>Feature sequence01 210 135 gene locus_tag LOCUS_t00010 210 135 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 973 707 gene locus_tag LOCUS_00010 973 707 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_00010 2408 1374 gene locus_tag LOCUS_00020 gene mutY 2408 1374 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_00020 5009 2574 gene locus_tag LOCUS_00030 5009 2574 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_00030 5613 5224 gene locus_tag LOCUS_00040 5613 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6089 5550 gene locus_tag LOCUS_00050 6089 5550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6305 8041 gene locus_tag LOCUS_00060 6305 8041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8047 9585 gene locus_tag LOCUS_00070 8047 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9551 9937 gene locus_tag LOCUS_00080 9551 9937 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326711.1 protein_id gnl|my_center|LOCUS_00080 10070 10570 gene locus_tag LOCUS_00090 10070 10570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11496 10579 gene locus_tag LOCUS_00100 gene iaaA 11496 10579 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030503.1 protein_id gnl|my_center|LOCUS_00100 12945 11560 gene locus_tag LOCUS_00110 12945 11560 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259349.1 protein_id gnl|my_center|LOCUS_00110 13101 13028 gene locus_tag LOCUS_t00020 13101 13028 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13274 13948 gene locus_tag LOCUS_00120 gene trmB 13274 13948 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118800.1 protein_id gnl|my_center|LOCUS_00120 14008 14298 gene locus_tag LOCUS_00130 14008 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14846 14460 gene locus_tag LOCUS_00140 14846 14460 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_00140 16156 14843 gene locus_tag LOCUS_00150 16156 14843 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705057.1 protein_id gnl|my_center|LOCUS_00150 16913 16137 gene locus_tag LOCUS_00160 16913 16137 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190029.1 protein_id gnl|my_center|LOCUS_00160 16969 17637 gene locus_tag LOCUS_00170 gene pyrE 16969 17637 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073929.1 protein_id gnl|my_center|LOCUS_00170 17750 18394 gene locus_tag LOCUS_00180 17750 18394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 18860 18399 gene locus_tag LOCUS_00190 gene dut 18860 18399 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011566231.1 protein_id gnl|my_center|LOCUS_00190 20110 18857 gene locus_tag LOCUS_00200 gene coaBC 20110 18857 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_00200 20233 20916 gene locus_tag LOCUS_00210 gene radC 20233 20916 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114357.1 protein_id gnl|my_center|LOCUS_00210 21275 21511 gene locus_tag LOCUS_00220 gene rpmB 21275 21511 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048256.1 protein_id gnl|my_center|LOCUS_00220 21522 21686 gene locus_tag LOCUS_00230 gene rpmG 21522 21686 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002922510.1 protein_id gnl|my_center|LOCUS_00230 23018 21858 gene locus_tag LOCUS_00240 23018 21858 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186237.1 protein_id gnl|my_center|LOCUS_00240 23178 23993 gene locus_tag LOCUS_00250 gene mutM 23178 23993 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_00250 25696 24005 gene locus_tag LOCUS_00260 gene ggt 25696 24005 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037530.1 protein_id gnl|my_center|LOCUS_00260 26195 25710 gene locus_tag LOCUS_00270 gene coaD 26195 25710 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_00270 26924 26238 gene locus_tag LOCUS_00280 gene rsmD 26924 26238 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102864.1 protein_id gnl|my_center|LOCUS_00280 26914 27873 gene locus_tag LOCUS_00290 26914 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 27891 28598 gene locus_tag LOCUS_00300 gene ftsE 27891 28598 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_00300 28595 29509 gene locus_tag LOCUS_00310 gene ftsX 28595 29509 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00310 29609 30472 gene locus_tag LOCUS_00320 gene rpoH 29609 30472 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_00320 31301 30606 gene locus_tag LOCUS_00330 31301 30606 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004435511.1 protein_id gnl|my_center|LOCUS_00330 31443 31910 gene locus_tag LOCUS_00340 31443 31910 CDS product DUF962 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843542.1 protein_id gnl|my_center|LOCUS_00340 31903 33264 gene locus_tag LOCUS_00350 gene dinF 31903 33264 CDS product MATE family efflux transporter DinF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819117.1 protein_id gnl|my_center|LOCUS_00350 33293 33844 gene locus_tag LOCUS_00360 33293 33844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 33911 34522 gene locus_tag LOCUS_00370 33911 34522 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_00370 34547 35827 gene locus_tag LOCUS_00380 34547 35827 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103263.1 protein_id gnl|my_center|LOCUS_00380 35942 37681 gene locus_tag LOCUS_00390 35942 37681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 39437 37710 gene locus_tag LOCUS_00400 gene phaC 39437 37710 CDS product class I poly(R)-hydroxyalkanoic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390166.1 protein_id gnl|my_center|LOCUS_00400 40008 39550 gene locus_tag LOCUS_00410 40008 39550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 40719 40375 gene locus_tag LOCUS_00420 40719 40375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 41154 41816 gene locus_tag LOCUS_00430 41154 41816 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083659.1 protein_id gnl|my_center|LOCUS_00430 41839 43500 gene locus_tag LOCUS_00440 41839 43500 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881045.1 protein_id gnl|my_center|LOCUS_00440 45664 43754 gene locus_tag LOCUS_00450 45664 43754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 46277 45693 gene locus_tag LOCUS_00460 46277 45693 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_00460 48093 47152 gene locus_tag LOCUS_00470 48093 47152 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088041.1 protein_id gnl|my_center|LOCUS_00470 48092 49549 gene locus_tag LOCUS_00480 gene gabD 48092 49549 CDS product NADP-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106269.1 protein_id gnl|my_center|LOCUS_00480 49647 50564 gene locus_tag LOCUS_00490 49647 50564 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944061.1 protein_id gnl|my_center|LOCUS_00490 52101 51028 gene locus_tag LOCUS_00500 52101 51028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 52306 54378 gene locus_tag LOCUS_00510 52306 54378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 54375 55067 gene locus_tag LOCUS_00520 54375 55067 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054938388.1 protein_id gnl|my_center|LOCUS_00520 55207 56589 gene locus_tag LOCUS_00530 55207 56589 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060993309.1 protein_id gnl|my_center|LOCUS_00530 58110 57133 gene locus_tag LOCUS_00540 58110 57133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59375 58773 gene locus_tag LOCUS_00550 59375 58773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 59644 65826 gene locus_tag LOCUS_00560 59644 65826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 65948 66163 gene locus_tag LOCUS_00570 65948 66163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66259 66741 gene locus_tag LOCUS_00580 66259 66741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67270 66827 gene locus_tag LOCUS_00590 67270 66827 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761848.1 protein_id gnl|my_center|LOCUS_00590 69794 67302 gene locus_tag LOCUS_00600 69794 67302 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_00600 70480 69791 gene locus_tag LOCUS_00610 70480 69791 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090949.1 protein_id gnl|my_center|LOCUS_00610 70464 71105 gene locus_tag LOCUS_00620 gene tesA 70464 71105 CDS product esterase TesA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114753.1 protein_id gnl|my_center|LOCUS_00620 71983 71129 gene locus_tag LOCUS_00630 71983 71129 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_00630 72704 72036 gene locus_tag LOCUS_00640 gene pyrF 72704 72036 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039203.1 protein_id gnl|my_center|LOCUS_00640 73905 72838 gene locus_tag LOCUS_00650 73905 72838 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806949.1 protein_id gnl|my_center|LOCUS_00650 75479 74265 gene locus_tag LOCUS_00660 gene aroB 75479 74265 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_00660 76058 75525 gene locus_tag LOCUS_00670 gene aroK 76058 75525 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_00670 78301 76373 gene locus_tag LOCUS_00680 78301 76373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 80576 78342 gene locus_tag LOCUS_00690 gene pilQ 80576 78342 CDS product type 4a pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114575.1 protein_id gnl|my_center|LOCUS_00690 81129 80611 gene locus_tag LOCUS_00700 gene pilP 81129 80611 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_00700 81844 81134 gene locus_tag LOCUS_00710 81844 81134 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038333.1 protein_id gnl|my_center|LOCUS_00710 82428 81841 gene locus_tag LOCUS_00720 gene pilN 82428 81841 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_00720 83464 82430 gene locus_tag LOCUS_00730 83464 82430 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038335.1 protein_id gnl|my_center|LOCUS_00730 83930 86539 gene locus_tag LOCUS_00740 83930 86539 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_00740 86543 87148 gene locus_tag LOCUS_00750 86543 87148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942371.1 protein_id gnl|my_center|LOCUS_00750 88679 87387 gene locus_tag LOCUS_00760 gene gltA 88679 87387 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312523.1 protein_id gnl|my_center|LOCUS_00760 89164 88961 gene locus_tag LOCUS_00770 gene rpmE 89164 88961 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768737.1 protein_id gnl|my_center|LOCUS_00770 89353 89532 gene locus_tag LOCUS_00780 89353 89532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 90120 89494 gene locus_tag LOCUS_00790 gene rdgB 90120 89494 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043877719.1 protein_id gnl|my_center|LOCUS_00790 90838 90095 gene locus_tag LOCUS_00800 gene rph 90838 90095 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_00800 91593 90853 gene locus_tag LOCUS_00810 91593 90853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 91816 92673 gene locus_tag LOCUS_00820 91816 92673 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_00820 92715 92909 gene locus_tag LOCUS_00830 92715 92909 CDS product AlpA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211742.1 protein_id gnl|my_center|LOCUS_00830 93327 92902 gene locus_tag LOCUS_00840 93327 92902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 94007 93324 gene locus_tag LOCUS_00850 94007 93324 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410108.1 protein_id gnl|my_center|LOCUS_00850 94084 94380 gene locus_tag LOCUS_00860 94084 94380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 94738 95619 gene locus_tag LOCUS_00870 94738 95619 CDS product TauD/TfdA family dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065174.1 protein_id gnl|my_center|LOCUS_00870 96356 95751 gene locus_tag LOCUS_00880 96356 95751 CDS product plasmid pRiA4b ORF-3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188723012.1 protein_id gnl|my_center|LOCUS_00880 96639 97262 gene locus_tag LOCUS_00890 gene gmk 96639 97262 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_00890 97426 97719 gene locus_tag LOCUS_00900 97426 97719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 97802 99982 gene locus_tag LOCUS_00910 97802 99982 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144347086.1 protein_id gnl|my_center|LOCUS_00910 100012 100392 gene locus_tag LOCUS_00920 100012 100392 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367486.1 protein_id gnl|my_center|LOCUS_00920 100458 102527 gene locus_tag LOCUS_00930 gene recG 100458 102527 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096624.1 protein_id gnl|my_center|LOCUS_00930 102524 103441 gene locus_tag LOCUS_00940 gene ubiA 102524 103441 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772835.1 protein_id gnl|my_center|LOCUS_00940 103955 103422 gene locus_tag LOCUS_00950 103955 103422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 104265 105254 gene locus_tag LOCUS_00960 gene bioB 104265 105254 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035642.1 protein_id gnl|my_center|LOCUS_00960 105309 106157 gene locus_tag LOCUS_00970 105309 106157 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065340943.1 protein_id gnl|my_center|LOCUS_00970 106286 106762 gene locus_tag LOCUS_00980 106286 106762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 106795 107646 gene locus_tag LOCUS_00990 106795 107646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 107715 109298 gene locus_tag LOCUS_01000 gene ctaD 107715 109298 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_01000 109295 109414 gene locus_tag LOCUS_01010 109295 109414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 109418 109990 gene locus_tag LOCUS_01020 109418 109990 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_01020 110004 110873 gene locus_tag LOCUS_01030 110004 110873 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038909.1 protein_id gnl|my_center|LOCUS_01030 111041 112687 gene locus_tag LOCUS_01040 111041 112687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 112944 112732 gene locus_tag LOCUS_01050 112944 112732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 112965 113741 gene locus_tag LOCUS_01060 112965 113741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_01060 113738 114310 gene locus_tag LOCUS_01070 113738 114310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083738.1 protein_id gnl|my_center|LOCUS_01070 114354 115376 gene locus_tag LOCUS_01080 114354 115376 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_01080 115420 117588 gene locus_tag LOCUS_01090 gene uvrD 115420 117588 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383393.1 protein_id gnl|my_center|LOCUS_01090 117603 118979 gene locus_tag LOCUS_01100 gene trkA 117603 118979 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_01100 118992 120443 gene locus_tag LOCUS_01110 118992 120443 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_01110 120578 121693 gene locus_tag LOCUS_01120 120578 121693 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_01120 122138 122440 gene locus_tag LOCUS_01130 122138 122440 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008139488.1 protein_id gnl|my_center|LOCUS_01130 122608 123282 gene locus_tag LOCUS_01140 gene fkpA 122608 123282 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838241.1 protein_id gnl|my_center|LOCUS_01140 123413 124555 gene locus_tag LOCUS_01150 123413 124555 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535743.1 protein_id gnl|my_center|LOCUS_01150 124552 125112 gene locus_tag LOCUS_01160 124552 125112 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038144.1 protein_id gnl|my_center|LOCUS_01160 126146 125109 gene locus_tag LOCUS_01170 126146 125109 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172559.1 protein_id gnl|my_center|LOCUS_01170 127146 126166 gene locus_tag LOCUS_01180 127146 126166 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227960.1 protein_id gnl|my_center|LOCUS_01180 128041 127148 gene locus_tag LOCUS_01190 128041 127148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 129017 128064 gene locus_tag LOCUS_01200 129017 128064 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069490.1 protein_id gnl|my_center|LOCUS_01200 130874 129018 gene locus_tag LOCUS_01210 130874 129018 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206612.1 protein_id gnl|my_center|LOCUS_01210 131345 131803 gene locus_tag LOCUS_01220 gene dtd 131345 131803 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694618.1 protein_id gnl|my_center|LOCUS_01220 131946 132185 gene locus_tag LOCUS_01230 gene tatA 131946 132185 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_01230 132193 132534 gene locus_tag LOCUS_01240 gene tatB 132193 132534 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260927.1 protein_id gnl|my_center|LOCUS_01240 132556 133338 gene locus_tag LOCUS_01250 gene tatC 132556 133338 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765541.1 protein_id gnl|my_center|LOCUS_01250 133531 135420 gene locus_tag LOCUS_01260 133531 135420 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_01260 135518 135829 gene locus_tag LOCUS_01270 135518 135829 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171395.1 protein_id gnl|my_center|LOCUS_01270 136334 135918 gene locus_tag LOCUS_01280 136334 135918 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941659.1 protein_id gnl|my_center|LOCUS_01280 136456 136881 gene locus_tag LOCUS_01290 136456 136881 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535003.1 protein_id gnl|my_center|LOCUS_01290 137986 136919 gene locus_tag LOCUS_01300 137986 