOCUS_40960 1503 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 >Feature sequence1550 <2263 1455 gene locus_tag LOCUS_40970 <2263 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479694.1:SulP family inorganic anion transporter >Feature sequence1551 <2262 4 gene locus_tag LOCUS_40980 <2262 4 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein >Feature sequence1552 1028 45 gene locus_tag LOCUS_40990 1028 45 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066670.1 protein_id gnl|my_center|LOCUS_40990 2036 1038 gene locus_tag LOCUS_41000 2036 1038 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000870126.1 protein_id gnl|my_center|LOCUS_41000 >Feature sequence1553 267 635 gene locus_tag LOCUS_41010 gene rplN 267 635 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_41010 636 1004 gene locus_tag LOCUS_41020 gene rplX 636 1004 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055947.1 protein_id gnl|my_center|LOCUS_41020 1069 1614 gene locus_tag LOCUS_41030 gene rplE 1069 1614 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055948.1 protein_id gnl|my_center|LOCUS_41030 1645 2046 gene locus_tag LOCUS_41040 gene rpsH 1645 2046 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_41040 >Feature sequence1554 <2259 69 gene locus_tag LOCUS_41050 <2259 69 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142489.1:efflux RND transporter permease subunit >Feature sequence1555 1949 948 gene locus_tag LOCUS_41060 1949 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41060 >Feature sequence1556 1632 754 gene locus_tag LOCUS_41070 1632 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141513.1 protein_id gnl|my_center|LOCUS_41070 >Feature sequence1557 314 1051 gene locus_tag LOCUS_41080 314 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 1111 2004 gene locus_tag LOCUS_41090 1111 2004 CDS product bestrophin family ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058043.1 protein_id gnl|my_center|LOCUS_41090 >Feature sequence1558 37 960 gene locus_tag LOCUS_41100 gene pstA 37 960 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941758.1 protein_id gnl|my_center|LOCUS_41100 1115 1918 gene locus_tag LOCUS_41110 gene pstB 1115 1918 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107795169.1 protein_id gnl|my_center|LOCUS_41110 >Feature sequence1559 94 1971 gene locus_tag LOCUS_41120 94 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 >Feature sequence1560 35 415 gene locus_tag LOCUS_41130 35 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 521 748 gene locus_tag LOCUS_41140 521 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41140 988 1296 gene locus_tag LOCUS_41150 988 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 1208 1657 gene locus_tag LOCUS_41160 1208 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41160 >Feature sequence1561 1585 1923 gene locus_tag LOCUS_41170 1585 1923 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141520.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence1562 1310 363 gene locus_tag LOCUS_41180 gene holA 1310 363 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920898.1 protein_id gnl|my_center|LOCUS_41180 1370 2155 gene locus_tag LOCUS_41190 1370 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41190 >Feature sequence1563 <2255 710 gene locus_tag LOCUS_41200 <2255 710 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence1564 1810 746 gene locus_tag LOCUS_41210 1810 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41210 >Feature sequence1565 1325 1038 gene locus_tag LOCUS_41220 1325 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41220 1689 1330 gene locus_tag LOCUS_41230 1689 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41230 >Feature sequence1566 1239 775 gene locus_tag LOCUS_41240 1239 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41240 >Feature sequence1567 1717 515 gene locus_tag LOCUS_41250 1717 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 1908 1837 gene locus_tag LOCUS_t00460 1908 1837 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1568 318 82 gene locus_tag LOCUS_41260 gene secG 318 82 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056943.1 protein_id gnl|my_center|LOCUS_41260 1998 400 gene locus_tag LOCUS_41270 gene gpmI 1998 400 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056006.1 protein_id gnl|my_center|LOCUS_41270 >Feature sequence1569 727 515 gene locus_tag LOCUS_41280 727 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41280 1588 818 gene locus_tag LOCUS_41290 gene hisF 1588 818 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799407.1 protein_id gnl|my_center|LOCUS_41290 >Feature sequence1570 926 33 gene locus_tag LOCUS_41300 926 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence1571 <1 806 gene locus_tag LOCUS_41310 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057521.1:amidophosphoribosyltransferase >Feature sequence1572 370 1482 gene locus_tag LOCUS_41320 gene wecB 370 1482 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_41320 >Feature sequence1573 114 383 gene locus_tag LOCUS_41330 114 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41330 376 804 gene locus_tag LOCUS_41340 376 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41340 862 1785 gene locus_tag LOCUS_41350 862 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41350 >Feature sequence1574 <1 2206 gene locus_tag LOCUS_41360 <1 2206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057451.1:EAL domain-containing protein >Feature sequence1575 268 1941 gene locus_tag LOCUS_41370 268 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41370 >Feature sequence1576 1592 24 gene locus_tag LOCUS_41380 gene ltrA 1592 24 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001097733.1 protein_id gnl|my_center|LOCUS_41380 >Feature sequence1577 1871 132 gene locus_tag LOCUS_41390 1871 132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 >Feature sequence1578 1493 906 gene locus_tag LOCUS_41400 1493 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41400 1643 1518 gene locus_tag LOCUS_41410 1643 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41410 >Feature sequence1579 614 72 gene locus_tag LOCUS_41420 614 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41420 1978 794 gene locus_tag LOCUS_41430 1978 794 CDS product glycosyltransferase family 61 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190897490.1 protein_id gnl|my_center|LOCUS_41430 >Feature sequence1580 235 480 gene locus_tag LOCUS_41440 235 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 697 903 gene locus_tag LOCUS_41450 697 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 1373 2083 gene locus_tag LOCUS_41460 gene rpiA 1373 2083 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057113.1 protein_id gnl|my_center|LOCUS_41460 >Feature sequence1581 1099 248 gene locus_tag LOCUS_41470 1099 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence1582 2141 1686 gene locus_tag LOCUS_41480 2141 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 >Feature sequence1583 13 210 gene locus_tag LOCUS_41490 13 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 >Feature sequence1584 1745 2215 gene locus_tag LOCUS_41500 1745 2215 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_41500 >Feature sequence1585 1074 304 gene locus_tag LOCUS_41510 1074 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 >Feature sequence1586 1469 603 gene locus_tag LOCUS_41520 1469 603 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141972.1 protein_id gnl|my_center|LOCUS_41520 >Feature sequence1587 386 1729 gene locus_tag LOCUS_41530 gene gor 386 1729 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057447.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence1588 >Feature sequence1589 1360 482 gene locus_tag LOCUS_41540 1360 482 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141338.1 protein_id gnl|my_center|LOCUS_41540 1695 1456 gene locus_tag LOCUS_41550 1695 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41550 1589 1846 gene locus_tag LOCUS_41560 1589 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41560 >Feature sequence1590 695 967 gene locus_tag LOCUS_41570 695 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41570 <2231 1068 gene locus_tag LOCUS_41580 <2231 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144393.1:potassium channel protein >Feature sequence1591 629 255 gene locus_tag LOCUS_41590 629 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_41590 1137 1802 gene locus_tag LOCUS_41600 1137 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41600 >Feature sequence1592 1916 444 gene locus_tag LOCUS_41610 1916 444 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920425.1 protein_id gnl|my_center|LOCUS_41610 >Feature sequence1593 349 555 gene locus_tag LOCUS_41620 349 555 CDS product glycogen debranching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921159.1 protein_id gnl|my_center|LOCUS_41620 1861 1229 gene locus_tag LOCUS_41630 1861 1229 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063170453.1 protein_id gnl|my_center|LOCUS_41630 >Feature sequence1594 1199 1813 gene locus_tag LOCUS_41640 1199 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 >Feature sequence1595 134 325 gene locus_tag LOCUS_41650 134 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41650 1606 422 gene locus_tag LOCUS_41660 1606 422 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_41660 >Feature sequence1596 2129 1701 gene locus_tag LOCUS_41670 gene gloA 2129 1701 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143550.1 protein_id gnl|my_center|LOCUS_41670 >Feature sequence1597 544 948 gene locus_tag LOCUS_41680 544 948 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_41680 956 1375 gene locus_tag LOCUS_41690 956 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41690 >Feature sequence1598 997 374 gene locus_tag LOCUS_41700 997 374 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_41700 2061 1603 gene locus_tag LOCUS_41710 2061 1603 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228204.1 protein_id gnl|my_center|LOCUS_41710 >Feature sequence1599 158 1249 gene locus_tag LOCUS_41720 158 1249 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056664.1 protein_id gnl|my_center|LOCUS_41720 1319 1636 gene locus_tag LOCUS_41730 1319 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 1630 2013 gene locus_tag LOCUS_41740 1630 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 >Feature sequence1600 <1 937 gene locus_tag LOCUS_41750 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256383.1:ABC transporter ATP-binding protein >Feature sequence1601 517 1974 gene locus_tag LOCUS_41760 517 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 >Feature sequence1602 687 256 gene locus_tag LOCUS_41770 687 256 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_41770 1237 821 gene locus_tag LOCUS_41780 1237 821 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986038.1 protein_id gnl|my_center|LOCUS_41780 >Feature sequence1603 365 231 gene locus_tag LOCUS_41790 gene psbF 365 231 CDS product cytochrome b559 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057382.1 protein_id gnl|my_center|LOCUS_41790 638 390 gene locus_tag LOCUS_41800 gene psbE 638 390 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057381.1 protein_id gnl|my_center|LOCUS_41800 1841 810 gene locus_tag LOCUS_41810 1841 810 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057532.1 protein_id gnl|my_center|LOCUS_41810 >Feature sequence1604 <1 559 gene locus_tag LOCUS_41820 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003564617.1:ROK family glucokinase 575 898 gene locus_tag LOCUS_41830 gene petF1 575 898 CDS product ferredoxin PetF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056851.1 protein_id gnl|my_center|LOCUS_41830 1038 1472 gene locus_tag LOCUS_41840 1038 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140049.1 protein_id gnl|my_center|LOCUS_41840 >Feature sequence1605 12 1319 gene locus_tag LOCUS_41850 12 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 1262 1729 gene locus_tag LOCUS_41860 1262 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence1606 1427 2065 gene locus_tag LOCUS_41870 1427 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 >Feature sequence1607 2019 1207 gene locus_tag LOCUS_41880 2019 1207 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_41880 >Feature sequence1608 <1 1225 gene locus_tag LOCUS_41890 <1 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence1609 1349 768 gene locus_tag LOCUS_41900 1349 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 >Feature sequence1610 1388 855 gene locus_tag LOCUS_41910 1388 855 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545903.1 protein_id gnl|my_center|LOCUS_41910 1746 1378 gene locus_tag LOCUS_41920 1746 1378 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_41920 1936 2027 gene locus_tag LOCUS_t00470 1936 2027 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1611 <2220 770 gene locus_tag LOCUS_41930 <2220 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057163.1:caspase family protein >Feature sequence1612 838 113 gene locus_tag LOCUS_41940 838 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 >Feature sequence1613 322 1023 gene locus_tag LOCUS_41950 322 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41950 1123 1467 gene locus_tag LOCUS_41960 1123 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence1614 196 729 gene locus_tag LOCUS_41970 196 729 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143752.1 protein_id gnl|my_center|LOCUS_41970 1602 1264 gene locus_tag LOCUS_41980 1602 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41980 >Feature sequence1615 1058 444 gene locus_tag LOCUS_41990 1058 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41990 1434 1664 gene locus_tag LOCUS_42000 1434 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 1744 2169 gene locus_tag LOCUS_42010 1744 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42010 >Feature sequence1616 447 659 gene locus_tag LOCUS_42020 447 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 931 1584 gene locus_tag LOCUS_42030 gene nox 931 1584 CDS product NADH dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227925.1 protein_id gnl|my_center|LOCUS_42030 >Feature sequence1617 2002 389 gene locus_tag LOCUS_42040 2002 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence1618 <1 1441 gene locus_tag LOCUS_42050 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161536185.1:response regulator 1675 2052 gene locus_tag LOCUS_42060 1675 2052 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085073.1 protein_id gnl|my_center|LOCUS_42060 >Feature sequence1619 <1 792 gene locus_tag LOCUS_42070 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144225.1:B12-binding domain-containing radical SAM protein 1295 1501 gene locus_tag LOCUS_42080 1295 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 >Feature sequence1620 1105 1428 gene locus_tag LOCUS_42090 gene clpS 1105 1428 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056930.1 protein_id gnl|my_center|LOCUS_42090 1757 1990 gene locus_tag LOCUS_42100 1757 1990 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_42100 >Feature sequence1621 462 737 gene locus_tag LOCUS_42110 462 737 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_42110 >Feature sequence1622 <2210 1112 gene locus_tag LOCUS_42120 <2210 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124471.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence1623 1034 2062 gene locus_tag LOCUS_42130 1034 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42130 >Feature sequence1624 798 163 gene locus_tag LOCUS_42140 798 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42140 881 953 gene locus_tag LOCUS_t00480 881 953 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2170 956 gene locus_tag LOCUS_42150 2170 956 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058074.1 protein_id gnl|my_center|LOCUS_42150 >Feature sequence1625 191 1081 gene locus_tag LOCUS_42160 gene pheA 191 1081 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594784.1 protein_id gnl|my_center|LOCUS_42160 >Feature sequence1626 465 2117 gene locus_tag LOCUS_42170 465 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42170 >Feature sequence1627 601 1479 gene locus_tag LOCUS_42180 601 1479 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175909.1 protein_id gnl|my_center|LOCUS_42180 >Feature sequence1628 <2206 1578 gene locus_tag LOCUS_42190 <2206 1578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920733.1:phenylalanine--tRNA ligase subunit beta >Feature sequence1629 <1 656 gene locus_tag LOCUS_42200 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140054.1:orange carotenoid protein N-terminal domain-containing protein 884 1216 gene locus_tag LOCUS_42210 884 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42210 2135 1278 gene locus_tag LOCUS_42220 2135 1278 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259386.1 protein_id gnl|my_center|LOCUS_42220 >Feature sequence1630 <1 716 gene locus_tag LOCUS_42230 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056314.1:glutamate racemase 1253 1026 gene locus_tag LOCUS_42240 1253 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42240 >Feature sequence1631 526 1110 gene locus_tag LOCUS_42250 526 1110 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_42250 1320 1805 gene locus_tag LOCUS_42260 gene lspA 1320 1805 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058252.1 protein_id gnl|my_center|LOCUS_42260 >Feature sequence1632 1728 1237 gene locus_tag LOCUS_42270 1728 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42270 >Feature sequence1633 899 75 gene locus_tag LOCUS_42280 899 75 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_42280 1217 1654 gene locus_tag LOCUS_42290 1217 1654 CDS product glyoxalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056265.1 protein_id gnl|my_center|LOCUS_42290 >Feature sequence1634 1676 1843 gene locus_tag LOCUS_42300 1676 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42300 >Feature sequence1635 521 321 gene locus_tag LOCUS_42310 521 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42310 1429 1932 gene locus_tag LOCUS_42320 1429 1932 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_42320 >Feature sequence1636 1881 1258 gene locus_tag LOCUS_42330 1881 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42330 >Feature sequence1637 1747 476 gene locus_tag LOCUS_42340 gene ftsZ 1747 476 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023065873.1 protein_id gnl|my_center|LOCUS_42340 >Feature sequence1638 1753 500 gene locus_tag LOCUS_42350 1753 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42350 >Feature sequence1639 185 487 gene locus_tag LOCUS_42360 185 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42360 <2196 532 gene locus_tag LOCUS_42370 <2196 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056292.1:ATP-binding protein >Feature sequence1640 1186 2100 gene locus_tag LOCUS_42380 1186 2100 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_42380 >Feature sequence1641 1786 1175 gene locus_tag LOCUS_42390 1786 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42390 >Feature sequence1642 909 1811 gene locus_tag LOCUS_42400 909 1811 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_114936010.1 protein_id gnl|my_center|LOCUS_42400 >Feature sequence1643 304 660 gene locus_tag LOCUS_42410 gene rplV 304 660 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_42410 712 1440 gene locus_tag LOCUS_42420 gene rpsC 712 1440 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055942.1 protein_id gnl|my_center|LOCUS_42420 1747 2163 gene locus_tag LOCUS_42430 gene rplP 1747 2163 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_42430 >Feature sequence1644 664 1128 gene locus_tag LOCUS_42440 664 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42440 1731 1324 gene locus_tag LOCUS_42450 1731 1324 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056339.1 protein_id gnl|my_center|LOCUS_42450 2025 1846 gene locus_tag LOCUS_42460 2025 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42460 >Feature sequence1645 162 791 gene locus_tag LOCUS_42470 162 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42470 <2191 958 gene locus_tag LOCUS_42480 <2191 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057167.1:ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent >Feature sequence1646 <2190 1582 gene locus_tag LOCUS_42490 <2190 1582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546883.1:IS200/IS605 family accessory protein TnpB-related protein >Feature sequence1647 <2190 736 gene locus_tag LOCUS_42500 <2190 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence1648 1685 1488 gene locus_tag LOCUS_42510 1685 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42510 1747 1989 gene locus_tag LOCUS_42520 1747 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42520 >Feature sequence1649 1485 364 gene locus_tag LOCUS_42530 1485 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42530 1827 1522 gene locus_tag LOCUS_42540 1827 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42540 >Feature sequence1650 1362 214 gene locus_tag LOCUS_42550 gene dndB 1362 214 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_42550 >Feature sequence1651 <2185 913 gene locus_tag LOCUS_42560 <2185 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140726.1:DUF1822 family protein >Feature sequence1652 1326 346 gene locus_tag LOCUS_42570 1326 346 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244102.1 protein_id gnl|my_center|LOCUS_42570 2093 1317 gene locus_tag LOCUS_42580 gene rfbF 2093 1317 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_42580 >Feature sequence1653 96 320 gene locus_tag LOCUS_42590 gene infA 96 320 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_42590 637 1020 gene locus_tag LOCUS_42600 gene rpsM 637 1020 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_42600 1760 2155 gene locus_tag LOCUS_42610 gene rpsK 1760 2155 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055959.1 protein_id gnl|my_center|LOCUS_42610 >Feature sequence1654 529 1350 gene locus_tag LOCUS_42620 529 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42620 >Feature sequence1655 1466 282 gene locus_tag LOCUS_42630 1466 282 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920725.1 protein_id gnl|my_center|LOCUS_42630 1987 1487 gene locus_tag LOCUS_42640 1987 1487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42640 >Feature sequence1656 1556 369 gene locus_tag LOCUS_42650 1556 369 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057679.1 protein_id gnl|my_center|LOCUS_42650 >Feature sequence1657 2084 321 gene locus_tag LOCUS_42660 2084 321 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967491.1 protein_id gnl|my_center|LOCUS_42660 >Feature sequence1658 1537 221 gene locus_tag LOCUS_42670 1537 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42670 >Feature sequence1659 2018 285 gene locus_tag LOCUS_42680 2018 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42680 >Feature sequence1660 353 727 gene locus_tag LOCUS_42690 353 727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42690 1699 1487 gene locus_tag LOCUS_42700 gene thiS 1699 1487 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_42700 >Feature sequence1661 1715 1912 gene locus_tag LOCUS_42710 1715 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42710 >Feature sequence1662 511 1557 gene locus_tag LOCUS_42720 511 1557 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_42720 >Feature sequence1663 <2175 359 gene locus_tag LOCUS_42730 <2175 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924872.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1664 <1 2115 gene locus_tag LOCUS_42740 <1 2115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208591.1:glycosyltransferase family 1 protein >Feature sequence1665 191 586 gene locus_tag LOCUS_42750 191 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42750 978 1904 gene locus_tag LOCUS_42760 978 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42760 >Feature sequence1666 208 1785 gene locus_tag LOCUS_42770 gene cobA 208 1785 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920993.1 protein_id gnl|my_center|LOCUS_42770 >Feature sequence1667 1501 1151 gene locus_tag LOCUS_42780 1501 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057712.1 protein_id gnl|my_center|LOCUS_42780 >Feature sequence1668 >Feature sequence1669 52 645 gene locus_tag LOCUS_42790 52 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42790 1412 816 gene locus_tag LOCUS_42800 1412 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_42800 <2163 1641 gene locus_tag LOCUS_42810 <2163 1641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193345479.1:YdiU family protein >Feature sequence1670 116 370 gene locus_tag LOCUS_42820 116 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42820 1730 969 gene locus_tag LOCUS_42830 1730 969 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142793.1 protein_id gnl|my_center|LOCUS_42830 >Feature sequence1671 437 171 gene locus_tag LOCUS_42840 437 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42840 794 1231 gene locus_tag LOCUS_42850 794 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42850 1263 1796 gene locus_tag LOCUS_42860 1263 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42860 >Feature sequence1672 1848 1063 gene locus_tag LOCUS_42870 1848 1063 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_42870 >Feature sequence1673 662 862 gene locus_tag LOCUS_42880 662 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42880 >Feature sequence1674 1888 1682 gene locus_tag LOCUS_42890 1888 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42890 2137 1982 gene locus_tag LOCUS_42900 2137 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42900 >Feature sequence1675 779 474 gene locus_tag LOCUS_42910 779 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42910 854 1135 gene locus_tag LOCUS_42920 854 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42920 1408 1653 gene locus_tag LOCUS_42930 1408 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42930 >Feature sequence1676 1572 169 gene locus_tag LOCUS_42940 1572 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42940 >Feature sequence1677 <1 677 gene locus_tag LOCUS_42950 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056296.1:ABC transporter ATP-binding protein 1022 1303 gene locus_tag LOCUS_42960 1022 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42960 1405 1650 gene locus_tag LOCUS_42970 1405 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42970 1653 2072 gene locus_tag LOCUS_42980 1653 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42980 >Feature sequence1678 2107 1349 gene locus_tag LOCUS_42990 2107 1349 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144138.1 protein_id gnl|my_center|LOCUS_42990 >Feature sequence1679 983 513 gene locus_tag LOCUS_43000 gene smpB 983 513 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_43000 1228 1995 gene locus_tag LOCUS_43010 1228 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43010 >Feature sequence1680 894 271 gene locus_tag LOCUS_43020 894 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43020 1848 943 gene locus_tag LOCUS_43030 1848 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43030 >Feature sequence1681 1540 161 gene locus_tag LOCUS_43040 gene thiC 1540 161 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_43040 >Feature sequence1682 737 537 gene locus_tag LOCUS_43050 737 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43050 980 786 gene locus_tag LOCUS_43060 980 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_43060 >Feature sequence1683 733 434 gene locus_tag LOCUS_43070 733 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43070 <2153 944 gene locus_tag LOCUS_43080 <2153 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142684.1:glycerol-3-phosphate acyltransferase >Feature sequence1684 <2153 1570 gene locus_tag LOCUS_43090 <2153 1570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056598.1:NYN domain-containing protein >Feature sequence1685 2124 1315 gene locus_tag LOCUS_43100 2124 1315 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_43100 >Feature sequence1686 478 1734 gene locus_tag LOCUS_43110 gene arsJ 478 1734 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798948.1 protein_id gnl|my_center|LOCUS_43110 >Feature sequence1687 2114 924 gene locus_tag LOCUS_43120 2114 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43120 >Feature sequence1688 1275 760 gene locus_tag LOCUS_43130 1275 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43130 >Feature sequence1689 2148 382 gene locus_tag LOCUS_43140 2148 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43140 >Feature sequence1690 1503 688 gene locus_tag LOCUS_43150 gene modA 1503 688 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860975.1 protein_id gnl|my_center|LOCUS_43150 >Feature sequence1691 <1 908 gene locus_tag LOCUS_43160 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202567.1:DUF262 domain-containing protein 905 1606 gene locus_tag LOCUS_43170 905 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43170 >Feature sequence1692 137 9 gene locus_tag LOCUS_43180 137 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43180 379 936 gene locus_tag LOCUS_43190 379 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43190 >Feature sequence1693 201 806 gene locus_tag LOCUS_43200 201 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43200 1066 1848 gene locus_tag LOCUS_43210 1066 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43210 >Feature sequence1694 1219 641 gene locus_tag LOCUS_43220 1219 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43220 1903 1676 gene locus_tag LOCUS_43230 1903 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43230 >Feature sequence1695 490 933 gene locus_tag LOCUS_43240 490 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43240 1993 1370 gene locus_tag LOCUS_43250 1993 1370 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_43250 >Feature sequence1696 724 960 gene locus_tag LOCUS_43260 724 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43260 1001 1594 gene locus_tag LOCUS_43270 1001 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43270 1548 2057 gene locus_tag LOCUS_43280 1548 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43280 >Feature sequence1697 1225 359 gene locus_tag LOCUS_43290 gene bchL 1225 359 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921031.1 protein_id gnl|my_center|LOCUS_43290 >Feature sequence1698 1572 220 gene locus_tag LOCUS_43300 1572 220 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124536.1 protein_id gnl|my_center|LOCUS_43300 >Feature sequence1699 449 1435 gene locus_tag LOCUS_43310 449 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43310 1485 1820 gene locus_tag LOCUS_43320 1485 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43320 >Feature sequence1700 1017 247 gene locus_tag LOCUS_43330 1017 247 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_43330 1375 2127 gene locus_tag LOCUS_43340 1375 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43340 >Feature sequence1701 139 1599 gene locus_tag LOCUS_43350 139 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43350 >Feature sequence1702 867 610 gene locus_tag LOCUS_43360 867 610 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920866.1 protein_id gnl|my_center|LOCUS_43360 >Feature sequence1703 1872 721 gene locus_tag LOCUS_43370 1872 721 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056563.1 protein_id gnl|my_center|LOCUS_43370 >Feature sequence1704 1818 2111 gene locus_tag LOCUS_43380 1818 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43380 >Feature sequence1705 409 753 gene locus_tag LOCUS_43390 409 753 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065092.1 protein_id gnl|my_center|LOCUS_43390 772 1083 gene locus_tag LOCUS_43400 772 1083 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966928.1 protein_id gnl|my_center|LOCUS_43400 1657 1145 gene locus_tag LOCUS_43410 1657 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43410 >Feature sequence1706 390 881 gene locus_tag LOCUS_43420 390 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43420 1056 2138 gene locus_tag LOCUS_43430 1056 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43430 >Feature sequence1707 >Feature sequence1708 <1 836 gene locus_tag LOCUS_43440 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057141.1:AMP-binding protein 890 1336 gene locus_tag LOCUS_43450 890 1336 CDS product YlqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166277356.1 protein_id gnl|my_center|LOCUS_43450 >Feature sequence1709 >Feature sequence1710 312 1283 gene locus_tag LOCUS_43460 gene nadA 312 1283 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_43460 1496 2095 gene locus_tag LOCUS_43470 1496 2095 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792164.1 protein_id gnl|my_center|LOCUS_43470 >Feature sequence1711 <2131 25 gene locus_tag LOCUS_43480 <2131 25 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057035.1:UPF0182 family protein >Feature sequence1712 <1 606 gene locus_tag LOCUS_43490 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933292.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 847 1866 gene locus_tag LOCUS_43500 847 1866 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_43500 >Feature sequence1713 <2129 900 gene locus_tag LOCUS_43510 <2129 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057958.1:NAD(P)H-quinone oxidoreductase subunit F >Feature sequence1714 <2128 117 gene locus_tag LOCUS_43520 <2128 117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence1715 967 341 gene locus_tag LOCUS_43530 967 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43530 >Feature sequence1716 949 752 gene locus_tag LOCUS_43540 949 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43540 1141 965 gene locus_tag LOCUS_43550 1141 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43550 1963 1556 gene locus_tag LOCUS_43560 1963 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_43560 >Feature sequence1717 1 612 gene locus_tag LOCUS_43570 1 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43570 754 969 gene locus_tag LOCUS_43580 754 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43580 2022 1072 gene locus_tag LOCUS_43590 2022 1072 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181711559.1 protein_id gnl|my_center|LOCUS_43590 >Feature sequence1718 857 213 gene locus_tag LOCUS_43600 857 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43600 935 1168 gene locus_tag LOCUS_43610 935 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43610 1459 2079 gene locus_tag LOCUS_43620 1459 2079 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143792.1 protein_id gnl|my_center|LOCUS_43620 >Feature sequence1719 489 22 gene locus_tag LOCUS_43630 gene tsaE 489 22 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722335.1 protein_id gnl|my_center|LOCUS_43630 935 1390 gene locus_tag LOCUS_43640 935 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43640 <2126 1536 gene locus_tag LOCUS_43650 <2126 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920957.1:YvcK family protein >Feature sequence1720 374 910 gene locus_tag LOCUS_43660 374 910 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057421.1 protein_id gnl|my_center|LOCUS_43660 1076 2122 gene locus_tag LOCUS_43670 1076 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43670 >Feature sequence1721 1213 524 gene locus_tag LOCUS_43680 1213 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43680 1555 1217 gene locus_tag LOCUS_43690 1555 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43690 1802 2068 gene locus_tag LOCUS_43700 1802 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43700 >Feature sequence1722 <2121 65 gene locus_tag LOCUS_43710 <2121 65 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence1723 792 79 gene locus_tag LOCUS_43720 792 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43720 962 801 gene locus_tag LOCUS_43730 962 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43730 1447 965 gene locus_tag LOCUS_43740 1447 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43740 >Feature sequence1724 1665 58 gene locus_tag LOCUS_43750 1665 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43750 >Feature sequence1725 126 1178 gene locus_tag LOCUS_43760 126 1178 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920837.1 protein_id gnl|my_center|LOCUS_43760 >Feature sequence1726 <1 1999 gene locus_tag LOCUS_43770 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920781.1:ABC transporter ATP-binding protein >Feature sequence1727 241 531 gene locus_tag LOCUS_43780 241 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43780 435 1442 gene locus_tag LOCUS_43790 435 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43790 <2115 1538 gene locus_tag LOCUS_43800 <2115 1538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002485218.1:2-keto-4-pentenoate hydratase >Feature sequence1728 335 1753 gene locus_tag LOCUS_43810 335 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43810 >Feature sequence1729 193 435 gene locus_tag LOCUS_43820 193 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43820 432 707 gene locus_tag LOCUS_43830 432 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43830 <2113 1017 gene locus_tag LOCUS_43840 <2113 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057679.1:TRC40/GET3/ArsA family transport-energizing ATPase >Feature sequence1730 1319 909 gene locus_tag LOCUS_43850 gene rpsI 1319 909 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055964.1 protein_id gnl|my_center|LOCUS_43850 1774 1325 gene locus_tag LOCUS_43860 gene rplM 1774 1325 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055963.1 protein_id gnl|my_center|LOCUS_43860 >Feature sequence1731 1888 179 gene locus_tag LOCUS_43870 1888 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43870 >Feature sequence1732 1528 497 gene locus_tag LOCUS_43880 1528 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43880 >Feature sequence1733 3 422 gene locus_tag LOCUS_43890 3 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43890 427 888 gene locus_tag LOCUS_43900 427 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43900 1546 935 gene locus_tag LOCUS_43910 1546 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43910 >Feature sequence1734 <1 1817 gene locus_tag LOCUS_43920 <1 1817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein >Feature sequence1735 >Feature sequence1736 804 1571 gene locus_tag LOCUS_43930 804 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43930 >Feature sequence1737 822 262 gene locus_tag LOCUS_43940 822 262 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_43940 >Feature sequence1738 615 1598 gene locus_tag LOCUS_43950 615 1598 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_43950 1573 1776 gene locus_tag LOCUS_43960 1573 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_43960 >Feature sequence1739 697 299 gene locus_tag LOCUS_43970 697 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43970 696 1469 gene locus_tag LOCUS_43980 696 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43980 1881 2039 gene locus_tag LOCUS_43990 1881 2039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_43990 >Feature sequence1740 1600 2022 gene locus_tag LOCUS_44000 1600 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44000 >Feature sequence1741 483 358 gene locus_tag LOCUS_44010 483 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44010 951 1271 gene locus_tag LOCUS_44020 951 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057706.1 protein_id gnl|my_center|LOCUS_44020 >Feature sequence1742 >Feature sequence1743 522 974 gene locus_tag LOCUS_44030 522 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44030 1244 1996 gene locus_tag LOCUS_44040 1244 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44040 >Feature sequence1744 1135 764 gene locus_tag LOCUS_44050 1135 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44050 1449 1132 gene locus_tag LOCUS_44060 1449 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44060 1808 1491 gene locus_tag LOCUS_44070 1808 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44070 >Feature sequence1745 1750 638 gene locus_tag LOCUS_44080 1750 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44080 >Feature sequence1746 259 1044 gene locus_tag LOCUS_44090 259 1044 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920674.1 protein_id gnl|my_center|LOCUS_44090 1103 1423 gene locus_tag LOCUS_44100 1103 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44100 >Feature sequence1747 1764 319 gene locus_tag LOCUS_44110 1764 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44110 >Feature sequence1748 478 167 gene locus_tag LOCUS_44120 478 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44120 1698 517 gene locus_tag LOCUS_44130 1698 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44130 >Feature sequence1749 <1 556 gene locus_tag LOCUS_44140 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064913.1:threonine ammonia-lyase, biosynthetic >Feature sequence1750 140 418 gene locus_tag LOCUS_44150 140 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44150 <2099 1583 gene locus_tag LOCUS_44160 <2099 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024124637.1:photosystem II reaction center protein CP43 >Feature sequence1751 1852 263 gene locus_tag LOCUS_44170 1852 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44170 >Feature sequence1752 1275 709 gene locus_tag LOCUS_44180 1275 709 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_44180 >Feature sequence1753 <1 1183 gene locus_tag LOCUS_44190 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein >Feature sequence1754 1867 266 gene locus_tag LOCUS_44200 1867 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44200 >Feature sequence1755 432 238 gene locus_tag LOCUS_44210 432 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44210 1401 688 gene locus_tag LOCUS_44220 1401 688 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057799.1 protein_id gnl|my_center|LOCUS_44220 >Feature sequence1756 320 910 gene locus_tag LOCUS_44230 320 910 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057548.1 protein_id gnl|my_center|LOCUS_44230 1029 1580 gene locus_tag LOCUS_44240 1029 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44240 2047 1709 gene locus_tag LOCUS_44250 2047 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44250 >Feature sequence1757 262 924 gene locus_tag LOCUS_44260 262 924 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_44260 1081 1737 gene locus_tag LOCUS_44270 1081 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44270 >Feature sequence1758 360 632 gene locus_tag LOCUS_44280 360 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44280 1714 905 gene locus_tag LOCUS_44290 1714 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057850.1 protein_id gnl|my_center|LOCUS_44290 >Feature sequence1759 228 506 gene locus_tag LOCUS_44300 228 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44300 490 1017 gene locus_tag LOCUS_44310 490 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44310 1263 2090 gene locus_tag LOCUS_44320 1263 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44320 >Feature sequence1760 690 346 gene locus_tag LOCUS_44330 690 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44330 943 761 gene locus_tag LOCUS_44340 943 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44340 1282 965 gene locus_tag LOCUS_44350 1282 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44350 >Feature sequence1761 818 306 gene locus_tag LOCUS_44360 818 306 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_44360 1084 1578 gene locus_tag LOCUS_44370 1084 1578 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799761.1 protein_id gnl|my_center|LOCUS_44370 1575 1958 gene locus_tag LOCUS_44380 1575 1958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44380 >Feature sequence1762 1719 478 gene locus_tag LOCUS_44390 1719 478 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_44390 >Feature sequence1763 746 1021 gene locus_tag LOCUS_44400 746 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44400 >Feature sequence1764 557 1519 gene locus_tag LOCUS_44410 557 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44410 >Feature sequence1765 394 41 gene locus_tag LOCUS_44420 394 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44420 1967 504 gene locus_tag LOCUS_44430 1967 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44430 >Feature sequence1766 1323 985 gene locus_tag LOCUS_44440 1323 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44440 >Feature sequence1767 164 445 gene locus_tag LOCUS_44450 164 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44450 1745 561 gene locus_tag LOCUS_44460 1745 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44460 >Feature sequence1768 1148 519 gene locus_tag LOCUS_44470 1148 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44470 1628 1987 gene locus_tag LOCUS_44480 1628 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44480 >Feature sequence1769 <1 724 gene locus_tag LOCUS_44490 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058268.1:HhoA/HhoB/HtrA family serine endopeptidase <2081 825 gene locus_tag LOCUS_44500 <2081 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058085.1:histidinol dehydrogenase >Feature sequence1770 <2080 365 gene locus_tag LOCUS_44510 <2080 365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143571.1:glycosyltransferase family 39 protein >Feature sequence1771 80 1159 gene locus_tag LOCUS_44520 gene acsF 80 1159 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_44520 >Feature sequence1772 <1 1703 gene locus_tag LOCUS_44530 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058208.1:translocation/assembly module TamB domain-containing protein >Feature sequence1773 638 1855 gene locus_tag LOCUS_44540 638 1855 CDS product glycoside hydrolase family 10 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057137.1 protein_id gnl|my_center|LOCUS_44540 >Feature sequence1774 1215 70 gene locus_tag LOCUS_44550 1215 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44550 >Feature sequence1775 369 175 gene locus_tag LOCUS_44560 369 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44560 <2076 713 gene locus_tag LOCUS_44570 <2076 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920839.1:helicase C-terminal domain-containing protein >Feature sequence1776 1776 109 gene locus_tag LOCUS_44580 1776 109 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053221433.1 protein_id gnl|my_center|LOCUS_44580 >Feature sequence1777 970 1998 gene locus_tag LOCUS_44590 970 1998 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249602.1 protein_id gnl|my_center|LOCUS_44590 >Feature sequence1778 <1 510 gene locus_tag LOCUS_44600 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142965.1:Uma2 family endonuclease 1666 974 gene locus_tag LOCUS_44610 1666 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44610 >Feature sequence1779 793 1311 gene locus_tag LOCUS_44620 793 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44620 1459 1878 gene locus_tag LOCUS_44630 1459 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44630 1879 2043 gene locus_tag LOCUS_44640 1879 2043 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015887299.1 protein_id gnl|my_center|LOCUS_44640 >Feature sequence1780 898 260 gene locus_tag LOCUS_44650 898 260 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056062.1 protein_id gnl|my_center|LOCUS_44650 <2071 1212 gene locus_tag LOCUS_44660 <2071 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013368544.1:TatD family hydrolase >Feature sequence1781 <1 1304 gene locus_tag LOCUS_44670 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546240.1:ATP-binding protein >Feature sequence1782 304 498 gene locus_tag LOCUS_44680 304 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44680 <2069 854 gene locus_tag LOCUS_44690 <2069 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124649.1:RNA polymerase sigma factor RpoD >Feature sequence1783 1218 931 gene locus_tag LOCUS_44700 1218 931 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921010.1 protein_id gnl|my_center|LOCUS_44700 >Feature sequence1784 1087 1287 gene locus_tag LOCUS_44710 1087 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44710 1325 1648 gene locus_tag LOCUS_44720 1325 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_44720 >Feature sequence1785 1844 1413 gene locus_tag LOCUS_44730 1844 1413 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001057909.1 protein_id gnl|my_center|LOCUS_44730 >Feature sequence1786 172 747 gene locus_tag LOCUS_44740 172 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44740 1135 1332 gene locus_tag LOCUS_44750 1135 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057807.1 protein_id gnl|my_center|LOCUS_44750 1420 1893 gene locus_tag LOCUS_44760 1420 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143287.1 protein_id gnl|my_center|LOCUS_44760 >Feature sequence1787 370 1716 gene locus_tag LOCUS_44770 370 1716 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143055.1 protein_id gnl|my_center|LOCUS_44770 >Feature sequence1788 <1 1320 gene locus_tag LOCUS_44780 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142241.1:caspase family protein 1862 1353 gene locus_tag LOCUS_44790 1862 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44790 >Feature sequence1789 472 14 gene locus_tag LOCUS_44800 gene rplI 472 14 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125983.1 protein_id gnl|my_center|LOCUS_44800 1340 567 gene locus_tag LOCUS_44810 gene gloB 1340 567 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057476.1 protein_id gnl|my_center|LOCUS_44810 1585 1791 gene locus_tag LOCUS_44820 1585 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44820 >Feature sequence1790 <2064 272 gene locus_tag LOCUS_44830 <2064 272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140990.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II >Feature sequence1791 <1 531 gene locus_tag LOCUS_44840 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein 755 528 gene locus_tag LOCUS_44850 755 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44850 1396 980 gene locus_tag LOCUS_44860 1396 980 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_44860 1749 1393 gene locus_tag LOCUS_44870 1749 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44870 >Feature sequence1792 157 8 gene locus_tag LOCUS_44880 157 8 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_44880 1193 1588 gene locus_tag LOCUS_44890 1193 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44890 >Feature sequence1793 >Feature sequence1794 608 859 gene locus_tag LOCUS_44900 608 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44900 1734 1874 gene locus_tag LOCUS_44910 1734 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44910 >Feature sequence1795 51 614 gene locus_tag LOCUS_44920 51 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44920 >Feature sequence1796 205 1221 gene locus_tag LOCUS_44930 205 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44930 >Feature sequence1797 <2054 1031 gene locus_tag LOCUS_44940 <2054 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530168.