136919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 139348 138113 gene locus_tag LOCUS_01310 139348 138113 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413541.1 protein_id gnl|my_center|LOCUS_01310 140531 139419 gene locus_tag LOCUS_01320 140531 139419 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958285.1 protein_id gnl|my_center|LOCUS_01320 140704 141150 gene locus_tag LOCUS_01330 140704 141150 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307875.1 protein_id gnl|my_center|LOCUS_01330 141158 141427 gene locus_tag LOCUS_01340 gene grxC 141158 141427 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918714.1 protein_id gnl|my_center|LOCUS_01340 141476 142489 gene locus_tag LOCUS_01350 gene gpsA 141476 142489 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704301.1 protein_id gnl|my_center|LOCUS_01350 142957 142502 gene locus_tag LOCUS_01360 gene trmL 142957 142502 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218664.1 protein_id gnl|my_center|LOCUS_01360 142969 143946 gene locus_tag LOCUS_01370 142969 143946 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_01370 144953 144033 gene locus_tag LOCUS_01380 gene ada 144953 144033 CDS product bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172581.1 protein_id gnl|my_center|LOCUS_01380 146480 145074 gene locus_tag LOCUS_01390 gene glnG 146480 145074 CDS product nitrogen regulation protein NR(I) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001188774.1 protein_id gnl|my_center|LOCUS_01390 147406 146477 gene locus_tag LOCUS_01400 gene ntrB 147406 146477 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_01400 148140 147568 gene locus_tag LOCUS_01410 148140 147568 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_01410 149632 148220 gene locus_tag LOCUS_01420 gene glnA 149632 148220 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_01420 150076 150993 gene locus_tag LOCUS_01430 gene glyQ 150076 150993 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097276.1 protein_id gnl|my_center|LOCUS_01430 151019 153124 gene locus_tag LOCUS_01440 gene glyS 151019 153124 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703776.1 protein_id gnl|my_center|LOCUS_01440 153141 153701 gene locus_tag LOCUS_01450 gene gmhB 153141 153701 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064982.1 protein_id gnl|my_center|LOCUS_01450 153701 154414 gene locus_tag LOCUS_01460 153701 154414 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_01460 156928 154511 gene locus_tag LOCUS_01470 gene gyrB 156928 154511 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356688.1 protein_id gnl|my_center|LOCUS_01470 158049 156958 gene locus_tag LOCUS_01480 gene recF 158049 156958 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266123.1 protein_id gnl|my_center|LOCUS_01480 159161 158061 gene locus_tag LOCUS_01490 gene dnaN 159161 158061 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_01490 160757 159423 gene locus_tag LOCUS_01500 gene dnaA 160757 159423 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_01500 161152 161451 gene locus_tag LOCUS_01510 161152 161451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 161464 163128 gene locus_tag LOCUS_01520 gene yidC 161464 163128 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_01520 163159 164523 gene locus_tag LOCUS_01530 gene mnmE 163159 164523 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152320698.1 protein_id gnl|my_center|LOCUS_01530 165342 164560 gene locus_tag LOCUS_01540 165342 164560 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_01540 168488 165339 gene locus_tag LOCUS_01550 168488 165339 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681375.1 protein_id gnl|my_center|LOCUS_01550 170014 168485 gene locus_tag LOCUS_01560 170014 168485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 171250 170084 gene locus_tag LOCUS_01570 171250 170084 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_01570 173413 171449 gene locus_tag LOCUS_01580 173413 171449 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080566.1 protein_id gnl|my_center|LOCUS_01580 174354 173410 gene locus_tag LOCUS_01590 174354 173410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 176966 174540 gene locus_tag LOCUS_01600 176966 174540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 177137 176970 gene locus_tag LOCUS_01610 177137 176970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 178650 177259 gene locus_tag LOCUS_01620 178650 177259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 179971 178775 gene locus_tag LOCUS_01630 179971 178775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 180153 182045 gene locus_tag LOCUS_01640 gene mnmG 180153 182045 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499797.1 protein_id gnl|my_center|LOCUS_01640 182042 183766 gene locus_tag LOCUS_01650 182042 183766 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706430.1 protein_id gnl|my_center|LOCUS_01650 183819 184841 gene locus_tag LOCUS_01660 gene oppB 183819 184841 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816417.1 protein_id gnl|my_center|LOCUS_01660 184838 185719 gene locus_tag LOCUS_01670 184838 185719 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_01670 185716 187530 gene locus_tag LOCUS_01680 185716 187530 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339157.1 protein_id gnl|my_center|LOCUS_01680 188454 187711 gene locus_tag LOCUS_01690 188454 187711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 188601 189188 gene locus_tag LOCUS_01700 188601 189188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 189261 190277 gene locus_tag LOCUS_01710 189261 190277 CDS product acryloyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233163.1 protein_id gnl|my_center|LOCUS_01710 190359 190997 gene locus_tag LOCUS_01720 gene rsmG 190359 190997 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099403.1 protein_id gnl|my_center|LOCUS_01720 190990 191757 gene locus_tag LOCUS_01730 190990 191757 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_01730 192146 193075 gene locus_tag LOCUS_01740 192146 193075 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377885.1 protein_id gnl|my_center|LOCUS_01740 193307 193741 gene locus_tag LOCUS_01750 193307 193741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 193742 194584 gene locus_tag LOCUS_01760 gene atpB 193742 194584 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_01760 194635 194904 gene locus_tag LOCUS_01770 gene atpE 194635 194904 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555987.1 protein_id gnl|my_center|LOCUS_01770 194954 195424 gene locus_tag LOCUS_01780 gene atpF 194954 195424 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 protein_id gnl|my_center|LOCUS_01780 195434 196000 gene locus_tag LOCUS_01790 195434 196000 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_01790 196038 197579 gene locus_tag LOCUS_01800 gene atpA 196038 197579 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_01800 197681 198541 gene locus_tag LOCUS_01810 gene atpG 197681 198541 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_01810 198632 200011 gene locus_tag LOCUS_01820 gene atpD 198632 200011 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_01820 200026 200466 gene locus_tag LOCUS_01830 200026 200466 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_01830 200472 201833 gene locus_tag LOCUS_01840 200472 201833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 201962 203326 gene locus_tag LOCUS_01850 gene glmU 201962 203326 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064821.1 protein_id gnl|my_center|LOCUS_01850 203509 205341 gene locus_tag LOCUS_01860 gene glmS 203509 205341 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105589.1 protein_id gnl|my_center|LOCUS_01860 205408 205959 gene locus_tag LOCUS_01870 205408 205959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 207428 206118 gene locus_tag LOCUS_01880 207428 206118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 207772 208797 gene locus_tag LOCUS_01890 gene mer 207772 208797 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_01890 210390 209059 gene locus_tag LOCUS_01900 gene rimO 210390 209059 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206991.1 protein_id gnl|my_center|LOCUS_01900 211537 210464 gene locus_tag LOCUS_01910 211537 210464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 212397 211633 gene locus_tag LOCUS_01920 gene xth 212397 211633 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004546769.1 protein_id gnl|my_center|LOCUS_01920 214490 212394 gene locus_tag LOCUS_01930 gene prlC 214490 212394 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704124.1 protein_id gnl|my_center|LOCUS_01930 214565 215914 gene locus_tag LOCUS_01940 gene gorA 214565 215914 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817382.1 protein_id gnl|my_center|LOCUS_01940 216817 216005 gene locus_tag LOCUS_01950 gene aroE 216817 216005 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_01950 217049 217636 gene locus_tag LOCUS_01960 217049 217636 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937663.1 protein_id gnl|my_center|LOCUS_01960 220930 217676 gene locus_tag LOCUS_01970 220930 217676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 221494 220955 gene locus_tag LOCUS_01980 221494 220955 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038838.1 protein_id gnl|my_center|LOCUS_01980 223988 221565 gene locus_tag LOCUS_01990 223988 221565 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038837.1 protein_id gnl|my_center|LOCUS_01990 224538 224062 gene locus_tag LOCUS_02000 224538 224062 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704269.1 protein_id gnl|my_center|LOCUS_02000 225674 224556 gene locus_tag LOCUS_02010 gene dprA 225674 224556 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038833.1 protein_id gnl|my_center|LOCUS_02010 226885 225767 gene locus_tag LOCUS_02020 226885 225767 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_02020 227112 227648 gene locus_tag LOCUS_02030 gene def 227112 227648 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107059.1 protein_id gnl|my_center|LOCUS_02030 227715 228668 gene locus_tag LOCUS_02040 gene fmt 227715 228668 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038830.1 protein_id gnl|my_center|LOCUS_02040 228665 230005 gene locus_tag LOCUS_02050 gene rsmB 228665 230005 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_02050 230055 230642 gene locus_tag LOCUS_02060 230055 230642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 230639 232843 gene locus_tag LOCUS_02070 230639 232843 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_02070 232849 234222 gene locus_tag LOCUS_02080 232849 234222 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087262.1 protein_id gnl|my_center|LOCUS_02080 235404 234325 gene locus_tag LOCUS_02090 235404 234325 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528474.1 protein_id gnl|my_center|LOCUS_02090 235889 235401 gene locus_tag LOCUS_02100 235889 235401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 237882 235993 gene locus_tag LOCUS_02110 gene argS 237882 235993 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837654.1 protein_id gnl|my_center|LOCUS_02110 237881 238582 gene locus_tag LOCUS_02120 237881 238582 CDS product N-formylglutamate amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946126.1 protein_id gnl|my_center|LOCUS_02120 240863 238617 gene locus_tag LOCUS_02130 240863 238617 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105332.1 protein_id gnl|my_center|LOCUS_02130 241274 241005 gene locus_tag LOCUS_02140 241274 241005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 241299 241898 gene locus_tag LOCUS_02150 241299 241898 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_02150 241895 242326 gene locus_tag LOCUS_02160 241895 242326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 242331 242570 gene locus_tag LOCUS_02170 242331 242570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 242554 243066 gene locus_tag LOCUS_02180 242554 243066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 243183 244850 gene locus_tag LOCUS_02190 gene pntA 243183 244850 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705256.1 protein_id gnl|my_center|LOCUS_02190 244863 246272 gene locus_tag LOCUS_02200 gene pntB 244863 246272 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705257.1 protein_id gnl|my_center|LOCUS_02200 247837 246284 gene locus_tag LOCUS_02210 247837 246284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 248382 247882 gene locus_tag LOCUS_02220 248382 247882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 250374 248449 gene locus_tag LOCUS_02230 250374 248449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 251006 250458 gene locus_tag LOCUS_02240 251006 250458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 251885 251472 gene locus_tag LOCUS_02250 251885 251472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 252082 251882 gene locus_tag LOCUS_02260 252082 251882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 252175 253035 gene locus_tag LOCUS_02270 252175 253035 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037844.1 protein_id gnl|my_center|LOCUS_02270 253390 254577 gene locus_tag LOCUS_02280 253390 254577 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_02280 254801 255457 gene locus_tag LOCUS_02290 254801 255457 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037574.1 protein_id gnl|my_center|LOCUS_02290 255927 256289 gene locus_tag LOCUS_02300 255927 256289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 256339 258000 gene locus_tag LOCUS_02310 256339 258000 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179844.1 protein_id gnl|my_center|LOCUS_02310 257997 258929 gene locus_tag LOCUS_02320 257997 258929 CDS product TniB family NTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003465065.1 protein_id gnl|my_center|LOCUS_02320 258931 259896 gene locus_tag LOCUS_02330 258931 259896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 >Feature sequence02 356 1762 gene locus_tag LOCUS_02340 gene leuC 356 1762 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197535740.1 protein_id gnl|my_center|LOCUS_02340 2486 3169 gene locus_tag LOCUS_02350 gene leuD 2486 3169 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083247.1 protein_id gnl|my_center|LOCUS_02350 3796 3188 gene locus_tag LOCUS_02360 3796 3188 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_02360 5021 3819 gene locus_tag LOCUS_02370 5021 3819 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808121.1 protein_id gnl|my_center|LOCUS_02370 5166 6128 gene locus_tag LOCUS_02380 5166 6128 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206797.1 protein_id gnl|my_center|LOCUS_02380 6221 6661 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcggcgccagccgcgacagatgacgccgcggcgc 7938 6715 gene locus_tag LOCUS_02390 7938 6715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 9151 8258 gene locus_tag LOCUS_02400 9151 8258 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528660.1 protein_id gnl|my_center|LOCUS_02400 9563 10282 gene locus_tag LOCUS_02410 9563 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 10874 10317 gene locus_tag LOCUS_02420 10874 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 11380 10916 gene locus_tag LOCUS_02430 11380 10916 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174739.1 protein_id gnl|my_center|LOCUS_02430 12496 11528 gene locus_tag LOCUS_02440 12496 11528 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_02440 13405 12545 gene locus_tag LOCUS_02450 13405 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 13540 14706 gene locus_tag LOCUS_02460 13540 14706 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213649.1 protein_id gnl|my_center|LOCUS_02460 14740 16239 gene locus_tag LOCUS_02470 14740 16239 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947081.1 protein_id gnl|my_center|LOCUS_02470 18926 16326 gene locus_tag LOCUS_02480 18926 16326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 19387 20379 gene locus_tag LOCUS_02490 gene corA 19387 20379 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968502.1 protein_id gnl|my_center|LOCUS_02490 20582 21010 gene locus_tag LOCUS_02500 20582 21010 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_02500 22042 21257 gene locus_tag LOCUS_02510 22042 21257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 23527 22382 gene locus_tag LOCUS_02520 23527 22382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 24562 23690 gene locus_tag LOCUS_02530 24562 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 26513 24933 gene locus_tag LOCUS_02540 26513 24933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 26763 28043 gene locus_tag LOCUS_02550 26763 28043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 28918 28085 gene locus_tag LOCUS_02560 28918 28085 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070869.1 protein_id gnl|my_center|LOCUS_02560 33315 29017 gene locus_tag LOCUS_02570 33315 29017 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147933.1 protein_id gnl|my_center|LOCUS_02570 33465 33821 gene locus_tag LOCUS_02580 33465 33821 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339062.1 protein_id gnl|my_center|LOCUS_02580 34798 33962 gene locus_tag LOCUS_02590 gene fdhD 34798 33962 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228505.1 protein_id gnl|my_center|LOCUS_02590 35867 34806 gene locus_tag LOCUS_02600 gene moaA 35867 34806 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_02600 36045 37052 gene locus_tag LOCUS_02610 36045 37052 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_02610 37078 38163 gene locus_tag LOCUS_02620 37078 38163 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072950.1 protein_id gnl|my_center|LOCUS_02620 38160 39389 gene locus_tag LOCUS_02630 38160 39389 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_02630 41003 39408 gene locus_tag LOCUS_02640 41003 39408 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388350.1 protein_id gnl|my_center|LOCUS_02640 41788 41105 gene locus_tag LOCUS_02650 41788 41105 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187213.1 protein_id gnl|my_center|LOCUS_02650 41891 42334 gene locus_tag LOCUS_02660 41891 42334 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086642.1 protein_id gnl|my_center|LOCUS_02660 43016 42417 gene locus_tag LOCUS_02670 43016 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012296472.1 protein_id gnl|my_center|LOCUS_02670 46217 43077 gene locus_tag LOCUS_02680 46217 43077 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943409.1 protein_id gnl|my_center|LOCUS_02680 47323 46214 gene locus_tag LOCUS_02690 47323 46214 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968568.1 protein_id gnl|my_center|LOCUS_02690 47662 48069 gene locus_tag LOCUS_02700 gene rnk 47662 48069 CDS product nucleoside diphosphate kinase regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072033.1 protein_id gnl|my_center|LOCUS_02700 48176 48835 gene locus_tag LOCUS_02710 48176 48835 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235191067.1 protein_id gnl|my_center|LOCUS_02710 49680 48934 gene locus_tag LOCUS_02720 49680 48934 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_02720 50039 49677 gene locus_tag LOCUS_02730 50039 49677 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262443.1 protein_id gnl|my_center|LOCUS_02730 51407 50103 gene locus_tag LOCUS_02740 51407 50103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 52060 51404 gene locus_tag LOCUS_02750 52060 51404 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_02750 52662 54548 gene locus_tag LOCUS_02760 52662 54548 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246686.1 protein_id gnl|my_center|LOCUS_02760 56124 54589 gene locus_tag LOCUS_02770 56124 54589 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200059.1 protein_id gnl|my_center|LOCUS_02770 57452 56121 gene locus_tag LOCUS_02780 57452 56121 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920685.1 protein_id gnl|my_center|LOCUS_02780 57590 58021 gene locus_tag LOCUS_02790 57590 58021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 58097 58579 gene locus_tag LOCUS_02800 gene moaB 58097 58579 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093023.1 protein_id gnl|my_center|LOCUS_02800 58584 59378 gene locus_tag LOCUS_02810 gene gloB 58584 59378 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066773.1 protein_id gnl|my_center|LOCUS_02810 59812 59888 gene locus_tag LOCUS_t00030 59812 59888 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 60125 60718 gene locus_tag LOCUS_02820 60125 60718 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143585.1 protein_id gnl|my_center|LOCUS_02820 60787 61281 gene locus_tag LOCUS_02830 60787 61281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 61905 62183 gene locus_tag LOCUS_02840 61905 62183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 62180 62566 gene locus_tag LOCUS_02850 62180 62566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 62563 62880 gene locus_tag LOCUS_02860 62563 62880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 62880 63410 gene locus_tag LOCUS_02870 gene def 62880 63410 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064978.1 protein_id gnl|my_center|LOCUS_02870 63827 63456 gene locus_tag LOCUS_02880 63827 63456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012438863.1 protein_id gnl|my_center|LOCUS_02880 64329 63844 gene locus_tag LOCUS_02890 64329 63844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 65370 64606 gene locus_tag LOCUS_02900 65370 64606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_02900 66607 65405 gene locus_tag LOCUS_02910 66607 65405 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_02910 67167 66604 gene locus_tag LOCUS_02920 67167 66604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 67833 67249 gene locus_tag LOCUS_02930 67833 67249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 68483 68100 gene locus_tag LOCUS_02940 68483 68100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 69842 68649 gene locus_tag LOCUS_02950 69842 68649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 70223 71518 gene locus_tag LOCUS_02960 70223 71518 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389663.1 protein_id gnl|my_center|LOCUS_02960 71529 72506 gene locus_tag LOCUS_02970 71529 72506 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_02970 72530 73630 gene locus_tag LOCUS_02980 72530 73630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 73769 74968 gene locus_tag LOCUS_02990 73769 74968 CDS product carbohydrate porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920728.1 protein_id gnl|my_center|LOCUS_02990 77878 75257 gene locus_tag LOCUS_03000 77878 75257 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_03000 78059 78676 gene locus_tag LOCUS_03010 78059 78676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 79403 78684 gene locus_tag LOCUS_03020 79403 78684 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249330.1 protein_id gnl|my_center|LOCUS_03020 80622 79408 gene locus_tag LOCUS_03030 80622 79408 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727834.1 protein_id gnl|my_center|LOCUS_03030 81983 80667 gene locus_tag LOCUS_03040 81983 80667 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172863.1 protein_id gnl|my_center|LOCUS_03040 82489 81980 gene locus_tag LOCUS_03050 82489 81980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 83502 82486 gene locus_tag LOCUS_03060 83502 82486 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929896.1 protein_id gnl|my_center|LOCUS_03060 84130 84480 gene locus_tag LOCUS_03070 84130 84480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 85025 84768 gene locus_tag LOCUS_03080 85025 84768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 85471 85103 gene locus_tag LOCUS_03090 85471 85103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 85665 88289 gene locus_tag LOCUS_03100 gene glgP 85665 88289 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_03100 88307 90388 gene locus_tag LOCUS_03110 gene glgX 88307 90388 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021995.1 protein_id gnl|my_center|LOCUS_03110 90483 91715 gene locus_tag LOCUS_03120 90483 91715 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172666.1 protein_id gnl|my_center|LOCUS_03120 91715 94867 gene locus_tag LOCUS_03130 91715 94867 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393635.1 protein_id gnl|my_center|LOCUS_03130 95119 95658 gene locus_tag LOCUS_03140 95119 95658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 97055 95826 gene locus_tag LOCUS_03150 gene pvdM 97055 95826 CDS product pyoverdine-tailoring dipeptidase-like protein PvdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246323.1 protein_id gnl|my_center|LOCUS_03150 97269 98339 gene locus_tag LOCUS_03160 97269 98339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 98350 98751 gene locus_tag LOCUS_03170 98350 98751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 99401 98829 gene locus_tag LOCUS_03180 99401 98829 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063830.1 protein_id gnl|my_center|LOCUS_03180 100317 99451 gene locus_tag LOCUS_03190 100317 99451 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705784.1 protein_id gnl|my_center|LOCUS_03190 100446 101351 gene locus_tag LOCUS_03200 100446 101351 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811380.1 protein_id gnl|my_center|LOCUS_03200 101893 102096 gene locus_tag LOCUS_03210 101893 102096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 102788 103009 gene locus_tag LOCUS_03220 102788 103009 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_03220 103002 103223 gene locus_tag LOCUS_03230 103002 103223 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755925.1 protein_id gnl|my_center|LOCUS_03230 103762 103244 gene locus_tag LOCUS_03240 103762 103244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 104585 104073 gene locus_tag LOCUS_03250 104585 104073 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_03250 106813 104594 gene locus_tag LOCUS_03260 gene glgB 106813 104594 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_03260 106923 108233 gene locus_tag LOCUS_03270 gene glgC 106923 108233 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_03270 108247 109698 gene locus_tag LOCUS_03280 gene malQ 108247 109698 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094267720.1 protein_id gnl|my_center|LOCUS_03280 111194 109737 gene locus_tag LOCUS_03290 gene glgA 111194 109737 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_03290 111759 111319 gene locus_tag LOCUS_03300 111759 111319 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941779.1 protein_id gnl|my_center|LOCUS_03300 112444 111968 gene locus_tag LOCUS_03310 112444 111968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 112781 112470 gene locus_tag LOCUS_03320 112781 112470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 113617 112883 gene locus_tag LOCUS_03330 113617 112883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 113842 114243 gene locus_tag LOCUS_03340 gene flgB 113842 114243 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003370068.1 protein_id gnl|my_center|LOCUS_03340 114246 114671 gene locus_tag LOCUS_03350 gene flgC 114246 114671 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811891.1 protein_id gnl|my_center|LOCUS_03350 114691 115380 gene locus_tag LOCUS_03360 114691 115380 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037114.1 protein_id gnl|my_center|LOCUS_03360 115429 116625 gene locus_tag LOCUS_03370 gene flgE 115429 116625 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_03370 116654 117397 gene locus_tag LOCUS_03380 gene flgF 116654 117397 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185014.1 protein_id gnl|my_center|LOCUS_03380 117425 118207 gene locus_tag LOCUS_03390 gene flgG 117425 118207 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 protein_id gnl|my_center|LOCUS_03390 118211 118927 gene locus_tag LOCUS_03400 gene flgH 118211 118927 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037111.1 protein_id gnl|my_center|LOCUS_03400 118948 120084 gene locus_tag LOCUS_03410 118948 120084 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 protein_id gnl|my_center|LOCUS_03410 120098 121093 gene locus_tag LOCUS_03420 gene flgJ 120098 121093 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197262.1 protein_id gnl|my_center|LOCUS_03420 121144 123036 gene locus_tag LOCUS_03430 gene flgK 121144 123036 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_03430 123037 124230 gene locus_tag LOCUS_03440 gene flgL 123037 124230 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037107.1 protein_id gnl|my_center|LOCUS_03440 125540 124278 gene locus_tag LOCUS_03450 125540 124278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 125867 127309 gene locus_tag LOCUS_03460 125867 127309 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_03460 127517 127879 gene locus_tag LOCUS_03470 127517 127879 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112502.1 protein_id gnl|my_center|LOCUS_03470 127969 129330 gene locus_tag LOCUS_03480 gene fliD 127969 129330 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_03480 129354 129776 gene locus_tag LOCUS_03490 gene fliS 129354 129776 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000287765.1 protein_id gnl|my_center|LOCUS_03490 129716 130138 gene locus_tag LOCUS_03500 129716 130138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 130135 130743 gene locus_tag LOCUS_03510 130135 130743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 130868 132094 gene locus_tag LOCUS_03520 gene fleS 130868 132094 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_03520 132091 133512 gene locus_tag LOCUS_03530 gene fleR 132091 133512 CDS product sigma-54-dependent response regulator transcription factor FleR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082202.1 protein_id gnl|my_center|LOCUS_03530 133525 133839 gene locus_tag LOCUS_03540 gene fliE 133525 133839 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_03540 133886 135541 gene locus_tag LOCUS_03550 gene fliF 133886 135541 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063741.1 protein_id gnl|my_center|LOCUS_03550 135534 136535 gene locus_tag LOCUS_03560 gene fliG 135534 136535 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073111.1 protein_id gnl|my_center|LOCUS_03560 136535 137173 gene locus_tag LOCUS_03570 136535 137173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 137142 138536 gene locus_tag LOCUS_03580 gene fliI 137142 138536 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_03580 138540 138965 gene locus_tag LOCUS_03590 138540 138965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 139105 140418 gene locus_tag LOCUS_03600 139105 140418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 140605 141177 gene locus_tag LOCUS_03610 gene fliL 140605 141177 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343996.1 protein_id gnl|my_center|LOCUS_03610 141188 142177 gene locus_tag LOCUS_03620 gene fliM 141188 142177 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_03620 142170 142553 gene locus_tag LOCUS_03630 142170 142553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 142565 142978 gene locus_tag LOCUS_03640 142565 142978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 142975 143721 gene locus_tag LOCUS_03650 gene fliP 142975 143721 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_03650 143744 144001 gene locus_tag LOCUS_03660 143744 144001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 144013 144783 gene locus_tag LOCUS_03670 gene fliR 144013 144783 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705283.1 protein_id gnl|my_center|LOCUS_03670 144786 145988 gene locus_tag LOCUS_03680 gene flhB 144786 145988 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938913.1 protein_id gnl|my_center|LOCUS_03680 146001 148082 gene locus_tag LOCUS_03690 gene flhA 146001 148082 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_03690 148129 149352 gene locus_tag LOCUS_03700 148129 149352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 149339 150265 gene locus_tag LOCUS_03710 149339 150265 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010374294.1 protein_id gnl|my_center|LOCUS_03710 150262 151017 gene locus_tag LOCUS_03720 gene fliA 150262 151017 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378731.1 protein_id gnl|my_center|LOCUS_03720 151025 151765 gene locus_tag LOCUS_03730 151025 151765 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037059.1 protein_id gnl|my_center|LOCUS_03730 151789 152661 gene locus_tag LOCUS_03740 gene motD 151789 152661 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037058.1 protein_id gnl|my_center|LOCUS_03740 152658 152840 gene locus_tag LOCUS_03750 152658 152840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 152853 153251 gene locus_tag LOCUS_03760 152853 153251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 153316 154836 gene locus_tag LOCUS_03770 153316 154836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 154968 155432 gene locus_tag LOCUS_03780 154968 155432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 156644 155472 gene locus_tag LOCUS_03790 156644 155472 CDS product FAD-dependent monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815139.1 protein_id gnl|my_center|LOCUS_03790 156668 158179 gene locus_tag LOCUS_03800 gene dhaS 156668 158179 CDS product aldehyde dehydrogenase DhaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080288.1 protein_id gnl|my_center|LOCUS_03800 158300 158854 gene locus_tag LOCUS_03810 158300 158854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 160055 158898 gene locus_tag LOCUS_03820 160055 158898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 160391 160260 gene locus_tag LOCUS_03830 160391 160260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 160950 161720 gene locus_tag LOCUS_03840 160950 161720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 161897 164362 gene locus_tag LOCUS_03850 gene copA1 161897 164362 CDS product copper-translocating P-type ATPase CopA1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093042.1 protein_id gnl|my_center|LOCUS_03850 164424 164633 gene locus_tag LOCUS_03860 164424 164633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 165984 164659 gene locus_tag LOCUS_03870 165984 164659 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_03870 167587 166010 gene locus_tag LOCUS_03880 167587 166010 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086088023.1 protein_id gnl|my_center|LOCUS_03880 168448 167696 gene locus_tag LOCUS_03890 168448 167696 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941989.1 protein_id gnl|my_center|LOCUS_03890 169477 168485 gene locus_tag LOCUS_03900 169477 168485 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_03900 170982 169588 gene locus_tag LOCUS_03910 170982 169588 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_03910 171130 172200 gene locus_tag LOCUS_03920 