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence1798 553 1557 gene locus_tag LOCUS_44950 553 1557 CDS product DUF4931 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546734.1 protein_id gnl|my_center|LOCUS_44950 >Feature sequence1799 356 286 gene locus_tag LOCUS_t00490 356 286 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 805 446 gene locus_tag LOCUS_44960 805 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44960 970 809 gene locus_tag LOCUS_44970 970 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_44970 >Feature sequence1800 140 490 gene locus_tag LOCUS_44980 140 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_44980 >Feature sequence1801 1614 136 gene locus_tag LOCUS_44990 1614 136 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_44990 >Feature sequence1802 54 1793 gene locus_tag LOCUS_45000 54 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45000 >Feature sequence1803 350 93 gene locus_tag LOCUS_45010 350 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45010 740 417 gene locus_tag LOCUS_45020 740 417 CDS product DUF1825 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057879.1 protein_id gnl|my_center|LOCUS_45020 >Feature sequence1804 >Feature sequence1805 1372 326 gene locus_tag LOCUS_45030 gene cobW 1372 326 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057463.1 protein_id gnl|my_center|LOCUS_45030 >Feature sequence1806 747 109 gene locus_tag LOCUS_45040 747 109 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_45040 1451 1134 gene locus_tag LOCUS_45050 gene rpsJ 1451 1134 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_45050 >Feature sequence1807 <1 529 gene locus_tag LOCUS_45060 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057263.1:dienelactone hydrolase family protein 562 1359 gene locus_tag LOCUS_45070 562 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45070 >Feature sequence1808 553 134 gene locus_tag LOCUS_45080 553 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057498.1 protein_id gnl|my_center|LOCUS_45080 <2042 766 gene locus_tag LOCUS_45090 <2042 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057497.1:AarF/ABC1/UbiB kinase family protein >Feature sequence1809 1584 307 gene locus_tag LOCUS_45100 1584 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45100 >Feature sequence1810 334 618 gene locus_tag LOCUS_45110 334 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45110 597 944 gene locus_tag LOCUS_45120 597 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45120 1231 1082 gene locus_tag LOCUS_45130 1231 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45130 >Feature sequence1811 <2038 1422 gene locus_tag LOCUS_45140 <2038 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence1812 1741 800 gene locus_tag LOCUS_45150 gene ispE 1741 800 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056351.1 protein_id gnl|my_center|LOCUS_45150 >Feature sequence1813 235 1203 gene locus_tag LOCUS_45160 235 1203 CDS product acetamidase/formamidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086130.1 protein_id gnl|my_center|LOCUS_45160 1588 1388 gene locus_tag LOCUS_45170 1588 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45170 >Feature sequence1814 829 951 gene locus_tag LOCUS_45180 829 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45180 1274 1723 gene locus_tag LOCUS_45190 1274 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45190 >Feature sequence1815 2021 1476 gene locus_tag LOCUS_45200 2021 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45200 >Feature sequence1816 1350 994 gene locus_tag LOCUS_45210 gene mazF 1350 994 CDS product endoribonuclease MazF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392535.1 protein_id gnl|my_center|LOCUS_45210 1573 1331 gene locus_tag LOCUS_45220 1573 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45220 >Feature sequence1817 833 1570 gene locus_tag LOCUS_45230 833 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45230 1575 1772 gene locus_tag LOCUS_45240 1575 1772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45240 >Feature sequence1818 <2033 922 gene locus_tag LOCUS_45250 <2033 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947219.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1819 <1 655 gene locus_tag LOCUS_45260 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142130.1:NAD(P)/FAD-dependent oxidoreductase 1235 882 gene locus_tag LOCUS_45270 1235 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45270 >Feature sequence1820 <1 811 gene locus_tag LOCUS_45280 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389971.1:lysylphosphatidylglycerol synthase domain-containing protein >Feature sequence1821 446 27 gene locus_tag LOCUS_45290 446 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45290 1077 694 gene locus_tag LOCUS_45300 1077 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45300 >Feature sequence1822 595 5 gene locus_tag LOCUS_45310 595 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45310 1685 1014 gene locus_tag LOCUS_45320 1685 1014 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_45320 >Feature sequence1823 792 154 gene locus_tag LOCUS_45330 792 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45330 >Feature sequence1824 1989 1042 gene locus_tag LOCUS_45340 1989 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45340 >Feature sequence1825 <2030 47 gene locus_tag LOCUS_45350 <2030 47 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence1826 1230 67 gene locus_tag LOCUS_45360 1230 67 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 protein_id gnl|my_center|LOCUS_45360 >Feature sequence1827 576 1739 gene locus_tag LOCUS_45370 576 1739 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_45370 >Feature sequence1828 500 246 gene locus_tag LOCUS_45380 500 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45380 745 1935 gene locus_tag LOCUS_45390 745 1935 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057982.1 protein_id gnl|my_center|LOCUS_45390 >Feature sequence1829 >Feature sequence1830 >Feature sequence1831 1463 546 gene locus_tag LOCUS_45400 gene cdaA 1463 546 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057599.1 protein_id gnl|my_center|LOCUS_45400 >Feature sequence1832 265 1701 gene locus_tag LOCUS_45410 gene sufB 265 1701 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_45410 >Feature sequence1833 23 904 gene locus_tag LOCUS_45420 23 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920654.1 protein_id gnl|my_center|LOCUS_45420 >Feature sequence1834 659 54 gene locus_tag LOCUS_45430 659 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45430 1747 827 gene locus_tag LOCUS_45440 1747 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45440 >Feature sequence1835 <2024 766 gene locus_tag LOCUS_45450 <2024 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920803.1:tubulin-like doman-containing protein >Feature sequence1836 <1 1037 gene locus_tag LOCUS_45460 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259079.1:amino acid ABC transporter substrate-binding protein 1294 1169 gene locus_tag LOCUS_45470 1294 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45470 >Feature sequence1837 926 306 gene locus_tag LOCUS_45480 926 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45480 <2022 1044 gene locus_tag LOCUS_45490 <2022 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057937.1:LL-diaminopimelate aminotransferase >Feature sequence1838 482 1201 gene locus_tag LOCUS_45500 482 1201 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_45500 >Feature sequence1839 733 2010 gene locus_tag LOCUS_45510 733 2010 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_45510 >Feature sequence1840 1444 1887 gene locus_tag LOCUS_45520 1444 1887 CDS product YbjN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142477.1 protein_id gnl|my_center|LOCUS_45520 >Feature sequence1841 <2017 1496 gene locus_tag LOCUS_45530 <2017 1496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142146.1:ACT domain-containing protein >Feature sequence1842 1051 1422 gene locus_tag LOCUS_45540 1051 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45540 >Feature sequence1843 <2014 433 gene locus_tag LOCUS_45550 <2014 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223153803.1:5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase >Feature sequence1844 1639 1328 gene locus_tag LOCUS_45560 1639 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45560 1803 1639 gene locus_tag LOCUS_45570 1803 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45570 >Feature sequence1845 825 394 gene locus_tag LOCUS_45580 825 394 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058006.1 protein_id gnl|my_center|LOCUS_45580 1117 1560 gene locus_tag LOCUS_45590 1117 1560 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056024.1 protein_id gnl|my_center|LOCUS_45590 >Feature sequence1846 1688 1086 gene locus_tag LOCUS_45600 1688 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45600 >Feature sequence1847 <2010 200 gene locus_tag LOCUS_45610 <2010 200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence1848 490 1728 gene locus_tag LOCUS_45620 490 1728 CDS product URC4/urg3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444165.1 protein_id gnl|my_center|LOCUS_45620 >Feature sequence1849 <2007 797 gene locus_tag LOCUS_45630 <2007 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143057.1:cytochrome P450 >Feature sequence1850 850 122 gene locus_tag LOCUS_45640 850 122 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920695.1 protein_id gnl|my_center|LOCUS_45640 >Feature sequence1851 777 1046 gene locus_tag LOCUS_45650 777 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45650 1106 1255 gene locus_tag LOCUS_45660 1106 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45660 1291 1467 gene locus_tag LOCUS_45670 1291 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45670 1455 1637 gene locus_tag LOCUS_45680 1455 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45680 >Feature sequence1852 <2004 672 gene locus_tag LOCUS_45690 <2004 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_155282710.1:autotransporter-associated N-terminal domain-containing protein >Feature sequence1853 776 1756 gene locus_tag LOCUS_45700 gene cmoB 776 1756 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000564730.1 protein_id gnl|my_center|LOCUS_45700 >Feature sequence1854 192 1355 gene locus_tag LOCUS_45710 192 1355 CDS product F420-0:Gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921060.1 protein_id gnl|my_center|LOCUS_45710 1367 1900 gene locus_tag LOCUS_45720 1367 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45720 >Feature sequence1855 <2001 367 gene locus_tag LOCUS_45730 <2001 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056767.1:protein phosphatase 2C domain-containing protein >Feature sequence1856 1790 858 gene locus_tag LOCUS_45740 1790 858 CDS product lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525079.1 protein_id gnl|my_center|LOCUS_45740 >Feature sequence1857 1414 710 gene locus_tag LOCUS_45750 1414 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_45750 >Feature sequence1858 600 403 gene locus_tag LOCUS_45760 600 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45760 1684 1481 gene locus_tag LOCUS_45770 1684 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45770 >Feature sequence1859 1685 1020 gene locus_tag LOCUS_45780 1685 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928626.1 protein_id gnl|my_center|LOCUS_45780 1845 1917 gene locus_tag LOCUS_t00500 1845 1917 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1860 1182 199 gene locus_tag LOCUS_45790 1182 199 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_45790 1950 1636 gene locus_tag LOCUS_45800 1950 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45800 >Feature sequence1861 991 242 gene locus_tag LOCUS_45810 991 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45810 <1997 1219 gene locus_tag LOCUS_45820 <1997 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061502.1:methionyl-tRNA formyltransferase >Feature sequence1862 38 1291 gene locus_tag LOCUS_45830 38 1291 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797661.1 protein_id gnl|my_center|LOCUS_45830 >Feature sequence1863 1781 501 gene locus_tag LOCUS_45840 1781 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45840 >Feature sequence1864 133 360 gene locus_tag LOCUS_45850 133 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45850 360 686 gene locus_tag LOCUS_45860 360 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45860 843 1217 gene locus_tag LOCUS_45870 843 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_45870 >Feature sequence1865 1077 808 gene locus_tag LOCUS_45880 1077 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45880 <1993 1025 gene locus_tag LOCUS_45890 <1993 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142246.1:IS1634 family transposase note possible pseudo, frameshifted >Feature sequence1866 1052 51 gene locus_tag LOCUS_45900 1052 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45900 <1993 1214 gene locus_tag LOCUS_45910 <1993 1214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920683.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence1867 310 933 gene locus_tag LOCUS_45920 310 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45920 >Feature sequence1868 <1 1375 gene locus_tag LOCUS_45930 <1 1375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403312.1:nucleoside transporter C-terminal domain-containing protein >Feature sequence1869 470 309 gene locus_tag LOCUS_45940 470 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45940 676 882 gene locus_tag LOCUS_45950 676 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45950 896 1099 gene locus_tag LOCUS_45960 896 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45960 1105 1389 gene locus_tag LOCUS_45970 1105 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45970 >Feature sequence1870 913 578 gene locus_tag LOCUS_45980 913 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45980 1317 901 gene locus_tag LOCUS_45990 1317 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_45990 >Feature sequence1871 777 10 gene locus_tag LOCUS_46000 777 10 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140728.1 protein_id gnl|my_center|LOCUS_46000 1016 1273 gene locus_tag LOCUS_46010 1016 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46010 1267 1704 gene locus_tag LOCUS_46020 1267 1704 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017285767.1 protein_id gnl|my_center|LOCUS_46020 >Feature sequence1872 188 1366 gene locus_tag LOCUS_46030 188 1366 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706729.1 protein_id gnl|my_center|LOCUS_46030 1778 1533 gene locus_tag LOCUS_46040 1778 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46040 >Feature sequence1873 580 873 gene locus_tag LOCUS_46050 580 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46050 1124 1246 gene locus_tag LOCUS_46060 1124 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46060 1892 1596 gene locus_tag LOCUS_46070 1892 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46070 >Feature sequence1874 652 41 gene locus_tag LOCUS_46080 652 41 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_46080 1541 900 gene locus_tag LOCUS_46090 1541 900 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140938.1 protein_id gnl|my_center|LOCUS_46090 >Feature sequence1875 <1985 13 gene locus_tag LOCUS_46100 <1985 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798165.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence1876 317 448 gene locus_tag LOCUS_46110 317 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46110 1258 608 gene locus_tag LOCUS_46120 gene pnuC 1258 608 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706944.1 protein_id gnl|my_center|LOCUS_46120 >Feature sequence1877 <1 501 gene locus_tag LOCUS_46130 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_161797768.1:DMT family transporter 1448 582 gene locus_tag LOCUS_46140 1448 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46140 >Feature sequence1878 688 1410 gene locus_tag LOCUS_46150 gene psb29 688 1410 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_46150 >Feature sequence1879 526 1917 gene locus_tag LOCUS_46160 526 1917 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088620334.1 protein_id gnl|my_center|LOCUS_46160 >Feature sequence1880 46 1749 gene locus_tag LOCUS_46170 46 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46170 >Feature sequence1881 800 1234 gene locus_tag LOCUS_46180 800 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46180 <1980 1351 gene locus_tag LOCUS_46190 <1980 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056198.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence1882 99 1352 gene locus_tag LOCUS_46200 99 1352 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_46200 >Feature sequence1883 377 1639 gene locus_tag LOCUS_46210 377 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46210 1682 1867 gene locus_tag LOCUS_46220 1682 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46220 >Feature sequence1884 784 113 gene locus_tag LOCUS_46230 784 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46230 >Feature sequence1885 320 51 gene locus_tag LOCUS_46240 320 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46240 1109 363 gene locus_tag LOCUS_46250 1109 363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46250 <1974 1290 gene locus_tag LOCUS_46260 <1974 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546883.1:IS200/IS605 family accessory protein TnpB-related protein >Feature sequence1886 1550 177 gene locus_tag LOCUS_46270 1550 177 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057055.1 protein_id gnl|my_center|LOCUS_46270 >Feature sequence1887 83 1198 gene locus_tag LOCUS_46280 83 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46280 >Feature sequence1888 <1972 121 gene locus_tag LOCUS_46290 <1972 121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144195.1:response regulator >Feature sequence1889 333 136 gene locus_tag LOCUS_46300 333 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46300 1104 892 gene locus_tag LOCUS_46310 1104 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46310 1485 1117 gene locus_tag LOCUS_46320 1485 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_46320 >Feature sequence1890 1294 932 gene locus_tag LOCUS_46330 1294 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46330 >Feature sequence1891 1845 1588 gene locus_tag LOCUS_46340 1845 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46340 >Feature sequence1892 1333 575 gene locus_tag LOCUS_46350 1333 575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_46350 >Feature sequence1893 >Feature sequence1894 848 390 gene locus_tag LOCUS_46360 848 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46360 1869 1177 gene locus_tag LOCUS_46370 1869 1177 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143729.1 protein_id gnl|my_center|LOCUS_46370 >Feature sequence1895 3 488 gene locus_tag LOCUS_46380 3 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46380 1644 973 gene locus_tag LOCUS_46390 1644 973 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771635.1 protein_id gnl|my_center|LOCUS_46390 >Feature sequence1896 530 1273 gene locus_tag LOCUS_46400 530 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46400 1820 1455 gene locus_tag LOCUS_46410 1820 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46410 >Feature sequence1897 1587 352 gene locus_tag LOCUS_46420 1587 352 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143728.1 protein_id gnl|my_center|LOCUS_46420 >Feature sequence1898 1569 1105 gene locus_tag LOCUS_46430 1569 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46430 >Feature sequence1899 1675 776 gene locus_tag LOCUS_46440 1675 776 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_46440 >Feature sequence1900 1295 420 gene locus_tag LOCUS_46450 1295 420 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057233.1 protein_id gnl|my_center|LOCUS_46450 >Feature sequence1901 274 903 gene locus_tag LOCUS_46460 274 903 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141193.1 protein_id gnl|my_center|LOCUS_46460 930 1235 gene locus_tag LOCUS_46470 930 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46470 1782 1522 gene locus_tag LOCUS_46480 1782 1522 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_46480 >Feature sequence1902 192 1628 gene locus_tag LOCUS_46490 192 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46490 >Feature sequence1903 3 683 gene locus_tag LOCUS_46500 3 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46500 870 1730 gene locus_tag LOCUS_46510 870 1730 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_46510 >Feature sequence1904 <1 1088 gene locus_tag LOCUS_46520 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057237.1:2-isopropylmalate synthase >Feature sequence1905 <1956 735 gene locus_tag LOCUS_46530 <1956 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017711988.1:AarF/ABC1/UbiB kinase family protein >Feature sequence1906 1104 1334 gene locus_tag LOCUS_46540 1104 1334 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_46540 >Feature sequence1907 <1 943 gene locus_tag LOCUS_46550 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140467.1:sulfotransferase domain-containing protein 956 1954 gene locus_tag LOCUS_46560 956 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46560 >Feature sequence1908 >Feature sequence1909 1422 112 gene locus_tag LOCUS_46570 1422 112 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056607.1 protein_id gnl|my_center|LOCUS_46570 1790 1431 gene locus_tag LOCUS_46580 1790 1431 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_46580 >Feature sequence1910 910 95 gene locus_tag LOCUS_46590 910 95 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_46590 955 1242 gene locus_tag LOCUS_46600 955 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46600 >Feature sequence1911 259 483 gene locus_tag LOCUS_46610 259 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46610 961 596 gene locus_tag LOCUS_46620 961 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46620 1471 992 gene locus_tag LOCUS_46630 gene ruvC 1471 992 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190407846.1 protein_id gnl|my_center|LOCUS_46630 1819 1613 gene locus_tag LOCUS_46640 1819 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46640 >Feature sequence1912 <1 1939 gene locus_tag LOCUS_46650 <1 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056271.1:L-glutamate gamma-semialdehyde dehydrogenase >Feature sequence1913 <1 519 gene locus_tag LOCUS_46660 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058103.1:DUF3536 domain-containing protein 1275 1490 gene locus_tag LOCUS_46670 1275 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46670 >Feature sequence1914 488 99 gene locus_tag LOCUS_46680 488 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46680 1523 906 gene locus_tag LOCUS_46690 1523 906 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200504.1 protein_id gnl|my_center|LOCUS_46690 >Feature sequence1915 310 555 gene locus_tag LOCUS_46700 310 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46700 658 1002 gene locus_tag LOCUS_46710 658 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46710 1456 1271 gene locus_tag LOCUS_46720 1456 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46720 1604 1765 gene locus_tag LOCUS_46730 1604 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46730 >Feature sequence1916 645 157 gene locus_tag LOCUS_46740 645 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46740 >Feature sequence1917 863 1177 gene locus_tag LOCUS_46750 863 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46750 1294 1872 gene locus_tag LOCUS_46760 1294 1872 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_46760 >Feature sequence1918 1288 152 gene locus_tag LOCUS_46770 1288 152 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390458.1 protein_id gnl|my_center|LOCUS_46770 <1945 1428 gene locus_tag LOCUS_46780 <1945 1428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142460.1:colanic acid biosynthesis glycosyltransferase WcaL >Feature sequence1919 815 585 gene locus_tag LOCUS_46790 815 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46790 1239 850 gene locus_tag LOCUS_46800 1239 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46800 <1944 1442 gene locus_tag LOCUS_46810 <1944 1442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799574.1:M23 family metallopeptidase >Feature sequence1920 1337 1606 gene locus_tag LOCUS_46820 1337 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46820 >Feature sequence1921 567 1232 gene locus_tag LOCUS_46830 567 1232 CDS product 2OG-Fe dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142596.1 protein_id gnl|my_center|LOCUS_46830 >Feature sequence1922 541 1923 gene locus_tag LOCUS_46840 gene gntT 541 1923 CDS product guanitoxin biosynthesis MATE family efflux transporter GntT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140501.1 protein_id gnl|my_center|LOCUS_46840 >Feature sequence1923 1090 449 gene locus_tag LOCUS_46850 1090 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46850 1347 1484 gene locus_tag LOCUS_46860 1347 1484 CDS product photosystem II reaction center protein K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799777.1 protein_id gnl|my_center|LOCUS_46860 1709 1587 gene locus_tag LOCUS_46870 1709 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46870 >Feature sequence1924 484 1401 gene locus_tag LOCUS_46880 gene nifU 484 1401 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942655.1 protein_id gnl|my_center|LOCUS_46880 >Feature sequence1925 1221 430 gene locus_tag LOCUS_46890 1221 430 CDS product IS5-like element ISMac15 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065538.1 protein_id gnl|my_center|LOCUS_46890 1939 1397 gene locus_tag LOCUS_46900 1939 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46900 >Feature sequence1926 1 1206 gene locus_tag LOCUS_46910 1 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46910 >Feature sequence1927 53 1909 gene locus_tag LOCUS_46920 53 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46920 >Feature sequence1928 <1 922 gene locus_tag LOCUS_46930 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950382.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence1929 927 1172 gene locus_tag LOCUS_46940 927 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46940 1756 1550 gene locus_tag LOCUS_46950 1756 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_46950 >Feature sequence1930 <1 1920 gene locus_tag LOCUS_46960 <1 1920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056610.1:phosphoenolpyruvate synthase >Feature sequence1931 1855 413 gene locus_tag LOCUS_46970 1855 413 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965184.1 protein_id gnl|my_center|LOCUS_46970 >Feature sequence1932 109 396 gene locus_tag LOCUS_46980 109 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920941.1 protein_id gnl|my_center|LOCUS_46980 >Feature sequence1933 >Feature sequence1934 <1 606 gene locus_tag LOCUS_46990 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057800.1:phycobilisome rod-core linker polypeptide 1113 1538 gene locus_tag LOCUS_47000 1113 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47000 >Feature sequence1935 459 722 gene locus_tag LOCUS_47010 459 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47010 <1934 844 gene locus_tag LOCUS_47020 <1934 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990687.1:formylglycine-generating enzyme family protein >Feature sequence1936 <1 1102 gene locus_tag LOCUS_47030 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence1937 53 1594 gene locus_tag LOCUS_47040 53 1594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47040 >Feature sequence1938 <1 974 gene locus_tag LOCUS_47050 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144201.1:DUF1800 domain-containing protein >Feature sequence1939 728 120 gene locus_tag LOCUS_47060 728 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47060 1104 853 gene locus_tag LOCUS_47070 1104 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47070 1397 1516 gene locus_tag LOCUS_47080 1397 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47080 >Feature sequence1940 461 1135 gene locus_tag LOCUS_47090 461 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47090 1176 1373 gene locus_tag LOCUS_47100 1176 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47100 1742 1557 gene locus_tag LOCUS_47110 1742 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47110 >Feature sequence1941 1519 485 gene locus_tag LOCUS_47120 1519 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47120 >Feature sequence1942 1019 192 gene locus_tag LOCUS_47130 1019 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47130 >Feature sequence1943 181 981 gene locus_tag LOCUS_47140 181 981 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790353.1 protein_id gnl|my_center|LOCUS_47140 1378 1115 gene locus_tag LOCUS_47150 1378 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47150 1808 1518 gene locus_tag LOCUS_47160 1808 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47160 >Feature sequence1944 <1 1426 gene locus_tag LOCUS_47170 <1 1426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122401.1:glycosyltransferase 1785 1423 gene locus_tag LOCUS_47180 1785 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47180 >Feature sequence1945 1202 318 gene locus_tag LOCUS_47190 gene lgt 1202 318 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057991.1 protein_id gnl|my_center|LOCUS_47190 >Feature sequence1946 1557 1102 gene locus_tag LOCUS_47200 1557 1102 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143403.1 protein_id gnl|my_center|LOCUS_47200 >Feature sequence1947 412 1605 gene locus_tag LOCUS_47210 412 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47210 >Feature sequence1948 672 1034 gene locus_tag LOCUS_47220 672 1034 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055899.1 protein_id gnl|my_center|LOCUS_47220 >Feature sequence1949 337 1401 gene locus_tag LOCUS_47230 gene pseI 337 1401 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_47230 >Feature sequence1950 929 756 gene locus_tag LOCUS_47240 929 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47240 <1924 1317 gene locus_tag LOCUS_47250 <1924 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142868.1:C-3',4' desaturase CrtD >Feature sequence1951 1061 441 gene locus_tag LOCUS_47260 1061 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_47260 1663 1079 gene locus_tag LOCUS_47270 1663 1079 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_47270 >Feature sequence1952 251 1132 gene locus_tag LOCUS_47280 251 1132 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144335.1 protein_id gnl|my_center|LOCUS_47280 >Feature sequence1953 603 1301 gene locus_tag LOCUS_47290 603 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47290 >Feature sequence1954 >Feature sequence1955 1073 303 gene locus_tag LOCUS_47300 1073 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47300 >Feature sequence1956 963 1148 gene locus_tag LOCUS_47310 963 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47310 1142 1663 gene locus_tag LOCUS_47320 1142 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47320 >Feature sequence1957 727 1719 gene locus_tag LOCUS_47330 727 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47330 >Feature sequence1958 <1916 1110 gene locus_tag LOCUS_47340 <1916 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030785.1:type I polyketide synthase >Feature sequence1959 1342 308 gene locus_tag LOCUS_47350 gene hppD 1342 308 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000810913.1 protein_id gnl|my_center|LOCUS_47350 >Feature sequence1960 533 1618 gene locus_tag LOCUS_47360 gene glk 533 1618 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141169.1 protein_id gnl|my_center|LOCUS_47360 >Feature sequence1961 690 764 gene locus_tag LOCUS_t00510 690 764 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 784 1749 gene locus_tag LOCUS_47370 784 1749 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_47370 >Feature sequence1962 860 309 gene locus_tag LOCUS_47380 860 309 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257073.1 protein_id gnl|my_center|LOCUS_47380 <1913 1290 gene locus_tag LOCUS_47390 <1913 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257072.1:bidirectional hydrogenase complex protein HoxU >Feature sequence1963 <1913 1155 gene locus_tag LOCUS_47400 <1913 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920652.1:ABC transporter ATP-binding protein/permease >Feature sequence1964 679 311 gene locus_tag LOCUS_47410 679 311 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531148.1 protein_id gnl|my_center|LOCUS_47410 1153 1869 gene locus_tag LOCUS_47420 1153 1869 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142802.1 protein_id gnl|my_center|LOCUS_47420 >Feature sequence1965 588 298 gene locus_tag LOCUS_47430 gene kaiB 588 298 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056333.1 protein_id gnl|my_center|LOCUS_47430 <1912 1156 gene locus_tag LOCUS_47440 <1912 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056332.1:circadian clock protein KaiA >Feature sequence1966 492 16 gene locus_tag LOCUS_47450 492 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47450 1191 1373 gene locus_tag LOCUS_47460 1191 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47460 1301 1900 gene locus_tag LOCUS_47470 1301 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47470 >Feature sequence1967 >Feature sequence1968 <1911 239 gene locus_tag LOCUS_47480 <1911 239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816642.1:yersiniabactin polyketide synthase HMWP1 >Feature sequence1969 977 360 gene locus_tag LOCUS_47490 977 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47490 >Feature sequence1970 768 418 gene locus_tag LOCUS_47500 gene rplQ 768 418 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_47500 <1910 941 gene locus_tag LOCUS_47510 <1910 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143560.1:DNA-directed RNA polymerase subunit alpha >Feature sequence1971 1198 596 gene locus_tag LOCUS_47520 1198 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_47520 >Feature sequence1972 <1 923 gene locus_tag LOCUS_47530 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140150.1:IS4-like element ISGvi2 family transposase <1908 1293 gene locus_tag LOCUS_47540 <1908 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920867.1:cobalt transporter CbiM >Feature sequence1973 172 1194 gene locus_tag LOCUS_47550 172 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47550 1296 1907 gene locus_tag LOCUS_47560 1296 1907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47560 >Feature sequence1974 1379 768 gene locus_tag LOCUS_47570 1379 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47570 >Feature sequence1975 483 1274 gene locus_tag LOCUS_47580 483 1274 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058307.1 protein_id gnl|my_center|LOCUS_47580 1776 1309 gene locus_tag LOCUS_47590 1776 1309 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056399.1 protein_id gnl|my_center|LOCUS_47590 >Feature sequence1976 <1 1313 gene locus_tag LOCUS_47600 <1 1313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766054.1:DUF5009 domain-containing protein 1330 1689 gene locus_tag LOCUS_47610 1330 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47610 >Feature sequence1977 614 456 gene locus_tag LOCUS_47620 614 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47620 1288 731 gene locus_tag LOCUS_47630 1288 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_47630 >Feature sequence1978 318 632 gene locus_tag LOCUS_47640 318 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47640 1289 1047 gene locus_tag LOCUS_47650 1289 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056980.1 protein_id gnl|my_center|LOCUS_47650 >Feature sequence1979 364 122 gene locus_tag LOCUS_47660 364 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47660 <1903 586 gene locus_tag LOCUS_47670 <1903 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence1980 103 432 gene locus_tag LOCUS_47680 103 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47680 861 1103 gene locus_tag LOCUS_47690 861 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47690 1366 1575 gene locus_tag LOCUS_47700 1366 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47700 >Feature sequence1981 847 422 gene locus_tag LOCUS_47710 847 422 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679685.1 protein_id gnl|my_center|LOCUS_47710 1095 844 gene locus_tag LOCUS_47720 1095 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47720 1405 1100 gene locus_tag LOCUS_47730 1405 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47730 1838 1554 gene locus_tag LOCUS_47740 1838 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47740 >Feature sequence1982 570 421 gene locus_tag LOCUS_47750 570 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47750 >Feature sequence1983 1723 1037 gene locus_tag LOCUS_47760 1723 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47760 >Feature sequence1984 424 1101 gene locus_tag LOCUS_47770 424 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47770 >Feature sequence1985 551 3 gene locus_tag LOCUS_47780 551 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47780 <1898 584 gene locus_tag LOCUS_47790 <1898 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836183.1:sulfotransferase >Feature sequence1986 496 1551 gene locus_tag LOCUS_47800 496 1551 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799453.1 protein_id gnl|my_center|LOCUS_47800 >Feature sequence1987 >Feature sequence1988 1 933 gene locus_tag LOCUS_47810 1 933 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_47810 >Feature sequence1989 1420 1067 gene locus_tag LOCUS_47820 1420 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47820 >Feature sequence1990 <1 558 gene locus_tag LOCUS_47830 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057370.1:photosystem II chlorophyll-binding protein CP47 1006 1563 gene locus_tag LOCUS_47840 gene nrdR 1006 1563 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_47840 >Feature sequence1991 >Feature sequence1992 <1 530 gene locus_tag LOCUS_47850 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140038.1:replicative DNA helicase >Feature sequence1993 623 225 gene locus_tag LOCUS_47860 623 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_47860 1343 648 gene locus_tag LOCUS_47870 1343 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47870 >Feature sequence1994 166 975 gene locus_tag LOCUS_47880 166 975 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142139.1 protein_id gnl|my_center|LOCUS_47880 1068 1316 gene locus_tag LOCUS_47890 1068 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47890 1398 1646 gene locus_tag LOCUS_47900 1398 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47900 >Feature sequence1995 <1892 74 gene locus_tag LOCUS_47910 <1892 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257474.1:S8 family serine peptidase >Feature sequence1996 279 64 gene locus_tag LOCUS_47920 279 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47920 630 409 gene locus_tag LOCUS_47930 630 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47930 1399 983 gene locus_tag LOCUS_47940 1399 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_47940 >Feature sequence1997 >Feature sequence1998 963 793 gene locus_tag LOCUS_47950 963 793 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390272.1 protein_id gnl|my_center|LOCUS_47950 <1888 1007 gene locus_tag LOCUS_47960 <1888 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978308.1:polyamine aminopropyltransferase >Feature sequence1999 1260 262 gene locus_tag LOCUS_47970 gene rpoD 1260 262 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920727.1 protein_id gnl|my_center|LOCUS_47970 >Feature sequence2000 679 1587 gene locus_tag LOCUS_47980 679 1587 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534169.1 protein_id gnl|my_center|LOCUS_47980 >Feature sequence2001 <1 1642 gene locus_tag LOCUS_47990 <1 1642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel >Feature sequence2002 272 1510 gene locus_tag LOCUS_48000 272 1510 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058010.1 protein_id gnl|my_center|LOCUS_48000 >Feature sequence2003 >Feature sequence2004 211 1704 gene locus_tag LOCUS_48010 211 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48010 >Feature sequence2005 >Feature sequence2006 1013 348 gene locus_tag LOCUS_48020 1013 348 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058105.1 protein_id gnl|my_center|LOCUS_48020 1117 1308 gene locus_tag LOCUS_48030 gene psbZ 1117 1308 CDS product photosystem II reaction center protein PsbZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057802.1 protein_id gnl|my_center|LOCUS_48030 >Feature sequence2007 356 679 gene locus_tag LOCUS_48040 356 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48040 <1885 1135 gene locus_tag LOCUS_48050 <1885 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057996.1:YdcF family protein >Feature sequence2008 722 216 gene locus_tag LOCUS_48060 722 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48060 1700 1876 gene locus_tag LOCUS_48070 1700 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48070 >Feature sequence2009 216 719 gene locus_tag LOCUS_48080 216 719 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142733.1 protein_id gnl|my_center|LOCUS_48080 716 1270 gene locus_tag LOCUS_48090 716 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48090 1477 1668 gene locus_tag LOCUS_48100 1477 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48100 >Feature sequence2010 52 816 gene locus_tag LOCUS_48110 52 816 CDS product HpsJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056247.1 protein_id gnl|my_center|LOCUS_48110 888 1475 gene locus_tag LOCUS_48120 888 1475 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141366.1 protein_id gnl|my_center|LOCUS_48120 >Feature sequence2011 377 1660 gene locus_tag LOCUS_48130 377 1660 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920846.1 protein_id gnl|my_center|LOCUS_48130 >Feature sequence2012 <1 564 gene locus_tag LOCUS_48140 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065411.1:class I SAM-dependent methyltransferase 687 1685 gene locus_tag LOCUS_48150 687 1685 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144142.1 protein_id gnl|my_center|LOCUS_48150 >Feature sequence2013 1257 265 gene locus_tag LOCUS_48160 1257 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48160 >Feature sequence2014 272 1762 gene locus_tag LOCUS_48170 272 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48170 >Feature sequence2015 1124 204 gene locus_tag LOCUS_48180 gene hypB 1124 204 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728544.1 protein_id gnl|my_center|LOCUS_48180 1459 1115 gene locus_tag LOCUS_48190 1459 1115 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225637.1 protein_id gnl|my_center|LOCUS_48190 >Feature sequence2016 532 194 gene locus_tag LOCUS_48200 gene rpsT 532 194 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_48200 >Feature sequence2017 291 506 gene locus_tag LOCUS_48210 291 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48210 <1874 641 gene locus_tag LOCUS_48220 <1874 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256120.1:Ig-like domain-containing protein >Feature sequence2018 539 189 gene locus_tag LOCUS_48230 539 189 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056570.1 protein_id gnl|my_center|LOCUS_48230 1810 1388 gene locus_tag LOCUS_48240 1810 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48240 >Feature sequence2019 355 1398 gene locus_tag LOCUS_48250 355 1398 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_48250 >Feature sequence2020 1085 234 gene locus_tag LOCUS_48260 1085 234 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001133791.1 protein_id gnl|my_center|LOCUS_48260 <1871 1216 gene locus_tag LOCUS_48270 <1871 1216 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897221.1:RNA-guided endonuclease TnpB family protein >Feature sequence2021 <1871 638 gene locus_tag LOCUS_48280 <1871 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393064.1:3-dehydroquinate synthase >Feature sequence2022 237 1571 gene locus_tag LOCUS_48290 237 1571 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057917.1 protein_id gnl|my_center|LOCUS_48290 >Feature sequence2023 315 1667 gene locus_tag LOCUS_48300 315 1667 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143056.1 protein_id gnl|my_center|LOCUS_48300 >Feature sequence2024 1325 273 gene locus_tag LOCUS_48310 1325 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48310 >Feature sequence2025 432 1805 gene locus_tag LOCUS_48320 432 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48320 >Feature sequence2026 <1 1026 gene locus_tag LOCUS_48330 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_231833781.1:DUF445 family protein 1559 1783 gene locus_tag LOCUS_48340 1559 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48340 >Feature sequence2027 700 44 gene locus_tag LOCUS_48350 700 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48350 1107 703 gene locus_tag LOCUS_48360 1107 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48360 >Feature sequence2028 1365 550 gene locus_tag LOCUS_48370 1365 550 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_48370 >Feature sequence2029 822 184 gene locus_tag LOCUS_48380 822 184 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_48380 979 1281 gene locus_tag LOCUS_48390 979 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056692.1 protein_id gnl|my_center|LOCUS_48390 >Feature sequence2030 <1866 653 gene locus_tag LOCUS_48400 <1866 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727717.1:flotillin family protein >Feature sequence2031 313 44 gene locus_tag LOCUS_48410 313 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48410 >Feature sequence2032 145 1251 gene locus_tag LOCUS_48420 145 1251 CDS product class III poly(R)-hydroxyalkanoic acid synthase subunit PhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037305.1 protein_id gnl|my_center|LOCUS_48420 >Feature sequence2033 457 1446 gene locus_tag LOCUS_48430 457 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48430 >Feature sequence2034 655 1203 gene locus_tag LOCUS_48440 655 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48440 >Feature sequence2035 <1863 1315 gene locus_tag LOCUS_48450 <1863 1315 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141894.1:Uma2 family endonuclease >Feature sequence2036 1576 473 gene locus_tag LOCUS_48460 1576 473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48460 >Feature sequence2037 949 542 gene locus_tag LOCUS_48470 949 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48470 1389 1024 gene locus_tag LOCUS_48480 1389 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48480 >Feature sequence2038 2 1453 gene locus_tag LOCUS_48490 2 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48490 >Feature sequence2039 1037 249 gene locus_tag LOCUS_48500 1037 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_48500 >Feature sequence2040 419 1081 gene locus_tag LOCUS_48510 419 1081 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057649.1 protein_id gnl|my_center|LOCUS_48510 1172 1408 gene locus_tag LOCUS_48520 1172 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48520 >Feature sequence2041 816 1136 gene locus_tag LOCUS_48530 816 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48530 1160 1579 gene locus_tag LOCUS_48540 1160 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48540 >Feature sequence2042 <1 701 gene locus_tag LOCUS_48550 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057520.1:phosphoribosylformylglycinamidine synthase subunit PurL note possible pseudo, internal stop codon 747 875 gene locus_tag LOCUS_48560 747 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48560 >Feature sequence2043 676 269 gene locus_tag LOCUS_48570 gene rplR 676 269 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_48570 1227 688 gene locus_tag LOCUS_48580 gene rplF 1227 688 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_48580 1772 1371 gene locus_tag LOCUS_48590 gene rpsH 1772 1371 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055949.1 protein_id gnl|my_center|LOCUS_48590 >Feature sequence2044 <1 1296 gene locus_tag LOCUS_48600 <1 1296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199341128.1:N-acetylmuramoyl-L-alanine amidase 1636 1451 gene locus_tag LOCUS_48610 1636 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48610 >Feature sequence2045 177 719 gene locus_tag LOCUS_48620 177 719 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166172348.1 protein_id gnl|my_center|LOCUS_48620 716 1369 gene locus_tag LOCUS_48630 716 1369 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143439.1 protein_id gnl|my_center|LOCUS_48630 >Feature sequence2046 590 988 gene locus_tag LOCUS_48640 gene psb27 590 988 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_48640 >Feature sequence2047 1339 488 gene locus_tag LOCUS_48650 1339 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48650 >Feature sequence2048 <1855 576 gene locus_tag LOCUS_48660 <1855 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057387.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence2049 128 1243 gene locus_tag LOCUS_48670 128 1243 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056469.1 protein_id gnl|my_center|LOCUS_48670 >Feature sequence2050 225 1067 gene locus_tag LOCUS_48680 225 1067 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_48680 >Feature sequence2051 943 116 gene locus_tag LOCUS_48690 943 116 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058175.1 protein_id gnl|my_center|LOCUS_48690 <1853 951 gene locus_tag LOCUS_48700 <1853 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921030.1:type IV pilus assembly protein PilM >Feature sequence2052 <1 984 gene locus_tag LOCUS_48710 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057166.1:serine/threonine-protein kinase 1216 1037 gene locus_tag LOCUS_48720 1216 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48720 >Feature sequence2053 138 278 gene locus_tag LOCUS_48730 138 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48730 641 1138 gene locus_tag LOCUS_48740 641 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48740 >Feature sequence2054 589 1698 gene locus_tag LOCUS_48750 589 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48750 >Feature sequence2055 1143 1580 gene locus_tag LOCUS_48760 1143 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48760 >Feature sequence2056 439 1071 gene locus_tag LOCUS_48770 439 1071 CDS product TIGR02117 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938028.1 protein_id gnl|my_center|LOCUS_48770 >Feature sequence2057 313 1443 gene locus_tag LOCUS_48780 313 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48780 >Feature sequence2058 1366 227 gene locus_tag LOCUS_48790 gene gcvT 1366 227 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143519.1 protein_id gnl|my_center|LOCUS_48790 >Feature sequence2059 394 711 gene locus_tag LOCUS_48800 394 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48800 712 1086 gene locus_tag LOCUS_48810 712 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48810 >Feature sequence2060 1387 626 gene locus_tag LOCUS_48820 1387 626 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056030.1 protein_id gnl|my_center|LOCUS_48820 >Feature sequence2061 641 1252 gene locus_tag LOCUS_48830 641 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48830 >Feature sequence2062 609 1280 gene locus_tag LOCUS_48840 609 1280 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142214.1 protein_id gnl|my_center|LOCUS_48840 >Feature sequence2063 1030 1509 gene locus_tag LOCUS_48850 1030 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48850 >Feature sequence2064 1419 382 gene locus_tag LOCUS_48860 1419 382 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082923.1 protein_id gnl|my_center|LOCUS_48860 >Feature sequence2065 <1 629 gene locus_tag LOCUS_48870 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967354.1:amidohydrolase family protein 1519 1031 gene locus_tag LOCUS_48880 1519 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_48880 >Feature sequence2066 <1 1667 gene locus_tag LOCUS_48890 <1 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012548770.1:flippase-like domain-containing protein >Feature sequence2067 744 445 gene locus_tag LOCUS_48900 744 445 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920842.1 protein_id gnl|my_center|LOCUS_48900 >Feature sequence2068 <1 699 gene locus_tag LOCUS_48910 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393799.1:ATP-binding protein 771 1217 gene locus_tag LOCUS_48920 771 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48920 >Feature sequence2069 <1 963 gene locus_tag LOCUS_48930 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140772.1:PrsW family glutamic-type intramembrane protease >Feature sequence2070 904 1653 gene locus_tag LOCUS_48940 904 1653 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797618.1 protein_id gnl|my_center|LOCUS_48940 >Feature sequence2071 893 402 gene locus_tag LOCUS_48950 893 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48950 1722 1201 gene locus_tag LOCUS_48960 1722 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48960 >Feature sequence2072 586 446 gene locus_tag LOCUS_48970 586 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48970 >Feature sequence2073 537 1376 gene locus_tag LOCUS_48980 gene recO 537 1376 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140088.1 protein_id gnl|my_center|LOCUS_48980 >Feature sequence2074 494 775 gene locus_tag LOCUS_48990 494 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_48990 <1840 789 gene locus_tag LOCUS_49000 <1840 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065525186.1:DUF4084 domain-containing protein >Feature sequence2075 1654 599 gene locus_tag LOCUS_49010 1654 599 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141920.1 protein_id gnl|my_center|LOCUS_49010 >Feature sequence2076 938 1162 gene locus_tag LOCUS_49020 938 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49020 >Feature sequence2077 <1838 482 gene locus_tag LOCUS_49030 <1838 482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence2078 <1 968 gene locus_tag LOCUS_49040 <1 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001832304.1:branched-chain amino acid aminotransferase >Feature sequence2079 >Feature sequence2080 442 8 gene locus_tag LOCUS_49050 442 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49050 885 1253 gene locus_tag LOCUS_49060 gene folB 885 1253 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798382.1 protein_id gnl|my_center|LOCUS_49060 >Feature sequence2081 >Feature sequence2082 305 1609 gene locus_tag LOCUS_49070 305 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49070 >Feature sequence2083 349 86 gene locus_tag LOCUS_49080 349 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49080 1077 616 gene locus_tag LOCUS_49090 1077 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49090 >Feature sequence2084 169 648 gene locus_tag LOCUS_49100 169 648 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_49100 697 1149 gene locus_tag LOCUS_49110 697 1149 CDS product nitrate reductase associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057196.1 protein_id gnl|my_center|LOCUS_49110 >Feature sequence2085 <1835 1267 gene locus_tag LOCUS_49120 <1835 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920287.1:O-antigen ligase >Feature sequence2086 497 165 gene locus_tag LOCUS_49130 497 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49130 908 696 gene locus_tag LOCUS_49140 908 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49140 1538 1302 gene locus_tag LOCUS_49150 1538 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49150 >Feature sequence2087 955 377 gene locus_tag LOCUS_49160 955 377 CDS product thylakoid membrane photosystem I accumulation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798220.1 protein_id gnl|my_center|LOCUS_49160 <1834 1223 gene locus_tag LOCUS_49170 <1834 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence2088 339 64 gene locus_tag LOCUS_49180 339 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49180 548 357 gene locus_tag LOCUS_49190 548 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49190 735 535 gene locus_tag LOCUS_49200 735 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49200 >Feature sequence2089 943 644 gene locus_tag LOCUS_49210 943 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49210 >Feature sequence2090 825 286 gene locus_tag LOCUS_49220 825 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49220 >Feature sequence2091 1646 558 gene locus_tag LOCUS_49230 1646 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49230 >Feature sequence2092 527 991 gene locus_tag LOCUS_49240 527 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49240 >Feature sequence2093 <1 1441 gene locus_tag LOCUS_49250 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144179.1:trigger factor >Feature sequence2094 1633 1094 gene locus_tag LOCUS_49260 1633 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49260 >Feature sequence2095 1539 340 gene locus_tag LOCUS_49270 1539 340 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056868.1 protein_id gnl|my_center|LOCUS_49270 >Feature sequence2096 209 544 gene locus_tag LOCUS_49280 209 544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49280 1632 886 gene locus_tag LOCUS_49290 1632 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49290 >Feature sequence2097 313 8 gene locus_tag LOCUS_49300 313 8 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_49300 579 313 gene locus_tag LOCUS_49310 579 313 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390130.1 protein_id gnl|my_center|LOCUS_49310 969 739 gene locus_tag LOCUS_49320 969 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49320 1332 1117 gene locus_tag LOCUS_49330 1332 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49330 1574 1332 gene locus_tag LOCUS_49340 1574 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49340 >Feature sequence2098 916 773 gene locus_tag LOCUS_49350 916 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49350 1167 913 gene locus_tag LOCUS_49360 1167 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49360 1431 1201 gene locus_tag LOCUS_49370 1431 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49370 >Feature sequence2099 >Feature sequence2100 <1 679 gene locus_tag LOCUS_49380 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259663.1:iron ABC transporter permease note possible pseudo, internal stop codon 689 970 gene locus_tag LOCUS_49390 689 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49390 1080 1742 gene locus_tag LOCUS_49400 1080 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49400 >Feature sequence2101 <1 578 gene locus_tag LOCUS_49410 <1 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_044205562.1:CHAT domain-containing protein 657 1283 gene locus_tag LOCUS_49420 657 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49420 1366 1707 gene locus_tag LOCUS_49430 1366 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49430 >Feature sequence2102 828 1121 gene locus_tag LOCUS_49440 828 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49440 >Feature sequence2103 1461 958 gene locus_tag LOCUS_49450 1461 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49450 >Feature sequence2104 1027 1773 gene locus_tag LOCUS_49460 1027 1773 CDS product DUF3120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190832035.1 protein_id gnl|my_center|LOCUS_49460 >Feature sequence2105 456 1823 gene locus_tag LOCUS_49470 456 1823 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056511.1 protein_id gnl|my_center|LOCUS_49470 >Feature sequence2106 1515 658 gene locus_tag LOCUS_49480 1515 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49480 >Feature sequence2107 584 1357 gene locus_tag LOCUS_49490 584 1357 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141607.1 protein_id gnl|my_center|LOCUS_49490 >Feature sequence2108 432 1805 gene locus_tag LOCUS_49500 432 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49500 >Feature sequence2109 1034 576 gene locus_tag LOCUS_49510 1034 576 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400458.1 protein_id gnl|my_center|LOCUS_49510 >Feature sequence2110 <1 907 gene locus_tag LOCUS_49520 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082593.1:ABC-ATPase domain-containing protein >Feature sequence2111 503 1384 gene locus_tag LOCUS_49530 503 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228671.1 protein_id gnl|my_center|LOCUS_49530 >Feature sequence2112 <1 667 gene locus_tag LOCUS_49540 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888694.1:sulfate/molybdate ABC transporter ATP-binding protein >Feature sequence2113 115 1446 gene locus_tag LOCUS_49550 115 1446 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799062.1 protein_id gnl|my_center|LOCUS_49550 >Feature sequence2114 1131 952 gene locus_tag LOCUS_49560 1131 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49560 >Feature sequence2115 47 193 gene locus_tag LOCUS_49570 47 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49570 429 1262 gene locus_tag LOCUS_49580 429 1262 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_49580 >Feature sequence2116 185 754 gene locus_tag LOCUS_49590 185 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49590 >Feature sequence2117 1434 1697 gene locus_tag LOCUS_49600 1434 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49600 >Feature sequence2118 309 707 gene locus_tag LOCUS_49610 309 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49610 969 1307 gene locus_tag LOCUS_49620 969 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49620 >Feature sequence2119 277 1647 gene locus_tag LOCUS_49630 gene glmU 277 1647 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_49630 >Feature sequence2120 <1 542 gene locus_tag LOCUS_49640 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057365.1:photosystem I assembly protein Ycf3 586 882 gene locus_tag LOCUS_49650 gene gatC 586 882 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057364.1 protein_id gnl|my_center|LOCUS_49650 1301 1483 gene locus_tag LOCUS_49660 1301 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49660 >Feature sequence2121 <1 915 gene locus_tag LOCUS_49670 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930460.1:glycosyltransferase >Feature sequence2122 243 1040 gene locus_tag LOCUS_49680 243 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49680 1115 1726 gene locus_tag LOCUS_49690 1115 1726 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058121.1 protein_id gnl|my_center|LOCUS_49690 >Feature sequence2123 121 1248 gene locus_tag LOCUS_49700 121 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49700 >Feature sequence2124 >Feature sequence2125 350 1015 gene locus_tag LOCUS_49710 350 1015 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142341.1 protein_id gnl|my_center|LOCUS_49710 >Feature sequence2126 284 1297 gene locus_tag LOCUS_49720 gene proX 284 1297 CDS product glycine betaine/L-proline ABC transporter substrate-binding protein ProX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173041.1 protein_id gnl|my_center|LOCUS_49720 >Feature sequence2127 927 688 gene locus_tag LOCUS_49730 927 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49730 <1817 1163 gene locus_tag LOCUS_49740 <1817 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence2128 1466 909 gene locus_tag LOCUS_49750 1466 909 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056278.1 protein_id gnl|my_center|LOCUS_49750 >Feature sequence2129 409 897 gene locus_tag LOCUS_49760 409 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49760 1736 1062 gene locus_tag LOCUS_49770 gene lipB 1736 1062 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_49770 >Feature sequence2130 1184 126 gene locus_tag LOCUS_49780 1184 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49780 >Feature sequence2131 670 1326 gene locus_tag LOCUS_49790 670 1326 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057943.1 protein_id gnl|my_center|LOCUS_49790 >Feature sequence2132 795 346 gene locus_tag LOCUS_49800 795 346 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051041523.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_49800 896 777 gene locus_tag LOCUS_49810 896 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49810 1415 1008 gene locus_tag LOCUS_49820 1415 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49820 >Feature sequence2133 1605 262 gene locus_tag LOCUS_49830 1605 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_49830 >Feature sequence2134 676 467 gene locus_tag LOCUS_49840 676 467 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021259.1 protein_id gnl|my_center|LOCUS_49840 761 1573 gene locus_tag LOCUS_49850 gene modA 761 1573 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001032249.1 protein_id gnl|my_center|LOCUS_49850 >Feature sequence2135 <1 595 gene locus_tag LOCUS_49860 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058073.1:DNA mismatch repair protein MutS 1385 1621 gene locus_tag LOCUS_49870 1385 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49870 >Feature sequence2136 890 735 gene locus_tag LOCUS_49880 890 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49880 1814 1146 gene locus_tag LOCUS_49890 1814 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49890 >Feature sequence2137 <1 1470 gene locus_tag LOCUS_49900 <1 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence2138 583 768 gene locus_tag LOCUS_49910 583 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49910 1736 840 gene locus_tag LOCUS_49920 1736 840 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814609.1 protein_id gnl|my_center|LOCUS_49920 >Feature sequence2139 276 608 gene locus_tag LOCUS_49930 276 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49930 >Feature sequence2140 608 1297 gene locus_tag LOCUS_49940 608 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056056.1 protein_id gnl|my_center|LOCUS_49940 >Feature sequence2141 <1 809 gene locus_tag LOCUS_49950 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057996.1:YdcF family protein 852 1082 gene locus_tag LOCUS_49960 852 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49960 >Feature sequence2142 89 1267 gene locus_tag LOCUS_49970 89 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_49970 >Feature sequence2143 359 1195 gene locus_tag LOCUS_49980 gene lpxC 359 1195 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057627.1 protein_id gnl|my_center|LOCUS_49980 >Feature sequence2144 <1 756 gene locus_tag LOCUS_49990 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057171.1:8-amino-7-oxononanoate synthase 1590 784 gene locus_tag LOCUS_50000 1590 784 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_50000 >Feature sequence2145 443 946 gene locus_tag LOCUS_50010 443 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50010 1107 1592 gene locus_tag LOCUS_50020 gene apcA 1107 1592 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_50020 >Feature sequence2146 638 1573 gene locus_tag LOCUS_50030 638 1573 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_50030 >Feature sequence2147 1184 510 gene locus_tag LOCUS_50040 1184 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50040 1650 1153 gene locus_tag LOCUS_50050 1650 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_50050 >Feature sequence2148 <1 1103 gene locus_tag LOCUS_50060 <1 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057426.1:redox-regulated ATPase YchF 1130 1501 gene locus_tag LOCUS_50070 1130 1501 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 protein_id gnl|my_center|LOCUS_50070 >Feature sequence2149 1235 1612 gene locus_tag LOCUS_50080 1235 1612 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975235.1 protein_id gnl|my_center|LOCUS_50080 >Feature sequence2150 1715 498 gene locus_tag LOCUS_50090 1715 498 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143013.1 protein_id gnl|my_center|LOCUS_50090 >Feature sequence2151 <1808 748 gene locus_tag LOCUS_50100 <1808 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056298.1:serine/threonine-protein kinase >Feature sequence2152 <1807 456 gene locus_tag LOCUS_50110 <1807 456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421615.1:SLC13 family permease >Feature sequence2153 <1807 1025 gene locus_tag LOCUS_50120 <1807 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005807931.1:glutamate synthase large subunit >Feature sequence2154 297 530 gene locus_tag LOCUS_50130 297 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50130 512 970 gene locus_tag LOCUS_50140 512 970 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878102.1 protein_id gnl|my_center|LOCUS_50140 >Feature sequence2155 574 1419 gene locus_tag LOCUS_50150 574 1419 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057597.1 protein_id gnl|my_center|LOCUS_50150 >Feature sequence2156 551 351 gene locus_tag LOCUS_50160 551 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50160 961 587 gene locus_tag LOCUS_50170 961 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50170 1803 1177 gene locus_tag LOCUS_50180 1803 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50180 >Feature sequence2157 168 1349 gene locus_tag LOCUS_50190 168 1349 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143323.1 protein_id gnl|my_center|LOCUS_50190 >Feature sequence2158 110 805 gene locus_tag LOCUS_50200 110 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50200 <1804 782 gene locus_tag LOCUS_50210 <1804 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529438.1:lipopolysaccharide biosynthesis protein >Feature sequence2159 <1 1233 gene locus_tag LOCUS_50220 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence2160 374 291 gene locus_tag LOCUS_t00520 374 291 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1153 1473 gene locus_tag LOCUS_50230 1153 1473 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_50230 >Feature sequence2161 421 116 gene locus_tag LOCUS_50240 421 116 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141908.1 protein_id gnl|my_center|LOCUS_50240 689 414 gene locus_tag LOCUS_50250 689 414 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141909.1 protein_id gnl|my_center|LOCUS_50250 >Feature sequence2162 1471 1076 gene locus_tag LOCUS_50260 1471 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50260 >Feature sequence2163 <1801 421 gene locus_tag LOCUS_50270 <1801 421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase >Feature sequence2164 1363 215 gene locus_tag LOCUS_50280 1363 215 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140086.1 protein_id gnl|my_center|LOCUS_50280 >Feature sequence2165 341 1639 gene locus_tag LOCUS_50290 341 1639 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_218596652.1 protein_id gnl|my_center|LOCUS_50290 >Feature sequence2166 623 360 gene locus_tag LOCUS_50300 623 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50300 927 598 gene locus_tag LOCUS_50310 927 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_50310 >Feature sequence2167 279 1040 gene locus_tag LOCUS_50320 279 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50320 1385 1125 gene locus_tag LOCUS_50330 1385 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50330 >Feature sequence2168 <1 898 gene locus_tag LOCUS_50340 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023171949.1:ribulose bisphosphate carboxylase small subunit 1046 1486 gene locus_tag LOCUS_50350 1046 1486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50350 >Feature sequence2169 <1 1007 gene locus_tag LOCUS_50360 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057039.1:ABC transporter permease >Feature sequence2170 335 1549 gene locus_tag LOCUS_50370 335 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50370 >Feature sequence2171 118 882 gene locus_tag LOCUS_50380 118 882 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_50380 >Feature sequence2172 636 190 gene locus_tag LOCUS_50390 636 190 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_50390 937 623 gene locus_tag LOCUS_50400 937 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50400 >Feature sequence2173 588 881 gene locus_tag LOCUS_50410 588 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50410 >Feature sequence2174 <1 839 gene locus_tag LOCUS_50420 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057427.1:type I glutamate--ammonia ligase >Feature sequence2175 309 926 gene locus_tag LOCUS_50430 309 926 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056516.1 protein_id gnl|my_center|LOCUS_50430 1064 1375 gene locus_tag LOCUS_50440 gene nuoK 1064 1375 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140654.1 protein_id gnl|my_center|LOCUS_50440 >Feature sequence2176 1369 206 gene locus_tag LOCUS_50450 1369 206 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_50450 >Feature sequence2177 164 289 gene locus_tag LOCUS_50460 164 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50460 500 1264 gene locus_tag LOCUS_50470 gene rnc 500 1264 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142642.1 protein_id gnl|my_center|LOCUS_50470 >Feature sequence2178 747 1646 gene locus_tag LOCUS_50480 747 1646 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254254.1 protein_id gnl|my_center|LOCUS_50480 >Feature sequence2179 <1 1779 gene locus_tag LOCUS_50490 <1 1779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929046.1:AIPR family protein >Feature sequence2180 >Feature sequence2181 1641 838 gene locus_tag LOCUS_50500 gene trpA 1641 838 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056294.1 protein_id gnl|my_center|LOCUS_50500 >Feature sequence2182 1 303 gene locus_tag LOCUS_50510 1 303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50510 307 450 gene locus_tag LOCUS_50520 307 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50520 >Feature sequence2183 <1 1453 gene locus_tag LOCUS_50530 <1 1453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057300.1:AAA-like domain-containing protein >Feature sequence2184 1554 829 gene locus_tag LOCUS_50540 1554 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057518.1 protein_id gnl|my_center|LOCUS_50540 >Feature sequence2185 1494 1132 gene locus_tag LOCUS_50550 1494 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50550 >Feature sequence2186 319 1299 gene locus_tag LOCUS_50560 319 1299 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389904.1 protein_id gnl|my_center|LOCUS_50560 1513 1674 gene locus_tag LOCUS_50570 1513 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50570 >Feature sequence2187 118 741 gene locus_tag LOCUS_50580 118 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50580 873 1295 gene locus_tag LOCUS_50590 873 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50590 >Feature sequence2188 >Feature sequence2189 <1 769 gene locus_tag LOCUS_50600 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056673.1:mechanosensitive ion channel 1585 890 gene locus_tag LOCUS_50610 1585 890 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056725.1 protein_id gnl|my_center|LOCUS_50610 >Feature sequence2190 1033 617 gene locus_tag LOCUS_50620 1033 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50620 >Feature sequence2191 1445 513 gene locus_tag LOCUS_50630 1445 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50630 >Feature sequence2192 510 1250 gene locus_tag LOCUS_50640 510 1250 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_50640 >Feature sequence2193 809 177 gene locus_tag LOCUS_50650 809 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986939.1 protein_id gnl|my_center|LOCUS_50650 1091 828 gene locus_tag LOCUS_50660 1091 828 CDS product nitrogen fixation protein NifZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028153326.1 protein_id gnl|my_center|LOCUS_50660 <1787 1078 gene locus_tag LOCUS_50670 <1787 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583977.1:homocitrate synthase >Feature sequence2194 67 360 gene locus_tag LOCUS_50680 67 360 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056266.1 protein_id gnl|my_center|LOCUS_50680 >Feature sequence2195 855 55 gene locus_tag LOCUS_50690 855 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50690 1175 912 gene locus_tag LOCUS_50700 1175 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50700 >Feature sequence2196 <1785 1200 gene locus_tag LOCUS_50710 <1785 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144315.1:ergothioneine biosynthesis protein EgtC >Feature sequence2197 1116 178 gene locus_tag LOCUS_50720 1116 178 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_50720 >Feature sequence2198 389 1540 gene locus_tag LOCUS_50730 389 1540 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020683.1 protein_id gnl|my_center|LOCUS_50730 >Feature sequence2199 1017 745 gene locus_tag LOCUS_50740 1017 745 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_50740 >Feature sequence2200 247 1032 gene locus_tag LOCUS_50750 247 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50750 1178 1573 gene locus_tag LOCUS_50760 1178 1573 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_50760 >Feature sequence2201 1069 1482 gene locus_tag LOCUS_50770 1069 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140148.1 protein_id gnl|my_center|LOCUS_50770 >Feature sequence2202 <1780 878 gene locus_tag LOCUS_50780 <1780 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143795.1:AAA family ATPase >Feature sequence2203 <1780 40 gene locus_tag LOCUS_50790 <1780 40 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056407.1:ABC transporter ATP-binding protein >Feature sequence2204 769 341 gene locus_tag LOCUS_50800 769 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055984.1 protein_id gnl|my_center|LOCUS_50800 >Feature sequence2205 923 1417 gene locus_tag LOCUS_50810 923 1417 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140022.1 protein_id gnl|my_center|LOCUS_50810 >Feature sequence2206 1665 1114 gene locus_tag LOCUS_50820 gene tsaB 1665 1114 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055917.1 protein_id gnl|my_center|LOCUS_50820 >Feature sequence2207 1364 573 gene locus_tag LOCUS_50830 1364 573 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056776.1 protein_id gnl|my_center|LOCUS_50830 >Feature sequence2208 352 158 gene locus_tag LOCUS_50840 352 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50840 1486 416 gene locus_tag LOCUS_50850 1486 416 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_50850 >Feature sequence2209 <1778 676 gene locus_tag LOCUS_50860 <1778 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056082.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase >Feature sequence2210 617 961 gene locus_tag LOCUS_50870 617 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50870 >Feature sequence2211 55 1464 gene locus_tag LOCUS_50880 55 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50880 >Feature sequence2212 1583 108 gene locus_tag LOCUS_50890 1583 108 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000456939.1 protein_id gnl|my_center|LOCUS_50890 >Feature sequence2213 174 1349 gene locus_tag LOCUS_50900 gene cfa 174 1349 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_50900 >Feature sequence2214 1033 323 gene locus_tag LOCUS_50910 1033 323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50910 >Feature sequence2215 1149 655 gene locus_tag LOCUS_50920 1149 655 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_50920 <1775 1246 gene locus_tag LOCUS_50930 <1775 1246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141190.1:bleomycin hydrolase >Feature sequence2216 391 645 gene locus_tag LOCUS_50940 391 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50940 739 1653 gene locus_tag LOCUS_50950 739 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50950 >Feature sequence2217 243 863 gene locus_tag LOCUS_50960 243 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50960 >Feature sequence2218 1158 1763 gene locus_tag LOCUS_50970 1158 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50970 >Feature sequence2219 1734 58 gene locus_tag LOCUS_50980 1734 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_50980 >Feature sequence2220 306 599 gene locus_tag LOCUS_50990 306 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921006.1 protein_id gnl|my_center|LOCUS_50990 719 1444 gene locus_tag LOCUS_51000 719 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51000 >Feature sequence2221 527 600 gene locus_tag LOCUS_t00530 527 600 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1021 1692 gene locus_tag LOCUS_51010 1021 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51010 >Feature sequence2222 159 623 gene locus_tag LOCUS_51020 159 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51020 672 995 gene locus_tag LOCUS_51030 672 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51030 >Feature sequence2223 >Feature sequence2224 790 290 gene locus_tag LOCUS_51040 790 290 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096828425.1 protein_id gnl|my_center|LOCUS_51040 1299 787 gene locus_tag LOCUS_51050 1299 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51050 >Feature sequence2225 >Feature sequence2226 1264 809 gene locus_tag LOCUS_51060 1264 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51060 >Feature sequence2227 1385 837 gene locus_tag LOCUS_51070 gene rfbC 1385 837 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246576.1 protein_id gnl|my_center|LOCUS_51070 >Feature sequence2228 <1767 968 gene locus_tag LOCUS_51080 <1767 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056776.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence2229 1450 188 gene locus_tag LOCUS_51090 1450 188 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_51090 >Feature sequence2230 <1 1342 gene locus_tag LOCUS_51100 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056974.1:DNA polymerase III subunit gamma/tau >Feature sequence2231 221 1732 gene locus_tag LOCUS_51110 221 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51110 >Feature sequence2232 1178 843 gene locus_tag LOCUS_51120 gene psb28 1178 843 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920702.1 protein_id gnl|my_center|LOCUS_51120 >Feature sequence2233 1142 357 gene locus_tag LOCUS_51130 gene xth 1142 357 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920930.1 protein_id gnl|my_center|LOCUS_51130 <1764 1226 gene locus_tag LOCUS_51140 <1764 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929375.1:class I SAM-dependent methyltransferase >Feature sequence2234 1763 726 gene locus_tag LOCUS_51150 1763 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51150 >Feature sequence2235 1072 866 gene locus_tag LOCUS_51160 1072 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51160 >Feature sequence2236 >Feature sequence2237 >Feature sequence2238 <1 1602 gene locus_tag LOCUS_51170 <1 1602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941142.1:EAL domain-containing protein >Feature sequence2239 154 396 gene locus_tag LOCUS_51180 154 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51180 1588 461 gene locus_tag LOCUS_51190 gene queA 1588 461 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056766.1 protein_id gnl|my_center|LOCUS_51190 >Feature sequence2240 <1 554 gene locus_tag LOCUS_51200 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057334.1:DUF1517 domain-containing protein 742 1731 gene locus_tag LOCUS_51210 742 1731 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057738.1 protein_id gnl|my_center|LOCUS_51210 >Feature sequence2241 >Feature sequence2242 1248 673 gene locus_tag LOCUS_51220 1248 673 CDS product DUF3038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057324.1 protein_id gnl|my_center|LOCUS_51220 >Feature sequence2243 862 152 gene locus_tag LOCUS_51230 862 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51230 <1760 1039 gene locus_tag LOCUS_51240 <1760 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056566.1:photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 >Feature sequence2244 <1 1742 gene locus_tag LOCUS_51250 <1 1742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142241.1:caspase family protein >Feature sequence2245 342 1400 gene locus_tag LOCUS_51260 342 1400 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_097654226.1 protein_id gnl|my_center|LOCUS_51260 >Feature sequence2246 >Feature sequence2247 1758 1495 gene locus_tag LOCUS_51270 1758 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51270 >Feature sequence2248 896 495 gene locus_tag LOCUS_51280 896 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51280 1164 1760 gene locus_tag LOCUS_51290 gene queC 1164 1760 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 protein_id gnl|my_center|LOCUS_51290 >Feature sequence2249 93 1421 gene locus_tag LOCUS_51300 93 1421 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141151.1 protein_id gnl|my_center|LOCUS_51300 >Feature sequence2250 113 1042 gene locus_tag LOCUS_51310 113 1042 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896752.1 protein_id gnl|my_center|LOCUS_51310 1507 1154 gene locus_tag LOCUS_51320 1507 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51320 >Feature sequence2251 639 349 gene locus_tag LOCUS_51330 639 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51330 1113 1268 gene locus_tag LOCUS_51340 1113 1268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51340 >Feature sequence2252 <1757 805 gene locus_tag LOCUS_51350 <1757 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056689.1:ketoacyl-ACP synthase III >Feature sequence2253 572 327 gene locus_tag LOCUS_51360 572 327 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249868.1 protein_id gnl|my_center|LOCUS_51360 <1755 1041 gene locus_tag LOCUS_51370 <1755 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203665.1:calcium-translocating P-type ATPase, PMCA-type >Feature sequence2254 308 466 gene locus_tag LOCUS_51380 308 466 CDS product YqaE/Pmp3 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084988.1 protein_id gnl|my_center|LOCUS_51380 605 1501 gene locus_tag LOCUS_51390 605 1501 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121934.1 protein_id gnl|my_center|LOCUS_51390 >Feature sequence2255 74 205 gene locus_tag LOCUS_51400 74 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51400 209 778 gene locus_tag LOCUS_51410 209 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51410 788 1318 gene locus_tag LOCUS_51420 788 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51420 >Feature sequence2256 <1 612 gene locus_tag LOCUS_51430 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920765.1:PRC-barrel domain-containing protein 1018 1689 gene locus_tag LOCUS_51440 1018 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51440 >Feature sequence2257 472 1590 gene locus_tag LOCUS_51450 472 1590 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057595.1 protein_id gnl|my_center|LOCUS_51450 >Feature sequence2258 683 985 gene locus_tag LOCUS_51460 683 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51460 >Feature sequence2259 501 250 gene locus_tag LOCUS_51470 501 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51470 <1754 822 gene locus_tag LOCUS_51480 <1754 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058178.1:ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N >Feature sequence2260 <1 809 gene locus_tag LOCUS_51490 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142579.1:pitrilysin family protein 812 1012 gene locus_tag LOCUS_51500 812 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51500 >Feature sequence2261 362 916 gene locus_tag LOCUS_51510 362 916 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057129.1 protein_id gnl|my_center|LOCUS_51510 1208 993 gene locus_tag LOCUS_51520 1208 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51520 >Feature sequence2262 1288 734 gene locus_tag LOCUS_51530 1288 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51530 >Feature sequence2263 >Feature sequence2264 <1752 814 gene locus_tag LOCUS_51540 <1752 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124751.1:phosphate ABC transporter permease subunit PstC >Feature sequence2265 759 262 gene locus_tag LOCUS_51550 759 262 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928842.1 protein_id gnl|my_center|LOCUS_51550 <1751 792 gene locus_tag LOCUS_51560 <1751 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193345474.1:RNA polymerase sigma factor, RpoD/SigA family >Feature sequence2266 <1751 226 gene locus_tag LOCUS_51570 <1751 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057166.1:serine/threonine-protein kinase >Feature sequence2267 >Feature sequence2268 1233 319 gene locus_tag LOCUS_51580 1233 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51580 >Feature sequence2269 <1 1162 gene locus_tag LOCUS_51590 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056313.1:alanine racemase >Feature sequence2270 489 313 gene locus_tag LOCUS_51600 489 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51600 852 664 gene locus_tag LOCUS_51610 852 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51610 1028 879 gene locus_tag LOCUS_51620 1028 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51620 1054 1302 gene locus_tag LOCUS_51630 1054 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51630 1454 1311 gene locus_tag LOCUS_51640 1454 1311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_51640 >Feature sequence2271 1194 1394 gene locus_tag LOCUS_51650 1194 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51650 1525 1400 gene locus_tag LOCUS_51660 1525 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51660 >Feature sequence2272 <1746 236 gene locus_tag LOCUS_51670 <1746 236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence2273 1587 355 gene locus_tag LOCUS_51680 1587 355 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165447207.1 protein_id gnl|my_center|LOCUS_51680 >Feature sequence2274 >Feature sequence2275 1119 46 gene locus_tag LOCUS_51690 1119 46 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056195.1 protein_id gnl|my_center|LOCUS_51690 >Feature sequence2276 <1742 202 gene locus_tag LOCUS_51700 <1742 202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase >Feature sequence2277 338 871 gene locus_tag LOCUS_51710 338 871 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146526238.1 protein_id gnl|my_center|LOCUS_51710 1305 1081 gene locus_tag LOCUS_51720 1305 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51720 1740 1369 gene locus_tag LOCUS_51730 1740 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51730 >Feature sequence2278 >Feature sequence2279 131 385 gene locus_tag LOCUS_51740 131 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51740 382 1065 gene locus_tag LOCUS_51750 gene nusG 382 1065 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056149.1 protein_id gnl|my_center|LOCUS_51750 1065 1490 gene locus_tag LOCUS_51760 gene rplK 1065 1490 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_51760 >Feature sequence2280 125 379 gene locus_tag LOCUS_51770 125 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51770 450 659 gene locus_tag LOCUS_51780 450 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51780 >Feature sequence2281 1415 645 gene locus_tag LOCUS_51790 1415 645 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058055.1 protein_id gnl|my_center|LOCUS_51790 1547 1696 gene locus_tag LOCUS_51800 1547 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51800 >Feature sequence2282 642 73 gene locus_tag LOCUS_51810 gene rplJ 642 73 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056152.1 protein_id gnl|my_center|LOCUS_51810 1668 958 gene locus_tag LOCUS_51820 gene rplA 1668 958 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056151.1 protein_id gnl|my_center|LOCUS_51820 >Feature sequence2283 699 1229 gene locus_tag LOCUS_51830 699 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51830 >Feature sequence2284 654 223 gene locus_tag LOCUS_51840 654 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51840 1515 805 gene locus_tag LOCUS_51850 1515 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51850 >Feature sequence2285 405 1253 gene locus_tag LOCUS_51860 405 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51860 >Feature sequence2286 >Feature sequence2287 310 1554 gene locus_tag LOCUS_51870 310 1554 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_51870 >Feature sequence2288 <1 951 gene locus_tag LOCUS_51880 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056876.1:polysaccharide deacetylase family protein >Feature sequence2289 618 253 gene locus_tag LOCUS_51890 618 253 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_51890 >Feature sequence2290 728 1447 gene locus_tag LOCUS_51900 728 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51900 >Feature sequence2291 326 1555 gene locus_tag LOCUS_51910 326 1555 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808454.1 protein_id gnl|my_center|LOCUS_51910 >Feature sequence2292 1066 875 gene locus_tag LOCUS_51920 1066 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51920 1388 1173 gene locus_tag LOCUS_51930 1388 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51930 1701 1495 gene locus_tag LOCUS_51940 1701 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51940 >Feature sequence2293 650 781 gene locus_tag LOCUS_51950 650 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51950 968 1366 gene locus_tag LOCUS_51960 968 1366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51960 1574 1350 gene locus_tag LOCUS_51970 1574 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_51970 >Feature sequence2294 <1732 1206 gene locus_tag LOCUS_51980 <1732 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057433.1:GUN4 domain-containing protein >Feature sequence2295 <1 943 gene locus_tag LOCUS_51990 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144136.1:DUF4912 domain-containing protein >Feature sequence2296 358 1020 gene locus_tag LOCUS_52000 358 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52000 >Feature sequence2297 <1731 716 gene locus_tag LOCUS_52010 <1731 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057122.1:PAS domain S-box protein >Feature sequence2298 208 1551 gene locus_tag LOCUS_52020 208 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52020 >Feature sequence2299 <1 989 gene locus_tag LOCUS_52030 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125901.1:NADP-dependent isocitrate dehydrogenase <1731 1148 gene locus_tag LOCUS_52040 <1731 1148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056997.1:MBL fold metallo-hydrolase >Feature sequence2300 >Feature sequence2301 <1730 146 gene locus_tag LOCUS_52050 <1730 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058183.1:murein biosynthesis integral membrane protein MurJ >Feature sequence2302 171 1109 gene locus_tag LOCUS_52060 171 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52060 1399 1166 gene locus_tag LOCUS_52070 1399 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52070 >Feature sequence2303 1636 221 gene locus_tag LOCUS_52080 1636 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52080 >Feature sequence2304 <1 971 gene locus_tag LOCUS_52090 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence2305 526 1158 gene locus_tag LOCUS_52100 526 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52100 >Feature sequence2306 89 919 gene locus_tag LOCUS_52110 gene larE 89 919 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920840.1 protein_id gnl|my_center|LOCUS_52110 >Feature sequence2307 135 1064 gene locus_tag LOCUS_52120 135 1064 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141368.1 protein_id gnl|my_center|LOCUS_52120 >Feature sequence2308 798 610 gene locus_tag LOCUS_52130 798 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52130 1458 904 gene locus_tag LOCUS_52140 1458 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52140 >Feature sequence2309 1427 726 gene locus_tag LOCUS_52150 1427 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52150 >Feature sequence2310 625 239 gene locus_tag LOCUS_52160 625 239 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140980.1 protein_id gnl|my_center|LOCUS_52160 975 622 gene locus_tag LOCUS_52170 975 622 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_52170 >Feature sequence2311 103 1698 gene locus_tag LOCUS_52180 103 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52180 >Feature sequence2312 880 1647 gene locus_tag LOCUS_52190 880 1647 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144380.1 protein_id gnl|my_center|LOCUS_52190 >Feature sequence2313 35 1549 gene locus_tag LOCUS_52200 gene glpK 35 1549 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141749.1 protein_id gnl|my_center|LOCUS_52200 >Feature sequence2314 1105 755 gene locus_tag LOCUS_52210 gene rplT 1105 755 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_52210 1416 1219 gene locus_tag LOCUS_52220 gene rpmI 1416 1219 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_52220 >Feature sequence2315 <1 766 gene locus_tag LOCUS_52230 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083253.1:M23 family metallopeptidase >Feature sequence2316 <1724 521 gene locus_tag LOCUS_52240 <1724 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141952.1:type I polyketide synthase >Feature sequence2317 591 1094 gene locus_tag LOCUS_52250 591 1094 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142230.1 protein_id gnl|my_center|LOCUS_52250 >Feature sequence2318 146 406 gene locus_tag LOCUS_52260 146 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52260 >Feature sequence2319 <1721 758 gene locus_tag LOCUS_52270 <1721 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003690264.1:DNA (cytosine-5-)-methyltransferase >Feature sequence2320 792 1085 gene locus_tag LOCUS_52280 gene fdxB 792 1085 CDS product ferredoxin III, nif-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720698.1 protein_id gnl|my_center|LOCUS_52280 >Feature sequence2321 1300 692 gene locus_tag LOCUS_52290 gene cobO 1300 692 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056120.1 protein_id gnl|my_center|LOCUS_52290 >Feature sequence2322 1661 687 gene locus_tag LOCUS_52300 1661 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056583.1 protein_id gnl|my_center|LOCUS_52300 >Feature sequence2323 422 568 gene locus_tag LOCUS_52310 422 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52310 865 1032 gene locus_tag LOCUS_52320 865 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52320 1020 1358 gene locus_tag LOCUS_52330 1020 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52330 >Feature sequence2324 <1 1484 gene locus_tag LOCUS_52340 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence2325 >Feature sequence2326 500 1048 gene locus_tag LOCUS_52350 500 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52350 >Feature sequence2327 757 1014 gene locus_tag LOCUS_52360 757 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_52360 1064 1372 gene locus_tag LOCUS_52370 1064 1372 CDS product DUF3181 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920922.1 protein_id gnl|my_center|LOCUS_52370 >Feature sequence2328 <1716 607 gene locus_tag LOCUS_52380 <1716 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055871.1:folate/biopterin family MFS transporter >Feature sequence2329 838 1413 gene locus_tag LOCUS_52390 838 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52390 >Feature sequence2330 101 1174 gene locus_tag LOCUS_52400 101 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52400 <1716 1203 gene locus_tag LOCUS_52410 <1716 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928520.1:chromophore lyase CpcT/CpeT >Feature sequence2331 <1 739 gene locus_tag LOCUS_52420 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056608.1:glycogen synthase GlgA 1346 918 gene locus_tag LOCUS_52430 1346 918 CDS product DUF1824 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929141.1 protein_id gnl|my_center|LOCUS_52430 >Feature sequence2332 217 1077 gene locus_tag LOCUS_52440 217 1077 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_52440 >Feature sequence2333 659 240 gene locus_tag LOCUS_52450 659 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52450 924 667 gene locus_tag LOCUS_52460 924 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52460 >Feature sequence2334 1262 1014 gene locus_tag LOCUS_52470 1262 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52470 >Feature sequence2335 457 1710 gene locus_tag LOCUS_52480 457 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52480 >Feature sequence2336 1340 888 gene locus_tag LOCUS_52490 1340 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52490 >Feature sequence2337 <1710 194 gene locus_tag LOCUS_52500 <1710 194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057520.1:phosphoribosylformylglycinamidine synthase subunit PurL >Feature sequence2338 124 