171130 172200 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_03920 172672 172247 gene locus_tag LOCUS_03930 172672 172247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 173171 172665 gene locus_tag LOCUS_03940 173171 172665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 174744 173164 gene locus_tag LOCUS_03950 174744 173164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 175582 174782 gene locus_tag LOCUS_03960 175582 174782 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940893.1 protein_id gnl|my_center|LOCUS_03960 176463 175594 gene locus_tag LOCUS_03970 176463 175594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 178229 176538 gene locus_tag LOCUS_03980 178229 176538 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903627.1 protein_id gnl|my_center|LOCUS_03980 178777 178226 gene locus_tag LOCUS_03990 178777 178226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 178988 178794 gene locus_tag LOCUS_04000 178988 178794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 179270 179088 gene locus_tag LOCUS_04010 179270 179088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 180409 179267 gene locus_tag LOCUS_04020 gene hisC 180409 179267 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_04020 180611 181414 gene locus_tag LOCUS_04030 180611 181414 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073519.1 protein_id gnl|my_center|LOCUS_04030 182490 181495 gene locus_tag LOCUS_04040 gene cysB 182490 181495 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634254.1 protein_id gnl|my_center|LOCUS_04040 182688 184133 gene locus_tag LOCUS_04050 gene cysG 182688 184133 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707782.1 protein_id gnl|my_center|LOCUS_04050 184157 185125 gene locus_tag LOCUS_04060 gene cysK 184157 185125 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038289.1 protein_id gnl|my_center|LOCUS_04060 185163 186062 gene locus_tag LOCUS_04070 185163 186062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 186068 187606 gene locus_tag LOCUS_04080 186068 187606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 187594 188571 gene locus_tag LOCUS_04090 gene hemB 187594 188571 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000448660.1 protein_id gnl|my_center|LOCUS_04090 188583 189860 gene locus_tag LOCUS_04100 188583 189860 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001075137.1 protein_id gnl|my_center|LOCUS_04100 189873 190829 gene locus_tag LOCUS_04110 189873 190829 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039480.1 protein_id gnl|my_center|LOCUS_04110 191097 190873 gene locus_tag LOCUS_04120 191097 190873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 191096 192322 gene locus_tag LOCUS_04130 191096 192322 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176993997.1 protein_id gnl|my_center|LOCUS_04130 192425 195073 gene locus_tag LOCUS_04140 192425 195073 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942321.1 protein_id gnl|my_center|LOCUS_04140 195982 195122 gene locus_tag LOCUS_04150 195982 195122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 197751 196111 gene locus_tag LOCUS_04160 197751 196111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 198649 197831 gene locus_tag LOCUS_04170 198649 197831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 200123 198708 gene locus_tag LOCUS_04180 200123 198708 CDS product o-succinylbenzoate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256006.1 protein_id gnl|my_center|LOCUS_04180 200243 201406 gene locus_tag LOCUS_04190 200243 201406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 202206 201391 gene locus_tag LOCUS_04200 202206 201391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 203117 202314 gene locus_tag LOCUS_04210 203117 202314 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175136.1 protein_id gnl|my_center|LOCUS_04210 203388 204293 gene locus_tag LOCUS_04220 203388 204293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 205589 204930 gene locus_tag LOCUS_04230 205589 204930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 205701 206375 gene locus_tag LOCUS_04240 205701 206375 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014329844.1 protein_id gnl|my_center|LOCUS_04240 206902 206411 gene locus_tag LOCUS_04250 206902 206411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 207316 208053 gene locus_tag LOCUS_04260 207316 208053 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530097.1 protein_id gnl|my_center|LOCUS_04260 210407 208152 gene locus_tag LOCUS_04270 210407 208152 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_04270 210906 210391 gene locus_tag LOCUS_04280 210906 210391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 211904 210903 gene locus_tag LOCUS_04290 211904 210903 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530704.1 protein_id gnl|my_center|LOCUS_04290 212211 213014 gene locus_tag LOCUS_04300 212211 213014 CDS product YSC84-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275486.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence03 695 1993 gene locus_tag LOCUS_04310 695 1993 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932090.1 protein_id gnl|my_center|LOCUS_04310 2840 2139 gene locus_tag LOCUS_04320 2840 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3468 2857 gene locus_tag LOCUS_04330 3468 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 3819 6713 gene locus_tag LOCUS_04340 3819 6713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6932 8395 gene locus_tag LOCUS_04350 6932 8395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 8546 9433 gene locus_tag LOCUS_04360 8546 9433 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037730.1 protein_id gnl|my_center|LOCUS_04360 10218 9460 gene locus_tag LOCUS_04370 10218 9460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 10424 11329 gene locus_tag LOCUS_04380 10424 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11329 12186 gene locus_tag LOCUS_04390 11329 12186 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421145.1 protein_id gnl|my_center|LOCUS_04390 12201 13736 gene locus_tag LOCUS_04400 12201 13736 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_04400 13755 14387 gene locus_tag LOCUS_04410 13755 14387 CDS product 2-hydroxychromene-2-carboxylate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088352.1 protein_id gnl|my_center|LOCUS_04410 14435 17254 gene locus_tag LOCUS_04420 14435 17254 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945117.1 protein_id gnl|my_center|LOCUS_04420 17239 18255 gene locus_tag LOCUS_04430 17239 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 18261 19073 gene locus_tag LOCUS_04440 18261 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 19681 19397 gene locus_tag LOCUS_04450 19681 19397 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_04450 19977 19678 gene locus_tag LOCUS_04460 19977 19678 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091489.1 protein_id gnl|my_center|LOCUS_04460 20589 19981 gene locus_tag LOCUS_04470 20589 19981 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957880.1 protein_id gnl|my_center|LOCUS_04470 20819 20586 gene locus_tag LOCUS_04480 20819 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 20700 21254 gene locus_tag LOCUS_04490 20700 21254 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328048.1 protein_id gnl|my_center|LOCUS_04490 21297 21971 gene locus_tag LOCUS_04500 21297 21971 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_04500 21974 22894 gene locus_tag LOCUS_04510 21974 22894 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037357.1 protein_id gnl|my_center|LOCUS_04510 22901 23656 gene locus_tag LOCUS_04520 22901 23656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 23700 24518 gene locus_tag LOCUS_04530 23700 24518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 24536 25204 gene locus_tag LOCUS_04540 24536 25204 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_04540 26011 25238 gene locus_tag LOCUS_04550 26011 25238 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245137.1 protein_id gnl|my_center|LOCUS_04550 27357 26008 gene locus_tag LOCUS_04560 27357 26008 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918160.1 protein_id gnl|my_center|LOCUS_04560 28043 27354 gene locus_tag LOCUS_04570 gene gph 28043 27354 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_04570 28756 28040 gene locus_tag LOCUS_04580 28756 28040 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_04580 30096 28753 gene locus_tag LOCUS_04590 30096 28753 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_04590 30329 32869 gene locus_tag LOCUS_04600 gene gyrA 30329 32869 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_04600 32949 34031 gene locus_tag LOCUS_04610 gene serC 32949 34031 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_04610 34064 35245 gene locus_tag LOCUS_04620 34064 35245 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_04620 35323 36393 gene locus_tag LOCUS_04630 gene pheA 35323 36393 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275386.1 protein_id gnl|my_center|LOCUS_04630 36401 37558 gene locus_tag LOCUS_04640 gene hisC 36401 37558 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_04640 37546 38868 gene locus_tag LOCUS_04650 gene aroA 37546 38868 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036773.1 protein_id gnl|my_center|LOCUS_04650 38876 39586 gene locus_tag LOCUS_04660 gene cmk 38876 39586 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_04660 39664 41340 gene locus_tag LOCUS_04670 gene rpsA 39664 41340 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_04670 41424 41732 gene locus_tag LOCUS_04680 41424 41732 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_04680 41874 42170 gene locus_tag LOCUS_04690 41874 42170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 42160 43344 gene locus_tag LOCUS_04700 gene lapB 42160 43344 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037337.1 protein_id gnl|my_center|LOCUS_04700 43465 43734 gene locus_tag LOCUS_04710 43465 43734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 43864 44709 gene locus_tag LOCUS_04720 gene galU 43864 44709 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225519.1 protein_id gnl|my_center|LOCUS_04720 44825 44751 gene locus_tag LOCUS_t00040 44825 44751 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 46113 44932 gene locus_tag LOCUS_04730 46113 44932 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_04730 46262 48214 gene locus_tag LOCUS_04740 gene uvrB 46262 48214 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104590.1 protein_id gnl|my_center|LOCUS_04740 48289 48364 gene locus_tag LOCUS_t00050 48289 48364 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 48546 50474 gene locus_tag LOCUS_04750 gene thrS 48546 50474 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191232.1 protein_id gnl|my_center|LOCUS_04750 50592 50996 gene locus_tag LOCUS_04760 50592 50996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 51098 51295 gene locus_tag LOCUS_04770 gene rpmI 51098 51295 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232040.1 protein_id gnl|my_center|LOCUS_04770 51311 51667 gene locus_tag LOCUS_04780 gene rplT 51311 51667 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138366.1 protein_id gnl|my_center|LOCUS_04780 51751 52734 gene locus_tag LOCUS_04790 gene pheS 51751 52734 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211832.1 protein_id gnl|my_center|LOCUS_04790 52745 55126 gene locus_tag LOCUS_04800 gene pheT 52745 55126 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211831.1 protein_id gnl|my_center|LOCUS_04800 55144 55443 gene locus_tag LOCUS_04810 gene ihfA 55144 55443 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_04810 55424 55780 gene locus_tag LOCUS_04820 55424 55780 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_04820 55954 56030 gene locus_tag LOCUS_t00060 55954 56030 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 56574 56086 gene locus_tag LOCUS_04830 56574 56086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 56848 56648 gene locus_tag LOCUS_04840 56848 56648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 57069 56845 gene locus_tag LOCUS_04850 57069 56845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 57347 57066 gene locus_tag LOCUS_04860 57347 57066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 58529 57432 gene locus_tag LOCUS_04870 58529 57432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 58987 58526 gene locus_tag LOCUS_04880 58987 58526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 59492 58965 gene locus_tag LOCUS_04890 59492 58965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 60192 59611 gene locus_tag LOCUS_04900 60192 59611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 60436 60194 gene locus_tag LOCUS_04910 60436 60194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 62631 60811 gene locus_tag LOCUS_04920 62631 60811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 63061 62825 gene locus_tag LOCUS_04930 63061 62825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 63840 63058 gene locus_tag LOCUS_04940 63840 63058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201843404.1 protein_id gnl|my_center|LOCUS_04940 64680 64471 gene locus_tag LOCUS_04950 64680 64471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 65388 64747 gene locus_tag LOCUS_04960 65388 64747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 66770 65388 gene locus_tag LOCUS_04970 66770 65388 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940741.1 protein_id gnl|my_center|LOCUS_04970 67422 68558 gene locus_tag LOCUS_04980 67422 68558 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_04980 68631 69674 gene locus_tag LOCUS_04990 68631 69674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 70744 69683 gene locus_tag LOCUS_05000 70744 69683 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612378.1 protein_id gnl|my_center|LOCUS_05000 72191 70929 gene locus_tag LOCUS_05010 72191 70929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 72348 73772 gene locus_tag LOCUS_05020 72348 73772 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388201.1 protein_id gnl|my_center|LOCUS_05020 73884 75581 gene locus_tag LOCUS_05030 gene ilvD 73884 75581 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000502719.1 protein_id gnl|my_center|LOCUS_05030 75819 78449 gene locus_tag LOCUS_05040 75819 78449 CDS product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_05040 78747 78454 gene locus_tag LOCUS_05050 78747 78454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 79427 78744 gene locus_tag LOCUS_05060 gene hisF 79427 78744 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459998.1 protein_id gnl|my_center|LOCUS_05060 80236 79493 gene locus_tag LOCUS_05070 gene hisA 80236 79493 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000586511.1 protein_id gnl|my_center|LOCUS_05070 80846 80241 gene locus_tag LOCUS_05080 gene hisH 80846 80241 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036982.1 protein_id gnl|my_center|LOCUS_05080 81913 80843 gene locus_tag LOCUS_05090 gene hisB 81913 80843 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946930.1 protein_id gnl|my_center|LOCUS_05090 82972 81917 gene locus_tag LOCUS_05100 gene hisC 82972 81917 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706051.1 protein_id gnl|my_center|LOCUS_05100 84285 82969 gene locus_tag LOCUS_05110 gene hisD 84285 82969 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706052.1 protein_id gnl|my_center|LOCUS_05110 85193 84282 gene locus_tag LOCUS_05120 gene hisG 85193 84282 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211896.1 protein_id gnl|my_center|LOCUS_05120 85522 85214 gene locus_tag LOCUS_05130 85522 85214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 86686 85616 gene locus_tag LOCUS_05140 gene leuB 86686 85616 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255951.1 protein_id gnl|my_center|LOCUS_05140 87258 86674 gene locus_tag LOCUS_05150 gene leuD 87258 86674 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_05150 88696 87287 gene locus_tag LOCUS_05160 gene leuC 88696 87287 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256078.1 protein_id gnl|my_center|LOCUS_05160 89746 88778 gene locus_tag LOCUS_05170 89746 88778 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_05170 91348 89780 gene locus_tag LOCUS_05180 91348 89780 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922561.1 protein_id gnl|my_center|LOCUS_05180 92113 92742 gene locus_tag LOCUS_05190 92113 92742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 92831 93769 gene locus_tag LOCUS_05200 92831 93769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 93777 94199 gene locus_tag LOCUS_05210 93777 94199 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118000.1 protein_id gnl|my_center|LOCUS_05210 94256 94681 gene locus_tag LOCUS_05220 94256 94681 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200660.1 protein_id gnl|my_center|LOCUS_05220 94688 95998 gene locus_tag LOCUS_05230 94688 95998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_05230 96149 96469 gene locus_tag LOCUS_05240 96149 96469 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921353.1 protein_id gnl|my_center|LOCUS_05240 97339 96503 gene locus_tag LOCUS_05250 97339 96503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 98548 97391 gene locus_tag LOCUS_05260 98548 97391 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258129.1 protein_id gnl|my_center|LOCUS_05260 98811 99767 