423 gene locus_tag LOCUS_52510 124 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52510 610 1578 gene locus_tag LOCUS_52520 610 1578 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920773.1 protein_id gnl|my_center|LOCUS_52520 >Feature sequence2339 648 1037 gene locus_tag LOCUS_52530 gene tnpA 648 1037 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057219.1 protein_id gnl|my_center|LOCUS_52530 1330 1686 gene locus_tag LOCUS_52540 1330 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52540 >Feature sequence2340 <1 1278 gene locus_tag LOCUS_52550 <1 1278 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056473.1:sugar transferase >Feature sequence2341 >Feature sequence2342 324 1331 gene locus_tag LOCUS_52560 324 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52560 >Feature sequence2343 399 205 gene locus_tag LOCUS_52570 399 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52570 723 424 gene locus_tag LOCUS_52580 723 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52580 1439 720 gene locus_tag LOCUS_52590 1439 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_52590 >Feature sequence2344 318 887 gene locus_tag LOCUS_52600 318 887 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125018.1 protein_id gnl|my_center|LOCUS_52600 >Feature sequence2345 1268 474 gene locus_tag LOCUS_52610 1268 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52610 >Feature sequence2346 1220 348 gene locus_tag LOCUS_52620 1220 348 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258724.1 protein_id gnl|my_center|LOCUS_52620 >Feature sequence2347 380 838 gene locus_tag LOCUS_52630 380 838 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_52630 >Feature sequence2348 1640 966 gene locus_tag LOCUS_52640 gene queC 1640 966 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057569.1 protein_id gnl|my_center|LOCUS_52640 >Feature sequence2349 459 97 gene locus_tag LOCUS_52650 459 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52650 976 1437 gene locus_tag LOCUS_52660 976 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52660 >Feature sequence2350 349 504 gene locus_tag LOCUS_52670 349 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52670 1099 1668 gene locus_tag LOCUS_52680 1099 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52680 >Feature sequence2351 212 1057 gene locus_tag LOCUS_52690 212 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52690 1157 1513 gene locus_tag LOCUS_52700 1157 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52700 >Feature sequence2352 712 1059 gene locus_tag LOCUS_52710 712 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52710 >Feature sequence2353 1420 836 gene locus_tag LOCUS_52720 1420 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52720 >Feature sequence2354 >Feature sequence2355 390 82 gene locus_tag LOCUS_52730 390 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52730 957 679 gene locus_tag LOCUS_52740 957 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52740 >Feature sequence2356 262 696 gene locus_tag LOCUS_52750 262 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52750 909 1424 gene locus_tag LOCUS_52760 909 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52760 >Feature sequence2357 773 372 gene locus_tag LOCUS_52770 gene arsC 773 372 CDS product arsenate reductase, glutathione/glutaredoxin type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140008.1 protein_id gnl|my_center|LOCUS_52770 1289 1609 gene locus_tag LOCUS_52780 1289 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52780 >Feature sequence2358 2 256 gene locus_tag LOCUS_52790 2 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52790 1097 285 gene locus_tag LOCUS_52800 1097 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52800 1619 1164 gene locus_tag LOCUS_52810 1619 1164 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_217651994.1 protein_id gnl|my_center|LOCUS_52810 >Feature sequence2359 <1 568 gene locus_tag LOCUS_52820 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937968.1:Fe-S cluster assembly protein NifU >Feature sequence2360 1039 1695 gene locus_tag LOCUS_52830 1039 1695 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055998.1 protein_id gnl|my_center|LOCUS_52830 >Feature sequence2361 <1 1423 gene locus_tag LOCUS_52840 <1 1423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963056.1:class I SAM-dependent methyltransferase >Feature sequence2362 <1 1257 gene locus_tag LOCUS_52850 <1 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141841.1:AAA family ATPase >Feature sequence2363 88 537 gene locus_tag LOCUS_52860 88 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_52860 1693 644 gene locus_tag LOCUS_52870 1693 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52870 >Feature sequence2364 <1692 131 gene locus_tag LOCUS_52880 <1692 131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009888694.1:sulfate/molybdate ABC transporter ATP-binding protein >Feature sequence2365 67 1605 gene locus_tag LOCUS_52890 67 1605 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058227.1 protein_id gnl|my_center|LOCUS_52890 >Feature sequence2366 567 100 gene locus_tag LOCUS_52900 567 100 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034522187.1 protein_id gnl|my_center|LOCUS_52900 863 564 gene locus_tag LOCUS_52910 863 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52910 >Feature sequence2367 799 1524 gene locus_tag LOCUS_52920 gene pyrH 799 1524 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_52920 1537 1692 gene locus_tag LOCUS_52930 1537 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52930 >Feature sequence2368 1370 756 gene locus_tag LOCUS_52940 1370 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52940 >Feature sequence2369 >Feature sequence2370 <1689 253 gene locus_tag LOCUS_52950 <1689 253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005109923.1:DNA sulfur modification protein DndD >Feature sequence2371 1556 1149 gene locus_tag LOCUS_52960 1556 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52960 >Feature sequence2372 355 26 gene locus_tag LOCUS_52970 355 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_52970 694 1509 gene locus_tag LOCUS_52980 694 1509 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929052.1 protein_id gnl|my_center|LOCUS_52980 >Feature sequence2373 362 126 gene locus_tag LOCUS_52990 362 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_52990 974 489 gene locus_tag LOCUS_53000 974 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53000 <1687 1031 gene locus_tag LOCUS_53010 <1687 1031 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002164514.1:CmcI family methyltransferase >Feature sequence2374 1495 803 gene locus_tag LOCUS_53020 gene surE 1495 803 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122691.1 protein_id gnl|my_center|LOCUS_53020 1675 1517 gene locus_tag LOCUS_53030 1675 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53030 >Feature sequence2375 793 1644 gene locus_tag LOCUS_53040 gene rsmH 793 1644 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_53040 >Feature sequence2376 <1686 955 gene locus_tag LOCUS_53050 <1686 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence2377 <1 571 gene locus_tag LOCUS_53060 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963914.1:RNA methyltransferase 1538 1101 gene locus_tag LOCUS_53070 1538 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53070 >Feature sequence2378 <1 1554 gene locus_tag LOCUS_53080 <1 1554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058264.1:serine/threonine-protein kinase >Feature sequence2379 179 715 gene locus_tag LOCUS_53090 179 715 CDS product P-loop NTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143500.1 protein_id gnl|my_center|LOCUS_53090 >Feature sequence2380 <1 713 gene locus_tag LOCUS_53100 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088430287.1:cation:proton antiporter >Feature sequence2381 944 93 gene locus_tag LOCUS_53110 944 93 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_53110 >Feature sequence2382 202 900 gene locus_tag LOCUS_53120 202 900 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_53120 >Feature sequence2383 1147 293 gene locus_tag LOCUS_53130 1147 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929385.1 protein_id gnl|my_center|LOCUS_53130 >Feature sequence2384 414 70 gene locus_tag LOCUS_53140 414 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53140 631 407 gene locus_tag LOCUS_53150 631 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53150 >Feature sequence2385 854 1297 gene locus_tag LOCUS_53160 854 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53160 >Feature sequence2386 174 1535 gene locus_tag LOCUS_53170 174 1535 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056562.1 protein_id gnl|my_center|LOCUS_53170 >Feature sequence2387 592 371 gene locus_tag LOCUS_53180 592 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53180 >Feature sequence2388 359 913 gene locus_tag LOCUS_53190 359 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53190 985 1416 gene locus_tag LOCUS_53200 985 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53200 >Feature sequence2389 >Feature sequence2390 516 1013 gene locus_tag LOCUS_53210 gene accB 516 1013 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921156.1 protein_id gnl|my_center|LOCUS_53210 1028 1393 gene locus_tag LOCUS_53220 1028 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53220 >Feature sequence2391 >Feature sequence2392 <1 905 gene locus_tag LOCUS_53230 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012220240.1:DUF4351 domain-containing protein 1016 1144 gene locus_tag LOCUS_53240 1016 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53240 1141 1326 gene locus_tag LOCUS_53250 1141 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53250 1548 1246 gene locus_tag LOCUS_53260 1548 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53260 >Feature sequence2393 <1 1039 gene locus_tag LOCUS_53270 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172598138.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence2394 451 191 gene locus_tag LOCUS_53280 451 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53280 <1676 698 gene locus_tag LOCUS_53290 <1676 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence2395 143 277 gene locus_tag LOCUS_53300 143 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53300 >Feature sequence2396 <1 694 gene locus_tag LOCUS_53310 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920718.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence2397 1529 78 gene locus_tag LOCUS_53320 1529 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53320 >Feature sequence2398 190 1455 gene locus_tag LOCUS_53330 190 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53330 >Feature sequence2399 831 1640 gene locus_tag LOCUS_53340 gene grpE 831 1640 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057154.1 protein_id gnl|my_center|LOCUS_53340 >Feature sequence2400 <1 810 gene locus_tag LOCUS_53350 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057521.1:amidophosphoribosyltransferase >Feature sequence2401 1319 105 gene locus_tag LOCUS_53360 1319 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53360 >Feature sequence2402 246 1469 gene locus_tag LOCUS_53370 246 1469 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640321.1 protein_id gnl|my_center|LOCUS_53370 >Feature sequence2403 1475 42 gene locus_tag LOCUS_53380 gene hpnJ 1475 42 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196953.1 protein_id gnl|my_center|LOCUS_53380 >Feature sequence2404 1243 743 gene locus_tag LOCUS_53390 1243 743 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_53390 >Feature sequence2405 1406 150 gene locus_tag LOCUS_53400 1406 150 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055884.1 protein_id gnl|my_center|LOCUS_53400 >Feature sequence2406 321 608 gene locus_tag LOCUS_53410 321 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53410 664 885 gene locus_tag LOCUS_53420 664 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53420 885 1109 gene locus_tag LOCUS_53430 885 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53430 1356 1174 gene locus_tag LOCUS_53440 1356 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53440 >Feature sequence2407 <1668 353 gene locus_tag LOCUS_53450 <1668 353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056416.1:hybrid sensor histidine kinase/response regulator >Feature sequence2408 613 383 gene locus_tag LOCUS_53460 613 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53460 1235 783 gene locus_tag LOCUS_53470 1235 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53470 >Feature sequence2409 1664 249 gene locus_tag LOCUS_53480 1664 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53480 >Feature sequence2410 560 766 gene locus_tag LOCUS_53490 560 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53490 <1665 874 gene locus_tag LOCUS_53500 <1665 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056221.1:argininosuccinate lyase >Feature sequence2411 1007 516 gene locus_tag LOCUS_53510 gene moaC 1007 516 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971801.1 protein_id gnl|my_center|LOCUS_53510 1071 1144 gene locus_tag LOCUS_t00540 1071 1144 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2412 619 1536 gene locus_tag LOCUS_53520 619 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53520 >Feature sequence2413 119 334 gene locus_tag LOCUS_53530 119 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53530 352 612 gene locus_tag LOCUS_53540 352 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53540 582 917 gene locus_tag LOCUS_53550 582 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53550 >Feature sequence2414 830 708 gene locus_tag LOCUS_53560 830 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53560 >Feature sequence2415 252 971 gene locus_tag LOCUS_53570 252 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53570 1011 1502 gene locus_tag LOCUS_53580 1011 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_53580 >Feature sequence2416 1267 71 gene locus_tag LOCUS_53590 1267 71 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124972844.1 protein_id gnl|my_center|LOCUS_53590 >Feature sequence2417 1003 515 gene locus_tag LOCUS_53600 1003 515 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012301.1 protein_id gnl|my_center|LOCUS_53600 >Feature sequence2418 234 866 gene locus_tag LOCUS_53610 234 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53610 <1663 1119 gene locus_tag LOCUS_53620 <1663 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799101.1:ABC transporter ATP-binding protein >Feature sequence2419 400 825 gene locus_tag LOCUS_53630 400 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53630 835 1200 gene locus_tag LOCUS_53640 835 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53640 1249 1401 gene locus_tag LOCUS_53650 1249 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53650 >Feature sequence2420 182 781 gene locus_tag LOCUS_53660 182 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53660 <1662 741 gene locus_tag LOCUS_53670 <1662 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000599571.1:DUF4435 domain-containing protein >Feature sequence2421 <1 824 gene locus_tag LOCUS_53680 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142799.1:NAD-dependent succinate-semialdehyde dehydrogenase >Feature sequence2422 244 1302 gene locus_tag LOCUS_53690 244 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53690 >Feature sequence2423 226 843 gene locus_tag LOCUS_53700 226 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53700 <1661 900 gene locus_tag LOCUS_53710 <1661 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence2424 1408 179 gene locus_tag LOCUS_53720 1408 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53720 >Feature sequence2425 397 56 gene locus_tag LOCUS_53730 397 56 CDS product nitrogenase-stabilizing/protective protein NifW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389923.1 protein_id gnl|my_center|LOCUS_53730 630 394 gene locus_tag LOCUS_53740 630 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53740 1154 672 gene locus_tag LOCUS_53750 1154 672 CDS product NifX-associated nitrogen fixation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389938.1 protein_id gnl|my_center|LOCUS_53750 >Feature sequence2426 659 429 gene locus_tag LOCUS_53760 659 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53760 >Feature sequence2427 444 1274 gene locus_tag LOCUS_53770 444 1274 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_53770 >Feature sequence2428 1505 1032 gene locus_tag LOCUS_53780 1505 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53780 >Feature sequence2429 555 388 gene locus_tag LOCUS_53790 555 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53790 1382 834 gene locus_tag LOCUS_53800 1382 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53800 >Feature sequence2430 557 315 gene locus_tag LOCUS_53810 557 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53810 1365 718 gene locus_tag LOCUS_53820 1365 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140615.1 protein_id gnl|my_center|LOCUS_53820 >Feature sequence2431 1341 256 gene locus_tag LOCUS_53830 gene aroC 1341 256 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056316.1 protein_id gnl|my_center|LOCUS_53830 >Feature sequence2432 921 565 gene locus_tag LOCUS_53840 921 565 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000617906.1 protein_id gnl|my_center|LOCUS_53840 1172 915 gene locus_tag LOCUS_53850 1172 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53850 >Feature sequence2433 740 1513 gene locus_tag LOCUS_53860 740 1513 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_53860 >Feature sequence2434 644 336 gene locus_tag LOCUS_53870 644 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53870 918 715 gene locus_tag LOCUS_53880 gene psbH 918 715 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_53880 >Feature sequence2435 628 119 gene locus_tag LOCUS_53890 628 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081148.1 protein_id gnl|my_center|LOCUS_53890 977 600 gene locus_tag LOCUS_53900 977 600 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081150.1 protein_id gnl|my_center|LOCUS_53900 >Feature sequence2436 <1 687 gene locus_tag LOCUS_53910 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124749.1:phosphate ABC transporter ATP-binding protein PstB 825 896 gene locus_tag LOCUS_t00550 825 896 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2437 715 347 gene locus_tag LOCUS_53920 715 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_53920 1098 775 gene locus_tag LOCUS_53930 1098 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53930 1519 1292 gene locus_tag LOCUS_53940 1519 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53940 >Feature sequence2438 <1 1110 gene locus_tag LOCUS_53950 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016983.1:ATP/GTP-binding protein >Feature sequence2439 1045 506 gene locus_tag LOCUS_53960 1045 506 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928695.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_53960 1149 1018 gene locus_tag LOCUS_53970 1149 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_53970 >Feature sequence2440 1407 580 gene locus_tag LOCUS_53980 1407 580 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056252.1 protein_id gnl|my_center|LOCUS_53980 >Feature sequence2441 602 363 gene locus_tag LOCUS_53990 gene acpP 602 363 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_53990 1203 943 gene locus_tag LOCUS_54000 1203 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54000 >Feature sequence2442 220 459 gene locus_tag LOCUS_54010 220 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54010 475 978 gene locus_tag LOCUS_54020 475 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54020 >Feature sequence2443 1073 237 gene locus_tag LOCUS_54030 1073 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_54030 1442 1077 gene locus_tag LOCUS_54040 1442 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_54040 1587 1369 gene locus_tag LOCUS_54050 1587 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54050 >Feature sequence2444 1646 93 gene locus_tag LOCUS_54060 1646 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54060 >Feature sequence2445 680 36 gene locus_tag LOCUS_54070 680 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54070 1094 789 gene locus_tag LOCUS_54080 1094 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54080 >Feature sequence2446 1100 1633 gene locus_tag LOCUS_54090 1100 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54090 >Feature sequence2447 <1 702 gene locus_tag LOCUS_54100 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057019.1:nicotinate phosphoribosyltransferase >Feature sequence2448 571 368 gene locus_tag LOCUS_54110 gene psbH 571 368 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_54110 651 791 gene locus_tag LOCUS_54120 gene psbN 651 791 CDS product photosystem II reaction center protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057227.1 protein_id gnl|my_center|LOCUS_54120 >Feature sequence2449 <1 1226 gene locus_tag LOCUS_54130 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056564.1:glucose-6-phosphate isomerase >Feature sequence2450 903 1136 gene locus_tag LOCUS_54140 903 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54140 >Feature sequence2451 112 1137 gene locus_tag LOCUS_54150 112 1137 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057039.1 protein_id gnl|my_center|LOCUS_54150 >Feature sequence2452 327 1397 gene locus_tag LOCUS_54160 gene ugpC 327 1397 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_54160 >Feature sequence2453 1085 156 gene locus_tag LOCUS_54170 gene menA 1085 156 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073592656.1 protein_id gnl|my_center|LOCUS_54170 >Feature sequence2454 744 1481 gene locus_tag LOCUS_54180 744 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54180 >Feature sequence2455 1138 851 gene locus_tag LOCUS_54190 1138 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54190 1402 1139 gene locus_tag LOCUS_54200 1402 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54200 >Feature sequence2456 >Feature sequence2457 1309 272 gene locus_tag LOCUS_54210 1309 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056254.1 protein_id gnl|my_center|LOCUS_54210 >Feature sequence2458 421 1209 gene locus_tag LOCUS_54220 421 1209 CDS product 4-hydroxybenzoate solanesyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143417.1 protein_id gnl|my_center|LOCUS_54220 >Feature sequence2459 316 801 gene locus_tag LOCUS_54230 316 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54230 >Feature sequence2460 1212 703 gene locus_tag LOCUS_54240 1212 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54240 >Feature sequence2461 1440 97 gene locus_tag LOCUS_54250 1440 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54250 >Feature sequence2462 <1639 231 gene locus_tag LOCUS_54260 <1639 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056613.1:CTP synthase >Feature sequence2463 <1 911 gene locus_tag LOCUS_54270 <1 911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057733.1:polysaccharide pyruvyl transferase CsaB 942 1637 gene locus_tag LOCUS_54280 942 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54280 >Feature sequence2464 <1 1123 gene locus_tag LOCUS_54290 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056767.1:protein phosphatase 2C domain-containing protein 1224 1454 gene locus_tag LOCUS_54300 1224 1454 CDS product ferredoxin-thioredoxin reductase variable chain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057357.1 protein_id gnl|my_center|LOCUS_54300 >Feature sequence2465 <1 999 gene locus_tag LOCUS_54310 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924872.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence2466 66 368 gene locus_tag LOCUS_54320 66 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54320 447 1394 gene locus_tag LOCUS_54330 447 1394 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920721.1 protein_id gnl|my_center|LOCUS_54330 >Feature sequence2467 893 1417 gene locus_tag LOCUS_54340 893 1417 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920918.1 protein_id gnl|my_center|LOCUS_54340 >Feature sequence2468 <1636 1006 gene locus_tag LOCUS_54350 <1636 1006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921031.1:ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein >Feature sequence2469 933 448 gene locus_tag LOCUS_54360 933 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54360 <1636 1061 gene locus_tag LOCUS_54370 <1636 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144086.1:phage tail sheath subtilisin-like domain-containing protein >Feature sequence2470 1435 53 gene locus_tag LOCUS_54380 1435 53 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54380 >Feature sequence2471 784 644 gene locus_tag LOCUS_54390 784 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54390 985 1137 gene locus_tag LOCUS_54400 985 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54400 >Feature sequence2472 208 1326 gene locus_tag LOCUS_54410 gene nuoH 208 1326 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126985484.1 protein_id gnl|my_center|LOCUS_54410 >Feature sequence2473 736 1320 gene locus_tag LOCUS_54420 736 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54420 >Feature sequence2474 545 1030 gene locus_tag LOCUS_54430 545 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54430 <1631 1122 gene locus_tag LOCUS_54440 <1631 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946382.1:type I secretion C-terminal target domain-containing protein >Feature sequence2475 <1 1098 gene locus_tag LOCUS_54450 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057595.1:LCP family protein >Feature sequence2476 >Feature sequence2477 52 588 gene locus_tag LOCUS_54460 52 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54460 1306 656 gene locus_tag LOCUS_54470 1306 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_54470 1534 1397 gene locus_tag LOCUS_54480 1534 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54480 >Feature sequence2478 273 1535 gene locus_tag LOCUS_54490 273 1535 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_54490 >Feature sequence2479 344 790 gene locus_tag LOCUS_54500 344 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54500 <1627 840 gene locus_tag LOCUS_54510 <1627 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010974187.1:glycosyltransferase >Feature sequence2480 1206 1529 gene locus_tag LOCUS_54520 1206 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54520 >Feature sequence2481 415 116 gene locus_tag LOCUS_54530 415 116 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142092.1 protein_id gnl|my_center|LOCUS_54530 761 432 gene locus_tag LOCUS_54540 761 432 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056790.1 protein_id gnl|my_center|LOCUS_54540 1548 1237 gene locus_tag LOCUS_54550 1548 1237 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_54550 >Feature sequence2482 502 113 gene locus_tag LOCUS_54560 502 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54560 709 1230 gene locus_tag LOCUS_54570 709 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54570 >Feature sequence2483 <1624 126 gene locus_tag LOCUS_54580 <1624 126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056162.1:transglutaminase domain-containing protein >Feature sequence2484 <1623 507 gene locus_tag LOCUS_54590 <1623 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010907546.1:cephalosporin hydroxylase family protein >Feature sequence2485 191 415 gene locus_tag LOCUS_54600 191 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54600 >Feature sequence2486 286 65 gene locus_tag LOCUS_54610 286 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54610 1435 311 gene locus_tag LOCUS_54620 1435 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54620 >Feature sequence2487 1466 114 gene locus_tag LOCUS_54630 1466 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54630 >Feature sequence2488 <1622 207 gene locus_tag LOCUS_54640 <1622 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057930.1:DUF87 domain-containing protein >Feature sequence2489 <1 989 gene locus_tag LOCUS_54650 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084553.1:nitrogenase molybdenum-iron protein subunit beta 1083 1418 gene locus_tag LOCUS_54660 1083 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54660 >Feature sequence2490 277 780 gene locus_tag LOCUS_54670 277 780 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_54670 >Feature sequence2491 <1621 376 gene locus_tag LOCUS_54680 <1621 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141077.1:bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase >Feature sequence2492 1181 93 gene locus_tag LOCUS_54690 1181 93 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967354.1 protein_id gnl|my_center|LOCUS_54690 >Feature sequence2493 >Feature sequence2494 895 668 gene locus_tag LOCUS_54700 895 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54700 >Feature sequence2495 107 265 gene locus_tag LOCUS_54710 107 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54710 794 1357 gene locus_tag LOCUS_54720 794 1357 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194622.1 protein_id gnl|my_center|LOCUS_54720 >Feature sequence2496 648 337 gene locus_tag LOCUS_54730 648 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54730 1235 1357 gene locus_tag LOCUS_54740 1235 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54740 >Feature sequence2497 1078 161 gene locus_tag LOCUS_54750 1078 161 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056702.1 protein_id gnl|my_center|LOCUS_54750 <1619 1112 gene locus_tag LOCUS_54760 <1619 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056703.1:NAD(P)H-binding protein >Feature sequence2498 930 640 gene locus_tag LOCUS_54770 930 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54770 >Feature sequence2499 <1 635 gene locus_tag LOCUS_54780 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142916.1:SAM-dependent chlorinase/fluorinase >Feature sequence2500 1269 412 gene locus_tag LOCUS_54790 1269 412 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384270.1 protein_id gnl|my_center|LOCUS_54790 >Feature sequence2501 357 40 gene locus_tag LOCUS_54800 357 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54800 >Feature sequence2502 3 164 gene locus_tag LOCUS_54810 3 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54810 168 866 gene locus_tag LOCUS_54820 168 866 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000873009.1 protein_id gnl|my_center|LOCUS_54820 1021 1341 gene locus_tag LOCUS_54830 1021 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54830 >Feature sequence2503 430 1353 gene locus_tag LOCUS_54840 gene murQ 430 1353 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_54840 >Feature sequence2504 636 1397 gene locus_tag LOCUS_54850 636 1397 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920671.1 protein_id gnl|my_center|LOCUS_54850 >Feature sequence2505 312 584 gene locus_tag LOCUS_54860 312 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54860 722 1480 gene locus_tag LOCUS_54870 722 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54870 >Feature sequence2506 <1615 732 gene locus_tag LOCUS_54880 <1615 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037121.1:ATP-binding protein >Feature sequence2507 346 197 gene locus_tag LOCUS_54890 346 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54890 730 494 gene locus_tag LOCUS_54900 730 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54900 897 1025 gene locus_tag LOCUS_54910 897 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54910 >Feature sequence2508 889 257 gene locus_tag LOCUS_54920 889 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54920 >Feature sequence2509 <1 673 gene locus_tag LOCUS_54930 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144254.1:sulfite oxidase-like oxidoreductase 710 1378 gene locus_tag LOCUS_54940 710 1378 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_54940 >Feature sequence2510 1043 99 gene locus_tag LOCUS_54950 gene lipA 1043 99 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056422.1 protein_id gnl|my_center|LOCUS_54950 >Feature sequence2511 >Feature sequence2512 149 769 gene locus_tag LOCUS_54960 149 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54960 >Feature sequence2513 1598 414 gene locus_tag LOCUS_54970 1598 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54970 >Feature sequence2514 735 1157 gene locus_tag LOCUS_54980 735 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54980 >Feature sequence2515 709 906 gene locus_tag LOCUS_54990 709 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_54990 1322 1110 gene locus_tag LOCUS_55000 1322 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55000 >Feature sequence2516 831 1307 gene locus_tag LOCUS_55010 gene ndhN 831 1307 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056972.1 protein_id gnl|my_center|LOCUS_55010 >Feature sequence2517 13 516 gene locus_tag LOCUS_55020 13 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55020 572 1537 gene locus_tag LOCUS_55030 572 1537 CDS product threo-3-hydroxy-L-aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143857.1 protein_id gnl|my_center|LOCUS_55030 >Feature sequence2518 <1611 1091 gene locus_tag LOCUS_55040 <1611 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921556.1:biotin/lipoyl-binding protein >Feature sequence2519 <1 609 gene locus_tag LOCUS_55050 <1 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142234.1:NAD(P)H-hydrate dehydratase 1536 1081 gene locus_tag LOCUS_55060 1536 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55060 >Feature sequence2520 <1 739 gene locus_tag LOCUS_55070 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056269.1:carotenoid biosynthesis protein >Feature sequence2521 292 1155 gene locus_tag LOCUS_55080 292 1155 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257664.1 protein_id gnl|my_center|LOCUS_55080 >Feature sequence2522 953 501 gene locus_tag LOCUS_55090 953 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55090 >Feature sequence2523 <1 754 gene locus_tag LOCUS_55100 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257763.1:carboxypeptidase M32 >Feature sequence2524 247 483 gene locus_tag LOCUS_55110 247 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55110 1089 568 gene locus_tag LOCUS_55120 1089 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55120 >Feature sequence2525 366 1358 gene locus_tag LOCUS_55130 366 1358 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057358.1 protein_id gnl|my_center|LOCUS_55130 >Feature sequence2526 1016 690 gene locus_tag LOCUS_55140 1016 690 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_55140 >Feature sequence2527 1049 261 gene locus_tag LOCUS_55150 gene ubiE 1049 261 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140131.1 protein_id gnl|my_center|LOCUS_55150 >Feature sequence2528 880 149 gene locus_tag LOCUS_55160 gene ndhK 880 149 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056552.1 protein_id gnl|my_center|LOCUS_55160 1233 871 gene locus_tag LOCUS_55170 gene ndhC 1233 871 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_55170 >Feature sequence2529 <1 1167 gene locus_tag LOCUS_55180 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence2530 209 616 gene locus_tag LOCUS_55190 209 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55190 >Feature sequence2531 <1 955 gene locus_tag LOCUS_55200 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056504.1:heavy metal translocating P-type ATPase <1604 1011 gene locus_tag LOCUS_55210 <1604 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056452.1:RNA-guided endonuclease TnpB family protein >Feature sequence2532 184 828 gene locus_tag LOCUS_55220 184 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55220 >Feature sequence2533 448 1011 gene locus_tag LOCUS_55230 448 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55230 1037 1570 gene locus_tag LOCUS_55240 1037 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55240 >Feature sequence2534 220 687 gene locus_tag LOCUS_55250 220 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55250 >Feature sequence2535 449 66 gene locus_tag LOCUS_55260 449 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55260 727 1110 gene locus_tag LOCUS_55270 727 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55270 1114 1473 gene locus_tag LOCUS_55280 1114 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_55280 >Feature sequence2536 73 939 gene locus_tag LOCUS_55290 73 939 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_55290 >Feature sequence2537 57 272 gene locus_tag LOCUS_55300 57 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55300 1052 1291 gene locus_tag LOCUS_55310 1052 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55310 >Feature sequence2538 351 1391 gene locus_tag LOCUS_55320 351 1391 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056427.1 protein_id gnl|my_center|LOCUS_55320 >Feature sequence2539 872 153 gene locus_tag LOCUS_55330 872 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55330 >Feature sequence2540 <1599 898 gene locus_tag LOCUS_55340 <1599 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141277.1:FG-GAP-like repeat-containing protein >Feature sequence2541 379 1113 gene locus_tag LOCUS_55350 379 1113 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141260.1 protein_id gnl|my_center|LOCUS_55350 >Feature sequence2542 844 410 gene locus_tag LOCUS_55360 844 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55360 1383 928 gene locus_tag LOCUS_55370 1383 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55370 >Feature sequence2543 <1598 969 gene locus_tag LOCUS_55380 <1598 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058177.1:AMIN domain-containing protein note possible pseudo, frameshifted >Feature sequence2544 <1597 970 gene locus_tag LOCUS_55390 <1597 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058250.1:glutamine-hydrolyzing GMP synthase >Feature sequence2545 <1597 591 gene locus_tag LOCUS_55400 <1597 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940714.1:CapA family protein >Feature sequence2546 1263 1574 gene locus_tag LOCUS_55410 1263 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55410 >Feature sequence2547 <1 640 gene locus_tag LOCUS_55420 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056835.1:tRNA dihydrouridine synthase DusB 666 1586 gene locus_tag LOCUS_55430 gene argF 666 1586 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920816.1 protein_id gnl|my_center|LOCUS_55430 >Feature sequence2548 152 1267 gene locus_tag LOCUS_55440 152 1267 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921229.1 protein_id gnl|my_center|LOCUS_55440 >Feature sequence2549 1080 1421 gene locus_tag LOCUS_55450 1080 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55450 >Feature sequence2550 271 23 gene locus_tag LOCUS_55460 271 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55460 1058 282 gene locus_tag LOCUS_55470 1058 282 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057029.1 protein_id gnl|my_center|LOCUS_55470 1349 1074 gene locus_tag LOCUS_55480 gene rpsT 1349 1074 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057030.1 protein_id gnl|my_center|LOCUS_55480 >Feature sequence2551 527 321 gene locus_tag LOCUS_55490 527 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55490 >Feature sequence2552 1428 487 gene locus_tag LOCUS_55500 1428 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55500 >Feature sequence2553 886 212 gene locus_tag LOCUS_55510 886 212 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_55510 >Feature sequence2554 <1 1160 gene locus_tag LOCUS_55520 <1 1160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929297.1:transketolase C-terminal domain-containing protein >Feature sequence2555 288 1103 gene locus_tag LOCUS_55530 288 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55530 1160 1312 gene locus_tag LOCUS_55540 1160 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55540 >Feature sequence2556 290 18 gene locus_tag LOCUS_55550 290 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55550 592 353 gene locus_tag LOCUS_55560 592 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55560 909 598 gene locus_tag LOCUS_55570 909 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55570 >Feature sequence2557 2 712 gene locus_tag LOCUS_55580 2 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55580 >Feature sequence2558 97 345 gene locus_tag LOCUS_55590 97 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55590 428 1492 gene locus_tag LOCUS_55600 428 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55600 >Feature sequence2559 >Feature sequence2560 <1586 400 gene locus_tag LOCUS_55610 <1586 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966223.1:sensor histidine kinase >Feature sequence2561 1399 5 gene locus_tag LOCUS_55620 gene secD 1399 5 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056058.1 protein_id gnl|my_center|LOCUS_55620 >Feature sequence2562 297 881 gene locus_tag LOCUS_55630 297 881 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008274486.1 protein_id gnl|my_center|LOCUS_55630 >Feature sequence2563 309 908 gene locus_tag LOCUS_55640 309 908 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208071.1 protein_id gnl|my_center|LOCUS_55640 >Feature sequence2564 606 1226 gene locus_tag LOCUS_55650 606 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55650 1451 1523 gene locus_tag LOCUS_t00560 1451 1523 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2565 >Feature sequence2566 <1 1002 gene locus_tag LOCUS_55660 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211175379.1:DUF58 domain-containing protein 1106 1522 gene locus_tag LOCUS_55670 1106 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55670 >Feature sequence2567 841 485 gene locus_tag LOCUS_55680 841 485 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142094.1 protein_id gnl|my_center|LOCUS_55680 >Feature sequence2568 <1 704 gene locus_tag LOCUS_55690 <1 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050761141.1:HAMP domain-containing sensor histidine kinase >Feature sequence2569 >Feature sequence2570 638 1228 gene locus_tag LOCUS_55700 638 1228 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141560.1 protein_id gnl|my_center|LOCUS_55700 >Feature sequence2571 768 514 gene locus_tag LOCUS_55710 768 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55710 <1581 818 gene locus_tag LOCUS_55720 <1581 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228698.1:long-chain fatty acid--CoA ligase >Feature sequence2572 339 770 gene locus_tag LOCUS_55730 339 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55730 >Feature sequence2573 >Feature sequence2574 921 703 gene locus_tag LOCUS_55740 921 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55740 >Feature sequence2575 995 129 gene locus_tag LOCUS_55750 995 129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902154.1 protein_id gnl|my_center|LOCUS_55750 <1578 1026 gene locus_tag LOCUS_55760 <1578 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057590.1:excinuclease ABC subunit UvrC >Feature sequence2576 <1 1317 gene locus_tag LOCUS_55770 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480405.1:Tn3 family transposase >Feature sequence2577 <1 653 gene locus_tag LOCUS_55780 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681594.1:glucosaminidase domain-containing protein >Feature sequence2578 289 1314 gene locus_tag LOCUS_55790 gene thiL 289 1314 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921033.1 protein_id gnl|my_center|LOCUS_55790 >Feature sequence2579 618 187 gene locus_tag LOCUS_55800 618 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55800 >Feature sequence2580 >Feature sequence2581 >Feature sequence2582 96 1442 gene locus_tag LOCUS_55810 96 1442 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920863.1 protein_id gnl|my_center|LOCUS_55810 >Feature sequence2583 <1575 386 gene locus_tag LOCUS_55820 <1575 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963056.1:class I SAM-dependent methyltransferase >Feature sequence2584 <1 863 gene locus_tag LOCUS_55830 <1 863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056226.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence2585 1487 900 gene locus_tag LOCUS_55840 1487 900 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142128.1 protein_id gnl|my_center|LOCUS_55840 >Feature sequence2586 252 956 gene locus_tag LOCUS_55850 252 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259390.1 protein_id gnl|my_center|LOCUS_55850 971 1393 gene locus_tag LOCUS_55860 971 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55860 >Feature sequence2587 175 603 gene locus_tag LOCUS_55870 175 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55870 >Feature sequence2588 125 256 gene locus_tag LOCUS_55880 125 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55880 556 816 gene locus_tag LOCUS_55890 556 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55890 <1574 955 gene locus_tag LOCUS_55900 <1574 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_085984844.1:tetratricopeptide repeat protein >Feature sequence2589 >Feature sequence2590 1462 311 gene locus_tag LOCUS_55910 1462 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55910 >Feature sequence2591 >Feature sequence2592 1326 115 gene locus_tag LOCUS_55920 1326 115 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141002.1 protein_id gnl|my_center|LOCUS_55920 >Feature sequence2593 819 343 gene locus_tag LOCUS_55930 819 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55930 1379 1065 gene locus_tag LOCUS_55940 1379 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55940 >Feature sequence2594 1410 922 gene locus_tag LOCUS_55950 1410 922 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137906819.1 protein_id gnl|my_center|LOCUS_55950 >Feature sequence2595 >Feature sequence2596 1030 572 gene locus_tag LOCUS_55960 1030 572 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056191.1 protein_id gnl|my_center|LOCUS_55960 >Feature sequence2597 105 1040 gene locus_tag LOCUS_55970 105 1040 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022329.1 protein_id gnl|my_center|LOCUS_55970 >Feature sequence2598 167 415 gene locus_tag LOCUS_55980 167 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55980 >Feature sequence2599 574 1560 gene locus_tag LOCUS_55990 574 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_55990 >Feature sequence2600 583 1449 gene locus_tag LOCUS_56000 583 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56000 >Feature sequence2601 2 223 gene locus_tag LOCUS_56010 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56010 301 1197 gene locus_tag LOCUS_56020 gene prmA 301 1197 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056181.1 protein_id gnl|my_center|LOCUS_56020 >Feature sequence2602 1370 207 gene locus_tag LOCUS_56030 1370 207 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928444.1 protein_id gnl|my_center|LOCUS_56030 >Feature sequence2603 <1566 120 gene locus_tag LOCUS_56040 <1566 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence2604 786 442 gene locus_tag LOCUS_56050 786 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56050 1348 851 gene locus_tag LOCUS_56060 1348 851 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193331.1 protein_id gnl|my_center|LOCUS_56060 >Feature sequence2605 677 45 gene locus_tag LOCUS_56070 gene nusB 677 45 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_56070 <1565 900 gene locus_tag LOCUS_56080 <1565 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124163.1:DUF502 domain-containing protein >Feature sequence2606 394 741 gene locus_tag LOCUS_56090 394 741 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920785.1 protein_id gnl|my_center|LOCUS_56090 897 1352 gene locus_tag LOCUS_56100 897 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56100 >Feature sequence2607 378 163 gene locus_tag LOCUS_56110 378 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56110 1390 530 gene locus_tag LOCUS_56120 1390 530 CDS product DUF3598 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057503.1 protein_id gnl|my_center|LOCUS_56120 >Feature sequence2608 <1 1249 gene locus_tag LOCUS_56130 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence2609 490 1041 gene locus_tag LOCUS_56140 490 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56140 >Feature sequence2610 <1 762 gene locus_tag LOCUS_56150 <1 762 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057244.1:geranylgeranyl reductase family protein >Feature sequence2611 <1 1459 gene locus_tag LOCUS_56160 <1 1459 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144130.1:Tex family protein >Feature sequence2612 <1 1141 gene locus_tag LOCUS_56170 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921137.1:methionine synthase >Feature sequence2613 942 1094 gene locus_tag LOCUS_56180 942 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56180 >Feature sequence2614 813 577 gene locus_tag LOCUS_56190 813 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56190 >Feature sequence2615 <1561 952 gene locus_tag LOCUS_56200 <1561 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014878023.1:phosphonatase-like hydrolase >Feature sequence2616 47 1171 gene locus_tag LOCUS_56210 47 1171 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929131.1 protein_id gnl|my_center|LOCUS_56210 1250 1369 gene locus_tag LOCUS_56220 1250 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56220 >Feature sequence2617 550 251 gene locus_tag LOCUS_56230 550 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56230 837 550 gene locus_tag LOCUS_56240 837 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56240 >Feature sequence2618 586 1086 gene locus_tag LOCUS_56250 586 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56250 >Feature sequence2619 289 492 gene locus_tag LOCUS_56260 289 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56260 700 1011 gene locus_tag LOCUS_56270 700 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56270 >Feature sequence2620 458 1078 gene locus_tag LOCUS_56280 458 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56280 >Feature sequence2621 501 64 gene locus_tag LOCUS_56290 gene ureE 501 64 CDS product urease accessory protein UreE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057206.1 protein_id gnl|my_center|LOCUS_56290 1035 514 gene locus_tag LOCUS_56300 1035 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56300 >Feature sequence2622 1120 218 gene locus_tag LOCUS_56310 gene trpC 1120 218 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056545.1 protein_id gnl|my_center|LOCUS_56310 >Feature sequence2623 125 439 gene locus_tag LOCUS_56320 125 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56320 447 1418 gene locus_tag LOCUS_56330 447 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_56330 1429 1551 gene locus_tag LOCUS_56340 1429 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56340 >Feature sequence2624 <1555 937 gene locus_tag LOCUS_56350 <1555 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928494.1:AraC family transcriptional regulator >Feature sequence2625 1461 43 gene locus_tag LOCUS_56360 1461 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56360 >Feature sequence2626 743 916 gene locus_tag LOCUS_56370 743 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56370 >Feature sequence2627 777 1304 gene locus_tag LOCUS_56380 777 1304 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_56380 >Feature sequence2628 1305 559 gene locus_tag LOCUS_56390 1305 559 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525108.1 protein_id gnl|my_center|LOCUS_56390 >Feature sequence2629 1185 301 gene locus_tag LOCUS_56400 1185 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56400 >Feature sequence2630 1128 562 gene locus_tag LOCUS_56410 1128 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56410 >Feature sequence2631 >Feature sequence2632 1323 538 gene locus_tag LOCUS_56420 1323 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_56420 >Feature sequence2633 311 580 gene locus_tag LOCUS_56430 311 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056692.1 protein_id gnl|my_center|LOCUS_56430 1091 603 gene locus_tag LOCUS_56440 1091 603 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044012301.1 protein_id gnl|my_center|LOCUS_56440 >Feature sequence2634 1311 214 gene locus_tag LOCUS_56450 1311 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56450 >Feature sequence2635 1447 995 gene locus_tag LOCUS_56460 1447 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56460 >Feature sequence2636 382 594 gene locus_tag LOCUS_56470 382 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56470 1377 898 gene locus_tag LOCUS_56480 1377 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56480 >Feature sequence2637 1038 1460 gene locus_tag LOCUS_56490 1038 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56490 >Feature sequence2638 <1546 180 gene locus_tag LOCUS_56500 <1546 180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927078.1:DUF559 domain-containing protein >Feature sequence2639 >Feature sequence2640 1336 470 gene locus_tag LOCUS_56510 1336 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142570.1 protein_id gnl|my_center|LOCUS_56510 >Feature sequence2641 1195 419 gene locus_tag LOCUS_56520 1195 419 CDS product DUF2993 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921011.1 protein_id gnl|my_center|LOCUS_56520 >Feature sequence2642 <1546 851 gene locus_tag LOCUS_56530 <1546 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259081.1:amino acid ABC transporter permease >Feature sequence2643 401 144 gene locus_tag LOCUS_56540 401 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56540 929 591 gene locus_tag LOCUS_56550 929 591 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390945.1 protein_id gnl|my_center|LOCUS_56550 1043 1213 gene locus_tag LOCUS_56560 1043 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56560 1262 1510 gene locus_tag LOCUS_56570 1262 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56570 >Feature sequence2644 <1 1082 gene locus_tag LOCUS_56580 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124524.1:glycoside hydrolase 100 family protein >Feature sequence2645 256 531 gene locus_tag LOCUS_56590 256 531 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202715939.1 protein_id gnl|my_center|LOCUS_56590 >Feature sequence2646 264 103 gene locus_tag LOCUS_56600 264 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56600 325 1095 gene locus_tag LOCUS_56610 325 1095 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705617.1 protein_id gnl|my_center|LOCUS_56610 >Feature sequence2647 1208 96 gene locus_tag LOCUS_56620 1208 96 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799101.1 protein_id gnl|my_center|LOCUS_56620 >Feature sequence2648 <1 1098 gene locus_tag LOCUS_56630 <1 1098 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798165.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence2649 337 2 gene locus_tag LOCUS_56640 337 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56640 >Feature sequence2650 <1542 154 gene locus_tag LOCUS_56650 <1542 154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057710.1:ribonuclease R >Feature sequence2651 600 788 gene locus_tag LOCUS_56660 600 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56660 >Feature sequence2652 580 356 gene locus_tag LOCUS_56670 580 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56670 947 684 gene locus_tag LOCUS_56680 947 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56680 1541 1050 gene locus_tag LOCUS_56690 1541 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56690 >Feature sequence2653 1536 4 gene locus_tag LOCUS_56700 1536 4 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_56700 >Feature sequence2654 1522 854 gene locus_tag LOCUS_56710 1522 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56710 >Feature sequence2655 >Feature sequence2656 <1 579 gene locus_tag LOCUS_56720 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057310.1:HAD family hydrolase >Feature sequence2657 945 145 gene locus_tag LOCUS_56730 945 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56730 >Feature sequence2658 426 1337 gene locus_tag LOCUS_56740 426 1337 CDS product IS4-like element ISGvi4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141195.1 protein_id gnl|my_center|LOCUS_56740 >Feature sequence2659 1043 711 gene locus_tag LOCUS_56750 gene trxA 1043 711 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140882.1 protein_id gnl|my_center|LOCUS_56750 >Feature sequence2660 610 257 gene locus_tag LOCUS_56760 610 257 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057408.1 protein_id gnl|my_center|LOCUS_56760 1438 740 gene locus_tag LOCUS_56770 1438 740 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143792.1 protein_id gnl|my_center|LOCUS_56770 >Feature sequence2661 16 1050 gene locus_tag LOCUS_56780 gene pksG 16 1050 CDS product polyketide biosynthesis 3-hydroxy-3-methylglutaryl-ACP synthase PksG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231805.1 protein_id gnl|my_center|LOCUS_56780 >Feature sequence2662 483 929 gene locus_tag LOCUS_56790 483 929 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056717.1 protein_id gnl|my_center|LOCUS_56790 >Feature sequence2663 <1535 306 gene locus_tag LOCUS_56800 <1535 306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057157.1:DNA primase >Feature sequence2664 400 200 gene locus_tag LOCUS_56810 400 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56810 >Feature sequence2665 >Feature sequence2666 1285 89 gene locus_tag LOCUS_56820 1285 89 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_110716881.1 protein_id gnl|my_center|LOCUS_56820 >Feature sequence2667 314 709 gene locus_tag LOCUS_56830 314 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56830 >Feature sequence2668 <1532 445 gene locus_tag LOCUS_56840 <1532 445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162305080.1:calcium-binding protein >Feature sequence2669 846 1475 gene locus_tag LOCUS_56850 846 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56850 >Feature sequence2670 356 81 gene locus_tag LOCUS_56860 356 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56860 492 343 gene locus_tag LOCUS_56870 492 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56870 >Feature sequence2671 1436 489 gene locus_tag LOCUS_56880 gene mdh 1436 489 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142537.1 protein_id gnl|my_center|LOCUS_56880 >Feature sequence2672 >Feature sequence2673 <1 591 gene locus_tag LOCUS_56890 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531128.1:ABC transporter permease 1370 1251 gene locus_tag LOCUS_56900 1370 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56900 >Feature sequence2674 57 1163 gene locus_tag LOCUS_56910 gene hrcA 57 1163 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_56910 >Feature sequence2675 <1 1072 gene locus_tag LOCUS_56920 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680236.1:mechanosensitive ion channel family protein >Feature sequence2676 <1 1336 gene locus_tag LOCUS_56930 <1 1336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011014933.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence2677 <1 1483 gene locus_tag LOCUS_56940 <1 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056126.1:magnesium chelatase subunit H >Feature sequence2678 191 430 gene locus_tag LOCUS_56950 191 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56950 >Feature sequence2679 <1528 714 gene locus_tag LOCUS_56960 <1528 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057710.1:ribonuclease R >Feature sequence2680 422 1165 gene locus_tag LOCUS_56970 422 1165 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259746.1 protein_id gnl|my_center|LOCUS_56970 >Feature sequence2681 1280 9 gene locus_tag LOCUS_56980 1280 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_56980 >Feature sequence2682 1142 132 gene locus_tag LOCUS_56990 1142 132 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107128.1 protein_id gnl|my_center|LOCUS_56990 >Feature sequence2683 1427 1044 gene locus_tag LOCUS_57000 1427 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799199.1 protein_id gnl|my_center|LOCUS_57000 >Feature sequence2684 1136 498 gene locus_tag LOCUS_57010 gene tmk 1136 498 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057890.1 protein_id gnl|my_center|LOCUS_57010 >Feature sequence2685 1315 578 gene locus_tag LOCUS_57020 1315 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57020 >Feature sequence2686 <1 729 gene locus_tag LOCUS_57030 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933504.1:2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase >Feature sequence2687 83 703 gene locus_tag LOCUS_57040 83 703 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142965.1 protein_id gnl|my_center|LOCUS_57040 <1525 739 gene locus_tag LOCUS_57050 <1525 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948298.1:ABC transporter permease >Feature sequence2688 834 448 gene locus_tag LOCUS_57060 834 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57060 >Feature sequence2689 251 180 gene locus_tag LOCUS_t00570 251 180 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 521 1321 gene locus_tag LOCUS_57070 gene cpdA 521 1321 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056616.1 protein_id gnl|my_center|LOCUS_57070 >Feature sequence2690 397 840 gene locus_tag LOCUS_57080 397 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57080 >Feature sequence2691 900 1514 gene locus_tag LOCUS_57090 900 1514 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931185.1 protein_id gnl|my_center|LOCUS_57090 >Feature sequence2692 302 700 gene locus_tag LOCUS_57100 302 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57100 1287 907 gene locus_tag LOCUS_57110 1287 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57110 >Feature sequence2693 50 208 gene locus_tag LOCUS_57120 50 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57120 208 1137 gene locus_tag LOCUS_57130 208 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061432862.1 protein_id gnl|my_center|LOCUS_57130 >Feature sequence2694 945 1 gene locus_tag LOCUS_57140 945 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57140 <1521 942 gene locus_tag LOCUS_57150 <1521 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003976356.1:MoxR family ATPase >Feature sequence2695 <1 831 gene locus_tag LOCUS_57160 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141699.1:glutathione S-transferase family protein >Feature sequence2696 <1520 402 gene locus_tag LOCUS_57170 <1520 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141071.1:iron uptake porin >Feature sequence2697 1251 226 gene locus_tag LOCUS_57180 1251 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57180 >Feature sequence2698 <1 538 gene locus_tag LOCUS_57190 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920910.1:global nitrogen regulator NtcA 632 1243 gene locus_tag LOCUS_57200 632 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57200 >Feature sequence2699 1168 122 gene locus_tag LOCUS_57210 1168 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57210 >Feature sequence2700 446 267 gene locus_tag LOCUS_57220 446 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57220 <1519 726 gene locus_tag LOCUS_57230 <1519 726 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143437.1:ABC transporter permease >Feature sequence2701 <1518 44 gene locus_tag LOCUS_57240 <1518 44 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545464.1:hydroxylamine reductase >Feature sequence2702 <1517 345 gene locus_tag LOCUS_57250 <1517 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929486.1:FG-GAP-like repeat-containing protein >Feature sequence2703 <1 1021 gene locus_tag LOCUS_57260 <1 1021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143412.1:threonine-phosphate decarboxylase CobD >Feature sequence2704 1300 188 gene locus_tag LOCUS_57270 1300 188 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928453.1 protein_id gnl|my_center|LOCUS_57270 >Feature sequence2705 51 995 gene locus_tag LOCUS_57280 51 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57280 >Feature sequence2706 637 335 gene locus_tag LOCUS_57290 637 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_57290 1071 712 gene locus_tag LOCUS_57300 1071 712 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402966.1 protein_id gnl|my_center|LOCUS_57300 >Feature sequence2707 <1 672 gene locus_tag LOCUS_57310 <1 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583812.1:polyamine aminopropyltransferase >Feature sequence2708 1254 955 gene locus_tag LOCUS_57320 1254 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57320 >Feature sequence2709 161 598 gene locus_tag LOCUS_57330 161 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57330 716 898 gene locus_tag LOCUS_57340 716 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57340 959 1213 gene locus_tag LOCUS_57350 959 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57350 >Feature sequence2710 711 1514 gene locus_tag LOCUS_57360 711 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57360 >Feature sequence2711 216 824 gene locus_tag LOCUS_57370 216 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57370 921 1265 gene locus_tag LOCUS_57380 921 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57380 >Feature sequence2712 968 81 gene locus_tag LOCUS_57390 968 81 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_57390 >Feature sequence2713 434 862 gene locus_tag LOCUS_57400 434 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57400 >Feature sequence2714 >Feature sequence2715 134 1138 gene locus_tag LOCUS_57410 134 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57410 >Feature sequence2716 42 329 gene locus_tag LOCUS_57420 42 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57420 569 1288 gene locus_tag LOCUS_57430 569 1288 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990622.1 protein_id gnl|my_center|LOCUS_57430 >Feature sequence2717 275 1309 gene locus_tag LOCUS_57440 275 1309 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_57440 >Feature sequence2718 809 1051 gene locus_tag LOCUS_57450 809 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57450 >Feature sequence2719 537 1091 gene locus_tag LOCUS_57460 gene coaD 537 1091 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_57460 >Feature sequence2720 80 544 gene locus_tag LOCUS_57470 80 544 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_57470 561 755 gene locus_tag LOCUS_57480 561 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57480 >Feature sequence2721 1041 187 gene locus_tag LOCUS_57490 1041 187 CDS product metal-dependent phosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172344.1 protein_id gnl|my_center|LOCUS_57490 >Feature sequence2722 77 901 gene locus_tag LOCUS_57500 77 901 CDS product SirB1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142488.1 protein_id gnl|my_center|LOCUS_57500 >Feature sequence2723 311 90 gene locus_tag LOCUS_57510 311 90 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143533.1 protein_id gnl|my_center|LOCUS_57510 1376 423 gene locus_tag LOCUS_57520 gene gmd 1376 423 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056481.1 protein_id gnl|my_center|LOCUS_57520 >Feature sequence2724 235 447 gene locus_tag LOCUS_57530 235 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57530 >Feature sequence2725 >Feature sequence2726 1507 797 gene locus_tag LOCUS_57540 1507 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57540 >Feature sequence2727 >Feature sequence2728 933 514 gene locus_tag LOCUS_57550 933 514 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171945.1 protein_id gnl|my_center|LOCUS_57550 >Feature sequence2729 >Feature sequence2730 288 689 gene locus_tag LOCUS_57560 288 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57560 >Feature sequence2731 >Feature sequence2732 289 864 gene locus_tag LOCUS_57570 289 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57570 >Feature sequence2733 <1 1152 gene locus_tag LOCUS_57580 <1 1152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258647.1:FAD/NAD(P)-binding protein >Feature sequence2734 526 311 gene locus_tag LOCUS_57590 526 311 CDS product DUF2949 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921037.1 protein_id gnl|my_center|LOCUS_57590 >Feature sequence2735 >Feature sequence2736 161 325 gene locus_tag LOCUS_57600 161 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57600 390 647 gene locus_tag LOCUS_57610 390 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57610 647 1048 gene locus_tag LOCUS_57620 647 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57620 1204 1419 gene locus_tag LOCUS_57630 1204 1419 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140129.1 protein_id gnl|my_center|LOCUS_57630 >Feature sequence2737 665 129 gene locus_tag LOCUS_57640 665 129 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057944.1 protein_id gnl|my_center|LOCUS_57640 <1503 848 gene locus_tag LOCUS_57650 <1503 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057943.1:sigma-70 family RNA polymerase sigma factor >Feature sequence2738 1250 633 gene locus_tag LOCUS_57660 1250 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57660 >Feature sequence2739 <1502 158 gene locus_tag LOCUS_57670 <1502 158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence2740 911 408 gene locus_tag LOCUS_57680 911 408 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142733.1 protein_id gnl|my_center|LOCUS_57680 >Feature sequence2741 614 333 gene locus_tag LOCUS_57690 614 333 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056384.1 protein_id gnl|my_center|LOCUS_57690 1068 745 gene locus_tag LOCUS_57700 1068 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57700 >Feature sequence2742 544 119 gene locus_tag LOCUS_57710 544 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57710 >Feature sequence2743 1141 116 gene locus_tag LOCUS_57720 1141 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57720 >Feature sequence2744 1270 353 gene locus_tag LOCUS_57730 gene thrB 1270 353 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057602.1 protein_id gnl|my_center|LOCUS_57730 >Feature sequence2745 558 334 gene locus_tag LOCUS_57740 558 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57740 >Feature sequence2746 <1500 523 gene locus_tag LOCUS_57750 <1500 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227769.1:TRAP transporter substrate-binding protein >Feature sequence2747 347 952 gene locus_tag LOCUS_57760 347 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57760 >Feature sequence2748 <1499 528 gene locus_tag LOCUS_57770 <1499 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048121910.1:HEAT repeat domain-containing protein >Feature sequence2749 759 340 gene locus_tag LOCUS_57780 gene vapC 759 340 CDS product type II toxin-antitoxin system toxin VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970128.1 protein_id gnl|my_center|LOCUS_57780 1183 749 gene locus_tag LOCUS_57790 1183 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57790 >Feature sequence2750 965 57 gene locus_tag LOCUS_57800 965 57 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_57800 >Feature sequence2751 <1498 992 gene locus_tag LOCUS_57810 <1498 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058218.1:hemolytic protein HlpA >Feature sequence2752 >Feature sequence2753 117 1082 gene locus_tag LOCUS_57820 117 1082 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056897.1 protein_id gnl|my_center|LOCUS_57820 >Feature sequence2754 809 372 gene locus_tag LOCUS_57830 gene queD 809 372 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391049.1 protein_id gnl|my_center|LOCUS_57830 >Feature sequence2755 >Feature sequence2756 480 49 gene locus_tag LOCUS_57840 480 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57840 <1495 441 gene locus_tag LOCUS_57850 <1495 441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330518.1:glutamate synthase subunit beta >Feature sequence2757 996 91 gene locus_tag LOCUS_57860 996 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57860 1354 1076 gene locus_tag LOCUS_57870 1354 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_57870 >Feature sequence2758 <1494 32 gene locus_tag LOCUS_57880 <1494 32 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_175552028.1:calcium-binding protein >Feature sequence2759 518 111 gene locus_tag LOCUS_57890 518 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57890 808 557 gene locus_tag LOCUS_57900 gene acpP 808 557 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_57900 >Feature sequence2760 1283 99 gene locus_tag LOCUS_57910 1283 99 CDS product aspartate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057885.1 protein_id gnl|my_center|LOCUS_57910 >Feature sequence2761 1308 550 gene locus_tag LOCUS_57920 1308 550 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_57920 >Feature sequence2762 <1492 295 gene locus_tag LOCUS_57930 <1492 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920635.1:serine protease >Feature sequence2763 545 129 gene locus_tag LOCUS_57940 545 129 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_57940 1192 1073 gene locus_tag LOCUS_57950 1192 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57950 >Feature sequence2764 49 567 gene locus_tag LOCUS_57960 49 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57960 581 1021 gene locus_tag LOCUS_57970 581 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920749.1 protein_id gnl|my_center|LOCUS_57970 >Feature sequence2765 <1491 987 gene locus_tag LOCUS_57980 <1491 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479510.1:mechanosensitive ion channel family protein >Feature sequence2766 890 348 gene locus_tag LOCUS_57990 890 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_57990 1432 1250 gene locus_tag LOCUS_58000 1432 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58000 >Feature sequence2767 320 982 gene locus_tag LOCUS_58010 320 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58010 >Feature sequence2768 634 35 gene locus_tag LOCUS_58020 634 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58020 1184 873 gene locus_tag LOCUS_58030 1184 873 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528398.1 protein_id gnl|my_center|LOCUS_58030 >Feature sequence2769 <1 1341 gene locus_tag LOCUS_58040 <1 1341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055977.1:GspE/PulE family protein >Feature sequence2770 >Feature sequence2771 1379 687 gene locus_tag LOCUS_58050 1379 687 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056926.1 protein_id gnl|my_center|LOCUS_58050 >Feature sequence2772 641 120 gene locus_tag LOCUS_58060 641 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58060 <1489 768 gene locus_tag LOCUS_58070 <1489 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226013942.1:retention module-containing protein >Feature sequence2773 >Feature sequence2774 1045 452 gene locus_tag LOCUS_58080 gene phnH 1045 452 CDS product phosphonate C-P lyase system protein PhnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392105.1 protein_id gnl|my_center|LOCUS_58080 >Feature sequence2775 867 10 gene locus_tag LOCUS_58090 gene csaB 867 10 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_58090 946 1263 gene locus_tag LOCUS_58100 946 1263 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_58100 >Feature sequence2776 756 316 gene locus_tag LOCUS_58110 756 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58110 969 1331 gene locus_tag LOCUS_58120 gene ndhC 969 1331 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126986108.1 protein_id gnl|my_center|LOCUS_58120 >Feature sequence2777 960 109 gene locus_tag LOCUS_58130 960 109 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000400423.1 protein_id gnl|my_center|LOCUS_58130 >Feature sequence2778 972 271 gene locus_tag LOCUS_58140 972 271 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_58140 >Feature sequence2779 884 1318 gene locus_tag LOCUS_58150 884 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58150 >Feature sequence2780 <1486 650 gene locus_tag LOCUS_58160 <1486 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence2781 <1485 237 gene locus_tag LOCUS_58170 <1485 237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041280254.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence2782 622 122 gene locus_tag LOCUS_58180 622 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58180 1218 619 gene locus_tag LOCUS_58190 1218 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58190 >Feature sequence2783 <1 831 gene locus_tag LOCUS_58200 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141774.1:diflavin flavoprotein >Feature sequence2784 >Feature sequence2785 >Feature sequence2786 <1482 225 gene locus_tag LOCUS_58210 <1482 225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009969242.1:alkaline phosphatase PhoD >Feature sequence2787 2 349 gene locus_tag LOCUS_58220 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58220 377 871 gene locus_tag LOCUS_58230 377 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58230 >Feature sequence2788 664 380 gene locus_tag LOCUS_58240 664 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58240 >Feature sequence2789 >Feature sequence2790 >Feature sequence2791 <1481 374 gene locus_tag LOCUS_58250 <1481 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084552.1:nitrogenase molybdenum-iron protein alpha chain >Feature sequence2792 1011 1427 gene locus_tag LOCUS_58260 gene vapC 1011 1427 CDS product tRNA(fMet)-specific endonuclease VapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331362.1 protein_id gnl|my_center|LOCUS_58260 >Feature sequence2793 36 350 gene locus_tag LOCUS_58270 36 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58270 >Feature sequence2794 <1 732 gene locus_tag LOCUS_58280 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056897.1:aldo/keto reductase <1480 761 gene locus_tag LOCUS_58290 <1480 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057217.1:succinate dehydrogenase/fumarate reductase flavoprotein subunit >Feature sequence2795 801 94 gene locus_tag LOCUS_58300 801 94 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257397.1 protein_id gnl|my_center|LOCUS_58300 1298 798 gene locus_tag LOCUS_58310 1298 798 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948551.1 protein_id gnl|my_center|LOCUS_58310 >Feature sequence2796 7 888 gene locus_tag LOCUS_58320 7 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58320 >Feature sequence2797 1108 431 gene locus_tag LOCUS_58330 1108 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58330 >Feature sequence2798 <1479 200 gene locus_tag LOCUS_58340 <1479 200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928630.1:FG-GAP-like repeat-containing protein >Feature sequence2799 <1 598 gene locus_tag LOCUS_58350 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000495223.1:glutathione peroxidase >Feature sequence2800 453 1163 gene locus_tag LOCUS_58360 453 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58360 >Feature sequence2801 243 890 gene locus_tag LOCUS_58370 243 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_58370 >Feature sequence2802 384 1 gene locus_tag LOCUS_58380 384 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58380 >Feature sequence2803 418 74 gene locus_tag LOCUS_58390 418 74 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58390 <1475 633 gene locus_tag LOCUS_58400 <1475 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920940.1:cobyrinate a,c-diamide synthase >Feature sequence2804 <1 1377 gene locus_tag LOCUS_58410 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015261871.1:HAMP domain-containing sensor histidine kinase >Feature sequence2805 >Feature sequence2806 <1474 339 gene locus_tag LOCUS_58420 <1474 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966552.1:Ig domain-containing protein >Feature sequence2807 708 259 gene locus_tag LOCUS_58430 708 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58430 1025 711 gene locus_tag LOCUS_58440 1025 711 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_58440 >Feature sequence2808 1380 430 gene locus_tag LOCUS_58450 1380 430 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055892.1 protein_id gnl|my_center|LOCUS_58450 >Feature sequence2809 250 20 gene locus_tag LOCUS_58460 250 20 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057407.1 protein_id gnl|my_center|LOCUS_58460 962 342 gene locus_tag LOCUS_58470 962 342 CDS product DUF6391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140118.1 protein_id gnl|my_center|LOCUS_58470 >Feature sequence2810 420 986 gene locus_tag LOCUS_58480 420 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58480 >Feature sequence2811 <1 763 gene locus_tag LOCUS_58490 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058043.1:bestrophin family ion channel >Feature sequence2812 <1471 810 gene locus_tag LOCUS_58500 <1471 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence2813 >Feature sequence2814 912 49 gene locus_tag LOCUS_58510 gene folD 912 49 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141882.1 protein_id gnl|my_center|LOCUS_58510 >Feature sequence2815 1218 1003 gene locus_tag LOCUS_58520 1218 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58520 >Feature sequence2816 1317 301 gene locus_tag LOCUS_58530 1317 301 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000683574.1 protein_id gnl|my_center|LOCUS_58530 >Feature sequence2817 <1 1075 gene locus_tag LOCUS_58540 <1 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein >Feature sequence2818 806 291 gene locus_tag LOCUS_58550 806 291 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056641.1 protein_id gnl|my_center|LOCUS_58550 >Feature sequence2819 <1467 191 gene locus_tag LOCUS_58560 <1467 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence2820 <1467 496 gene locus_tag LOCUS_58570 <1467 496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein >Feature sequence2821 1157 453 gene locus_tag LOCUS_58580 1157 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58580 1427 1248 gene locus_tag LOCUS_58590 1427 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58590 >Feature sequence2822 256 1080 gene locus_tag LOCUS_58600 256 1080 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142264.1 protein_id gnl|my_center|LOCUS_58600 >Feature sequence2823 1429 500 gene locus_tag LOCUS_58610 1429 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58610 >Feature sequence2824 631 20 gene locus_tag LOCUS_58620 631 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58620 1326 652 gene locus_tag LOCUS_58630 1326 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58630 >Feature sequence2825 >Feature sequence2826 524 1060 gene locus_tag LOCUS_58640 524 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58640 >Feature sequence2827 813 70 gene locus_tag LOCUS_58650 813 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58650 >Feature sequence2828 292 23 gene locus_tag LOCUS_58660 292 23 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530241.1 protein_id gnl|my_center|LOCUS_58660 >Feature sequence2829 821 684 gene locus_tag LOCUS_58670 821 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58670 >Feature sequence2830 315 512 gene locus_tag LOCUS_58680 315 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58680 1358 906 gene locus_tag LOCUS_58690 1358 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799825.1 protein_id gnl|my_center|LOCUS_58690 >Feature sequence2831 134 1300 gene locus_tag LOCUS_58700 134 1300 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057329.1 protein_id gnl|my_center|LOCUS_58700 >Feature sequence2832 661 1179 gene locus_tag LOCUS_58710 661 1179 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_58710 >Feature sequence2833 511 65 gene locus_tag LOCUS_58720 511 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58720 1336 590 gene locus_tag LOCUS_58730 1336 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58730 >Feature sequence2834 >Feature sequence2835 1429 1357 gene locus_tag LOCUS_t00580 1429 1357 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2836 <1 1053 gene locus_tag LOCUS_58740 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227769.1:TRAP transporter substrate-binding protein >Feature sequence2837 999 184 gene locus_tag LOCUS_58750 999 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58750 >Feature sequence2838 629 84 gene locus_tag LOCUS_58760 gene fldA 629 84 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_58760 >Feature sequence2839 524 925 gene locus_tag LOCUS_58770 524 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58770 937 1320 gene locus_tag LOCUS_58780 937 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58780 >Feature sequence2840 697 1041 gene locus_tag LOCUS_58790 697 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58790 1038 1250 gene locus_tag LOCUS_58800 1038 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58800 >Feature sequence2841 <1459 367 gene locus_tag LOCUS_58810 <1459 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206373.1:ankyrin repeat domain-containing protein >Feature sequence2842 1457 771 gene locus_tag LOCUS_58820 1457 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58820 >Feature sequence2843 <1458 465 gene locus_tag LOCUS_58830 <1458 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920783.1:transglycosylase SLT domain-containing protein >Feature sequence2844 1131 574 gene locus_tag LOCUS_58840 1131 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58840 >Feature sequence2845 467 150 gene locus_tag LOCUS_58850 467 150 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057538.1 protein_id gnl|my_center|LOCUS_58850 1045 728 gene locus_tag LOCUS_58860 1045 728 CDS product DUF2605 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057537.1 protein_id gnl|my_center|LOCUS_58860 >Feature sequence2846 1035 751 gene locus_tag LOCUS_58870 1035 751 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_58870 1267 1025 gene locus_tag LOCUS_58880 1267 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58880 >Feature sequence2847 1299 448 gene locus_tag LOCUS_58890 gene rsmH 1299 448 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057907.1 protein_id gnl|my_center|LOCUS_58890 >Feature sequence2848 1226 606 gene locus_tag LOCUS_58900 1226 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58900 >Feature sequence2849 482 1327 gene locus_tag LOCUS_58910 482 1327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58910 >Feature sequence2850 <1455 930 gene locus_tag LOCUS_58920 <1455 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009895984.1:spermidine/putrescine ABC transporter substrate-binding protein >Feature sequence2851 <1455 527 gene locus_tag LOCUS_58930 <1455 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971984.1:ATP-binding protein >Feature sequence2852 1123 617 gene locus_tag LOCUS_58940 1123 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58940 >Feature sequence2853 246 962 gene locus_tag LOCUS_58950 246 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58950 >Feature sequence2854 64 492 gene locus_tag LOCUS_58960 64 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58960 638 970 gene locus_tag LOCUS_58970 638 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58970 970 1344 gene locus_tag LOCUS_58980 970 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_58980 >Feature sequence2855 <1 1029 gene locus_tag LOCUS_58990 <1 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141963.1:NB-ARC domain-containing protein >Feature sequence2856 1383 364 gene locus_tag LOCUS_59000 1383 364 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057152.1 protein_id gnl|my_center|LOCUS_59000 >Feature sequence2857 1145 3 gene locus_tag LOCUS_59010 1145 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59010 1451 1155 gene locus_tag LOCUS_59020 1451 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59020 >Feature sequence2858 991 68 gene locus_tag LOCUS_59030 991 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59030 >Feature sequence2859 124 423 gene locus_tag LOCUS_59040 124 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59040 944 459 gene locus_tag LOCUS_59050 944 459 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_59050 1306 941 gene locus_tag LOCUS_59060 1306 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59060 >Feature sequence2860 186 1286 gene locus_tag LOCUS_59070 186 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59070 >Feature sequence2861 7 945 gene locus_tag LOCUS_59080 7 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59080 >Feature sequence2862 131 835 gene locus_tag LOCUS_59090 131 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59090 <1449 944 gene locus_tag LOCUS_59100 <1449 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_191315613.1:ABC transporter substrate-binding protein >Feature sequence2863 101 1210 gene locus_tag LOCUS_59110 101 1210 CDS product serine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616243.1 protein_id gnl|my_center|LOCUS_59110 >Feature sequence2864 493 879 gene locus_tag LOCUS_59120 493 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_59120 >Feature sequence2865 <1447 143 gene locus_tag LOCUS_59130 <1447 143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728459.1:N-acetylglutaminylglutamine amidotransferase >Feature sequence2866 <1446 716 gene locus_tag LOCUS_59140 <1446 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071727514.1:nucleoside hydrolase >Feature sequence2867 164 1393 gene locus_tag LOCUS_59150 164 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59150 >Feature sequence2868 <1446 95 gene locus_tag LOCUS_59160 <1446 95 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase >Feature sequence2869 <1 1444 gene locus_tag LOCUS_59170 <1 1444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880400.1:carbamoyltransferase HypF >Feature sequence2870 1024 152 gene locus_tag LOCUS_59180 1024 152 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057037.1 protein_id gnl|my_center|LOCUS_59180 >Feature sequence2871 >Feature sequence2872 1362 439 gene locus_tag LOCUS_59190 gene rbsK 1362 439 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_59190 >Feature sequence2873 1415 432 gene locus_tag LOCUS_59200 1415 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59200 >Feature sequence2874 839 639 gene locus_tag LOCUS_59210 839 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59210 >Feature sequence2875 >Feature sequence2876 1213 779 gene locus_tag LOCUS_59220 1213 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59220 >Feature sequence2877 459 1142 gene locus_tag LOCUS_59230 459 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59230 >Feature sequence2878 <1441 1 gene locus_tag LOCUS_59240 <1441 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence2879 1007 207 gene locus_tag LOCUS_59250 1007 207 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263020.1 protein_id gnl|my_center|LOCUS_59250 >Feature sequence2880 716 327 gene locus_tag LOCUS_59260 716 327 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142884.1 protein_id gnl|my_center|LOCUS_59260 >Feature sequence2881 <1 877 gene locus_tag LOCUS_59270 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190697803.1:amylo-alpha-1,6-glucosidase >Feature sequence2882 <1439 577 gene locus_tag LOCUS_59280 <1439 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074028.1:aromatic amino acid ammonia-lyase >Feature sequence2883 1263 1048 gene locus_tag LOCUS_59290 1263 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59290 >Feature sequence2884 <1 1261 gene locus_tag LOCUS_59300 <1 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020804.1:PAS domain S-box protein >Feature sequence2885 113 1237 gene locus_tag LOCUS_59310 113 1237 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929514.1 protein_id gnl|my_center|LOCUS_59310 >Feature sequence2886 <1 850 gene locus_tag LOCUS_59320 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258301.1:ABC transporter ATP-binding protein >Feature sequence2887 118 1059 gene locus_tag LOCUS_59330 gene murQ 118 1059 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057013.1 protein_id gnl|my_center|LOCUS_59330 1437 1207 gene locus_tag LOCUS_59340 1437 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59340 >Feature sequence2888 1340 66 gene locus_tag LOCUS_59350 1340 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59350 >Feature sequence2889 784 356 gene locus_tag LOCUS_59360 784 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59360 732 1088 gene locus_tag LOCUS_59370 732 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59370 1170 1337 gene locus_tag LOCUS_59380 1170 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59380 >Feature sequence2890 789 1367 gene locus_tag LOCUS_59390 789 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59390 >Feature sequence2891 <1 938 gene locus_tag LOCUS_59400 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142707.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence2892 <1434 302 gene locus_tag LOCUS_59410 <1434 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099798964.1:type II secretion system F family protein >Feature sequence2893 <1 1139 gene locus_tag LOCUS_59420 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799342.1:ShlB/FhaC/HecB family hemolysin secretion/activation protein >Feature sequence2894 1427 651 gene locus_tag LOCUS_59430 1427 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59430 >Feature sequence2895 <1 622 gene locus_tag LOCUS_59440 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125542.1:sugar transferase >Feature sequence2896 125 1387 gene locus_tag LOCUS_59450 125 1387 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_59450 >Feature sequence2897 430 951 gene locus_tag LOCUS_59460 430 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59460 >Feature sequence2898 <1 798 gene locus_tag LOCUS_59470 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence2899 489 980 gene locus_tag LOCUS_59480 489 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59480 >Feature sequence2900 142 426 gene locus_tag LOCUS_59490 142 426 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920900.1 protein_id gnl|my_center|LOCUS_59490 1186 701 gene locus_tag LOCUS_59500 1186 701 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_59500 >Feature sequence2901 >Feature sequence2902 99 1235 gene locus_tag LOCUS_59510 99 1235 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056261.1 protein_id gnl|my_center|LOCUS_59510 >Feature sequence2903 567 301 gene locus_tag LOCUS_59520 567 301 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058048.1 protein_id gnl|my_center|LOCUS_59520 1311 883 gene locus_tag LOCUS_59530 1311 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59530 >Feature sequence2904 256 927 gene locus_tag LOCUS_59540 256 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59540 1074 1310 gene locus_tag LOCUS_59550 1074 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59550 >Feature sequence2905 719 838 gene locus_tag LOCUS_59560 719 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59560 <1429 888 gene locus_tag LOCUS_59570 <1429 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_025687389.1:HAD family hydrolase >Feature sequence2906 509 306 gene locus_tag LOCUS_59580 509 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59580 <1428 811 gene locus_tag LOCUS_59590 <1428 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058235.1:molybdopterin-synthase adenylyltransferase MoeB >Feature sequence2907 >Feature sequence2908 201 1 gene locus_tag LOCUS_59600 201 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59600 >Feature sequence2909 <1 611 gene locus_tag LOCUS_59610 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920717.1:ABC transporter ATP-binding protein <1427 665 gene locus_tag LOCUS_59620 <1427 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000377275.1:diguanylate cyclase >Feature sequence2910 463 62 gene locus_tag LOCUS_59630 463 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59630 <1426 602 gene locus_tag LOCUS_59640 <1426 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056502.1:ABC transporter ATP-binding protein >Feature sequence2911 160 462 gene locus_tag LOCUS_59650 160 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59650 >Feature sequence2912 279 1028 gene locus_tag LOCUS_59660 279 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59660 >Feature sequence2913 158 1306 gene locus_tag LOCUS_59670 158 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_59670 >Feature sequence2914 >Feature sequence2915 208 894 gene locus_tag LOCUS_59680 208 894 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143139.1 protein_id gnl|my_center|LOCUS_59680 >Feature sequence2916 16 453 gene locus_tag LOCUS_59690 16 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59690 670 461 gene locus_tag LOCUS_59700 670 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59700 >Feature sequence2917 577 831 gene locus_tag LOCUS_59710 577 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59710 835 1164 gene locus_tag LOCUS_59720 835 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59720 >Feature sequence2918 963 58 gene locus_tag LOCUS_59730 gene purU 963 58 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524116.1 protein_id gnl|my_center|LOCUS_59730 >Feature sequence2919 509 42 gene locus_tag LOCUS_59740 509 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59740 814 1416 gene locus_tag LOCUS_59750 814 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59750 >Feature sequence2920 2 223 gene locus_tag LOCUS_59760 2 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59760 859 209 gene locus_tag LOCUS_59770 859 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59770 1328 906 gene locus_tag LOCUS_59780 1328 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59780 >Feature sequence2921 186 464 gene locus_tag LOCUS_59790 186 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59790 531 686 gene locus_tag LOCUS_59800 531 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59800 702 1115 gene locus_tag LOCUS_59810 702 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_59810 >Feature sequence2922 >Feature sequence2923 1 735 gene locus_tag LOCUS_59820 1 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59820 >Feature sequence2924 >Feature sequence2925 239 463 gene locus_tag LOCUS_59830 239 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59830 480 1346 gene locus_tag LOCUS_59840 480 1346 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909297.1 protein_id gnl|my_center|LOCUS_59840 >Feature sequence2926 28 231 gene locus_tag LOCUS_59850 28 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59850 238 417 gene locus_tag LOCUS_59860 238 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59860 >Feature sequence2927 >Feature sequence2928 770 258 gene locus_tag LOCUS_59870 770 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59870 950 879 gene locus_tag LOCUS_t00590 950 879 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2929 <1414 352 gene locus_tag LOCUS_59880 <1414 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001099029.1:glycosyltransferase >Feature sequence2930 704 9 gene locus_tag LOCUS_59890 704 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59890 1295 930 gene locus_tag LOCUS_59900 1295 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59900 >Feature sequence2931 993 121 gene locus_tag LOCUS_59910 993 121 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839117.1 protein_id gnl|my_center|LOCUS_59910 >Feature sequence2932 705 271 gene locus_tag LOCUS_59920 705 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59920 985 692 gene locus_tag LOCUS_59930 985 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59930 >Feature sequence2933 861 301 gene locus_tag LOCUS_59940 861 301 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_59940 >Feature sequence2934 448 786 gene locus_tag LOCUS_59950 448 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59950 >Feature sequence2935 1162 23 gene locus_tag LOCUS_59960 1162 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59960 >Feature sequence2936 1208 768 gene locus_tag LOCUS_59970 1208 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59970 >Feature sequence2937 >Feature sequence2938 268 122 gene locus_tag LOCUS_59980 268 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_59980 526 293 gene locus_tag LOCUS_59990 526 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_59990 771 526 gene locus_tag LOCUS_60000 771 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60000 >Feature sequence2939 191 967 gene locus_tag LOCUS_60010 191 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60010 >Feature sequence2940 646 389 gene locus_tag LOCUS_60020 646 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60020 990 754 gene locus_tag LOCUS_60030 990 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60030 >Feature sequence2941 629 540 gene locus_tag LOCUS_t00600 629 540 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1410 697 gene locus_tag LOCUS_60040 1410 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60040 >Feature sequence2942 552 256 gene locus_tag LOCUS_60050 552 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60050 1066 554 gene locus_tag LOCUS_60060 1066 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60060 >Feature sequence2943 80 1006 gene locus_tag LOCUS_60070 80 1006 