gene locus_tag LOCUS_05270 98811 99767 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918355.1 protein_id gnl|my_center|LOCUS_05270 99909 101963 gene locus_tag LOCUS_05280 99909 101963 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258127.1 protein_id gnl|my_center|LOCUS_05280 101993 103912 gene locus_tag LOCUS_05290 101993 103912 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258126.1 protein_id gnl|my_center|LOCUS_05290 104743 103949 gene locus_tag LOCUS_05300 104743 103949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 105194 106267 gene locus_tag LOCUS_05310 105194 106267 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_05310 107828 106392 gene locus_tag LOCUS_05320 107828 106392 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967349.1 protein_id gnl|my_center|LOCUS_05320 108282 109592 gene locus_tag LOCUS_05330 108282 109592 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_05330 109592 110107 gene locus_tag LOCUS_05340 109592 110107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 110107 111366 gene locus_tag LOCUS_05350 gene dctM 110107 111366 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105529.1 protein_id gnl|my_center|LOCUS_05350 111469 111951 gene locus_tag LOCUS_05360 111469 111951 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921223.1 protein_id gnl|my_center|LOCUS_05360 112039 112728 gene locus_tag LOCUS_05370 112039 112728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 113998 112766 gene locus_tag LOCUS_05380 113998 112766 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770075.1 protein_id gnl|my_center|LOCUS_05380 114970 114017 gene locus_tag LOCUS_05390 114970 114017 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035862.1 protein_id gnl|my_center|LOCUS_05390 115734 114994 gene locus_tag LOCUS_05400 115734 114994 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035863.1 protein_id gnl|my_center|LOCUS_05400 115925 116782 gene locus_tag LOCUS_05410 115925 116782 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820280.1 protein_id gnl|my_center|LOCUS_05410 116841 117566 gene locus_tag LOCUS_05420 116841 117566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 117971 119215 gene locus_tag LOCUS_05430 117971 119215 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089286.1 protein_id gnl|my_center|LOCUS_05430 119283 120533 gene locus_tag LOCUS_05440 119283 120533 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038462.1 protein_id gnl|my_center|LOCUS_05440 120553 123228 gene locus_tag LOCUS_05450 120553 123228 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958090.1 protein_id gnl|my_center|LOCUS_05450 123228 126614 gene locus_tag LOCUS_05460 123228 126614 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958091.1 protein_id gnl|my_center|LOCUS_05460 127386 126622 gene locus_tag LOCUS_05470 127386 126622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 127889 127392 gene locus_tag LOCUS_05480 127889 127392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 129152 127893 gene locus_tag LOCUS_05490 gene xcpY 129152 127893 CDS product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 protein_id gnl|my_center|LOCUS_05490 130146 129145 gene locus_tag LOCUS_05500 gene gspK 130146 129145 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_05500 130781 130152 gene locus_tag LOCUS_05510 gene xcpW 130781 130152 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_05510 131290 130778 gene locus_tag LOCUS_05520 131290 130778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 131849 131280 gene locus_tag LOCUS_05530 gene xcpU 131849 131280 CDS product GspH family T2SS minor pseudopilin variant XcpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103530.1 protein_id gnl|my_center|LOCUS_05530 132315 131902 gene locus_tag LOCUS_05540 gene xcpT 132315 131902 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_05540 132516 133091 gene locus_tag LOCUS_05550 gene rrtA 132516 133091 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135354435.1 protein_id gnl|my_center|LOCUS_05550 133138 133893 gene locus_tag LOCUS_05560 gene fabG 133138 133893 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367190.1 protein_id gnl|my_center|LOCUS_05560 134024 134269 gene locus_tag LOCUS_05570 gene acpP 134024 134269 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091135.1 protein_id gnl|my_center|LOCUS_05570 134378 135589 gene locus_tag LOCUS_05580 gene fabF 134378 135589 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104132.1 protein_id gnl|my_center|LOCUS_05580 135632 137074 gene locus_tag LOCUS_05590 135632 137074 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_05590 137080 137913 gene locus_tag LOCUS_05600 gene pabC 137080 137913 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020799938.1 protein_id gnl|my_center|LOCUS_05600 137901 138926 gene locus_tag LOCUS_05610 gene mltG 137901 138926 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957616.1 protein_id gnl|my_center|LOCUS_05610 138923 139570 gene locus_tag LOCUS_05620 gene tmk 138923 139570 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_05620 139593 140576 gene locus_tag LOCUS_05630 139593 140576 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_05630 140581 140919 gene locus_tag LOCUS_05640 140581 140919 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_05640 142002 140938 gene locus_tag LOCUS_05650 142002 140938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 144151 142097 gene locus_tag LOCUS_05660 144151 142097 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_05660 144888 144148 gene locus_tag LOCUS_05670 144888 144148 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393113.1 protein_id gnl|my_center|LOCUS_05670 145002 145457 gene locus_tag LOCUS_05680 145002 145457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 145630 146661 gene locus_tag LOCUS_05690 145630 146661 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088624.1 protein_id gnl|my_center|LOCUS_05690 146686 147627 gene locus_tag LOCUS_05700 gene glpQ 146686 147627 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098017.1 protein_id gnl|my_center|LOCUS_05700 148681 147743 gene locus_tag LOCUS_05710 148681 147743 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275352.1 protein_id gnl|my_center|LOCUS_05710 149133 148678 gene locus_tag LOCUS_05720 149133 148678 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055068.1 protein_id gnl|my_center|LOCUS_05720 149693 149130 gene locus_tag LOCUS_05730 149693 149130 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946598.1 protein_id gnl|my_center|LOCUS_05730 151664 149697 gene locus_tag LOCUS_05740 151664 149697 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_05740 152130 151675 gene locus_tag LOCUS_05750 gene ccmE 152130 151675 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268403.1 protein_id gnl|my_center|LOCUS_05750 152339 152127 gene locus_tag LOCUS_05760 152339 152127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 153058 152294 gene locus_tag LOCUS_05770 153058 152294 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 protein_id gnl|my_center|LOCUS_05770 153798 153130 gene locus_tag LOCUS_05780 gene ccmB 153798 153130 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262348.1 protein_id gnl|my_center|LOCUS_05780 154432 153803 gene locus_tag LOCUS_05790 gene ccmA 154432 153803 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895172.1 protein_id gnl|my_center|LOCUS_05790 154645 155691 gene locus_tag LOCUS_05800 154645 155691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 155764 156324 gene locus_tag LOCUS_05810 155764 156324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 156391 157917 gene locus_tag LOCUS_05820 156391 157917 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268952.1 protein_id gnl|my_center|LOCUS_05820 158198 159607 gene locus_tag LOCUS_05830 158198 159607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 159657 159571 gene locus_tag LOCUS_t00070 159657 159571 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 159747 159674 gene locus_tag LOCUS_t00080 159747 159674 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 159943 159868 gene locus_tag LOCUS_t00090 159943 159868 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 160559 159984 gene locus_tag LOCUS_05840 gene pgsA 160559 159984 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268070.1 protein_id gnl|my_center|LOCUS_05840 162477 160636 gene locus_tag LOCUS_05850 gene uvrC 162477 160636 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_05850 162997 162479 gene locus_tag LOCUS_05860 162997 162479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 164498 163140 gene locus_tag LOCUS_05870 164498 163140 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040942381.1 protein_id gnl|my_center|LOCUS_05870 164609 165988 gene locus_tag LOCUS_05880 164609 165988 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225665631.1 protein_id gnl|my_center|LOCUS_05880 166025 166783 gene locus_tag LOCUS_05890 166025 166783 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523205.1 protein_id gnl|my_center|LOCUS_05890 167596 166817 gene locus_tag LOCUS_05900 gene mazG 167596 166817 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919615.1 protein_id gnl|my_center|LOCUS_05900 167936 167607 gene locus_tag LOCUS_05910 167936 167607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 167922 168104 gene locus_tag LOCUS_05920 167922 168104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 169620 168232 gene locus_tag LOCUS_05930 169620 168232 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036680.1 protein_id gnl|my_center|LOCUS_05930 169725 171116 gene locus_tag LOCUS_05940 gene purB 169725 171116 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705315.1 protein_id gnl|my_center|LOCUS_05940 171366 171863 gene locus_tag LOCUS_05950 171366 171863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 172053 172571 gene locus_tag LOCUS_05960 172053 172571 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037129.1 protein_id gnl|my_center|LOCUS_05960 172617 173795 gene locus_tag LOCUS_05970 gene mnmA 172617 173795 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544237.1 protein_id gnl|my_center|LOCUS_05970 173908 176586 gene locus_tag LOCUS_05980 gene acnA 173908 176586 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259000.1 protein_id gnl|my_center|LOCUS_05980 176597 177331 gene locus_tag LOCUS_05990 176597 177331 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258788.1 protein_id gnl|my_center|LOCUS_05990 177343 178167 gene locus_tag LOCUS_06000 177343 178167 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_06000 178766 178176 gene locus_tag LOCUS_06010 178766 178176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 180076 178781 gene locus_tag LOCUS_06020 gene thrC 180076 178781 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036973.1 protein_id gnl|my_center|LOCUS_06020 182537 180087 gene locus_tag LOCUS_06030 gene thrA 182537 180087 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403462.1 protein_id gnl|my_center|LOCUS_06030 182772 183779 gene locus_tag LOCUS_06040 182772 183779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 183940 184794 gene locus_tag LOCUS_06050 183940 184794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720152.1 protein_id gnl|my_center|LOCUS_06050 184875 185486 gene locus_tag LOCUS_06060 184875 185486 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_06060 185643 186851 gene locus_tag LOCUS_06070 185643 186851 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245808.1 protein_id gnl|my_center|LOCUS_06070 187233 186946 gene locus_tag LOCUS_06080 187233 186946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 188528 187431 gene locus_tag LOCUS_06090 188528 187431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 189032 188664 gene locus_tag LOCUS_06100 189032 188664 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892849.1 protein_id gnl|my_center|LOCUS_06100 191008 189197 gene locus_tag LOCUS_06110 191008 189197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 193770 191005 gene locus_tag LOCUS_06120 gene fdhF 193770 191005 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338701.1 protein_id gnl|my_center|LOCUS_06120 195310 193763 gene locus_tag LOCUS_06130 195310 193763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 195294 195572 gene locus_tag LOCUS_06140 195294 195572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 195574 196284 gene locus_tag LOCUS_06150 195574 196284 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975933.1 protein_id gnl|my_center|LOCUS_06150 196465 197886 gene locus_tag LOCUS_06160 196465 197886 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086313.1 protein_id gnl|my_center|LOCUS_06160 197907 198956 gene locus_tag LOCUS_06170 197907 198956 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_06170 199308 199760 gene locus_tag LOCUS_06180 199308 199760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 200880 199777 gene locus_tag LOCUS_06190 200880 199777 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_06190 201290 202042 gene locus_tag LOCUS_06200 201290 202042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence04 1087 302 gene locus_tag LOCUS_06210 1087 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2081 1098 gene locus_tag LOCUS_06220 2081 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 3105 2098 gene locus_tag LOCUS_06230 3105 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 3621 4622 gene locus_tag LOCUS_06240 gene lipA 3621 4622 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946482.1 protein_id gnl|my_center|LOCUS_06240 4622 5653 gene locus_tag LOCUS_06250 gene sohB 4622 5653 CDS product protease SohB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769160.1 protein_id gnl|my_center|LOCUS_06250 5713 6486 gene locus_tag LOCUS_06260 5713 6486 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705171.1 protein_id gnl|my_center|LOCUS_06260 6557 7639 gene locus_tag LOCUS_06270 6557 7639 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_06270 7682 8374 gene locus_tag LOCUS_06280 7682 8374 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941515.1 protein_id gnl|my_center|LOCUS_06280 8449 10017 gene locus_tag LOCUS_06290 8449 10017 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974722.1 protein_id gnl|my_center|LOCUS_06290 10214 10849 gene locus_tag LOCUS_06300 10214 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 10859 11518 gene locus_tag LOCUS_06310 10859 11518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 11616 12563 gene locus_tag LOCUS_06320 11616 12563 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140499.1 protein_id gnl|my_center|LOCUS_06320 14117 12588 gene locus_tag LOCUS_06330 gene ilvA 14117 12588 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082739.1 protein_id gnl|my_center|LOCUS_06330 15304 14180 gene locus_tag LOCUS_06340 15304 14180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 17181 15310 gene locus_tag LOCUS_06350 17181 15310 CDS product GldG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092447.1 protein_id gnl|my_center|LOCUS_06350 17926 17192 gene locus_tag LOCUS_06360 17926 17192 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_06360 18861 17926 gene locus_tag LOCUS_06370 18861 17926 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_06370 21765 19048 gene locus_tag LOCUS_06380 21765 19048 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640527.1 protein_id gnl|my_center|LOCUS_06380 21864 22841 gene locus_tag LOCUS_06390 gene pip 21864 22841 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036072.1 protein_id gnl|my_center|LOCUS_06390 22838 24184 gene locus_tag LOCUS_06400 22838 24184 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_06400 24166 24987 gene locus_tag LOCUS_06410 24166 24987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 25097 25876 gene locus_tag LOCUS_06420 25097 25876 CDS product TorF family putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073341.1 protein_id gnl|my_center|LOCUS_06420 25892 27085 gene locus_tag LOCUS_06430 gene potF 25892 27085 CDS product spermidine/putrescine ABC transporter substrate-binding protein PotF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097372.1 protein_id gnl|my_center|LOCUS_06430 27103 28236 gene locus_tag LOCUS_06440 gene potA 27103 28236 CDS product polyamine ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388772.1 protein_id gnl|my_center|LOCUS_06440 28233 29246 gene locus_tag LOCUS_06450 28233 29246 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388771.1 protein_id gnl|my_center|LOCUS_06450 29243 30091 gene locus_tag LOCUS_06460 29243 30091 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388770.1 protein_id gnl|my_center|LOCUS_06460 31341 30265 gene locus_tag LOCUS_06470 31341 30265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 31556 33367 gene locus_tag LOCUS_06480 31556 33367 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089481.1 protein_id gnl|my_center|LOCUS_06480 33434 35245 gene locus_tag LOCUS_06490 33434 35245 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174555.1 protein_id gnl|my_center|LOCUS_06490 35242 36297 gene locus_tag LOCUS_06500 35242 36297 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089483.1 protein_id gnl|my_center|LOCUS_06500 36373 36657 gene locus_tag LOCUS_06510 36373 36657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 37346 37179 gene locus_tag LOCUS_06520 37346 37179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 37525 39372 gene locus_tag LOCUS_06530 37525 