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057438.1 protein_id gnl|my_center|LOCUS_60070 >Feature sequence2944 <1407 431 gene locus_tag LOCUS_60080 <1407 431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193345474.1:RNA polymerase sigma factor, RpoD/SigA family >Feature sequence2945 1319 96 gene locus_tag LOCUS_60090 1319 96 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041233550.1 protein_id gnl|my_center|LOCUS_60090 >Feature sequence2946 >Feature sequence2947 314 577 gene locus_tag LOCUS_60100 314 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60100 1266 661 gene locus_tag LOCUS_60110 1266 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60110 >Feature sequence2948 >Feature sequence2949 861 469 gene locus_tag LOCUS_60120 861 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60120 1345 833 gene locus_tag LOCUS_60130 1345 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60130 >Feature sequence2950 252 64 gene locus_tag LOCUS_60140 252 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60140 <1403 694 gene locus_tag LOCUS_60150 <1403 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057177.1:adenosylcobinamide-GDP ribazoletransferase >Feature sequence2951 <1403 186 gene locus_tag LOCUS_60160 <1403 186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence2952 347 694 gene locus_tag LOCUS_60170 347 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60170 682 852 gene locus_tag LOCUS_60180 682 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60180 >Feature sequence2953 <1 579 gene locus_tag LOCUS_60190 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence2954 354 542 gene locus_tag LOCUS_60200 354 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60200 527 814 gene locus_tag LOCUS_60210 527 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60210 1167 937 gene locus_tag LOCUS_60220 1167 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60220 >Feature sequence2955 >Feature sequence2956 547 131 gene locus_tag LOCUS_60230 gene nifX 547 131 CDS product nitrogen fixation protein NifX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084556.1 protein_id gnl|my_center|LOCUS_60230 <1401 719 gene locus_tag LOCUS_60240 <1401 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533487.1:nitrogenase iron-molybdenum cofactor biosynthesis protein NifN >Feature sequence2957 1274 627 gene locus_tag LOCUS_60250 1274 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60250 >Feature sequence2958 1330 287 gene locus_tag LOCUS_60260 gene obgE 1330 287 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058186.1 protein_id gnl|my_center|LOCUS_60260 >Feature sequence2959 <1 602 gene locus_tag LOCUS_60270 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082922.1:ABC transporter ATP-binding protein 820 1320 gene locus_tag LOCUS_60280 820 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60280 >Feature sequence2960 143 1393 gene locus_tag LOCUS_60290 143 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60290 >Feature sequence2961 95 1297 gene locus_tag LOCUS_60300 95 1297 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615452.1 protein_id gnl|my_center|LOCUS_60300 >Feature sequence2962 <1399 728 gene locus_tag LOCUS_60310 <1399 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546558.1:glycosyltransferase family 2 protein >Feature sequence2963 401 225 gene locus_tag LOCUS_60320 401 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60320 902 537 gene locus_tag LOCUS_60330 902 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60330 >Feature sequence2964 <1 1267 gene locus_tag LOCUS_60340 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256685.1:peptide ABC transporter substrate-binding protein >Feature sequence2965 512 159 gene locus_tag LOCUS_60350 512 159 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_60350 808 509 gene locus_tag LOCUS_60360 808 509 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_60360 >Feature sequence2966 >Feature sequence2967 <1 538 gene locus_tag LOCUS_60370 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence2968 >Feature sequence2969 159 722 gene locus_tag LOCUS_60380 159 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60380 >Feature sequence2970 3 1049 gene locus_tag LOCUS_60390 3 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60390 >Feature sequence2971 >Feature sequence2972 <1394 5 gene locus_tag LOCUS_60400 <1394 5 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence2973 1233 943 gene locus_tag LOCUS_60410 1233 943 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_60410 >Feature sequence2974 858 88 gene locus_tag LOCUS_60420 858 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60420 >Feature sequence2975 <1 745 gene locus_tag LOCUS_60430 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057553.1:cobyric acid synthase 790 1023 gene locus_tag LOCUS_60440 790 1023 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_60440 >Feature sequence2976 <1 849 gene locus_tag LOCUS_60450 <1 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057980.1:SulP family inorganic anion transporter >Feature sequence2977 >Feature sequence2978 895 284 gene locus_tag LOCUS_60460 895 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60460 1193 927 gene locus_tag LOCUS_60470 1193 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_60470 >Feature sequence2979 167 1201 gene locus_tag LOCUS_60480 167 1201 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267343.1 protein_id gnl|my_center|LOCUS_60480 >Feature sequence2980 27 491 gene locus_tag LOCUS_60490 27 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60490 639 1367 gene locus_tag LOCUS_60500 639 1367 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259229.1 protein_id gnl|my_center|LOCUS_60500 >Feature sequence2981 429 1349 gene locus_tag LOCUS_60510 429 1349 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_60510 >Feature sequence2982 1021 281 gene locus_tag LOCUS_60520 1021 281 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_60520 >Feature sequence2983 >Feature sequence2984 681 22 gene locus_tag LOCUS_60530 681 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60530 <1390 858 gene locus_tag LOCUS_60540 <1390 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057525.1:30S ribosomal protein S2 >Feature sequence2985 >Feature sequence2986 1367 456 gene locus_tag LOCUS_60550 1367 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60550 >Feature sequence2987 778 903 gene locus_tag LOCUS_60560 778 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60560 1388 1026 gene locus_tag LOCUS_60570 1388 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60570 >Feature sequence2988 1094 33 gene locus_tag LOCUS_60580 1094 33 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_60580 >Feature sequence2989 1016 102 gene locus_tag LOCUS_60590 1016 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60590 >Feature sequence2990 1135 236 gene locus_tag LOCUS_60600 gene argB 1135 236 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_60600 >Feature sequence2991 834 361 gene locus_tag LOCUS_60610 834 361 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920888.1 protein_id gnl|my_center|LOCUS_60610 >Feature sequence2992 104 244 gene locus_tag LOCUS_60620 104 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60620 524 596 gene locus_tag LOCUS_t00610 524 596 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence2993 826 290 gene locus_tag LOCUS_60630 826 290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60630 1256 816 gene locus_tag LOCUS_60640 1256 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60640 >Feature sequence2994 >Feature sequence2995 75 488 gene locus_tag LOCUS_60650 75 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60650 655 819 gene locus_tag LOCUS_60660 655 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60660 >Feature sequence2996 912 7 gene locus_tag LOCUS_60670 912 7 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055901.1 protein_id gnl|my_center|LOCUS_60670 >Feature sequence2997 1317 994 gene locus_tag LOCUS_60680 1317 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60680 >Feature sequence2998 1204 1034 gene locus_tag LOCUS_60690 1204 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60690 >Feature sequence2999 <1382 261 gene locus_tag LOCUS_60700 <1382 261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence3000 <1 1037 gene locus_tag LOCUS_60710 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence3001 177 1364 gene locus_tag LOCUS_60720 177 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60720 >Feature sequence3002 265 1359 gene locus_tag LOCUS_60730 gene rseP 265 1359 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057479.1 protein_id gnl|my_center|LOCUS_60730 >Feature sequence3003 166 1380 gene locus_tag LOCUS_60740 166 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60740 >Feature sequence3004 <1 814 gene locus_tag LOCUS_60750 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143313.1:pyruvate kinase 1378 974 gene locus_tag LOCUS_60760 1378 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60760 >Feature sequence3005 1225 296 gene locus_tag LOCUS_60770 1225 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60770 >Feature sequence3006 605 222 gene locus_tag LOCUS_60780 605 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055883.1 protein_id gnl|my_center|LOCUS_60780 >Feature sequence3007 717 481 gene locus_tag LOCUS_60790 717 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60790 >Feature sequence3008 <1376 249 gene locus_tag LOCUS_60800 <1376 249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057338.1:AAA-like domain-containing protein >Feature sequence3009 272 12 gene locus_tag LOCUS_60810 272 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60810 657 301 gene locus_tag LOCUS_60820 657 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60820 <1376 758 gene locus_tag LOCUS_60830 <1376 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057101.1:ABC transporter permease subunit >Feature sequence3010 <1 735 gene locus_tag LOCUS_60840 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057799.1:phycobilisome rod-core linker polypeptide >Feature sequence3011 <1 1079 gene locus_tag LOCUS_60850 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089836.1:ABC transporter substrate-binding protein >Feature sequence3012 90 614 gene locus_tag LOCUS_60860 gene fabZ 90 614 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_60860 >Feature sequence3013 <1 822 gene locus_tag LOCUS_60870 <1 822 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142400.1:DNA replication/repair protein RecF 952 1347 gene locus_tag LOCUS_60880 gene psb27 952 1347 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_60880 >Feature sequence3014 38 181 gene locus_tag LOCUS_60890 38 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60890 727 356 gene locus_tag LOCUS_60900 727 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60900 >Feature sequence3015 <1 790 gene locus_tag LOCUS_60910 <1 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921141.1:chlorophyll a/b binding light-harvesting protein 837 1025 gene locus_tag LOCUS_60920 837 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60920 >Feature sequence3016 673 290 gene locus_tag LOCUS_60930 gene rpsM 673 290 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055958.1 protein_id gnl|my_center|LOCUS_60930 1203 979 gene locus_tag LOCUS_60940 gene infA 1203 979 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055956.1 protein_id gnl|my_center|LOCUS_60940 >Feature sequence3017 >Feature sequence3018 1193 156 gene locus_tag LOCUS_60950 1193 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60950 >Feature sequence3019 <1 758 gene locus_tag LOCUS_60960 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920882.1:MBL fold metallo-hydrolase >Feature sequence3020 411 860 gene locus_tag LOCUS_60970 411 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60970 >Feature sequence3021 1206 703 gene locus_tag LOCUS_60980 1206 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_60980 >Feature sequence3022 344 1354 gene locus_tag LOCUS_60990 344 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_60990 >Feature sequence3023 1335 142 gene locus_tag LOCUS_61000 gene cotSA 1335 142 CDS product spore coat protein CotSA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229028.1 protein_id gnl|my_center|LOCUS_61000 >Feature sequence3024 >Feature sequence3025 445 1227 gene locus_tag LOCUS_61010 445 1227 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056764.1 protein_id gnl|my_center|LOCUS_61010 >Feature sequence3026 1014 1193 gene locus_tag LOCUS_61020 1014 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61020 >Feature sequence3027 675 1184 gene locus_tag LOCUS_61030 675 1184 CDS product peptidase S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384184.1 protein_id gnl|my_center|LOCUS_61030 >Feature sequence3028 1284 976 gene locus_tag LOCUS_61040 1284 976 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056708.1 protein_id gnl|my_center|LOCUS_61040 >Feature sequence3029 566 1096 gene locus_tag LOCUS_61050 566 1096 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524131.1 protein_id gnl|my_center|LOCUS_61050 >Feature sequence3030 801 1310 gene locus_tag LOCUS_61060 gene mreD 801 1310 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056784.1 protein_id gnl|my_center|LOCUS_61060 >Feature sequence3031 541 302 gene locus_tag LOCUS_61070 541 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61070 1156 620 gene locus_tag LOCUS_61080 1156 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61080 >Feature sequence3032 1170 742 gene locus_tag LOCUS_61090 1170 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61090 >Feature sequence3033 995 144 gene locus_tag LOCUS_61100 995 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61100 >Feature sequence3034 567 355 gene locus_tag LOCUS_61110 567 355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61110 1303 680 gene locus_tag LOCUS_61120 gene nusB 1303 680 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141336.1 protein_id gnl|my_center|LOCUS_61120 >Feature sequence3035 789 409 gene locus_tag LOCUS_61130 789 409 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056047.1 protein_id gnl|my_center|LOCUS_61130 1035 1322 gene locus_tag LOCUS_61140 gene purS 1035 1322 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_61140 >Feature sequence3036 <1 716 gene locus_tag LOCUS_61150 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257882.1:S41 family peptidase 849 1118 gene locus_tag LOCUS_61160 849 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61160 >Feature sequence3037 >Feature sequence3038 87 362 gene locus_tag LOCUS_61170 87 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_61170 465 941 gene locus_tag LOCUS_61180 465 941 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057304.1 protein_id gnl|my_center|LOCUS_61180 >Feature sequence3039 1148 663 gene locus_tag LOCUS_61190 1148 663 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086103.1 protein_id gnl|my_center|LOCUS_61190 >Feature sequence3040 113 571 gene locus_tag LOCUS_61200 113 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61200 >Feature sequence3041 178 555 gene locus_tag LOCUS_61210 178 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61210 564 1172 gene locus_tag LOCUS_61220 564 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61220 >Feature sequence3042 3 569 gene locus_tag LOCUS_61230 3 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61230 >Feature sequence3043 134 877 gene locus_tag LOCUS_61240 134 877 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056184.1 protein_id gnl|my_center|LOCUS_61240 >Feature sequence3044 338 535 gene locus_tag LOCUS_61250 338 535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61250 513 689 gene locus_tag LOCUS_61260 513 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61260 >Feature sequence3045 228 1076 gene locus_tag LOCUS_61270 228 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61270 >Feature sequence3046 543 1097 gene locus_tag LOCUS_61280 543 1097 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056727.1 protein_id gnl|my_center|LOCUS_61280 >Feature sequence3047 605 243 gene locus_tag LOCUS_61290 gene rplR 605 243 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_61290 1145 606 gene locus_tag LOCUS_61300 gene rplF 1145 606 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_61300 >Feature sequence3048 585 328 gene locus_tag LOCUS_61310 585 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057356.1 protein_id gnl|my_center|LOCUS_61310 >Feature sequence3049 1066 368 gene locus_tag LOCUS_61320 1066 368 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799326.1 protein_id gnl|my_center|LOCUS_61320 >Feature sequence3050 140 1210 gene locus_tag LOCUS_61330 140 1210 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_61330 >Feature sequence3051 866 288 gene locus_tag LOCUS_61340 866 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61340 >Feature sequence3052 <1 833 gene locus_tag LOCUS_61350 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947426.1:bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG >Feature sequence3053 510 289 gene locus_tag LOCUS_61360 510 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61360 751 909 gene locus_tag LOCUS_61370 751 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61370 987 1223 gene locus_tag LOCUS_61380 987 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61380 >Feature sequence3054 424 759 gene locus_tag LOCUS_61390 424 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61390 1039 827 gene locus_tag LOCUS_61400 1039 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61400 >Feature sequence3055 670 254 gene locus_tag LOCUS_61410 670 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61410 >Feature sequence3056 1180 539 gene locus_tag LOCUS_61420 1180 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61420 >Feature sequence3057 <1 1317 gene locus_tag LOCUS_61430 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence3058 372 698 gene locus_tag LOCUS_61440 372 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61440 857 985 gene locus_tag LOCUS_61450 857 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61450 >Feature sequence3059 451 1080 gene locus_tag LOCUS_61460 451 1080 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521551.1 protein_id gnl|my_center|LOCUS_61460 >Feature sequence3060 1343 6 gene locus_tag LOCUS_61470 1343 6 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058262.1 protein_id gnl|my_center|LOCUS_61470 >Feature sequence3061 >Feature sequence3062 1130 33 gene locus_tag LOCUS_61480 gene aroF 1130 33 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056213.1 protein_id gnl|my_center|LOCUS_61480 >Feature sequence3063 <1 725 gene locus_tag LOCUS_61490 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056634.1:molecular chaperone DnaK >Feature sequence3064 <1349 634 gene locus_tag LOCUS_61500 <1349 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_093950382.1:hybrid non-ribosomal peptide synthetase/type I polyketide synthase >Feature sequence3065 714 448 gene locus_tag LOCUS_61510 714 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61510 >Feature sequence3066 92 484 gene locus_tag LOCUS_61520 92 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61520 654 1331 gene locus_tag LOCUS_61530 654 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61530 >Feature sequence3067 <1 1032 gene locus_tag LOCUS_61540 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057768.1:glycosyltransferase family 2 protein >Feature sequence3068 <1348 753 gene locus_tag LOCUS_61550 <1348 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081007.1:calcium/sodium antiporter >Feature sequence3069 <1348 178 gene locus_tag LOCUS_61560 <1348 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000024453.1:glycosyltransferase >Feature sequence3070 <1346 507 gene locus_tag LOCUS_61570 <1346 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058172.1:DUF655 domain-containing protein >Feature sequence3071 3 212 gene locus_tag LOCUS_61580 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61580 591 223 gene locus_tag LOCUS_61590 591 223 CDS product DUF1622 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005160110.1 protein_id gnl|my_center|LOCUS_61590 1332 697 gene locus_tag LOCUS_61600 1332 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61600 >Feature sequence3072 316 846 gene locus_tag LOCUS_61610 316 846 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057228.1 protein_id gnl|my_center|LOCUS_61610 1155 967 gene locus_tag LOCUS_61620 1155 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61620 >Feature sequence3073 1011 193 gene locus_tag LOCUS_61630 1011 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61630 >Feature sequence3074 >Feature sequence3075 324 1 gene locus_tag LOCUS_61640 324 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61640 >Feature sequence3076 1342 197 gene locus_tag LOCUS_61650 1342 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61650 >Feature sequence3077 335 51 gene locus_tag LOCUS_61660 335 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61660 <1339 585 gene locus_tag LOCUS_61670 <1339 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055905.1:tyrosine--tRNA ligase >Feature sequence3078 161 754 gene locus_tag LOCUS_61680 161 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61680 >Feature sequence3079 >Feature sequence3080 1142 120 gene locus_tag LOCUS_61690 1142 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61690 >Feature sequence3081 327 662 gene locus_tag LOCUS_61700 327 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61700 693 977 gene locus_tag LOCUS_61710 693 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61710 >Feature sequence3082 55 309 gene locus_tag LOCUS_61720 55 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61720 >Feature sequence3083 <1 1018 gene locus_tag LOCUS_61730 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056541.1:Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha >Feature sequence3084 294 37 gene locus_tag LOCUS_61740 294 37 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546699.1 protein_id gnl|my_center|LOCUS_61740 535 374 gene locus_tag LOCUS_61750 535 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61750 <1337 627 gene locus_tag LOCUS_61760 <1337 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022778.1:tetratricopeptide repeat protein >Feature sequence3085 <1336 158 gene locus_tag LOCUS_61770 <1336 158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143556.1:tetratricopeptide repeat protein >Feature sequence3086 <1335 545 gene locus_tag LOCUS_61780 <1335 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057329.1:RNA-guided endonuclease TnpB family protein >Feature sequence3087 22 804 gene locus_tag LOCUS_61790 22 804 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 protein_id gnl|my_center|LOCUS_61790 >Feature sequence3088 >Feature sequence3089 <1 618 gene locus_tag LOCUS_61800 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141364.1:DEAD/DEAH box helicase family protein >Feature sequence3090 >Feature sequence3091 836 540 gene locus_tag LOCUS_61810 836 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61810 >Feature sequence3092 545 1228 gene locus_tag LOCUS_61820 545 1228 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921101.1 protein_id gnl|my_center|LOCUS_61820 >Feature sequence3093 <1 848 gene locus_tag LOCUS_61830 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920940.1:cobyrinate a,c-diamide synthase 879 1115 gene locus_tag LOCUS_61840 879 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_61840 >Feature sequence3094 630 1229 gene locus_tag LOCUS_61850 630 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61850 >Feature sequence3095 >Feature sequence3096 <1331 546 gene locus_tag LOCUS_61860 <1331 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence3097 509 231 gene locus_tag LOCUS_61870 509 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61870 <1330 639 gene locus_tag LOCUS_61880 <1330 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence3098 >Feature sequence3099 >Feature sequence3100 >Feature sequence3101 <1 1252 gene locus_tag LOCUS_61890 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532721.1:ABC transporter ATP-binding protein >Feature sequence3102 <1 804 gene locus_tag LOCUS_61900 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056277.1:porphobilinogen synthase >Feature sequence3103 <1 1109 gene locus_tag LOCUS_61910 <1 1109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase >Feature sequence3104 656 189 gene locus_tag LOCUS_61920 656 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61920 >Feature sequence3105 563 165 gene locus_tag LOCUS_61930 563 165 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_61930 808 560 gene locus_tag LOCUS_61940 808 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61940 >Feature sequence3106 747 1088 gene locus_tag LOCUS_61950 747 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61950 >Feature sequence3107 567 28 gene locus_tag LOCUS_61960 567 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61960 <1328 656 gene locus_tag LOCUS_61970 <1328 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141175.1:NB-ARC domain-containing protein >Feature sequence3108 <1 567 gene locus_tag LOCUS_61980 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057253.1:magnesium chelatase ATPase subunit D >Feature sequence3109 1326 196 gene locus_tag LOCUS_61990 1326 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_61990 >Feature sequence3110 528 719 gene locus_tag LOCUS_62000 528 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62000 746 1234 gene locus_tag LOCUS_62010 746 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62010 >Feature sequence3111 223 498 gene locus_tag LOCUS_62020 223 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62020 495 911 gene locus_tag LOCUS_62030 495 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62030 >Feature sequence3112 <1 1014 gene locus_tag LOCUS_62040 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence3113 45 725 gene locus_tag LOCUS_62050 45 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62050 >Feature sequence3114 891 46 gene locus_tag LOCUS_62060 gene dapF 891 46 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058127.1 protein_id gnl|my_center|LOCUS_62060 976 1188 gene locus_tag LOCUS_62070 976 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058128.1 protein_id gnl|my_center|LOCUS_62070 >Feature sequence3115 944 6 gene locus_tag LOCUS_62080 944 6 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221267088.1 protein_id gnl|my_center|LOCUS_62080 >Feature sequence3116 >Feature sequence3117 470 691 gene locus_tag LOCUS_62090 470 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62090 >Feature sequence3118 1044 586 gene locus_tag LOCUS_62100 1044 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62100 >Feature sequence3119 602 1279 gene locus_tag LOCUS_62110 602 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057488.1 protein_id gnl|my_center|LOCUS_62110 >Feature sequence3120 483 199 gene locus_tag LOCUS_62120 483 199 CDS product DUF427 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141965.1 protein_id gnl|my_center|LOCUS_62120 <1323 545 gene locus_tag LOCUS_62130 <1323 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037386813.1:Ig-like domain-containing protein >Feature sequence3121 <1 761 gene locus_tag LOCUS_62140 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920928.1:polyprenyl diphosphate synthase 1115 843 gene locus_tag LOCUS_62150 1115 843 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_62150 >Feature sequence3122 1137 226 gene locus_tag LOCUS_62160 1137 226 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055875.1 protein_id gnl|my_center|LOCUS_62160 >Feature sequence3123 >Feature sequence3124 >Feature sequence3125 >Feature sequence3126 <1321 208 gene locus_tag LOCUS_62170 <1321 208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001292843.1:class I SAM-dependent methyltransferase >Feature sequence3127 >Feature sequence3128 1230 88 gene locus_tag LOCUS_62180 1230 88 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_62180 >Feature sequence3129 550 356 gene locus_tag LOCUS_62190 550 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62190 822 628 gene locus_tag LOCUS_62200 822 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62200 1083 889 gene locus_tag LOCUS_62210 1083 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62210 >Feature sequence3130 <1320 41 gene locus_tag LOCUS_62220 <1320 41 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057517.1:Ppx/GppA phosphatase family protein >Feature sequence3131 3 926 gene locus_tag LOCUS_62230 3 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62230 >Feature sequence3132 <1319 209 gene locus_tag LOCUS_62240 <1319 209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941639.1:ATP-binding protein >Feature sequence3133 556 254 gene locus_tag LOCUS_62250 556 254 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943940.1 protein_id gnl|my_center|LOCUS_62250 996 592 gene locus_tag LOCUS_62260 996 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62260 >Feature sequence3134 <1 1215 gene locus_tag LOCUS_62270 <1 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141470.1:S9 family peptidase >Feature sequence3135 234 437 gene locus_tag LOCUS_62280 234 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62280 473 640 gene locus_tag LOCUS_62290 473 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62290 >Feature sequence3136 198 806 gene locus_tag LOCUS_62300 198 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62300 >Feature sequence3137 >Feature sequence3138 >Feature sequence3139 768 157 gene locus_tag LOCUS_62310 768 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62310 >Feature sequence3140 <1 1283 gene locus_tag LOCUS_62320 <1 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056694.1:citramalate synthase >Feature sequence3141 339 127 gene locus_tag LOCUS_62330 339 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62330 1314 604 gene locus_tag LOCUS_62340 gene cobS 1314 604 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057177.1 protein_id gnl|my_center|LOCUS_62340 >Feature sequence3142 <1313 196 gene locus_tag LOCUS_62350 <1313 196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272333.1:peptidoglycan-binding protein >Feature sequence3143 131 610 gene locus_tag LOCUS_62360 131 610 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141212.1 protein_id gnl|my_center|LOCUS_62360 >Feature sequence3144 <1312 754 gene locus_tag LOCUS_62370 <1312 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050752960.1:non-ribosomal peptide synthetase >Feature sequence3145 <1 966 gene locus_tag LOCUS_62380 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797673.1:penicillin-binding protein 1A >Feature sequence3146 1117 143 gene locus_tag LOCUS_62390 gene rlmN 1117 143 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_62390 >Feature sequence3147 625 1023 gene locus_tag LOCUS_62400 625 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62400 >Feature sequence3148 <1 711 gene locus_tag LOCUS_62410 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence3149 <1309 678 gene locus_tag LOCUS_62420 <1309 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877333.1:phosphate ABC transporter substrate-binding protein >Feature sequence3150 541 32 gene locus_tag LOCUS_62430 541 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62430 <1309 752 gene locus_tag LOCUS_62440 <1309 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057137.1:glycoside hydrolase family 10 protein >Feature sequence3151 1153 95 gene locus_tag LOCUS_62450 1153 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62450 >Feature sequence3152 >Feature sequence3153 638 297 gene locus_tag LOCUS_62460 638 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62460 >Feature sequence3154 <1308 13 gene locus_tag LOCUS_62470 <1308 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058264.1:serine/threonine-protein kinase >Feature sequence3155 >Feature sequence3156 1025 219 gene locus_tag LOCUS_62480 1025 219 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_62480 >Feature sequence3157 >Feature sequence3158 591 226 gene locus_tag LOCUS_62490 591 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62490 <1307 719 gene locus_tag LOCUS_62500 <1307 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122357.1:phytanoyl-CoA dioxygenase family protein >Feature sequence3159 >Feature sequence3160 1 1119 gene locus_tag LOCUS_62510 1 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62510 >Feature sequence3161 1241 666 gene locus_tag LOCUS_62520 1241 666 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142465.1 protein_id gnl|my_center|LOCUS_62520 >Feature sequence3162 <1 686 gene locus_tag LOCUS_62530 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056852.1:glycosyltransferase 1047 1292 gene locus_tag LOCUS_62540 1047 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62540 >Feature sequence3163 1231 377 gene locus_tag LOCUS_62550 1231 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_62550 >Feature sequence3164 1149 922 gene locus_tag LOCUS_62560 1149 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62560 >Feature sequence3165 344 538 gene locus_tag LOCUS_62570 344 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62570 610 804 gene locus_tag LOCUS_62580 610 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62580 843 1037 gene locus_tag LOCUS_62590 843 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62590 >Feature sequence3166 1193 1121 gene locus_tag LOCUS_t00620 1193 1121 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence3167 733 464 gene locus_tag LOCUS_62600 733 464 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057448.1 protein_id gnl|my_center|LOCUS_62600 >Feature sequence3168 <1303 291 gene locus_tag LOCUS_62610 <1303 291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920143.1:glucan 1,4-alpha-glucosidase >Feature sequence3169 982 677 gene locus_tag LOCUS_62620 982 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_62620 >Feature sequence3170 1008 322 gene locus_tag LOCUS_62630 1008 322 CDS product lecithin retinol acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206573.1 protein_id gnl|my_center|LOCUS_62630 >Feature sequence3171 <1 618 gene locus_tag LOCUS_62640 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124260.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence3172 <1301 448 gene locus_tag LOCUS_62650 <1301 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836919.1:type I secretion system permease/ATPase >Feature sequence3173 266 811 gene locus_tag LOCUS_62660 266 811 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920655.1 protein_id gnl|my_center|LOCUS_62660 >Feature sequence3174 867 1271 gene locus_tag LOCUS_62670 867 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62670 >Feature sequence3175 <1 1258 gene locus_tag LOCUS_62680 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058157.1:iron uptake porin >Feature sequence3176 <1 553 gene locus_tag LOCUS_62690 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071891.1:Vat family streptogramin A O-acetyltransferase >Feature sequence3177 904 98 gene locus_tag LOCUS_62700 904 98 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230571.1 protein_id gnl|my_center|LOCUS_62700 >Feature sequence3178 <1298 331 gene locus_tag LOCUS_62710 <1298 331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056025.1:SagB/ThcOx family dehydrogenase >Feature sequence3179 388 609 gene locus_tag LOCUS_62720 388 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62720 647 955 gene locus_tag LOCUS_62730 647 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62730 960 1079 gene locus_tag LOCUS_62740 960 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62740 >Feature sequence3180 1206 526 gene locus_tag LOCUS_62750 1206 526 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_62750 >Feature sequence3181 <1 659 gene locus_tag LOCUS_62760 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013844854.1:tetratricopeptide repeat protein >Feature sequence3182 <1 602 gene locus_tag LOCUS_62770 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941856.1:thermonuclease family protein >Feature sequence3183 >Feature sequence3184 577 1008 gene locus_tag LOCUS_62780 577 1008 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208630611.1 protein_id gnl|my_center|LOCUS_62780 1022 1141 gene locus_tag LOCUS_62790 1022 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62790 >Feature sequence3185 >Feature sequence3186 831 433 gene locus_tag LOCUS_62800 831 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62800 1006 1152 gene locus_tag LOCUS_62810 1006 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62810 >Feature sequence3187 527 985 gene locus_tag LOCUS_62820 527 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62820 >Feature sequence3188 <1 1085 gene locus_tag LOCUS_62830 <1 1085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058269.1:phospholipid carrier-dependent glycosyltransferase >Feature sequence3189 >Feature sequence3190 439 1017 gene locus_tag LOCUS_62840 439 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62840 >Feature sequence3191 495 40 gene locus_tag LOCUS_62850 495 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62850 >Feature sequence3192 529 1029 gene locus_tag LOCUS_62860 529 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62860 >Feature sequence3193 692 123 gene locus_tag LOCUS_62870 692 123 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140580.1 protein_id gnl|my_center|LOCUS_62870 <1294 714 gene locus_tag LOCUS_62880 <1294 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057646.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence3194 546 1091 gene locus_tag LOCUS_62890 546 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62890 >Feature sequence3195 <1293 36 gene locus_tag LOCUS_62900 <1293 36 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272333.1:peptidoglycan-binding protein >Feature sequence3196 1 600 gene locus_tag LOCUS_62910 gene ycaC 1 600 CDS product isochorismate family cysteine hydrolase YcaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771485.1 protein_id gnl|my_center|LOCUS_62910 808 1293 gene locus_tag LOCUS_62920 808 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62920 >Feature sequence3197 <1293 540 gene locus_tag LOCUS_62930 <1293 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125444.1:glycosyltransferase family 39 protein >Feature sequence3198 73 636 gene locus_tag LOCUS_62940 73 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62940 552 893 gene locus_tag LOCUS_62950 552 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62950 909 1193 gene locus_tag LOCUS_62960 909 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62960 >Feature sequence3199 >Feature sequence3200 767 1060 gene locus_tag LOCUS_62970 767 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62970 >Feature sequence3201 932 735 gene locus_tag LOCUS_62980 932 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_62980 >Feature sequence3202 864 1 gene locus_tag LOCUS_62990 864 1 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038292.1 protein_id gnl|my_center|LOCUS_62990 >Feature sequence3203 891 1151 gene locus_tag LOCUS_63000 891 1151 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058088.1 protein_id gnl|my_center|LOCUS_63000 >Feature sequence3204 <1290 567 gene locus_tag LOCUS_63010 <1290 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920905.1:YaaW family protein >Feature sequence3205 <1 567 gene locus_tag LOCUS_63020 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058292.1:LON peptidase substrate-binding domain-containing protein <1290 736 gene locus_tag LOCUS_63030 <1290 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056423.1:protochlorophyllide reductase >Feature sequence3206 946 227 gene locus_tag LOCUS_63040 946 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056873.1 protein_id gnl|my_center|LOCUS_63040 >Feature sequence3207 168 1016 gene locus_tag LOCUS_63050 168 1016 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_63050 >Feature sequence3208 1164 655 gene locus_tag LOCUS_63060 1164 655 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_63060 >Feature sequence3209 235 858 gene locus_tag LOCUS_63070 235 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63070 >Feature sequence3210 1272 787 gene locus_tag LOCUS_63080 1272 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63080 >Feature sequence3211 826 56 gene locus_tag LOCUS_63090 826 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63090 >Feature sequence3212 241 717 gene locus_tag LOCUS_63100 241 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63100 >Feature sequence3213 341 523 gene locus_tag LOCUS_63110 341 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63110 547 693 gene locus_tag LOCUS_63120 547 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63120 >Feature sequence3214 >Feature sequence3215 286 8 gene locus_tag LOCUS_63130 286 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63130 >Feature sequence3216 426 58 gene locus_tag LOCUS_63140 426 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63140 <1284 769 gene locus_tag LOCUS_63150 <1284 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056342.1:iron-sulfur cluster biosynthesis transcriptional regulator SufR >Feature sequence3217 495 256 gene locus_tag LOCUS_63160 495 256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63160 >Feature sequence3218 2 529 gene locus_tag LOCUS_63170 2 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63170 >Feature sequence3219 965 468 gene locus_tag LOCUS_63180 gene ispF 965 468 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168569903.1 protein_id gnl|my_center|LOCUS_63180 >Feature sequence3220 <1 1131 gene locus_tag LOCUS_63190 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125976.1:glycosyltransferase family 1 protein >Feature sequence3221 >Feature sequence3222 <1280 652 gene locus_tag LOCUS_63200 <1280 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058239.1:MlaD family protein >Feature sequence3223 >Feature sequence3224 200 775 gene locus_tag LOCUS_63210 200 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63210 <1280 716 gene locus_tag LOCUS_63220 <1280 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056120.1:cob(I)yrinic acid a,c-diamide adenosyltransferase >Feature sequence3225 1131 700 gene locus_tag LOCUS_63230 1131 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63230 >Feature sequence3226 320 874 gene locus_tag LOCUS_63240 320 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63240 >Feature sequence3227 976 284 gene locus_tag LOCUS_63250 976 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63250 >Feature sequence3228 <1 749 gene locus_tag LOCUS_63260 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012805028.1:alpha/beta fold hydrolase >Feature sequence3229 493 921 gene locus_tag LOCUS_63270 493 921 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_63270 >Feature sequence3230 1166 111 gene locus_tag LOCUS_63280 1166 111 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143741.1 protein_id gnl|my_center|LOCUS_63280 >Feature sequence3231 >Feature sequence3232 721 155 gene locus_tag LOCUS_63290 721 155 CDS product DUF1802 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009935899.1 protein_id gnl|my_center|LOCUS_63290 >Feature sequence3233 >Feature sequence3234 609 418 gene locus_tag LOCUS_63300 609 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63300 >Feature sequence3235 <1 928 gene locus_tag LOCUS_63310 <1 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028892.1:RtcB family protein >Feature sequence3236 58 735 gene locus_tag LOCUS_63320 58 735 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056891.1 protein_id gnl|my_center|LOCUS_63320 803 1207 gene locus_tag LOCUS_63330 803 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_63330 >Feature sequence3237 1172 384 gene locus_tag LOCUS_63340 1172 384 CDS product ABC-2 family transporter protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143432.1 protein_id gnl|my_center|LOCUS_63340 >Feature sequence3238 379 693 gene locus_tag LOCUS_63350 379 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63350 >Feature sequence3239 443 661 gene locus_tag LOCUS_63360 443 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63360 1151 843 gene locus_tag LOCUS_63370 1151 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63370 >Feature sequence3240 672 442 gene locus_tag LOCUS_63380 672 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63380 >Feature sequence3241 1106 228 gene locus_tag LOCUS_63390 1106 228 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141358.1 protein_id gnl|my_center|LOCUS_63390 >Feature sequence3242 414 166 gene locus_tag LOCUS_63400 414 166 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_63400 >Feature sequence3243 >Feature sequence3244 >Feature sequence3245 <1 591 gene locus_tag LOCUS_63410 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057901.1:alpha/beta hydrolase >Feature sequence3246 310 618 gene locus_tag LOCUS_63420 310 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63420 611 979 gene locus_tag LOCUS_63430 611 979 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_63430 >Feature sequence3247 357 148 gene locus_tag LOCUS_63440 357 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63440 505 744 gene locus_tag LOCUS_63450 505 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63450 >Feature sequence3248 1156 251 gene locus_tag LOCUS_63460 gene rimK 1156 251 CDS product 30S ribosomal protein S6--L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096254.1 protein_id gnl|my_center|LOCUS_63460 >Feature sequence3249 <1 842 gene locus_tag LOCUS_63470 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338725.1:calcium-binding protein >Feature sequence3250 >Feature sequence3251 3 590 gene locus_tag LOCUS_63480 3 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63480 872 732 gene locus_tag LOCUS_63490 872 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63490 >Feature sequence3252 <1271 230 gene locus_tag LOCUS_63500 <1271 230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124260.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence3253 <1270 79 gene locus_tag LOCUS_63510 <1270 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920846.1:FGGY-family carbohydrate kinase >Feature sequence3254 1061 582 gene locus_tag LOCUS_63520 1061 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63520 >Feature sequence3255 >Feature sequence3256 25 270 gene locus_tag LOCUS_63530 25 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63530 >Feature sequence3257 <1269 595 gene locus_tag LOCUS_63540 <1269 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143396.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase >Feature sequence3258 >Feature sequence3259 332 1036 gene locus_tag LOCUS_63550 332 1036 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_220818393.1 protein_id gnl|my_center|LOCUS_63550 >Feature sequence3260 364 534 gene locus_tag LOCUS_63560 364 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63560 >Feature sequence3261 396 896 gene locus_tag LOCUS_63570 396 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63570 >Feature sequence3262 >Feature sequence3263 43 1149 gene locus_tag LOCUS_63580 43 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63580 >Feature sequence3264 546 617 gene locus_tag LOCUS_t00630 546 617 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence3265 635 351 gene locus_tag LOCUS_63590 635 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63590 >Feature sequence3266 743 153 gene locus_tag LOCUS_63600 743 153 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530066.1 protein_id gnl|my_center|LOCUS_63600 >Feature sequence3267 508 855 gene locus_tag LOCUS_63610 508 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63610 >Feature sequence3268 1084 500 gene locus_tag LOCUS_63620 1084 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63620 >Feature sequence3269 <1 746 gene locus_tag LOCUS_63630 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920720.1:tRNA epoxyqueuosine(34) reductase QueG >Feature sequence3270 <1 1256 gene locus_tag LOCUS_63640 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144130.1:Tex family protein >Feature sequence3271 443 1261 gene locus_tag LOCUS_63650 443 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63650 >Feature sequence3272 <1 1144 gene locus_tag LOCUS_63660 <1 1144 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920939.1:phosphoribosylamine--glycine ligase >Feature sequence3273 <1 590 gene locus_tag LOCUS_63670 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125984.1:replicative DNA helicase >Feature sequence3274 >Feature sequence3275 >Feature sequence3276 <1262 537 gene locus_tag LOCUS_63680 <1262 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011731597.1:class II aldolase/adducin family protein >Feature sequence3277 483 301 gene locus_tag LOCUS_63690 483 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63690 >Feature sequence3278 721 972 gene locus_tag LOCUS_63700 721 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63700 >Feature sequence3279 50 1231 gene locus_tag LOCUS_63710 50 1231 CDS product DUF1822 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140225.1 protein_id gnl|my_center|LOCUS_63710 >Feature sequence3280 <1 688 gene locus_tag LOCUS_63720 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_028172344.1:metal-dependent phosphohydrolase >Feature sequence3281 >Feature sequence3282 <1 900 gene locus_tag LOCUS_63730 <1 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928708.1:DMT family transporter >Feature sequence3283 >Feature sequence3284 240 1079 gene locus_tag LOCUS_63740 240 1079 CDS product calcium-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529018.1 protein_id gnl|my_center|LOCUS_63740 >Feature sequence3285 1084 347 gene locus_tag LOCUS_63750 1084 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63750 >Feature sequence3286 271 639 gene locus_tag LOCUS_63760 271 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63760 >Feature sequence3287 592 104 gene locus_tag LOCUS_63770 592 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63770 >Feature sequence3288 58 405 gene locus_tag LOCUS_63780 58 405 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 protein_id gnl|my_center|LOCUS_63780 >Feature sequence3289 <1257 717 gene locus_tag LOCUS_63790 <1257 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878349.1:Na+/H+ antiporter >Feature sequence3290 >Feature sequence3291 <1 965 gene locus_tag LOCUS_63800 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057179.1:DNA polymerase I >Feature sequence3292 1045 176 gene locus_tag LOCUS_63810 1045 176 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057821.1 protein_id gnl|my_center|LOCUS_63810 >Feature sequence3293 >Feature sequence3294 506 288 gene locus_tag LOCUS_63820 506 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63820 838 620 gene locus_tag LOCUS_63830 838 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63830 >Feature sequence3295 856 1071 gene locus_tag LOCUS_63840 856 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63840 >Feature sequence3296 508 224 gene locus_tag LOCUS_63850 508 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63850 782 579 gene locus_tag LOCUS_63860 782 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63860 >Feature sequence3297 <1254 116 gene locus_tag LOCUS_63870 <1254 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140589.1:RNA-guided endonuclease TnpB family protein >Feature sequence3298 772 1203 gene locus_tag LOCUS_63880 gene dut 772 1203 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964734.1 protein_id gnl|my_center|LOCUS_63880 >Feature sequence3299 <1 502 gene locus_tag LOCUS_63890 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041233550.1:RNA-guided endonuclease TnpB family protein 873 499 gene locus_tag LOCUS_63900 873 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63900 >Feature sequence3300 122 412 gene locus_tag LOCUS_63910 122 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63910 409 822 gene locus_tag LOCUS_63920 409 822 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142424.1 protein_id gnl|my_center|LOCUS_63920 962 1201 gene locus_tag LOCUS_63930 962 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63930 >Feature sequence3301 <1 870 gene locus_tag LOCUS_63940 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056460.1:permease 919 1068 gene locus_tag LOCUS_63950 919 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63950 1035 1211 gene locus_tag LOCUS_63960 1035 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63960 >Feature sequence3302 610 413 gene locus_tag LOCUS_63970 610 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_63970 >Feature sequence3303 <1251 109 gene locus_tag LOCUS_63980 <1251 109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056673.1:mechanosensitive ion channel >Feature sequence3304 890 288 gene locus_tag LOCUS_63990 890 288 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142691.1 protein_id gnl|my_center|LOCUS_63990 >Feature sequence3305 199 975 gene locus_tag LOCUS_64000 gene fabI 199 975 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057530.1 protein_id gnl|my_center|LOCUS_64000 >Feature sequence3306 <1 1157 gene locus_tag LOCUS_64010 <1 1157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921274.1:DUF4347 domain-containing protein >Feature sequence3307 920 69 gene locus_tag LOCUS_64020 920 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64020 >Feature sequence3308 3 371 gene locus_tag LOCUS_64030 3 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64030 398 1204 gene locus_tag LOCUS_64040 398 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64040 >Feature sequence3309 >Feature sequence3310 >Feature sequence3311 683 1054 gene locus_tag LOCUS_64050 683 1054 CDS product DUF1823 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057769.1 protein_id gnl|my_center|LOCUS_64050 >Feature sequence3312 <1 519 gene locus_tag LOCUS_64060 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921199.1:AAA family ATPase 695 1048 gene locus_tag LOCUS_64070 695 1048 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124912.1 protein_id gnl|my_center|LOCUS_64070 >Feature sequence3313 >Feature sequence3314 218 565 gene locus_tag LOCUS_64080 218 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64080 562 735 gene locus_tag LOCUS_64090 562 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64090 820 1149 gene locus_tag LOCUS_64100 820 1149 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142926.1 protein_id gnl|my_center|LOCUS_64100 >Feature sequence3315 3 281 gene locus_tag LOCUS_64110 3 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64110 >Feature sequence3316 453 818 gene locus_tag LOCUS_64120 453 818 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009455671.1 protein_id gnl|my_center|LOCUS_64120 >Feature sequence3317 >Feature sequence3318 <1 620 gene locus_tag LOCUS_64130 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921232.1:bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR >Feature sequence3319 <1 793 gene locus_tag LOCUS_64140 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209000319.1:sodium/proline symporter >Feature sequence3320 <1 582 gene locus_tag LOCUS_64150 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140702.1:glycosyltransferase family 2 protein >Feature sequence3321 25 351 gene locus_tag LOCUS_64160 25 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64160 <1242 451 gene locus_tag LOCUS_64170 <1242 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein >Feature sequence3322 3 1046 gene locus_tag LOCUS_64180 3 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64180 >Feature sequence3323 19 678 gene locus_tag LOCUS_64190 19 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64190 693 902 gene locus_tag LOCUS_64200 693 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64200 >Feature sequence3324 >Feature sequence3325 >Feature sequence3326 <1 1014 gene locus_tag LOCUS_64210 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056566.1:photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit D1 >Feature sequence3327 1221 442 gene locus_tag LOCUS_64220 1221 442 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142774.1 protein_id gnl|my_center|LOCUS_64220 >Feature sequence3328 <1 989 gene locus_tag LOCUS_64230 <1 989 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase >Feature sequence3329 156 818 gene locus_tag LOCUS_64240 156 818 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_64240 >Feature sequence3330 >Feature sequence3331 1049 357 gene locus_tag LOCUS_64250 1049 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64250 >Feature sequence3332 141 530 gene locus_tag LOCUS_64260 141 530 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000816343.1 protein_id gnl|my_center|LOCUS_64260 >Feature sequence3333 >Feature sequence3334 974 72 gene locus_tag LOCUS_64270 974 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64270 >Feature sequence3335 <1239 416 gene locus_tag LOCUS_64280 <1239 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057130.1:DUF697 domain-containing protein >Feature sequence3336 514 143 gene locus_tag LOCUS_64290 514 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64290 >Feature sequence3337 >Feature sequence3338 >Feature sequence3339 <1 852 gene locus_tag LOCUS_64300 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994150.1:lectin >Feature sequence3340 1209 79 gene locus_tag LOCUS_64310 1209 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64310 >Feature sequence3341 <1237 318 gene locus_tag LOCUS_64320 <1237 318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142186.1:glycosyltransferase >Feature sequence3342 >Feature sequence3343 402 785 gene locus_tag LOCUS_64330 402 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64330 >Feature sequence3344 <1236 410 gene locus_tag LOCUS_64340 <1236 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057033.1:molecular chaperone HtpG >Feature sequence3345 701 1012 gene locus_tag LOCUS_64350 701 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64350 >Feature sequence3346 <1 596 gene locus_tag LOCUS_64360 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533206.1:TIGR04290 family methyltransferase 634 1158 gene locus_tag LOCUS_64370 634 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64370 >Feature sequence3347 593 1054 gene locus_tag LOCUS_64380 593 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64380 >Feature sequence3348 838 632 gene locus_tag LOCUS_64390 838 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64390 >Feature sequence3349 348 1157 gene locus_tag LOCUS_64400 348 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64400 >Feature sequence3350 <1235 177 gene locus_tag LOCUS_64410 <1235 177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_069639775.1:glycine betaine/L-proline ABC transporter ATP-binding protein >Feature sequence3351 >Feature sequence3352 <1 615 gene locus_tag LOCUS_64420 <1 615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011728886.1:biotin synthase BioB >Feature sequence3353 715 365 gene locus_tag LOCUS_64430 715 365 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214438544.1 protein_id gnl|my_center|LOCUS_64430 1232 1017 gene locus_tag LOCUS_64440 1232 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64440 >Feature sequence3354 490 843 gene locus_tag LOCUS_64450 490 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64450 >Feature sequence3355 121 321 gene locus_tag LOCUS_64460 121 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64460 1064 459 gene locus_tag LOCUS_64470 1064 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64470 >Feature sequence3356 >Feature sequence3357 861 220 gene locus_tag LOCUS_64480 861 220 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_64480 >Feature sequence3358 <1231 447 gene locus_tag LOCUS_64490 <1231 447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919623.1:tryptophan 7-halogenase >Feature sequence3359 886 698 gene locus_tag LOCUS_64500 886 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64500 >Feature sequence3360 <1 861 gene locus_tag LOCUS_64510 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143975.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence3361 >Feature sequence3362 588 79 gene locus_tag LOCUS_64520 588 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64520 <1229 585 gene locus_tag LOCUS_64530 <1229 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020316.1:IS200/IS605 family element RNA-guided endonuclease TnpB >Feature sequence3363 >Feature sequence3364 259 717 gene locus_tag LOCUS_64540 259 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64540 >Feature sequence3365 339 809 gene locus_tag LOCUS_64550 339 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64550 >Feature sequence3366 361 837 gene locus_tag LOCUS_64560 361 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64560 >Feature sequence3367 >Feature sequence3368 1104 559 gene locus_tag LOCUS_64570 1104 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64570 >Feature sequence3369 150 644 gene locus_tag LOCUS_64580 150 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64580 >Feature sequence3370 958 587 gene locus_tag LOCUS_64590 gene rplV 958 587 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055941.1 protein_id gnl|my_center|LOCUS_64590 >Feature sequence3371 <1227 85 gene locus_tag LOCUS_64600 <1227 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058092.1:TIGR03960 family B12-binding radical SAM protein >Feature sequence3372 880 1176 gene locus_tag LOCUS_64610 880 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64610 >Feature sequence3373 <1226 78 gene locus_tag LOCUS_64620 <1226 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143551.1:chemotaxis protein CheB >Feature sequence3374 >Feature sequence3375 <1 1202 gene locus_tag LOCUS_64630 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920933.1:cation:proton antiporter >Feature sequence3376 >Feature sequence3377 <1223 617 gene locus_tag LOCUS_64640 <1223 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258909.1:PAS domain-containing hybrid sensor histidine kinase/response regulator >Feature sequence3378 455 607 gene locus_tag LOCUS_64650 455 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64650 >Feature sequence3379 473 1063 gene locus_tag LOCUS_64660 473 1063 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144066.1 protein_id gnl|my_center|LOCUS_64660 >Feature sequence3380 130 699 gene locus_tag LOCUS_64670 130 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64670 696 1010 gene locus_tag LOCUS_64680 696 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64680 >Feature sequence3381 <1222 614 gene locus_tag LOCUS_64690 <1222 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055976.1:type IV pilus twitching motility protein PilT >Feature sequence3382 600 112 gene locus_tag LOCUS_64700 600 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64700 <1222 704 gene locus_tag LOCUS_64710 <1222 704 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258620.1:NHL repeat-containing protein >Feature sequence3383 >Feature sequence3384 <1219 310 gene locus_tag LOCUS_64720 <1219 310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157768866.1:glycosyltransferase >Feature sequence3385 168 386 gene locus_tag LOCUS_64730 168 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64730 386 616 gene locus_tag LOCUS_64740 386 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64740 >Feature sequence3386 <1219 662 gene locus_tag LOCUS_64750 <1219 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057982.1:acyl-CoA dehydrogenase family protein >Feature sequence3387 140 829 gene locus_tag LOCUS_64760 140 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141964.1 protein_id gnl|my_center|LOCUS_64760 >Feature sequence3388 857 393 gene locus_tag LOCUS_64770 857 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64770 >Feature sequence3389 <1 523 gene locus_tag LOCUS_64780 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920936.1:cysteine--tRNA ligase >Feature sequence3390 >Feature sequence3391 642 73 gene locus_tag LOCUS_64790 642 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64790 >Feature sequence3392 636 214 gene locus_tag LOCUS_64800 gene queF 636 214 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056073.1 protein_id gnl|my_center|LOCUS_64800 >Feature sequence3393 993 601 gene locus_tag LOCUS_64810 993 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64810 >Feature sequence3394 >Feature sequence3395 334 50 gene locus_tag LOCUS_64820 334 50 CDS product type II toxin-antitoxin system mRNA interferase toxin, RelE/StbE family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967243.1 protein_id gnl|my_center|LOCUS_64820 561 331 gene locus_tag LOCUS_64830 561 331 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143516.1 protein_id gnl|my_center|LOCUS_64830 1096 674 gene locus_tag LOCUS_64840 1096 674 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081160608.1 protein_id gnl|my_center|LOCUS_64840 >Feature sequence3396 507 91 gene locus_tag LOCUS_64850 507 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64850 947 1210 gene locus_tag LOCUS_64860 947 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64860 >Feature sequence3397 734 303 gene locus_tag LOCUS_64870 gene mreD 734 303 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144384.1 protein_id gnl|my_center|LOCUS_64870 >Feature sequence3398 3 470 gene locus_tag LOCUS_64880 3 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64880 845 1213 gene locus_tag LOCUS_64890 845 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64890 >Feature sequence3399 <1 925 gene locus_tag LOCUS_64900 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948299.1:extracellular solute-binding protein >Feature sequence3400 <1213 512 gene locus_tag LOCUS_64910 <1213 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099799709.1:radical SAM family heme chaperone HemW >Feature sequence3401 329 144 gene locus_tag LOCUS_64920 329 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64920 539 1135 gene locus_tag LOCUS_64930 539 1135 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_64930 >Feature sequence3402 <1211 8 gene locus_tag LOCUS_64940 <1211 8 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence3403 >Feature sequence3404 66 644 gene locus_tag LOCUS_64950 66 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64950 >Feature sequence3405 >Feature sequence3406 >Feature sequence3407 1023 475 gene locus_tag LOCUS_64960 1023 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64960 1209 1063 gene locus_tag LOCUS_64970 1209 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64970 >Feature sequence3408 349 609 gene locus_tag LOCUS_64980 349 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64980 >Feature sequence3409 473 144 gene locus_tag LOCUS_64990 473 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_64990 1067 588 gene locus_tag LOCUS_65000 1067 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65000 >Feature sequence3410 126 956 gene locus_tag LOCUS_65010 gene menH 126 956 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_65010 >Feature sequence3411 902 207 gene locus_tag LOCUS_65020 902 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65020 >Feature sequence3412 >Feature sequence3413 <1207 622 gene locus_tag LOCUS_65030 <1207 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530159.1:M15 family metallopeptidase >Feature sequence3414 635 354 gene locus_tag LOCUS_65040 635 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65040 >Feature sequence3415 875 618 gene locus_tag LOCUS_65050 gene grxC 875 618 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056751.1 protein_id gnl|my_center|LOCUS_65050 >Feature sequence3416 <1206 390 gene locus_tag LOCUS_65060 <1206 390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein note possible pseudo, internal stop codon >Feature sequence3417 881 252 gene locus_tag LOCUS_65070 881 252 CDS product Vat family streptogramin A O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078927652.1 protein_id gnl|my_center|LOCUS_65070 >Feature sequence3418 <1 1153 gene locus_tag LOCUS_65080 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056597.1:methionine--tRNA ligase >Feature sequence3419 <1 673 gene locus_tag LOCUS_65090 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057605.1:polysaccharide biosynthesis/export family protein >Feature sequence3420 <1 792 gene locus_tag LOCUS_65100 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963162.1:PAS domain S-box protein >Feature sequence3421 >Feature sequence3422 >Feature sequence3423 <1 512 gene locus_tag LOCUS_65110 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056888.1:alpha/beta fold hydrolase >Feature sequence3424 164 571 gene locus_tag LOCUS_65120 164 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65120 >Feature sequence3425 <1 569 gene locus_tag LOCUS_65130 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870391.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence3426 >Feature sequence3427 <1 757 gene locus_tag LOCUS_65140 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338725.1:calcium-binding protein >Feature sequence3428 2 931 gene locus_tag LOCUS_65150 2 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65150 >Feature sequence3429 945 733 gene locus_tag LOCUS_65160 945 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65160 >Feature sequence3430 336 875 gene locus_tag LOCUS_65170 336 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65170 >Feature sequence3431 >Feature sequence3432 <1198 490 gene locus_tag LOCUS_65180 <1198 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524103.1:ribose-phosphate pyrophosphokinase >Feature sequence3433 <1198 607 gene locus_tag LOCUS_65190 <1198 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142666.1:ABC transporter ATP-binding protein >Feature sequence3434 <1198 567 gene locus_tag LOCUS_65200 <1198 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536604.1:type I polyketide synthase note possible pseudo, frameshifted >Feature sequence3435 998 267 gene locus_tag LOCUS_65210 gene sfsA 998 267 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_65210 >Feature sequence3436 >Feature sequence3437 >Feature sequence3438 1086 481 gene locus_tag LOCUS_65220 1086 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65220 >Feature sequence3439 994 107 gene locus_tag LOCUS_65230 994 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65230 >Feature sequence3440 450 139 gene locus_tag LOCUS_65240 450 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65240 >Feature sequence3441 634 422 gene locus_tag LOCUS_65250 634 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65250 633 1154 gene locus_tag LOCUS_65260 633 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65260 >Feature sequence3442 83 646 gene locus_tag LOCUS_65270 83 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929368.1 protein_id gnl|my_center|LOCUS_65270 670 1050 gene locus_tag LOCUS_65280 670 1050 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_65280 >Feature sequence3443 >Feature sequence3444 <1195 378 gene locus_tag LOCUS_65290 <1195 378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224463.1:glycogen debranching protein GlgX >Feature sequence3445 <1195 100 gene locus_tag LOCUS_65300 <1195 100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence3446 >Feature sequence3447 181 981 gene locus_tag LOCUS_65310 181 981 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057729.1 protein_id gnl|my_center|LOCUS_65310 >Feature sequence3448 >Feature sequence3449 569 1096 gene locus_tag LOCUS_65320 569 1096 CDS product DUF2808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056648.1 protein_id gnl|my_center|LOCUS_65320 >Feature sequence3450 110 853 gene locus_tag LOCUS_65330 110 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65330 >Feature sequence3451 1032 37 gene locus_tag LOCUS_65340 1032 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65340 >Feature sequence3452 223 972 gene locus_tag LOCUS_65350 223 972 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_65350 >Feature sequence3453 687 565 gene locus_tag LOCUS_65360 687 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65360 930 715 gene locus_tag LOCUS_65370 930 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65370 1191 1030 gene locus_tag LOCUS_65380 1191 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65380 >Feature sequence3454 349 1044 gene locus_tag LOCUS_65390 349 1044 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056116.1 protein_id gnl|my_center|LOCUS_65390 >Feature sequence3455 <1 603 gene locus_tag LOCUS_65400 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003414900.1:phthiotriol/phenolphthiotriol dimycocerosates methyltransferase >Feature sequence3456 184 435 gene locus_tag LOCUS_65410 184 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65410 >Feature sequence3457 597 325 gene locus_tag LOCUS_65420 597 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65420 903 778 gene locus_tag LOCUS_65430 903 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65430 >Feature sequence3458 531 88 gene locus_tag LOCUS_65440 gene psbQ 531 88 CDS product photosystem II protein PsbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057892.1 protein_id gnl|my_center|LOCUS_65440 >Feature sequence3459 >Feature sequence3460 274 531 gene locus_tag LOCUS_65450 274 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65450 >Feature sequence3461 <1 910 gene locus_tag LOCUS_65460 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224412629.1:ribonuclease Z >Feature sequence3462 <1188 118 gene locus_tag LOCUS_65470 <1188 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023004217.1:VCBS domain-containing protein >Feature sequence3463 281 622 gene locus_tag LOCUS_65480 281 622 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024124133.1 protein_id gnl|my_center|LOCUS_65480 695 1099 gene locus_tag LOCUS_65490 695 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65490 >Feature sequence3464 243 1178 gene locus_tag LOCUS_65500 243 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65500 >Feature sequence3465 872 375 gene locus_tag LOCUS_65510 872 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65510 >Feature sequence3466 <1186 53 gene locus_tag LOCUS_65520 <1186 53 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058190.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence3467 <1186 198 gene locus_tag LOCUS_65530 <1186 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106290870.1:glycosyltransferase family 4 protein >Feature sequence3468 311 655 gene locus_tag LOCUS_65540 311 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65540 >Feature sequence3469 >Feature sequence3470 104 475 gene locus_tag LOCUS_65550 104 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65550 >Feature sequence3471 <1185 684 gene locus_tag LOCUS_65560 <1185 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056499.1:ribonuclease R >Feature sequence3472 <1 635 gene locus_tag LOCUS_65570 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141163.1:GMC family oxidoreductase >Feature sequence3473 >Feature sequence3474 1057 527 gene locus_tag LOCUS_65580 1057 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65580 >Feature sequence3475 217 540 gene locus_tag LOCUS_65590 217 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65590 829 611 gene locus_tag LOCUS_65600 829 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65600 1112 780 gene locus_tag LOCUS_65610 1112 780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65610 >Feature sequence3476 697 38 gene locus_tag LOCUS_65620 697 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_65620 >Feature sequence3477 <1182 408 gene locus_tag LOCUS_65630 <1182 408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767086.1:SpoIID/LytB domain-containing protein >Feature sequence3478 1157 435 gene locus_tag LOCUS_65640 1157 435 CDS product Mo-dependent nitrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920896.1 protein_id gnl|my_center|LOCUS_65640 >Feature sequence3479 951 64 gene locus_tag LOCUS_65650 951 64 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256667.1 protein_id gnl|my_center|LOCUS_65650 >Feature sequence3480 406 197 gene locus_tag LOCUS_65660 406 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65660 622 449 gene locus_tag LOCUS_65670 622 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65670 901 734 gene locus_tag LOCUS_65680 901 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65680 >Feature sequence3481 179 898 gene locus_tag LOCUS_65690 179 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65690 >Feature sequence3482 1143 211 gene locus_tag LOCUS_65700 1143 211 CDS product DUF4351 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142039.1 protein_id gnl|my_center|LOCUS_65700 >Feature sequence3483 216 536 gene locus_tag LOCUS_65710 216 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65710 >Feature sequence3484 1178 147 gene locus_tag LOCUS_65720 gene fabF 1178 147 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057708.1 protein_id gnl|my_center|LOCUS_65720 >Feature sequence3485 >Feature sequence3486 15 281 gene locus_tag LOCUS_65730 15 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65730 330 530 gene locus_tag LOCUS_65740 330 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65740 535 663 gene locus_tag LOCUS_65750 535 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65750 825 1052 gene locus_tag LOCUS_65760 825 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65760 >Feature sequence3487 1039 611 gene locus_tag LOCUS_65770 1039 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65770 >Feature sequence3488 <1 620 gene locus_tag LOCUS_65780 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000185757.1:HIRAN domain-containing protein >Feature sequence3489 >Feature sequence3490 79 915 gene locus_tag LOCUS_65790 79 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65790 >Feature sequence3491 518 102 gene locus_tag LOCUS_65800 518 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65800 <1178 643 gene locus_tag LOCUS_65810 <1178 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000723092.1:dTDP-glucose 4,6-dehydratase >Feature sequence3492 >Feature sequence3493 >Feature sequence3494 1108 5 gene locus_tag LOCUS_65820 1108 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65820 >Feature sequence3495 <1 744 gene locus_tag LOCUS_65830 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545943.1:CHAT domain-containing protein >Feature sequence3496 599 880 gene locus_tag LOCUS_65840 599 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65840 >Feature sequence3497 234 1112 gene locus_tag LOCUS_65850 234 1112 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_65850 >Feature sequence3498 <1177 576 gene locus_tag LOCUS_65860 <1177 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035684.1:lamin tail domain-containing protein >Feature sequence3499 305 1021 gene locus_tag LOCUS_65870 305 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65870 >Feature sequence3500 >Feature sequence3501 424 786 gene locus_tag LOCUS_65880 424 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_65880 764 982 gene locus_tag LOCUS_65890 764 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65890 >Feature sequence3502 >Feature sequence3503 988 440 gene locus_tag LOCUS_65900 gene rfbC 988 440 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_65900 >Feature sequence3504 1016 285 gene locus_tag LOCUS_65910 1016 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65910 >Feature sequence3505 <1175 301 gene locus_tag LOCUS_65920 <1175 301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013384638.1:ABC transporter substrate-binding protein >Feature sequence3506 228 1070 gene locus_tag LOCUS_65930 228 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_65930 >Feature sequence3507 <1 650 gene locus_tag LOCUS_65940 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057464.1:FAD-linked oxidase C-terminal domain-containing protein >Feature sequence3508 634 233 gene locus_tag LOCUS_65950 634 233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65950 >Feature sequence3509 1017 319 gene locus_tag LOCUS_65960 gene bioD 1017 319 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406219.1 protein_id gnl|my_center|LOCUS_65960 >Feature sequence3510 >Feature sequence3511 133 609 gene locus_tag LOCUS_65970 133 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65970 >Feature sequence3512 706 419 gene locus_tag LOCUS_65980 gene rpmA 706 419 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140826.1 protein_id gnl|my_center|LOCUS_65980 >Feature sequence3513 449 189 gene locus_tag LOCUS_65990 449 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_65990 947 705 gene locus_tag LOCUS_66000 947 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66000 >Feature sequence3514 353 51 gene locus_tag LOCUS_66010 gene rpsN 353 51 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057663.1 protein_id gnl|my_center|LOCUS_66010 >Feature sequence3515 >Feature sequence3516 607 870 gene locus_tag LOCUS_66020 607 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66020 >Feature sequence3517 <1170 268 gene locus_tag LOCUS_66030 <1170 268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530482.1:histidinol dehydrogenase >Feature sequence3518 466 726 gene locus_tag LOCUS_66040 466 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66040 719 1060 gene locus_tag LOCUS_66050 719 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66050 >Feature sequence3519 >Feature sequence3520 805 581 gene locus_tag LOCUS_66060 805 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66060 >Feature sequence3521 420 602 gene locus_tag LOCUS_66070 420 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66070 >Feature sequence3522 961 506 gene locus_tag LOCUS_66080 961 506 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141099.1 protein_id gnl|my_center|LOCUS_66080 >Feature sequence3523 <1 537 gene locus_tag LOCUS_66090 <1 537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056585.1:RNA polymerase sigma factor SigF >Feature sequence3524 <1 831 gene locus_tag LOCUS_66100 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056225.1:UDP-N-acetylmuramate dehydrogenase >Feature sequence3525 >Feature sequence3526 406 50 gene locus_tag LOCUS_66110 406 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66110 1091 621 gene locus_tag LOCUS_66120 1091 621 CDS product DUF3574 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012437623.1 protein_id gnl|my_center|LOCUS_66120 >Feature sequence3527 <1168 348 gene locus_tag LOCUS_66130 <1168 348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_120704930.1:site-specific DNA-methyltransferase >Feature sequence3528 321 1 gene locus_tag LOCUS_66140 321 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66140 907 554 gene locus_tag LOCUS_66150 907 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66150 1100 891 gene locus_tag LOCUS_66160 1100 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66160 >Feature sequence3529 >Feature sequence3530 >Feature sequence3531 68 622 gene locus_tag LOCUS_66170 68 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66170 774 1163 gene locus_tag LOCUS_66180 774 1163 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056144.1 protein_id gnl|my_center|LOCUS_66180 >Feature sequence3532 >Feature sequence3533 <1166 642 gene locus_tag LOCUS_66190 <1166 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_106459194.1:tetratricopeptide repeat protein note possible pseudo, internal stop codon >Feature sequence3534 741 947 gene locus_tag LOCUS_66200 741 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66200 >Feature sequence3535 623 120 gene locus_tag LOCUS_66210 623 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66210 >Feature sequence3536 <1 670 gene locus_tag LOCUS_66220 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393453.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence3537 <1 837 gene locus_tag LOCUS_66230 <1 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943547.1:ATP-binding protein >Feature sequence3538 <1 975 gene locus_tag LOCUS_66240 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056612.1:cobalt-precorrin-5B (C(1))-methyltransferase CbiD >Feature sequence3539 >Feature sequence3540 308 706 gene locus_tag LOCUS_66250 gene msrB 308 706 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144007.1 protein_id gnl|my_center|LOCUS_66250 >Feature sequence3541 582 845 gene locus_tag LOCUS_66260 gene rpmE 582 845 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_66260 >Feature sequence3542 556 777 gene locus_tag LOCUS_66270 gene rpsR 556 777 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057896.1 protein_id gnl|my_center|LOCUS_66270 >Feature sequence3543 292 801 gene locus_tag LOCUS_66280 292 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66280 >Feature sequence3544 644 315 gene locus_tag LOCUS_66290 644 315 CDS product DUF3007 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056554.1 protein_id gnl|my_center|LOCUS_66290 >Feature sequence3545 >Feature sequence3546 647 1024 gene locus_tag LOCUS_66300 647 1024 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057790.1 protein_id gnl|my_center|LOCUS_66300 >Feature sequence3547 <1162 368 gene locus_tag LOCUS_66310 <1162 368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056177.1:glutamate--cysteine ligase >Feature sequence3548 <1 1078 gene locus_tag LOCUS_66320 <1 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929440.1:fasciclin domain-containing protein >Feature sequence3549 >Feature sequence3550 <1160 430 gene locus_tag LOCUS_66330 <1160 430 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531129.1:cytosine deaminase >Feature sequence3551 <1160 607 gene locus_tag LOCUS_66340 <1160 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056337.1:CPBP family intramembrane metalloprotease >Feature sequence3552 128 1135 gene locus_tag LOCUS_66350 128 1135 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057048.1 protein_id gnl|my_center|LOCUS_66350 >Feature sequence3553 <1 736 gene locus_tag LOCUS_66360 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_165448192.1:calcium-binding protein 772 1152 gene locus_tag LOCUS_66370 772 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66370 >Feature sequence3554 >Feature sequence3555 1056 154 gene locus_tag LOCUS_66380 gene sucD 1056 154 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327387.1 protein_id gnl|my_center|LOCUS_66380 >Feature sequence3556 729 412 gene locus_tag LOCUS_66390 gene grxC 729 412 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143672.1 protein_id gnl|my_center|LOCUS_66390 >Feature sequence3557 598 233 gene locus_tag LOCUS_66400 598 233 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057146.1 protein_id gnl|my_center|LOCUS_66400 >Feature sequence3558 <1158 156 gene locus_tag LOCUS_66410 <1158 156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112330.1:heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein >Feature sequence3559 <1158 320 gene locus_tag LOCUS_66420 <1158 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence3560 <1 796 gene locus_tag LOCUS_66430 <1 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966350.1:glycosyltransferase family 2 protein >Feature sequence3561 200 508 gene locus_tag LOCUS_66440 200 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66440 565 762 gene locus_tag LOCUS_66450 565 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66450 >Feature sequence3562 <1 954 gene locus_tag LOCUS_66460 <1 954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523980.1:helix-turn-helix domain-containing protein >Feature sequence3563 1107 448 gene locus_tag LOCUS_66470 1107 448 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920805.1 protein_id gnl|my_center|LOCUS_66470 >Feature sequence3564 1142 267 gene locus_tag LOCUS_66480 gene pyrF 1142 267 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141657.1 protein_id gnl|my_center|LOCUS_66480 >Feature sequence3565 823 1047 gene locus_tag LOCUS_66490 823 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66490 >Feature sequence3566 <1 988 gene locus_tag LOCUS_66500 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391057.1:sulfotransferase domain-containing protein >Feature sequence3567 786 1139 gene locus_tag LOCUS_66510 786 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66510 >Feature sequence3568 165 671 gene locus_tag LOCUS_66520 165 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66520 961 830 gene locus_tag LOCUS_66530 961 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66530 >Feature sequence3569 370 122 gene locus_tag LOCUS_66540 370 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66540 834 463 gene locus_tag LOCUS_66550 834 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66550 >Feature sequence3570 79 525 gene locus_tag LOCUS_66560 79 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66560 >Feature sequence3571 80 928 gene locus_tag LOCUS_66570 80 928 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257127.1 protein_id gnl|my_center|LOCUS_66570 >Feature sequence3572 1 609 gene locus_tag LOCUS_66580 1 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66580 >Feature sequence3573 1024 14 gene locus_tag LOCUS_66590 1024 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66590 >Feature sequence3574 <1154 177 gene locus_tag LOCUS_66600 <1154 177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257553.1:ABC transporter ATP-binding protein >Feature sequence3575 <1 1142 gene locus_tag LOCUS_66610 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030287.1:EAL domain-containing protein >Feature sequence3576 499 137 gene locus_tag LOCUS_66620 499 137 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_66620 595 1086 gene locus_tag LOCUS_66630 595 1086 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 protein_id gnl|my_center|LOCUS_66630 >Feature sequence3577 <1152 644 gene locus_tag LOCUS_66640 <1152 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797681.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence3578 <1 546 gene locus_tag LOCUS_66650 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928644.1:iron uptake porin >Feature sequence3579 <1 870 gene locus_tag LOCUS_66660 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202567.1:DUF262 domain-containing protein >Feature sequence3580 45 977 gene locus_tag LOCUS_66670 45 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66670 >Feature sequence3581 573 923 gene locus_tag LOCUS_66680 573 923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66680 >Feature sequence3582 >Feature sequence3583 <1150 43 gene locus_tag LOCUS_66690 <1150 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140425.1:serine/threonine-protein kinase >Feature sequence3584 <1150 182 gene locus_tag LOCUS_66700 <1150 182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331455.1:SulP family inorganic anion transporter >Feature sequence3585 203 595 gene locus_tag LOCUS_66710 203 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66710 >Feature sequence3586 >Feature sequence3587 961 32 gene locus_tag LOCUS_66720 961 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66720 >Feature sequence3588 >Feature sequence3589 97 687 gene locus_tag LOCUS_66730 97 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66730 >Feature sequence3590 139 831 gene locus_tag LOCUS_66740 139 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66740 >Feature sequence3591 <1148 326 gene locus_tag LOCUS_66750 <1148 326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058009.1:SMC family ATPase >Feature sequence3592 251 1018 gene locus_tag LOCUS_66760 251 1018 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_66760 >Feature sequence3593 >Feature sequence3594 120 242 gene locus_tag LOCUS_66770 120 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66770 <1148 490 gene locus_tag LOCUS_66780 <1148 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390772.1:2OG-Fe(II) oxygenase >Feature sequence3595 <1147 274 gene locus_tag LOCUS_66790 <1147 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980639.1:RNA-guided endonuclease TnpB family protein >Feature sequence3596 129 803 gene locus_tag LOCUS_66800 129 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66800 >Feature sequence3597 <1 953 gene locus_tag LOCUS_66810 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057877.1:aldo/keto reductase >Feature sequence3598 <1147 290 gene locus_tag LOCUS_66820 <1147 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704078.1:alpha-D-ribose 1-methylphosphonate 5-phosphate C-P-lyase PhnJ >Feature sequence3599 334 585 gene locus_tag LOCUS_66830 334 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66830 582 842 gene locus_tag LOCUS_66840 582 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66840 >Feature sequence3600 >Feature sequence3601 852 130 gene locus_tag LOCUS_66850 852 130 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_66850 >Feature sequence3602 231 968 gene locus_tag LOCUS_66860 231 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66860 >Feature sequence3603 362 1114 gene locus_tag LOCUS_66870 362 1114 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_66870 >Feature sequence3604 1016 1144 gene locus_tag LOCUS_66880 1016 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66880 >Feature sequence3605 >Feature sequence3606 103 513 gene locus_tag LOCUS_66890 103 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66890 510 914 gene locus_tag LOCUS_66900 510 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66900 >Feature sequence3607 139 903 gene locus_tag LOCUS_66910 139 903 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058265.1 protein_id gnl|my_center|LOCUS_66910 >Feature sequence3608 <1144 76 gene locus_tag LOCUS_66920 <1144 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454621.1:phosphoglucomutase >Feature sequence3609 <1 884 gene locus_tag LOCUS_66930 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057223.1:ABC transporter permease >Feature sequence3610 <1143 414 gene locus_tag LOCUS_66940 <1143 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056064.1:16S rRNA (cytosine(967)-C(5))-methyltransferase >Feature sequence3611 627 139 gene locus_tag LOCUS_66950 627 139 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083625306.1 protein_id gnl|my_center|LOCUS_66950 >Feature sequence3612 606 331 gene locus_tag LOCUS_66960 606 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66960 <1142 618 gene locus_tag LOCUS_66970 <1142 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393311.1:malto-oligosyltrehalose synthase note possible pseudo, frameshifted >Feature sequence3613 199 8 gene locus_tag LOCUS_66980 199 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66980 1002 148 gene locus_tag LOCUS_66990 1002 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_66990 >Feature sequence3614 544 1101 gene locus_tag LOCUS_67000 544 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057906.1 protein_id gnl|my_center|LOCUS_67000 >Feature sequence3615 652 146 gene locus_tag LOCUS_67010 652 146 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057270.1 protein_id gnl|my_center|LOCUS_67010 >Feature sequence3616 352 1017 gene locus_tag LOCUS_67020 352 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67020 >Feature sequence3617 <1 1133 gene locus_tag LOCUS_67030 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence3618 298 786 gene locus_tag LOCUS_67040 gene cpcA 298 786 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_67040 >Feature sequence3619 >Feature sequence3620 152 829 gene locus_tag LOCUS_67050 152 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67050 >Feature sequence3621 334 978 gene locus_tag LOCUS_67060 334 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67060 >Feature sequence3622 <1138 366 gene locus_tag LOCUS_67070 <1138 366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057207.1:ATP-binding protein >Feature sequence3623 <1 1013 gene locus_tag LOCUS_67080 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083435096.1:DUF4347 domain-containing protein >Feature sequence3624 <1136 601 gene locus_tag LOCUS_67090 <1136 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142018.1:DUF2301 domain-containing membrane protein >Feature sequence3625 >Feature sequence3626 607 26 gene locus_tag LOCUS_67100 607 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67100 >Feature sequence3627 232 456 gene locus_tag LOCUS_67110 232 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67110 829 632 gene locus_tag LOCUS_67120 829 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67120 >Feature sequence3628 >Feature sequence3629 <1134 84 gene locus_tag LOCUS_67130 <1134 84 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140828.1:FIST C-terminal domain-containing protein >Feature sequence3630 125 391 gene locus_tag LOCUS_67140 125 391 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920742.1 protein_id gnl|my_center|LOCUS_67140 590 970 gene locus_tag LOCUS_67150 590 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67150 >Feature sequence3631 >Feature sequence3632 <1132 567 gene locus_tag LOCUS_67160 <1132 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142331.1:alpha/beta fold hydrolase >Feature sequence3633 2 814 gene locus_tag LOCUS_67170 2 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67170 >Feature sequence3634 36 1019 gene locus_tag LOCUS_67180 36 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67180 >Feature sequence3635 81 1025 gene locus_tag LOCUS_67190 81 1025 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141923.1 protein_id gnl|my_center|LOCUS_67190 >Feature sequence3636 116 418 gene locus_tag LOCUS_67200 116 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67200 >Feature sequence3637 102 251 gene locus_tag LOCUS_67210 102 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67210 613 1017 gene locus_tag LOCUS_67220 613 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67220 >Feature sequence3638 1029 202 gene locus_tag LOCUS_67230 1029 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67230 >Feature sequence3639 >Feature sequence3640 <1 542 gene locus_tag LOCUS_67240 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143459.1:SagB/ThcOx family dehydrogenase <1128 619 gene locus_tag LOCUS_67250 <1128 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037391758.1:acyltransferase >Feature sequence3641 <1 544 gene locus_tag LOCUS_67260 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058059.1:UbiD family decarboxylase 634 951 gene locus_tag LOCUS_67270 634 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_67270 >Feature sequence3642 >Feature sequence3643 <1 514 gene locus_tag LOCUS_67280 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_159587410.1:ISAs1 family transposase >Feature sequence3644 <1 723 gene locus_tag LOCUS_67290 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057784.1:folate-binding protein YgfZ >Feature sequence3645 <1 593 gene locus_tag LOCUS_67300 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057627.1:UDP-3-O-acyl-N-acetylglucosamine deacetylase >Feature sequence3646 <1127 120 gene locus_tag LOCUS_67310 <1127 120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence3647 >Feature sequence3648 >Feature sequence3649 77 250 gene locus_tag LOCUS_67320 77 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67320 260 550 gene locus_tag LOCUS_67330 260 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67330 531 914 gene locus_tag LOCUS_67340 531 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67340 >Feature sequence3650 >Feature sequence3651 <1 688 gene locus_tag LOCUS_67350 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144247.1:rhomboid family intramembrane serine protease >Feature sequence3652 >Feature sequence3653 940 311 gene locus_tag LOCUS_67360 940 311 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141483.1 protein_id gnl|my_center|LOCUS_67360 >Feature sequence3654 1033 869 gene locus_tag LOCUS_67370 1033 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67370 >Feature sequence3655 288 85 gene locus_tag LOCUS_67380 288 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67380 >Feature sequence3656 <1125 377 gene locus_tag LOCUS_67390 <1125 377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142490.