39372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 39399 40043 gene locus_tag LOCUS_06540 39399 40043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 40047 40769 gene locus_tag LOCUS_06550 40047 40769 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112481.1 protein_id gnl|my_center|LOCUS_06550 40902 42293 gene locus_tag LOCUS_06560 gene dacB 40902 42293 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064320.1 protein_id gnl|my_center|LOCUS_06560 42389 42727 gene locus_tag LOCUS_06570 42389 42727 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198020.1 protein_id gnl|my_center|LOCUS_06570 42823 44079 gene locus_tag LOCUS_06580 42823 44079 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_06580 44684 44067 gene locus_tag LOCUS_06590 gene msrQ 44684 44067 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_06590 45654 44692 gene locus_tag LOCUS_06600 gene msrP 45654 44692 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920589.1 protein_id gnl|my_center|LOCUS_06600 46457 45663 gene locus_tag LOCUS_06610 46457 45663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 46583 47602 gene locus_tag LOCUS_06620 46583 47602 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253036.1 protein_id gnl|my_center|LOCUS_06620 48581 47571 gene locus_tag LOCUS_06630 48581 47571 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258144.1 protein_id gnl|my_center|LOCUS_06630 50007 48562 gene locus_tag LOCUS_06640 50007 48562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 50064 50708 gene locus_tag LOCUS_06650 gene msrA 50064 50708 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_06650 51137 50784 gene locus_tag LOCUS_06660 51137 50784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 51354 52676 gene locus_tag LOCUS_06670 51354 52676 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_06670 52687 53991 gene locus_tag LOCUS_06680 52687 53991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 54093 55238 gene locus_tag LOCUS_06690 54093 55238 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_06690 55258 55938 gene locus_tag LOCUS_06700 55258 55938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439273.1 protein_id gnl|my_center|LOCUS_06700 55939 57147 gene locus_tag LOCUS_06710 55939 57147 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_06710 57150 58349 gene locus_tag LOCUS_06720 57150 58349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_06720 58635 60602 gene locus_tag LOCUS_06730 58635 60602 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392047.1 protein_id gnl|my_center|LOCUS_06730 60654 61823 gene locus_tag LOCUS_06740 gene yhbH 60654 61823 CDS product sporulation protein YhbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392048.1 protein_id gnl|my_center|LOCUS_06740 61848 63215 gene locus_tag LOCUS_06750 gene spoVR 61848 63215 CDS product stage V sporulation protein SpoVR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202710.1 protein_id gnl|my_center|LOCUS_06750 63319 64068 gene locus_tag LOCUS_06760 63319 64068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 65728 64094 gene locus_tag LOCUS_06770 65728 64094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 65867 67015 gene locus_tag LOCUS_06780 65867 67015 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_06780 67140 67823 gene locus_tag LOCUS_06790 67140 67823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 68334 67951 gene locus_tag LOCUS_06800 68334 67951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 68447 70507 gene locus_tag LOCUS_06810 gene fusA 68447 70507 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479820.1 protein_id gnl|my_center|LOCUS_06810 71737 70532 gene locus_tag LOCUS_06820 71737 70532 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084438.1 protein_id gnl|my_center|LOCUS_06820 72538 71771 gene locus_tag LOCUS_06830 72538 71771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 73663 72644 gene locus_tag LOCUS_06840 73663 72644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 74534 73839 gene locus_tag LOCUS_06850 74534 73839 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185176.1 protein_id gnl|my_center|LOCUS_06850 75751 74561 gene locus_tag LOCUS_06860 75751 74561 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706654.1 protein_id gnl|my_center|LOCUS_06860 75980 76243 gene locus_tag LOCUS_06870 75980 76243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 77234 76347 gene locus_tag LOCUS_06880 77234 76347 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_06880 77683 77231 gene locus_tag LOCUS_06890 77683 77231 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389911.1 protein_id gnl|my_center|LOCUS_06890 78244 77792 gene locus_tag LOCUS_06900 78244 77792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 79139 78318 gene locus_tag LOCUS_06910 79139 78318 CDS product FNR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005300768.1 protein_id gnl|my_center|LOCUS_06910 80717 79239 gene locus_tag LOCUS_06920 80717 79239 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143099.1 protein_id gnl|my_center|LOCUS_06920 82159 80717 gene locus_tag LOCUS_06930 82159 80717 CDS product DUF3526 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143098.1 protein_id gnl|my_center|LOCUS_06930 82879 82178 gene locus_tag LOCUS_06940 82879 82178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143097.1 protein_id gnl|my_center|LOCUS_06940 82991 83638 gene locus_tag LOCUS_06950 82991 83638 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920512.1 protein_id gnl|my_center|LOCUS_06950 84585 83635 gene locus_tag LOCUS_06960 84585 83635 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114217.1 protein_id gnl|my_center|LOCUS_06960 84722 85453 gene locus_tag LOCUS_06970 84722 85453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 85549 86691 gene locus_tag LOCUS_06980 85549 86691 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027750.1 protein_id gnl|my_center|LOCUS_06980 86688 87377 gene locus_tag LOCUS_06990 86688 87377 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977459.1 protein_id gnl|my_center|LOCUS_06990 87370 87960 gene locus_tag LOCUS_07000 87370 87960 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030525.1 protein_id gnl|my_center|LOCUS_07000 87973 89100 gene locus_tag LOCUS_07010 87973 89100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 91031 89463 gene locus_tag LOCUS_07020 91031 89463 CDS product DUF3612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074292.1 protein_id gnl|my_center|LOCUS_07020 91107 92732 gene locus_tag LOCUS_07030 gene aceB 91107 92732 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258821.1 protein_id gnl|my_center|LOCUS_07030 92742 94040 gene locus_tag LOCUS_07040 gene aceA 92742 94040 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818550.1 protein_id gnl|my_center|LOCUS_07040 94076 95812 gene locus_tag LOCUS_07050 gene aceK 94076 95812 CDS product bifunctional isocitrate dehydrogenase kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038861.1 protein_id gnl|my_center|LOCUS_07050 95901 97130 gene locus_tag LOCUS_07060 95901 97130 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350283.1 protein_id gnl|my_center|LOCUS_07060 98085 97144 gene locus_tag LOCUS_07070 98085 97144 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338826.1 protein_id gnl|my_center|LOCUS_07070 98170 98571 gene locus_tag LOCUS_07080 98170 98571 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090283.1 protein_id gnl|my_center|LOCUS_07080 98597 100108 gene locus_tag LOCUS_07090 98597 100108 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530017.1 protein_id gnl|my_center|LOCUS_07090 100243 100818 gene locus_tag LOCUS_07100 100243 100818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 100870 101976 gene locus_tag LOCUS_07110 100870 101976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 102084 103286 gene locus_tag LOCUS_07120 102084 103286 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929310.1 protein_id gnl|my_center|LOCUS_07120 103954 103619 gene locus_tag LOCUS_07130 103954 103619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 104146 105108 gene locus_tag LOCUS_07140 104146 105108 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970910.1 protein_id gnl|my_center|LOCUS_07140 105151 105363 gene locus_tag LOCUS_07150 105151 105363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 106025 105408 gene locus_tag LOCUS_07160 106025 105408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 107203 106085 gene locus_tag LOCUS_07170 107203 106085 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389543.1 protein_id gnl|my_center|LOCUS_07170 108341 107208 gene locus_tag LOCUS_07180 108341 107208 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389544.1 protein_id gnl|my_center|LOCUS_07180 110110 108338 gene locus_tag LOCUS_07190 110110 108338 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391778.1 protein_id gnl|my_center|LOCUS_07190 111116 110112 gene locus_tag LOCUS_07200 gene hlyD 111116 110112 CDS product secretion protein HlyD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389546.1 protein_id gnl|my_center|LOCUS_07200 111599 111180 gene locus_tag LOCUS_07210 111599 111180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 112276 111668 gene locus_tag LOCUS_07220 gene slmA 112276 111668 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918350.1 protein_id gnl|my_center|LOCUS_07220 114387 113410 gene locus_tag LOCUS_07230 114387 113410 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275314.1 protein_id gnl|my_center|LOCUS_07230 116575 114368 gene locus_tag LOCUS_07240 116575 114368 CDS product PepSY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528761.1 protein_id gnl|my_center|LOCUS_07240 117067 116597 gene locus_tag LOCUS_07250 117067 116597 CDS product DUF2271 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004202123.1 protein_id gnl|my_center|LOCUS_07250 118387 117119 gene locus_tag LOCUS_07260 118387 117119 CDS product ferric reductase-like transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101595.1 protein_id gnl|my_center|LOCUS_07260 118790 118398 gene locus_tag LOCUS_07270 118790 118398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 118920 119579 gene locus_tag LOCUS_07280 118920 119579 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331306.1 protein_id gnl|my_center|LOCUS_07280 119582 120961 gene locus_tag LOCUS_07290 119582 120961 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140446.1 protein_id gnl|my_center|LOCUS_07290 121473 120970 gene locus_tag LOCUS_07300 121473 120970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 122158 121808 gene locus_tag LOCUS_07310 122158 121808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 122683 123462 gene locus_tag LOCUS_07320 122683 123462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 124452 123478 gene locus_tag LOCUS_07330 124452 123478 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812687.1 protein_id gnl|my_center|LOCUS_07330 124651 126210 gene locus_tag LOCUS_07340 124651 126210 CDS product tannase/feruloyl esterase family alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268043.1 protein_id gnl|my_center|LOCUS_07340 126334 127164 gene locus_tag LOCUS_07350 126334 127164 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461744.1 protein_id gnl|my_center|LOCUS_07350 127169 129355 gene locus_tag LOCUS_07360 127169 129355 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_07360 129915 129415 gene locus_tag LOCUS_07370 129915 129415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 132189 130117 gene locus_tag LOCUS_07380 132189 130117 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257128.1 protein_id gnl|my_center|LOCUS_07380 133729 132428 gene locus_tag LOCUS_07390 133729 132428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 135062 133836 gene locus_tag LOCUS_07400 135062 133836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 135787 135071 gene locus_tag LOCUS_07410 135787 135071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 136293 135889 gene locus_tag LOCUS_07420 136293 135889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 138663 136411 gene locus_tag LOCUS_07430 138663 136411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 140404 138710 gene locus_tag LOCUS_07440 140404 138710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 140289 140858 gene locus_tag LOCUS_07450 140289 140858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 141543 142220 gene locus_tag LOCUS_07460 141543 142220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 142694 142221 gene locus_tag LOCUS_07470 142694 142221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 142578 143945 gene locus_tag LOCUS_07480 142578 143945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 144017 144625 gene locus_tag LOCUS_07490 144017 144625 CDS product 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927004.1 protein_id gnl|my_center|LOCUS_07490 144622 145404 gene locus_tag LOCUS_07500 gene lgt 144622 145404 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112963.1 protein_id gnl|my_center|LOCUS_07500 145401 146195 gene locus_tag LOCUS_07510 145401 146195 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110588.1 protein_id gnl|my_center|LOCUS_07510 147035 146211 gene locus_tag LOCUS_07520 147035 146211 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814962.1 protein_id gnl|my_center|LOCUS_07520 147423 147037 gene locus_tag LOCUS_07530 gene apaG 147423 147037 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_07530 148229 147441 gene locus_tag LOCUS_07540 gene rsmA 148229 147441 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768067.1 protein_id gnl|my_center|LOCUS_07540 149219 148233 gene locus_tag LOCUS_07550 gene pdxA 149219 148233 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241277.1 protein_id gnl|my_center|LOCUS_07550 150531 149227 gene locus_tag LOCUS_07560 150531 149227 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115345.1 protein_id gnl|my_center|LOCUS_07560 152738 150540 gene locus_tag LOCUS_07570 gene lptD 152738 150540 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113209.1 protein_id gnl|my_center|LOCUS_07570 152891 153538 gene locus_tag LOCUS_07580 152891 153538 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463963.1 protein_id gnl|my_center|LOCUS_07580 153650 154642 gene locus_tag LOCUS_07590 gene fabK 153650 154642 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392462.1 protein_id gnl|my_center|LOCUS_07590 154790 155410 gene locus_tag LOCUS_07600 154790 155410 CDS product HutD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809213.1 protein_id gnl|my_center|LOCUS_07600 155520 156779 gene locus_tag LOCUS_07610 155520 156779 CDS product D-amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085010.1 protein_id gnl|my_center|LOCUS_07610 156987 157502 gene locus_tag LOCUS_07620 156987 157502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 157905 159674 gene locus_tag LOCUS_07630 157905 159674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 160360 159758 gene locus_tag LOCUS_07640 gene lipB 160360 159758 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005488805.1 protein_id gnl|my_center|LOCUS_07640 160641 160357 gene locus_tag LOCUS_07650 160641 160357 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189266.1 protein_id gnl|my_center|LOCUS_07650 161479 160619 gene locus_tag LOCUS_07660 161479 160619 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189800.1 protein_id gnl|my_center|LOCUS_07660 162663 161506 gene locus_tag LOCUS_07670 162663 161506 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_07670 163532 162696 gene locus_tag LOCUS_07680 163532 162696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 164574 163549 gene locus_tag LOCUS_07690 gene mltB 164574 163549 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_07690 165704 164571 gene locus_tag LOCUS_07700 gene rodA 165704 164571 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261454.1 protein_id gnl|my_center|LOCUS_07700 167560 165701 gene locus_tag LOCUS_07710 gene mrdA 167560 165701 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105194.1 protein_id gnl|my_center|LOCUS_07710 168074 167574 gene locus_tag LOCUS_07720 gene mreD 168074 167574 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_07720 169108 168071 gene locus_tag LOCUS_07730 169108 168071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 170240 169197 gene locus_tag LOCUS_07740 gene mreB 170240 169197 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_07740 170385 170672 gene locus_tag LOCUS_07750 gene gatC 170385 170672 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106543.1 protein_id gnl|my_center|LOCUS_07750 170689 172239 gene locus_tag LOCUS_07760 gene gatA 170689 172239 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766477.1 protein_id gnl|my_center|LOCUS_07760 172236 173675 gene locus_tag LOCUS_07770 gene gatB 172236 173675 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence05 1694 873 gene locus_tag LOCUS_07780 gene trpA 1694 873 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_07780 2627 1857 gene locus_tag LOCUS_07790 2627 1857 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918411.1 protein_id gnl|my_center|LOCUS_07790 4166 2724 gene locus_tag LOCUS_07800 4166 2724 CDS product alkaline phosphatase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120624.1 protein_id gnl|my_center|LOCUS_07800 4322 4549 gene locus_tag LOCUS_07810 4322 4549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 6017 4617 gene locus_tag