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence3657 <1 711 gene locus_tag LOCUS_67400 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056768.1:diguanylate cyclase >Feature sequence3658 <1 1058 gene locus_tag LOCUS_67410 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056043.1:ammonium transporter >Feature sequence3659 291 10 gene locus_tag LOCUS_67420 291 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67420 901 395 gene locus_tag LOCUS_67430 901 395 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_67430 >Feature sequence3660 435 815 gene locus_tag LOCUS_67440 435 815 CDS product chaperonin family protein RbcX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142154.1 protein_id gnl|my_center|LOCUS_67440 >Feature sequence3661 364 50 gene locus_tag LOCUS_67450 gene petF1 364 50 CDS product ferredoxin PetF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056851.1 protein_id gnl|my_center|LOCUS_67450 970 608 gene locus_tag LOCUS_67460 970 608 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214438544.1 protein_id gnl|my_center|LOCUS_67460 >Feature sequence3662 975 346 gene locus_tag LOCUS_67470 gene coaE 975 346 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056742.1 protein_id gnl|my_center|LOCUS_67470 >Feature sequence3663 >Feature sequence3664 536 39 gene locus_tag LOCUS_67480 536 39 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_67480 986 573 gene locus_tag LOCUS_67490 gene rsfS 986 573 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057064.1 protein_id gnl|my_center|LOCUS_67490 >Feature sequence3665 653 174 gene locus_tag LOCUS_67500 653 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67500 >Feature sequence3666 411 722 gene locus_tag LOCUS_67510 411 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67510 >Feature sequence3667 <1 581 gene locus_tag LOCUS_67520 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227744.1:TOMM precursor leader peptide-binding protein >Feature sequence3668 149 547 gene locus_tag LOCUS_67530 149 547 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065296.1 protein_id gnl|my_center|LOCUS_67530 561 962 gene locus_tag LOCUS_67540 561 962 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_67540 >Feature sequence3669 <1 561 gene locus_tag LOCUS_67550 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920971.1:LysR family transcriptional regulator >Feature sequence3670 521 255 gene locus_tag LOCUS_67560 521 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67560 792 661 gene locus_tag LOCUS_67570 792 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67570 >Feature sequence3671 389 60 gene locus_tag LOCUS_67580 389 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67580 746 588 gene locus_tag LOCUS_67590 746 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67590 >Feature sequence3672 43 1011 gene locus_tag LOCUS_67600 43 1011 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142186.1 protein_id gnl|my_center|LOCUS_67600 >Feature sequence3673 966 763 gene locus_tag LOCUS_67610 966 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67610 >Feature sequence3674 403 732 gene locus_tag LOCUS_67620 403 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67620 >Feature sequence3675 >Feature sequence3676 154 306 gene locus_tag LOCUS_67630 154 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67630 <1117 410 gene locus_tag LOCUS_67640 <1117 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055928.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence3677 <1 824 gene locus_tag LOCUS_67650 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530168.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence3678 609 4 gene locus_tag LOCUS_67660 609 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67660 >Feature sequence3679 <1116 307 gene locus_tag LOCUS_67670 <1116 307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920648.1:proteasome-type protease >Feature sequence3680 >Feature sequence3681 <1 759 gene locus_tag LOCUS_67680 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_135257956.1:MFS transporter >Feature sequence3682 434 162 gene locus_tag LOCUS_67690 434 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67690 <1115 439 gene locus_tag LOCUS_67700 <1115 439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056695.1:serine O-acetyltransferase >Feature sequence3683 22 903 gene locus_tag LOCUS_67710 22 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_67710 >Feature sequence3684 291 67 gene locus_tag LOCUS_67720 291 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67720 <1115 340 gene locus_tag LOCUS_67730 <1115 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057484.1:TIGR03279 family radical SAM protein >Feature sequence3685 338 979 gene locus_tag LOCUS_67740 338 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67740 >Feature sequence3686 696 166 gene locus_tag LOCUS_67750 696 166 CDS product DUF4330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920747.1 protein_id gnl|my_center|LOCUS_67750 >Feature sequence3687 <1114 317 gene locus_tag LOCUS_67760 <1114 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137908656.1:pre-peptidase C-terminal domain-containing protein >Feature sequence3688 564 241 gene locus_tag LOCUS_67770 564 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67770 >Feature sequence3689 <1 573 gene locus_tag LOCUS_67780 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140402.1:50S ribosomal protein L25/general stress protein Ctc >Feature sequence3690 480 689 gene locus_tag LOCUS_67790 480 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67790 >Feature sequence3691 <1112 62 gene locus_tag LOCUS_67800 <1112 62 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein >Feature sequence3692 491 1060 gene locus_tag LOCUS_67810 491 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67810 >Feature sequence3693 <1112 429 gene locus_tag LOCUS_67820 <1112 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392232.1:LD-carboxypeptidase >Feature sequence3694 280 624 gene locus_tag LOCUS_67830 280 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141134.1 protein_id gnl|my_center|LOCUS_67830 >Feature sequence3695 <1111 603 gene locus_tag LOCUS_67840 <1111 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058037.1:response regulator >Feature sequence3696 2 196 gene locus_tag LOCUS_67850 2 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67850 >Feature sequence3697 1011 538 gene locus_tag LOCUS_67860 1011 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67860 >Feature sequence3698 914 432 gene locus_tag LOCUS_67870 gene petD 914 432 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056640.1 protein_id gnl|my_center|LOCUS_67870 >Feature sequence3699 >Feature sequence3700 842 600 gene locus_tag LOCUS_67880 842 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_67880 >Feature sequence3701 <1110 287 gene locus_tag LOCUS_67890 <1110 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057401.1:15-cis-phytoene desaturase >Feature sequence3702 599 423 gene locus_tag LOCUS_67900 599 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67900 1010 678 gene locus_tag LOCUS_67910 1010 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67910 >Feature sequence3703 >Feature sequence3704 <1 629 gene locus_tag LOCUS_67920 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053221433.1:serine/threonine-protein kinase >Feature sequence3705 <1110 201 gene locus_tag LOCUS_67930 <1110 201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975234.1:response regulator >Feature sequence3706 313 525 gene locus_tag LOCUS_67940 313 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67940 522 935 gene locus_tag LOCUS_67950 522 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67950 >Feature sequence3707 261 581 gene locus_tag LOCUS_67960 261 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67960 >Feature sequence3708 >Feature sequence3709 <1 621 gene locus_tag LOCUS_67970 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326778.1:transglutaminase family protein >Feature sequence3710 <1 861 gene locus_tag LOCUS_67980 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057718.1:type I DNA topoisomerase note possible pseudo, frameshifted >Feature sequence3711 >Feature sequence3712 21 368 gene locus_tag LOCUS_67990 21 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_67990 <1108 376 gene locus_tag LOCUS_68000 <1108 376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099258689.1:ISL3 family transposase >Feature sequence3713 204 740 gene locus_tag LOCUS_68010 204 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68010 >Feature sequence3714 >Feature sequence3715 <1 576 gene locus_tag LOCUS_68020 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057395.1:MoxR family ATPase >Feature sequence3716 <1 538 gene locus_tag LOCUS_68030 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920919.1:iron uptake porin >Feature sequence3717 <1 809 gene locus_tag LOCUS_68040 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444553.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence3718 400 1101 gene locus_tag LOCUS_68050 400 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68050 >Feature sequence3719 <1 922 gene locus_tag LOCUS_68060 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036976.1:histidine--tRNA ligase >Feature sequence3720 718 155 gene locus_tag LOCUS_68070 718 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68070 793 930 gene locus_tag LOCUS_68080 793 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68080 >Feature sequence3721 >Feature sequence3722 >Feature sequence3723 808 371 gene locus_tag LOCUS_68090 808 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68090 >Feature sequence3724 <1104 575 gene locus_tag LOCUS_68100 <1104 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055856.1:zinc-dependent alcohol dehydrogenase family protein >Feature sequence3725 <1104 305 gene locus_tag LOCUS_68110 <1104 305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939574.1:glycine betaine/L-proline ABC transporter ATP-binding protein >Feature sequence3726 >Feature sequence3727 <1 580 gene locus_tag LOCUS_68120 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057098.1:5-(carboxyamino)imidazole ribonucleotide synthase >Feature sequence3728 >Feature sequence3729 >Feature sequence3730 878 489 gene locus_tag LOCUS_68130 878 489 CDS product DUF1636 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562166.1 protein_id gnl|my_center|LOCUS_68130 >Feature sequence3731 269 505 gene locus_tag LOCUS_68140 269 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68140 515 952 gene locus_tag LOCUS_68150 515 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68150 >Feature sequence3732 478 765 gene locus_tag LOCUS_68160 478 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68160 >Feature sequence3733 140 583 gene locus_tag LOCUS_68170 140 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68170 >Feature sequence3734 728 369 gene locus_tag LOCUS_68180 728 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68180 >Feature sequence3735 <1 539 gene locus_tag LOCUS_68190 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099797719.1:GH116 family glycosyl hydrolase >Feature sequence3736 <1101 103 gene locus_tag LOCUS_68200 <1101 103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085076.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence3737 >Feature sequence3738 >Feature sequence3739 331 777 gene locus_tag LOCUS_68210 331 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68210 >Feature sequence3740 >Feature sequence3741 53 562 gene locus_tag LOCUS_68220 53 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68220 762 613 gene locus_tag LOCUS_68230 762 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68230 >Feature sequence3742 <1098 264 gene locus_tag LOCUS_68240 <1098 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056887.1:sulfate adenylyltransferase >Feature sequence3743 <1098 494 gene locus_tag LOCUS_68250 <1098 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546171.1:CAP domain-containing protein >Feature sequence3744 <1 711 gene locus_tag LOCUS_68260 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921221.1:NADH-quinone oxidoreductase subunit M >Feature sequence3745 882 484 gene locus_tag LOCUS_68270 882 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68270 >Feature sequence3746 477 133 gene locus_tag LOCUS_68280 477 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68280 >Feature sequence3747 >Feature sequence3748 350 916 gene locus_tag LOCUS_68290 350 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68290 >Feature sequence3749 436 771 gene locus_tag LOCUS_68300 436 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68300 >Feature sequence3750 53 538 gene locus_tag LOCUS_68310 53 538 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_68310 >Feature sequence3751 12 407 gene locus_tag LOCUS_68320 12 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68320 394 828 gene locus_tag LOCUS_68330 394 828 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057899.1 protein_id gnl|my_center|LOCUS_68330 >Feature sequence3752 60 830 gene locus_tag LOCUS_68340 60 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68340 >Feature sequence3753 1045 335 gene locus_tag LOCUS_68350 1045 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68350 >Feature sequence3754 >Feature sequence3755 3 155 gene locus_tag LOCUS_68360 3 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68360 <1094 191 gene locus_tag LOCUS_68370 <1094 191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056213.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence3756 137 325 gene locus_tag LOCUS_68380 gene rpsU 137 325 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_68380 <1094 341 gene locus_tag LOCUS_68390 <1094 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143647.1:glycerol acyltransferase >Feature sequence3757 711 415 gene locus_tag LOCUS_68400 711 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_68400 >Feature sequence3758 740 18 gene locus_tag LOCUS_68410 740 18 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140900.1 protein_id gnl|my_center|LOCUS_68410 >Feature sequence3759 <1092 136 gene locus_tag LOCUS_68420 <1092 136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140428.1:VgrG-related protein note possible pseudo, frameshifted >Feature sequence3760 1043 417 gene locus_tag LOCUS_68430 gene azoR3 1043 417 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_68430 >Feature sequence3761 >Feature sequence3762 329 862 gene locus_tag LOCUS_68440 329 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68440 >Feature sequence3763 <1 570 gene locus_tag LOCUS_68450 <1 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090388836.1:7TM diverse intracellular signaling domain-containing protein >Feature sequence3764 <1 589 gene locus_tag LOCUS_68460 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000152207.1:putative 2-aminoethylphosphonate ABC transporter ATP-binding protein >Feature sequence3765 191 288 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq acaattaacaattaacaatt 860 384 gene locus_tag LOCUS_68470 860 384 CDS product CRR6 family NdhI maturation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057132.1 protein_id gnl|my_center|LOCUS_68470 >Feature sequence3766 <1090 442 gene locus_tag LOCUS_68480 <1090 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256174.1:phosphate ABC transporter permease subunit PstC >Feature sequence3767 >Feature sequence3768 <1 1017 gene locus_tag LOCUS_68490 <1 1017 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140079.1:DNA/RNA non-specific endonuclease >Feature sequence3769 <1088 205 gene locus_tag LOCUS_68500 <1088 205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228698.1:long-chain fatty acid--CoA ligase >Feature sequence3770 620 339 gene locus_tag LOCUS_68510 620 339 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144025.1 protein_id gnl|my_center|LOCUS_68510 >Feature sequence3771 652 1035 gene locus_tag LOCUS_68520 652 1035 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948976.1 protein_id gnl|my_center|LOCUS_68520 >Feature sequence3772 >Feature sequence3773 805 245 gene locus_tag LOCUS_68530 805 245 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201778948.1 protein_id gnl|my_center|LOCUS_68530 >Feature sequence3774 >Feature sequence3775 2 226 gene locus_tag LOCUS_68540 2 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68540 <1086 475 gene locus_tag LOCUS_68550 <1086 475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272339.1:DEAD/DEAH box helicase >Feature sequence3776 1 945 gene locus_tag LOCUS_68560 1 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68560 >Feature sequence3777 116 313 gene locus_tag LOCUS_68570 116 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_68570 416 601 gene locus_tag LOCUS_68580 416 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68580 717 839 gene locus_tag LOCUS_68590 717 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68590 >Feature sequence3778 <1085 469 gene locus_tag LOCUS_68600 <1085 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057439.1:3-isopropylmalate dehydrogenase >Feature sequence3779 541 2 gene locus_tag LOCUS_68610 541 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68610 >Feature sequence3780 638 1003 gene locus_tag LOCUS_68620 638 1003 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_68620 >Feature sequence3781 528 76 gene locus_tag LOCUS_68630 gene rplN 528 76 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055946.1 protein_id gnl|my_center|LOCUS_68630 811 566 gene locus_tag LOCUS_68640 gene rpsQ 811 566 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055945.1 protein_id gnl|my_center|LOCUS_68640 >Feature sequence3782 <1084 295 gene locus_tag LOCUS_68650 <1084 295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479721.1:mannose-1-phosphate guanylyltransferase >Feature sequence3783 <1 677 gene locus_tag LOCUS_68660 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228221.1:cation acetate symporter >Feature sequence3784 1055 534 gene locus_tag LOCUS_68670 1055 534 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920767.1 protein_id gnl|my_center|LOCUS_68670 >Feature sequence3785 <1084 341 gene locus_tag LOCUS_68680 <1084 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141501.1:site-2 protease family protein >Feature sequence3786 48 1016 gene locus_tag LOCUS_68690 48 1016 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056369.1 protein_id gnl|my_center|LOCUS_68690 >Feature sequence3787 618 253 gene locus_tag LOCUS_68700 618 253 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056201.1 protein_id gnl|my_center|LOCUS_68700 >Feature sequence3788 >Feature sequence3789 317 880 gene locus_tag LOCUS_68710 317 880 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227382.1 protein_id gnl|my_center|LOCUS_68710 >Feature sequence3790 789 136 gene locus_tag LOCUS_68720 789 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68720 >Feature sequence3791 <1 573 gene locus_tag LOCUS_68730 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence3792 366 491 gene locus_tag LOCUS_68740 366 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68740 460 702 gene locus_tag LOCUS_68750 460 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68750 >Feature sequence3793 659 174 gene locus_tag LOCUS_68760 659 174 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208329.1 protein_id gnl|my_center|LOCUS_68760 >Feature sequence3794 408 1010 gene locus_tag LOCUS_68770 408 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68770 >Feature sequence3795 >Feature sequence3796 524 859 gene locus_tag LOCUS_68780 524 859 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_68780 >Feature sequence3797 484 969 gene locus_tag LOCUS_68790 484 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68790 >Feature sequence3798 <1 575 gene locus_tag LOCUS_68800 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087310.1:SagB family peptide dehydrogenase note possible pseudo, internal stop codon, frameshifted 633 809 gene locus_tag LOCUS_68810 633 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68810 800 1042 gene locus_tag LOCUS_68820 800 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_68820 >Feature sequence3799 57 1058 gene locus_tag LOCUS_68830 57 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68830 >Feature sequence3800 >Feature sequence3801 >Feature sequence3802 316 20 gene locus_tag LOCUS_68840 316 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68840 >Feature sequence3803 >Feature sequence3804 <1077 139 gene locus_tag LOCUS_68850 <1077 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476085.1:glycosyltransferase family 4 protein >Feature sequence3805 1076 96 gene locus_tag LOCUS_68860 1076 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68860 >Feature sequence3806 789 1 gene locus_tag LOCUS_68870 789 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68870 >Feature sequence3807 <1 805 gene locus_tag LOCUS_68880 <1 805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057253.1:magnesium chelatase ATPase subunit D >Feature sequence3808 >Feature sequence3809 <1076 434 gene locus_tag LOCUS_68890 <1076 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057727.1:type II CAAX endopeptidase family protein >Feature sequence3810 778 491 gene locus_tag LOCUS_68900 gene clpS 778 491 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024123996.1 protein_id gnl|my_center|LOCUS_68900 >Feature sequence3811 631 969 gene locus_tag LOCUS_68910 631 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68910 >Feature sequence3812 <1 655 gene locus_tag LOCUS_68920 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056373.1:D-alanine--D-alanine ligase family protein >Feature sequence3813 >Feature sequence3814 <1 673 gene locus_tag LOCUS_68930 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015228421.1:reverse transcriptase N-terminal domain-containing protein >Feature sequence3815 <1073 457 gene locus_tag LOCUS_68940 <1073 457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390673.1:glycosyltransferase family 4 protein >Feature sequence3816 3 584 gene locus_tag LOCUS_68950 3 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68950 >Feature sequence3817 659 273 gene locus_tag LOCUS_68960 659 273 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392206.1 protein_id gnl|my_center|LOCUS_68960 885 652 gene locus_tag LOCUS_68970 885 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68970 >Feature sequence3818 838 422 gene locus_tag LOCUS_68980 838 422 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392184.1 protein_id gnl|my_center|LOCUS_68980 >Feature sequence3819 703 56 gene locus_tag LOCUS_68990 703 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_68990 >Feature sequence3820 581 201 gene locus_tag LOCUS_69000 581 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69000 >Feature sequence3821 >Feature sequence3822 215 484 gene locus_tag LOCUS_69010 215 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69010 >Feature sequence3823 >Feature sequence3824 <1070 345 gene locus_tag LOCUS_69020 <1070 345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058023.1:C40 family peptidase >Feature sequence3825 1068 637 gene locus_tag LOCUS_69030 1068 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69030 >Feature sequence3826 802 365 gene locus_tag LOCUS_69040 802 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69040 912 1055 gene locus_tag LOCUS_69050 912 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69050 >Feature sequence3827 >Feature sequence3828 <1069 153 gene locus_tag LOCUS_69060 <1069 153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056997.1:MBL fold metallo-hydrolase >Feature sequence3829 269 490 gene locus_tag LOCUS_69070 269 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69070 >Feature sequence3830 127 1020 gene locus_tag LOCUS_69080 127 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69080 >Feature sequence3831 857 366 gene locus_tag LOCUS_69090 857 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69090 >Feature sequence3832 481 65 gene locus_tag LOCUS_69100 481 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69100 <1067 522 gene locus_tag LOCUS_69110 <1067 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055931.1:AAA family ATPase >Feature sequence3833 215 66 gene locus_tag LOCUS_69120 215 66 CDS product chlorophyll a/b-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124265.1 protein_id gnl|my_center|LOCUS_69120 442 1014 gene locus_tag LOCUS_69130 442 1014 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057636.1 protein_id gnl|my_center|LOCUS_69130 >Feature sequence3834 <1066 132 gene locus_tag LOCUS_69140 <1066 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055935.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence3835 <1 806 gene locus_tag LOCUS_69150 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524113.1:phosphoribosylglycinamide formyltransferase >Feature sequence3836 <1066 494 gene locus_tag LOCUS_69160 <1066 494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975283.1:SDR family oxidoreductase >Feature sequence3837 <1 561 gene locus_tag LOCUS_69170 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056899.1:cobalt-precorrin-6A reductase >Feature sequence3838 127 333 gene locus_tag LOCUS_69180 127 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69180 803 330 gene locus_tag LOCUS_69190 803 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69190 >Feature sequence3839 <1066 79 gene locus_tag LOCUS_69200 <1066 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941776.1:helix-turn-helix domain-containing protein >Feature sequence3840 258 452 gene locus_tag LOCUS_69210 258 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69210 >Feature sequence3841 <1 949 gene locus_tag LOCUS_69220 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275275.1:flavin monoamine oxidase family protein >Feature sequence3842 692 414 gene locus_tag LOCUS_69230 gene cas2 692 414 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256456.1 protein_id gnl|my_center|LOCUS_69230 763 1002 gene locus_tag LOCUS_69240 763 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69240 >Feature sequence3843 811 242 gene locus_tag LOCUS_69250 811 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69250 >Feature sequence3844 337 29 gene locus_tag LOCUS_69260 337 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69260 881 264 gene locus_tag LOCUS_69270 881 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69270 >Feature sequence3845 >Feature sequence3846 913 104 gene locus_tag LOCUS_69280 913 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69280 >Feature sequence3847 758 96 gene locus_tag LOCUS_69290 758 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69290 >Feature sequence3848 >Feature sequence3849 >Feature sequence3850 535 134 gene locus_tag LOCUS_69300 535 134 CDS product DUF2358 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929025.1 protein_id gnl|my_center|LOCUS_69300 >Feature sequence3851 507 809 gene locus_tag LOCUS_69310 507 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69310 >Feature sequence3852 995 330 gene locus_tag LOCUS_69320 995 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69320 >Feature sequence3853 >Feature sequence3854 394 627 gene locus_tag LOCUS_69330 394 627 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141646.1 protein_id gnl|my_center|LOCUS_69330 >Feature sequence3855 535 720 gene locus_tag LOCUS_69340 535 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69340 >Feature sequence3856 >Feature sequence3857 >Feature sequence3858 <1057 126 gene locus_tag LOCUS_69350 <1057 126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142048.1:DNA gyrase subunit A >Feature sequence3859 <1057 448 gene locus_tag LOCUS_69360 <1057 448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057242.1:DUF2232 domain-containing protein >Feature sequence3860 540 884 gene locus_tag LOCUS_69370 540 884 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_69370 >Feature sequence3861 >Feature sequence3862 99 1004 gene locus_tag LOCUS_69380 99 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807011.1 protein_id gnl|my_center|LOCUS_69380 >Feature sequence3863 <1 585 gene locus_tag LOCUS_69390 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920721.1:vitamin K epoxide reductase family protein >Feature sequence3864 <1 593 gene locus_tag LOCUS_69400 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920752.1:recombinase family protein >Feature sequence3865 >Feature sequence3866 367 59 gene locus_tag LOCUS_69410 367 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_69410 >Feature sequence3867 832 611 gene locus_tag LOCUS_69420 832 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69420 >Feature sequence3868 <1 607 gene locus_tag LOCUS_69430 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142405.1:Uma2 family endonuclease >Feature sequence3869 >Feature sequence3870 <1 910 gene locus_tag LOCUS_69440 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012166117.1:pentapeptide repeat-containing protein >Feature sequence3871 329 658 gene locus_tag LOCUS_69450 329 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69450 >Feature sequence3872 397 1044 gene locus_tag LOCUS_69460 397 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69460 >Feature sequence3873 <1 814 gene locus_tag LOCUS_69470 <1 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090620535.1:patatin-like phospholipase family protein >Feature sequence3874 116 667 gene locus_tag LOCUS_69480 116 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69480 >Feature sequence3875 313 957 gene locus_tag LOCUS_69490 313 957 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929078.1 protein_id gnl|my_center|LOCUS_69490 >Feature sequence3876 144 587 gene locus_tag LOCUS_69500 144 587 CDS product ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920689.1 protein_id gnl|my_center|LOCUS_69500 >Feature sequence3877 417 722 gene locus_tag LOCUS_69510 417 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_69510 >Feature sequence3878 2 304 gene locus_tag LOCUS_69520 2 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69520 >Feature sequence3879 158 871 gene locus_tag LOCUS_69530 gene rpe 158 871 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_69530 >Feature sequence3880 543 268 gene locus_tag LOCUS_69540 543 268 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529822.1 protein_id gnl|my_center|LOCUS_69540 >Feature sequence3881 260 934 gene locus_tag LOCUS_69550 260 934 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056679.1 protein_id gnl|my_center|LOCUS_69550 >Feature sequence3882 <1051 15 gene locus_tag LOCUS_69560 <1051 15 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057961.1:serine hydroxymethyltransferase >Feature sequence3883 238 14 gene locus_tag LOCUS_69570 238 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69570 >Feature sequence3884 338 694 gene locus_tag LOCUS_69580 338 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69580 >Feature sequence3885 88 915 gene locus_tag LOCUS_69590 88 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_69590 >Feature sequence3886 750 1025 gene locus_tag LOCUS_69600 750 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69600 >Feature sequence3887 <1 938 gene locus_tag LOCUS_69610 <1 938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056007.1:ABC transporter ATP-binding protein note possible pseudo, frameshifted >Feature sequence3888 <1049 264 gene locus_tag LOCUS_69620 <1049 264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141839.1:TIGR03032 family protein >Feature sequence3889 <1 502 gene locus_tag LOCUS_69630 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_166277356.1:YlqD family protein >Feature sequence3890 <1048 85 gene locus_tag LOCUS_69640 <1048 85 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_208353729.1:amino acid adenylation domain-containing protein >Feature sequence3891 <1 700 gene locus_tag LOCUS_69650 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011055907.1:cytochrome c biogenesis protein CcdA >Feature sequence3892 >Feature sequence3893 <1048 352 gene locus_tag LOCUS_69660 <1048 352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_216087114.1:threonine--tRNA ligase >Feature sequence3894 188 787 gene locus_tag LOCUS_69670 188 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69670 >Feature sequence3895 >Feature sequence3896 >Feature sequence3897 876 121 gene locus_tag LOCUS_69680 876 121 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056783.1 protein_id gnl|my_center|LOCUS_69680 >Feature sequence3898 720 187 gene locus_tag LOCUS_69690 720 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69690 >Feature sequence3899 >Feature sequence3900 <1046 244 gene locus_tag LOCUS_69700 <1046 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944691.1:polysaccharide deacetylase family protein >Feature sequence3901 <1 697 gene locus_tag LOCUS_69710 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter >Feature sequence3902 475 47 gene locus_tag LOCUS_69720 475 47 CDS product globin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928811.1 protein_id gnl|my_center|LOCUS_69720 >Feature sequence3903 <1 674 gene locus_tag LOCUS_69730 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056135.1:DnaJ C-terminal domain-containing protein >Feature sequence3904 <1046 195 gene locus_tag LOCUS_69740 <1046 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929052.1:sirohydrochlorin chelatase >Feature sequence3905 <1045 260 gene locus_tag LOCUS_69750 <1045 260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197524138.1:TPM domain-containing protein >Feature sequence3906 807 25 gene locus_tag LOCUS_69760 807 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69760 >Feature sequence3907 <1 1009 gene locus_tag LOCUS_69770 <1 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:MBOAT family protein >Feature sequence3908 149 967 gene locus_tag LOCUS_69780 149 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69780 >Feature sequence3909 <1042 210 gene locus_tag LOCUS_69790 <1042 210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058165.1:carbamoyl-phosphate synthase large subunit >Feature sequence3910 >Feature sequence3911 762 34 gene locus_tag LOCUS_69800 gene pyrH 762 34 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056115.1 protein_id gnl|my_center|LOCUS_69800 >Feature sequence3912 >Feature sequence3913 <1041 77 gene locus_tag LOCUS_69810 <1041 77 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266216.1:energy transducer TonB >Feature sequence3914 >Feature sequence3915 322 32 gene locus_tag LOCUS_69820 322 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69820 593 315 gene locus_tag LOCUS_69830 593 315 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920932.1 protein_id gnl|my_center|LOCUS_69830 841 590 gene locus_tag LOCUS_69840 841 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057652.1 protein_id gnl|my_center|LOCUS_69840 >Feature sequence3916 848 246 gene locus_tag LOCUS_69850 848 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69850 >Feature sequence3917 >Feature sequence3918 773 297 gene locus_tag LOCUS_69860 773 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69860 >Feature sequence3919 <1039 75 gene locus_tag LOCUS_69870 <1039 75 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057279.1:S-layer homology domain-containing protein >Feature sequence3920 >Feature sequence3921 248 625 gene locus_tag LOCUS_69880 248 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69880 >Feature sequence3922 <1037 420 gene locus_tag LOCUS_69890 <1037 420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404780.1:ATP-binding protein >Feature sequence3923 >Feature sequence3924 338 141 gene locus_tag LOCUS_69900 338 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69900 578 348 gene locus_tag LOCUS_69910 578 348 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087471.1 protein_id gnl|my_center|LOCUS_69910 995 651 gene locus_tag LOCUS_69920 995 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69920 >Feature sequence3925 853 206 gene locus_tag LOCUS_69930 853 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69930 >Feature sequence3926 486 121 gene locus_tag LOCUS_69940 486 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69940 >Feature sequence3927 258 755 gene locus_tag LOCUS_69950 gene psbV2 258 755 CDS product photosystem II cytochrome PsbV2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057124.1 protein_id gnl|my_center|LOCUS_69950 >Feature sequence3928 819 4 gene locus_tag LOCUS_69960 819 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_69960 >Feature sequence3929 853 374 gene locus_tag LOCUS_69970 853 374 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_69970 >Feature sequence3930 <1 869 gene locus_tag LOCUS_69980 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140627.1:prolyl oligopeptidase family serine peptidase >Feature sequence3931 719 324 gene locus_tag LOCUS_69990 719 324 CDS product DUF3119 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056952.1 protein_id gnl|my_center|LOCUS_69990 >Feature sequence3932 <1 848 gene locus_tag LOCUS_70000 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000872781.1:N-methyl-L-tryptophan oxidase >Feature sequence3933 8 619 gene locus_tag LOCUS_70010 8 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70010 >Feature sequence3934 152 397 gene locus_tag LOCUS_70020 152 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70020 360 689 gene locus_tag LOCUS_70030 360 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70030 >Feature sequence3935 <1 794 gene locus_tag LOCUS_70040 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190557989.1:Uma2 family endonuclease >Feature sequence3936 >Feature sequence3937 <1 920 gene locus_tag LOCUS_70050 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143571.1:glycosyltransferase family 39 protein >Feature sequence3938 <1033 123 gene locus_tag LOCUS_70060 <1033 123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056005.1:geranylgeranyl reductase >Feature sequence3939 474 115 gene locus_tag LOCUS_70070 474 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70070 >Feature sequence3940 1030 182 gene locus_tag LOCUS_70080 1030 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70080 >Feature sequence3941 >Feature sequence3942 1032 88 gene locus_tag LOCUS_70090 1032 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70090 >Feature sequence3943 >Feature sequence3944 756 226 gene locus_tag LOCUS_70100 756 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055861.1 protein_id gnl|my_center|LOCUS_70100 >Feature sequence3945 341 922 gene locus_tag LOCUS_70110 341 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70110 >Feature sequence3946 48 410 gene locus_tag LOCUS_70120 48 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70120 407 811 gene locus_tag LOCUS_70130 407 811 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249840.1 protein_id gnl|my_center|LOCUS_70130 >Feature sequence3947 534 289 gene locus_tag LOCUS_70140 534 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70140 >Feature sequence3948 >Feature sequence3949 <1 811 gene locus_tag LOCUS_70150 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014527266.1:sulfotransferase >Feature sequence3950 637 20 gene locus_tag LOCUS_70160 637 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70160 >Feature sequence3951 425 222 gene locus_tag LOCUS_70170 425 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70170 872 447 gene locus_tag LOCUS_70180 872 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70180 >Feature sequence3952 309 653 gene locus_tag LOCUS_70190 gene ndhM 309 653 CDS product photosynthetic/respiratory NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056300.1 protein_id gnl|my_center|LOCUS_70190 >Feature sequence3953 183 815 gene locus_tag LOCUS_70200 183 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70200 >Feature sequence3954 22 486 gene locus_tag LOCUS_70210 22 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70210 >Feature sequence3955 <1029 499 gene locus_tag LOCUS_70220 <1029 499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228051.1:thioredoxin family protein >Feature sequence3956 471 779 gene locus_tag LOCUS_70230 471 779 CDS product carbon dioxide-concentrating mechanism protein CcmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142093.1 protein_id gnl|my_center|LOCUS_70230 >Feature sequence3957 519 91 gene locus_tag LOCUS_70240 519 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70240 >Feature sequence3958 >Feature sequence3959 572 147 gene locus_tag LOCUS_70250 572 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70250 >Feature sequence3960 974 36 gene locus_tag LOCUS_70260 974 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70260 >Feature sequence3961 >Feature sequence3962 137 787 gene locus_tag LOCUS_70270 137 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70270 >Feature sequence3963 <1028 66 gene locus_tag LOCUS_70280 <1028 66 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence3964 822 502 gene locus_tag LOCUS_70290 822 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70290 960 823 gene locus_tag LOCUS_70300 960 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70300 >Feature sequence3965 433 188 gene locus_tag LOCUS_70310 gene atpE 433 188 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125083.1 protein_id gnl|my_center|LOCUS_70310 >Feature sequence3966 220 885 gene locus_tag LOCUS_70320 220 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70320 >Feature sequence3967 141 773 gene locus_tag LOCUS_70330 141 773 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143302.1 protein_id gnl|my_center|LOCUS_70330 >Feature sequence3968 <1026 43 gene locus_tag LOCUS_70340 <1026 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218132780.1:ISAzo13 family transposase >Feature sequence3969 237 19 gene locus_tag LOCUS_70350 237 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70350 523 389 gene locus_tag LOCUS_70360 523 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70360 755 507 gene locus_tag LOCUS_70370 755 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70370 >Feature sequence3970 <1026 335 gene locus_tag LOCUS_70380 <1026 335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057361.1:MFS transporter >Feature sequence3971 8 760 gene locus_tag LOCUS_70390 8 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70390 >Feature sequence3972 520 218 gene locus_tag LOCUS_70400 520 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70400 >Feature sequence3973 998 72 gene locus_tag LOCUS_70410 998 72 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70410 >Feature sequence3974 385 753 gene locus_tag LOCUS_70420 385 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70420 >Feature sequence3975 <1 647 gene locus_tag LOCUS_70430 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021891.1:pentapeptide repeat-containing protein >Feature sequence3976 <1024 141 gene locus_tag LOCUS_70440 <1024 141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056831.1:small ribosomal subunit biogenesis GTPase RsgA >Feature sequence3977 >Feature sequence3978 812 321 gene locus_tag LOCUS_70450 gene ruvC 812 321 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190407846.1 protein_id gnl|my_center|LOCUS_70450 >Feature sequence3979 <1 771 gene locus_tag LOCUS_70460 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057313.1:ABC transporter ATP-binding protein >Feature sequence3980 >Feature sequence3981 164 529 gene locus_tag LOCUS_70470 164 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70470 552 872 gene locus_tag LOCUS_70480 552 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70480 >Feature sequence3982 898 548 gene locus_tag LOCUS_70490 898 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70490 >Feature sequence3983 <1 876 gene locus_tag LOCUS_70500 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142690.1:aldo/keto reductase >Feature sequence3984 <1022 118 gene locus_tag LOCUS_70510 <1022 118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057579.1:valine--pyruvate transaminase >Feature sequence3985 348 1022 gene locus_tag LOCUS_70520 gene deoC 348 1022 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_70520 >Feature sequence3986 >Feature sequence3987 367 149 gene locus_tag LOCUS_70530 367 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70530 >Feature sequence3988 >Feature sequence3989 <1 707 gene locus_tag LOCUS_70540 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031019.1:alkaline phosphatase family protein >Feature sequence3990 >Feature sequence3991 138 347 gene locus_tag LOCUS_70550 138 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70550 585 773 gene locus_tag LOCUS_70560 gene rpsU 585 773 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_70560 >Feature sequence3992 >Feature sequence3993 >Feature sequence3994 468 680 gene locus_tag LOCUS_70570 468 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140926.1 protein_id gnl|my_center|LOCUS_70570 884 699 gene locus_tag LOCUS_70580 884 699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057262.1 protein_id gnl|my_center|LOCUS_70580 >Feature sequence3995 <1018 464 gene locus_tag LOCUS_70590 <1018 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140166.1:PBP1A family penicillin-binding protein >Feature sequence3996 >Feature sequence3997 <1018 517 gene locus_tag LOCUS_70600 <1018 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057636.1:Uma2 family endonuclease >Feature sequence3998 134 616 gene locus_tag LOCUS_70610 134 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70610 761 967 gene locus_tag LOCUS_70620 761 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70620 >Feature sequence3999 <1018 495 gene locus_tag LOCUS_70630 <1018 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058004.1:cyanophycin synthetase >Feature sequence4000 52 681 gene locus_tag LOCUS_70640 52 681 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920666.1 protein_id gnl|my_center|LOCUS_70640 >Feature sequence4001 613 353 gene locus_tag LOCUS_70650 613 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70650 >Feature sequence4002 >Feature sequence4003 >Feature sequence4004 464 922 gene locus_tag LOCUS_70660 464 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70660 >Feature sequence4005 934 440 gene locus_tag LOCUS_70670 934 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_70670 >Feature sequence4006 100 513 gene locus_tag LOCUS_70680 100 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70680 498 875 gene locus_tag LOCUS_70690 498 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70690 >Feature sequence4007 <1014 160 gene locus_tag LOCUS_70700 <1014 160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143922.1:DNA polymerase III subunit alpha >Feature sequence4008 <1014 231 gene locus_tag LOCUS_70710 <1014 231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123429.1:Calx-beta domain-containing protein >Feature sequence4009 558 1013 gene locus_tag LOCUS_70720 558 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70720 >Feature sequence4010 400 260 gene locus_tag LOCUS_70730 400 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70730 >Feature sequence4011 809 6 gene locus_tag LOCUS_70740 809 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70740 >Feature sequence4012 922 779 gene locus_tag LOCUS_70750 922 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70750 >Feature sequence4013 <1011 274 gene locus_tag LOCUS_70760 <1011 274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058242.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence4014 <1011 74 gene locus_tag LOCUS_70770 <1011 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000558138.1:PAS domain-containing protein >Feature sequence4015 485 225 gene locus_tag LOCUS_70780 485 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70780 >Feature sequence4016 932 78 gene locus_tag LOCUS_70790 932 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70790 >Feature sequence4017 <1010 303 gene locus_tag LOCUS_70800 <1010 303 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259588.1:glycosyltransferase family 4 protein >Feature sequence4018 <1 634 gene locus_tag LOCUS_70810 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057595.1:LCP family protein >Feature sequence4019 725 168 gene locus_tag LOCUS_70820 725 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70820 >Feature sequence4020 <1 842 gene locus_tag LOCUS_70830 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057482.1:CHAT domain-containing protein >Feature sequence4021 >Feature sequence4022 <1 599 gene locus_tag LOCUS_70840 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920959.1:MBL fold metallo-hydrolase >Feature sequence4023 >Feature sequence4024 99 596 gene locus_tag LOCUS_70850 99 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70850 >Feature sequence4025 1 261 gene locus_tag LOCUS_70860 1 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70860 >Feature sequence4026 >Feature sequence4027 863 63 gene locus_tag LOCUS_70870 863 63 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055925.1 protein_id gnl|my_center|LOCUS_70870 >Feature sequence4028 >Feature sequence4029 517 116 gene locus_tag LOCUS_70880 517 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143307.1 protein_id gnl|my_center|LOCUS_70880 >Feature sequence4030 221 955 gene locus_tag LOCUS_70890 221 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70890 >Feature sequence4031 <1 612 gene locus_tag LOCUS_70900 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143650.1:caspase family protein >Feature sequence4032 548 162 gene locus_tag LOCUS_70910 548 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70910 784 539 gene locus_tag LOCUS_70920 784 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70920 >Feature sequence4033 527 165 gene locus_tag LOCUS_70930 527 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70930 895 527 gene locus_tag LOCUS_70940 895 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70940 >Feature sequence4034 >Feature sequence4035 <1004 226 gene locus_tag LOCUS_70950 <1004 226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024124637.1:photosystem II reaction center protein CP43 >Feature sequence4036 818 438 gene locus_tag LOCUS_70960 818 438 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144314.1 protein_id gnl|my_center|LOCUS_70960 >Feature sequence4037 >Feature sequence4038 >Feature sequence4039 >Feature sequence4040 <1003 18 gene locus_tag LOCUS_70970 <1003 18 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530023.1:tocopherol cyclase family protein >Feature sequence4041 241 696 gene locus_tag LOCUS_70980 241 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_70980 >Feature sequence4042 <1003 169 gene locus_tag LOCUS_70990 <1003 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_088430287.1:cation:proton antiporter >Feature sequence4043 80 958 gene locus_tag LOCUS_71000 80 958 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803426.1 protein_id gnl|my_center|LOCUS_71000 >Feature sequence4044 256 486 gene locus_tag LOCUS_71010 256 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_71010 >Feature sequence4045 >Feature sequence4046 >Feature sequence4047 533 745 gene locus_tag LOCUS_71020 533 745 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057932.1 protein_id gnl|my_center|LOCUS_71020 >Feature sequence4048 >Feature sequence4049 >Feature sequence4050 >Feature sequence4051 <1000 150 gene locus_tag LOCUS_71030 <1000 150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058103.1:DUF3536 domain-containing protein >Feature sequence4052 124 498 gene locus_tag LOCUS_71040 124 498 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144197.1 protein_id gnl|my_center|LOCUS_71040