LOCUS_07820 6017 4617 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795565.1 protein_id gnl|my_center|LOCUS_07820 6357 6830 gene locus_tag LOCUS_07830 6357 6830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 7218 8102 gene locus_tag LOCUS_07840 7218 8102 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393022.1 protein_id gnl|my_center|LOCUS_07840 9799 8237 gene locus_tag LOCUS_07850 gene cimA 9799 8237 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583555.1 protein_id gnl|my_center|LOCUS_07850 10570 10193 gene locus_tag LOCUS_07860 10570 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 12159 10747 gene locus_tag LOCUS_07870 gene mpl 12159 10747 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770120.1 protein_id gnl|my_center|LOCUS_07870 12776 12546 gene locus_tag LOCUS_07880 12776 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 12947 14104 gene locus_tag LOCUS_07890 12947 14104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 14227 16230 gene locus_tag LOCUS_07900 14227 16230 CDS product Piwi domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031225.1 protein_id gnl|my_center|LOCUS_07900 16476 17306 gene locus_tag LOCUS_07910 16476 17306 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187036.1 protein_id gnl|my_center|LOCUS_07910 17694 17308 gene locus_tag LOCUS_07920 17694 17308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 18920 17715 gene locus_tag LOCUS_07930 18920 17715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 19687 18917 gene locus_tag LOCUS_07940 19687 18917 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776125.1 protein_id gnl|my_center|LOCUS_07940 19902 21038 gene locus_tag LOCUS_07950 19902 21038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 21718 21314 gene locus_tag LOCUS_07960 gene merR 21718 21314 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166628.1 protein_id gnl|my_center|LOCUS_07960 21767 22357 gene locus_tag LOCUS_07970 21767 22357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 22405 22854 gene locus_tag LOCUS_07980 22405 22854 CDS product copper chaperone Copz family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057722.1 protein_id gnl|my_center|LOCUS_07980 23128 23544 gene locus_tag LOCUS_07990 23128 23544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 25526 23433 gene locus_tag LOCUS_08000 25526 23433 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_08000 26405 25851 gene locus_tag LOCUS_08010 26405 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 26695 27039 gene locus_tag LOCUS_08020 26695 27039 CDS product four-helix bundle copper-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183698.1 protein_id gnl|my_center|LOCUS_08020 27325 27176 gene locus_tag LOCUS_08030 27325 27176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 27474 28052 gene locus_tag LOCUS_08040 27474 28052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 28181 28002 gene locus_tag LOCUS_08050 28181 28002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 28334 29338 gene locus_tag LOCUS_08060 28334 29338 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031646.1 protein_id gnl|my_center|LOCUS_08060 29335 29766 gene locus_tag LOCUS_08070 29335 29766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 29792 30895 gene locus_tag LOCUS_08080 29792 30895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 30940 32442 gene locus_tag LOCUS_08090 30940 32442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 32439 33107 gene locus_tag LOCUS_08100 32439 33107 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_08100 33151 34491 gene locus_tag LOCUS_08110 33151 34491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 34510 35436 gene locus_tag LOCUS_08120 gene gnd 34510 35436 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392797.1 protein_id gnl|my_center|LOCUS_08120 35433 36005 gene locus_tag LOCUS_08130 35433 36005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 36002 36871 gene locus_tag LOCUS_08140 36002 36871 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143083.1 protein_id gnl|my_center|LOCUS_08140 36875 39196 gene locus_tag LOCUS_08150 36875 39196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 39794 39210 gene locus_tag LOCUS_08160 39794 39210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 41244 39922 gene locus_tag LOCUS_08170 41244 39922 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972396.1 protein_id gnl|my_center|LOCUS_08170 41507 42199 gene locus_tag LOCUS_08180 41507 42199 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967149.1 protein_id gnl|my_center|LOCUS_08180 42848 42204 gene locus_tag LOCUS_08190 42848 42204 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978556.1 protein_id gnl|my_center|LOCUS_08190 42937 43596 gene locus_tag LOCUS_08200 42937 43596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244421.1 protein_id gnl|my_center|LOCUS_08200 43714 44862 gene locus_tag LOCUS_08210 43714 44862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 45571 44897 gene locus_tag LOCUS_08220 45571 44897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 45762 46319 gene locus_tag LOCUS_08230 45762 46319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 46805 46392 gene locus_tag LOCUS_08240 46805 46392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 47430 46975 gene locus_tag LOCUS_08250 47430 46975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 47720 47427 gene locus_tag LOCUS_08260 47720 47427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 48115 47870 gene locus_tag LOCUS_08270 48115 47870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 48353 48132 gene locus_tag LOCUS_08280 48353 48132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 48738 48436 gene locus_tag LOCUS_08290 48738 48436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 52091 48735 gene locus_tag LOCUS_08300 52091 48735 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_08300 54245 52158 gene locus_tag LOCUS_08310 54245 52158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 55631 54258 gene locus_tag LOCUS_08320 55631 54258 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_08320 56168 55773 gene locus_tag LOCUS_08330 56168 55773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 56573 56247 gene locus_tag LOCUS_08340 56573 56247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 57043 56639 gene locus_tag LOCUS_08350 57043 56639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 59128 57356 gene locus_tag LOCUS_08360 59128 57356 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929287.1 protein_id gnl|my_center|LOCUS_08360 60856 59156 gene locus_tag LOCUS_08370 gene glgP 60856 59156 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545636.1 protein_id gnl|my_center|LOCUS_08370 61247 60915 gene locus_tag LOCUS_08380 61247 60915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 61773 61363 gene locus_tag LOCUS_08390 61773 61363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 62085 62573 gene locus_tag LOCUS_08400 62085 62573 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_08400 62737 63180 gene locus_tag LOCUS_08410 62737 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 63955 63584 gene locus_tag LOCUS_08420 63955 63584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 63848 64612 gene locus_tag LOCUS_08430 63848 64612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 65083 64631 gene locus_tag LOCUS_08440 65083 64631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 65437 65114 gene locus_tag LOCUS_08450 65437 65114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 65499 65864 gene locus_tag LOCUS_08460 65499 65864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 66962 65931 gene locus_tag LOCUS_08470 gene rpoD 66962 65931 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_08470 67463 66972 gene locus_tag LOCUS_08480 67463 66972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 67856 68665 gene locus_tag LOCUS_08490 67856 68665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 69004 69771 gene locus_tag LOCUS_08500 69004 69771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 70466 69825 gene locus_tag LOCUS_08510 70466 69825 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_08510 70872 70480 gene locus_tag LOCUS_08520 70872 70480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 71782 71084 gene locus_tag LOCUS_08530 71782 71084 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403448.1 protein_id gnl|my_center|LOCUS_08530 73292 71823 gene locus_tag LOCUS_08540 73292 71823 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838309.1 protein_id gnl|my_center|LOCUS_08540 73866 73426 gene locus_tag LOCUS_08550 73866 73426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 74664 73981 gene locus_tag LOCUS_08560 74664 73981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 75334 74669 gene locus_tag LOCUS_08570 75334 74669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 75862 76044 gene locus_tag LOCUS_08580 75862 76044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 76493 76185 gene locus_tag LOCUS_08590 76493 76185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 77431 76502 gene locus_tag LOCUS_08600 77431 76502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 78821 77856 gene locus_tag LOCUS_08610 78821 77856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 79269 78847 gene locus_tag LOCUS_08620 79269 78847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 80309 79350 gene locus_tag LOCUS_08630 80309 79350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 80735 80328 gene locus_tag LOCUS_08640 80735 80328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 80964 86360 gene locus_tag LOCUS_08650 80964 86360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 86398 87669 gene locus_tag LOCUS_08660 86398 87669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 87764 88654 gene locus_tag LOCUS_08670 87764 88654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 89886 88678 gene locus_tag LOCUS_08680 89886 88678 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085426.1 protein_id gnl|my_center|LOCUS_08680 90380 89886 gene locus_tag LOCUS_08690 90380 89886 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_08690 92333 90474 gene locus_tag LOCUS_08700 92333 90474 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_08700 92918 92496 gene locus_tag LOCUS_08710 92918 92496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 93216 92941 gene locus_tag LOCUS_08720 93216 92941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 93905 93213 gene locus_tag LOCUS_08730 gene rpe 93905 93213 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392431.1 protein_id gnl|my_center|LOCUS_08730 94285 93941 gene locus_tag LOCUS_08740 94285 93941 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405530.1 protein_id gnl|my_center|LOCUS_08740 94772 94290 gene locus_tag LOCUS_08750 94772 94290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 95202 94786 gene locus_tag LOCUS_08760 95202 94786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 98372 95199 gene locus_tag LOCUS_08770 98372 95199 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103123.1 protein_id gnl|my_center|LOCUS_08770 99101 98397 gene locus_tag LOCUS_08780 99101 98397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 100393 99098 gene locus_tag LOCUS_08790 100393 99098 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_08790 100961 100506 gene locus_tag LOCUS_08800 100961 100506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 101833 100976 gene locus_tag LOCUS_08810 101833 100976 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056168.1 protein_id gnl|my_center|LOCUS_08810 103361 101982 gene locus_tag LOCUS_08820 103361 101982 CDS product coenzyme F390 synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899567.1 protein_id gnl|my_center|LOCUS_08820 104014 103358 gene locus_tag LOCUS_08830 104014 103358 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966301.1 protein_id gnl|my_center|LOCUS_08830 104567 104130 gene locus_tag LOCUS_08840 104567 104130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 105039 104626 gene locus_tag LOCUS_08850 105039 104626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 108194 105036 gene locus_tag LOCUS_08860 108194 105036 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103123.1 protein_id gnl|my_center|LOCUS_08860 108652 108194 gene locus_tag LOCUS_08870 108652 108194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 109944 108649 gene locus_tag LOCUS_08880 109944 108649 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941495.1 protein_id gnl|my_center|LOCUS_08880 111166 110498 gene locus_tag LOCUS_08890 111166 110498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966848.1 protein_id gnl|my_center|LOCUS_08890 112316 111159 gene locus_tag LOCUS_08900 112316 111159 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941337.1 protein_id gnl|my_center|LOCUS_08900 112873 112313 gene locus_tag LOCUS_08910 112873 112313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 113442 112870 gene locus_tag LOCUS_08920 113442 112870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 114416 113454 gene locus_tag LOCUS_08930 114416 113454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 114724 114413 gene locus_tag LOCUS_08940 114724 114413 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003678450.1 protein_id gnl|my_center|LOCUS_08940 115322 114921 gene locus_tag LOCUS_08950 115322 114921 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_08950 115835 115416 gene locus_tag LOCUS_08960 115835 115416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 116127 115930 gene locus_tag LOCUS_08970 116127 115930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 116809 116345 gene locus_tag LOCUS_08980 116809 116345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 117793 117473 gene locus_tag LOCUS_08990 117793 117473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 119146 117812 gene locus_tag LOCUS_09000 119146 117812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 119600 119172 gene locus_tag LOCUS_09010 119600 119172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 120175 119597 gene locus_tag LOCUS_09020 120175 119597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 121587 120172 gene locus_tag LOCUS_09030 gene nrfD 121587 120172 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228899.1 protein_id gnl|my_center|LOCUS_09030 122659 121574 gene locus_tag LOCUS_09040 122659 121574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 122874 122656 gene locus_tag LOCUS_09050 122874 122656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 123170 123934 gene locus_tag LOCUS_09060 123170 123934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941606.1 protein_id gnl|my_center|LOCUS_09060 125084 124098 gene locus_tag LOCUS_09070 gene cysK 125084 124098 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528637.1 protein_id gnl|my_center|LOCUS_09070 127262 125325 gene locus_tag LOCUS_09080 127262 125325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 128437 127259 gene locus_tag LOCUS_09090 128437 127259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 129082 128441 gene locus_tag LOCUS_09100 129082 128441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 129372 129082 gene locus_tag LOCUS_09110 129372 129082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 129974 129426 gene locus_tag LOCUS_09120 129974 129426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 130162 132615 gene locus_tag LOCUS_09130 130162 132615 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_09130 132629 132862 gene locus_tag LOCUS_09140 132629 132862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 132897 133271 gene locus_tag LOCUS_09150 132897 133271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 133268 133951 gene locus_tag LOCUS_09160 133268 133951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 133960 134379 gene locus_tag LOCUS_09170 gene zntR 133960 134379 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_09170 135204 134404 gene locus_tag LOCUS_09180 135204 134404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 137300 135222 gene locus_tag LOCUS_09190 137300 135222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 137742 137368 gene locus_tag LOCUS_09200 137742 137368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 138548 137754 gene locus_tag LOCUS_09210 138548 137754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 140073 138607 gene locus_tag LOCUS_09220 140073 138607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 140524 140039 gene locus_tag LOCUS_09230 140524 140039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 140936 140508 gene locus_tag LOCUS_09240 140936 140508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 142223 140964 gene locus_tag LOCUS_09250 142223 140964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 145414 142232 gene locus_tag LOCUS_09260 145414 142232 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_09260 146309 145431 gene locus_tag LOCUS_09270 146309 145431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 146548 146306 gene locus_tag LOCUS_09280 146548 146306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 147167 146598 gene locus_tag LOCUS_09290 147167 146598 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_09290 147640 147173 gene locus_tag LOCUS_09300 147640 147173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 147987 147637 gene locus_tag LOCUS_09310 147987 147637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 147990 148193 gene locus_tag LOCUS_09320 147990 148193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 148658 148374 gene locus_tag LOCUS_09330 148658 148374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 149359 148787 gene locus_tag LOCUS_09340 149359 148787 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_09340 149818 149369 gene locus_tag LOCUS_09350 149818 149369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 150162 149815 gene locus_tag LOCUS_09360 150162 149815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 150358 151089 gene locus_tag LOCUS_09370 150358 151089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 151701 151459 gene locus_tag LOCUS_09380 151701 151459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09380 152146 151784 gene locus_tag LOCUS_09390 152146 151784 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615449.1 protein_id gnl|my_center|LOCUS_09390 152310 152558 gene locus_tag LOCUS_09400 152310 152558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 153033 152608 gene locus_tag LOCUS_09410 153033 152608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 153900 153220 gene locus_tag LOCUS_09420 153900 153220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 154297 153980 gene locus_tag LOCUS_09430 154297 153980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 157173 154300 gene locus_tag LOCUS_09440 157173 154300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 157447 157160 gene locus_tag LOCUS_09450 157447 157160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 157564 158154 gene locus_tag LOCUS_09460 157564 158154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 158151 159065 gene locus_tag LOCUS_09470 158151 159065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 159086 159556 gene locus_tag LOCUS_09480 159086 159556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 159553 159918 gene locus_tag LOCUS_09490 159553 159918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 160411 159842 gene locus_tag LOCUS_09500 160411 159842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 161003 160452 gene locus_tag LOCUS_09510 161003 160452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 161081 162583 gene locus_tag LOCUS_09520 161081 162583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 162580 163026 gene locus_tag LOCUS_09530 162580 163026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 163266 162979 gene locus_tag LOCUS_09540 163266 162979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 163553 163266 gene locus_tag LOCUS_09550 163553 163266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 164132 163557 gene locus_tag LOCUS_09560 164132 163557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 164231 164584 gene locus_tag LOCUS_09570 164231 164584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 165860 164622 gene locus_tag LOCUS_09580 165860 164622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 166262 167548 gene locus_tag LOCUS_09590 gene eno 166262 167548 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785741.1 protein_id gnl|my_center|LOCUS_09590 167570 168193 gene locus_tag LOCUS_09600 167570 168193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 169425 168259 gene locus_tag LOCUS_09610 169425 168259 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943264.1 protein_id gnl|my_center|LOCUS_09610 169698 169609 gene locus_tag LOCUS_t00100 169698 169609 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence06 1153 449 gene locus_tag LOCUS_09620 1153 449 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_09620 3047 1260 gene locus_tag LOCUS_09630 gene aspS 3047 1260 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123218.1 protein_id gnl|my_center|LOCUS_09630 3734 3087 gene locus_tag LOCUS_09640 3734 3087 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_09640 4214 3819 gene locus_tag LOCUS_09650 4214 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4549 4280 gene locus_tag LOCUS_09660 4549 4280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09660 7224 4633 gene locus_tag LOCUS_09670 gene clpB 7224 4633 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_09670 8225 7476 gene locus_tag LOCUS_09680 gene pgeF 8225 7476 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_09680 9196 8204 gene locus_tag LOCUS_09690 gene rluD 9196 8204 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707736.1 protein_id gnl|my_center|LOCUS_09690 9429 9193 gene locus_tag LOCUS_09700 9429 9193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 9358 10128 gene locus_tag LOCUS_09710 9358 10128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 11966 10338 gene locus_tag LOCUS_09720 11966 10338 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198600.1 protein_id gnl|my_center|LOCUS_09720 13014 12142 gene locus_tag LOCUS_09730 gene sucD 13014 12142 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_09730 14186 13011 gene locus_tag LOCUS_09740 gene sucC 14186 13011 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444794.1 protein_id gnl|my_center|LOCUS_09740 14346 15998 gene locus_tag LOCUS_09750 gene pilS 14346 15998 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_09750 15989 17332 gene locus_tag LOCUS_09760 gene pilR 15989 17332 CDS product two-component system response regulator PilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094694.1 protein_id gnl|my_center|LOCUS_09760 17682 18191 gene locus_tag LOCUS_09770 gene pilE 17682 18191 CDS product fimbrial major subunit PilE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980743.1 protein_id gnl|my_center|LOCUS_09770 18365 20086 gene locus_tag LOCUS_09780 gene pilB 18365 20086 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038212.1 protein_id gnl|my_center|LOCUS_09780 20299 21516 gene locus_tag LOCUS_09790 20299 21516 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_09790 21545 22408 gene locus_tag LOCUS_09800 21545 22408 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_09800 22408 23019 gene locus_tag LOCUS_09810 gene coaE 22408 23019 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704406.1 protein_id gnl|my_center|LOCUS_09810 23170 23922 gene locus_tag LOCUS_09820 gene zapD 23170 23922 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957406.1 protein_id gnl|my_center|LOCUS_09820 24603 24187 gene locus_tag LOCUS_09830 24603 24187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 27352 24587 gene locus_tag LOCUS_09840 gene secA 27352 24587 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_09840 28428 27508 gene locus_tag LOCUS_09850 28428 27508 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035969.1 protein_id gnl|my_center|LOCUS_09850 28716 29021 gene locus_tag LOCUS_09860 28716 29021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 30073 29162 gene locus_tag LOCUS_09870 gene lpxC 30073 29162 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_09870 31511 30327 gene locus_tag LOCUS_09880 gene ftsZ 31511 30327 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 protein_id gnl|my_center|LOCUS_09880 32806 31571 gene locus_tag LOCUS_09890 gene ftsA 32806 31571 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_09890 33584 32799 gene locus_tag LOCUS_09900 33584 32799 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094118.1 protein_id gnl|my_center|LOCUS_09900 34545 33574 gene locus_tag LOCUS_09910 34545 33574 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_09910 35435 34542 gene locus_tag LOCUS_09920 gene murB 35435 34542 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_09920 36883 35459 gene locus_tag LOCUS_09930 gene murC 36883 35459 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073899.1 protein_id gnl|my_center|LOCUS_09930 37965 36880 gene locus_tag LOCUS_09940 gene murG 37965 36880 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_09940 39158 37962 gene locus_tag LOCUS_09950 gene ftsW 39158 37962 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_09950 40528 39155 gene locus_tag LOCUS_09960 gene murD 40528 39155 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103104.1 protein_id gnl|my_center|LOCUS_09960 41622 40540 gene locus_tag LOCUS_09970 gene mraY 41622 40540 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_09970 43028 41625 gene locus_tag LOCUS_09980 43028 41625 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_09980 44425 43025 gene locus_tag LOCUS_09990 44425 43025 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_09990 46254 44515 gene locus_tag LOCUS_10000 gene ftsI 46254 44515 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_10000 46529 46251 gene locus_tag LOCUS_10010 46529 46251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 47458 46526 gene locus_tag LOCUS_10020 gene rsmH 47458 46526 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769446.1 protein_id gnl|my_center|LOCUS_10020 47998 47519 gene locus_tag LOCUS_10030 gene mraZ 47998 47519 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769445.1 protein_id gnl|my_center|LOCUS_10030 49624 48776 gene locus_tag LOCUS_10040 gene rsmI 49624 48776 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035951.1 protein_id gnl|my_center|LOCUS_10040 49898 50977 gene locus_tag LOCUS_10050 49898 50977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 50974 51375 gene locus_tag LOCUS_10060 50974 51375 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_10060 51454 52041 gene locus_tag LOCUS_10070 51454 52041 CDS product phosphoheptose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418801.1 protein_id gnl|my_center|LOCUS_10070 52482 52060 gene locus_tag LOCUS_10080 gene sspB 52482 52060 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420947.1 protein_id gnl|my_center|LOCUS_10080 53094 52495 gene locus_tag LOCUS_10090 gene sspA 53094 52495 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369483.1 protein_id gnl|my_center|LOCUS_10090 53853 53185 gene locus_tag LOCUS_10100 53853 53185 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994029.1 protein_id gnl|my_center|LOCUS_10100 55232 53970 gene locus_tag LOCUS_10110 55232 53970 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_10110 55822 55229 gene locus_tag LOCUS_10120 gene petA 55822 55229 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_10120 57245 55992 gene locus_tag LOCUS_10130 gene murA 57245 55992 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_10130 57550 57269 gene locus_tag LOCUS_10140 57550 57269 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037923.1 protein_id gnl|my_center|LOCUS_10140 57673 58656 gene locus_tag LOCUS_10150 57673 58656 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_10150 58707 59225 gene locus_tag LOCUS_10160 gene kdsC 58707 59225 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213328.1 protein_id gnl|my_center|LOCUS_10160 59232 59792 gene locus_tag LOCUS_10170 59232 59792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 59782 60408 gene locus_tag LOCUS_10180 gene lptA 59782 60408 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830444.1 protein_id gnl|my_center|LOCUS_10180 60405 61130 gene locus_tag LOCUS_10190 gene lptB 60405 61130 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467801.1 protein_id gnl|my_center|LOCUS_10190 61252 62682 gene locus_tag LOCUS_10200 61252 62682 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_10200 62723 63049 gene locus_tag LOCUS_10210 gene hpf 62723 63049 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_10210 63093 63986 gene locus_tag LOCUS_10220 gene rapZ 63093 63986 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_10220 64204 65598 gene locus_tag LOCUS_10230 gene mgtE 64204 65598 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417489.1 protein_id gnl|my_center|LOCUS_10230 66929 65628 gene locus_tag LOCUS_10240 66929 65628 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408362.1 protein_id gnl|my_center|LOCUS_10240 67046 67585 gene locus_tag LOCUS_10250 gene bcp 67046 67585 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_10250 68938 67607 gene locus_tag LOCUS_10260 68938 67607 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037997.1 protein_id gnl|my_center|LOCUS_10260 70460 69030 gene locus_tag LOCUS_10270 gene pyk 70460 69030 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169197.1 protein_id gnl|my_center|LOCUS_10270 71686 70481 gene locus_tag LOCUS_10280 71686 70481 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_10280 72689 71676 gene locus_tag LOCUS_10290 gene gap 72689 71676 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809444.1 protein_id gnl|my_center|LOCUS_10290 74745 72721 gene locus_tag LOCUS_10300 gene tkt 74745 72721 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706909.1 protein_id gnl|my_center|LOCUS_10300 75228 74878 gene locus_tag LOCUS_10310 75228 74878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 75348 76523 gene locus_tag LOCUS_10320 gene metK 75348 76523 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004149807.1 protein_id gnl|my_center|LOCUS_10320 76545 77858 gene locus_tag LOCUS_10330 gene ahcY 76545 77858 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947737.1 protein_id gnl|my_center|LOCUS_10330 77987 78799 gene locus_tag LOCUS_10340 gene cpdA 77987 78799 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 protein_id gnl|my_center|LOCUS_10340 78868 79782 gene locus_tag LOCUS_10350 78868 79782 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_10350 79966 79790 gene locus_tag LOCUS_10360 79966 79790 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947264.1 protein_id gnl|my_center|LOCUS_10360 81392 80022 gene locus_tag LOCUS_10370 gene mpl 81392 80022 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_10370 81910 81392 gene locus_tag LOCUS_10380 81910 81392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 81941 83050 gene locus_tag LOCUS_10390 gene rnd 81941 83050 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_10390 83746 83093 gene locus_tag LOCUS_10400 83746 83093 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_10400 83984 85240 gene locus_tag LOCUS_10410 83984 85240 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_10410 85574 87619 gene locus_tag LOCUS_10420 85574 87619 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_10420 88471 87665 gene locus_tag LOCUS_10430 88471 87665 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_10430 90939 88615 gene locus_tag LOCUS_10440 90939 88615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 91211 91870 gene locus_tag LOCUS_10450 91211 91870 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_10450 92051 93511 gene locus_tag LOCUS_10460 gene tolC 92051 93511 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_10460 94811 93513 gene locus_tag LOCUS_10470 gene waaA 94811 93513 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_10470 96249 94822 gene locus_tag LOCUS_10480 gene hldE 96249 94822 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707478.1 protein_id gnl|my_center|LOCUS_10480 97053 96343 gene locus_tag LOCUS_10490 97053 96343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_10490 99293 97080 gene locus_tag LOCUS_10500 99293 97080 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895708.1 protein_id gnl|my_center|LOCUS_10500 99737 101098 gene locus_tag LOCUS_10510 99737 101098 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 protein_id gnl|my_center|LOCUS_10510 101290 102240 gene locus_tag LOCUS_10520 101290 102240 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_10520 103192 102185 gene locus_tag LOCUS_10530 103192 102185 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118564.1 protein_id gnl|my_center|LOCUS_10530 103318 104553 gene locus_tag LOCUS_10540 103318 104553 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817222.1 protein_id gnl|my_center|LOCUS_10540 105774 104860 gene locus_tag LOCUS_10550 105774 104860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 105658 106005 gene locus_tag LOCUS_10560 105658 106005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 107202 106024 gene locus_tag LOCUS_10570 107202 106024 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004566001.1 protein_id gnl|my_center|LOCUS_10570 107273 108028 gene locus_tag LOCUS_10580 107273 108028 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_10580 108605 108042 gene locus_tag LOCUS_10590 gene folK 108605 108042 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_10590 108988 108602 gene locus_tag LOCUS_10600 gene folB 108988 108602 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_10600 110050 109007 gene locus_tag LOCUS_10610 gene tsaD 110050 109007 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_10610 110142 110357 gene locus_tag LOCUS_10620 gene rpsU 110142 110357 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 protein_id gnl|my_center|LOCUS_10620 110376 110822 gene locus_tag LOCUS_10630 110376 110822 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190948.1 protein_id gnl|my_center|LOCUS_10630 110913 112712 gene locus_tag LOCUS_10640 gene dnaG 110913 112712 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_10640 112935 114770 gene locus_tag LOCUS_10650 gene rpoD 112935 114770 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_10650 116279 114795 gene locus_tag LOCUS_10660 116279 114795 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_10660 117446 116463 gene locus_tag LOCUS_10670 117446 116463 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919459.1 protein_id gnl|my_center|LOCUS_10670 118417 117722 gene locus_tag LOCUS_10680 118417 117722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 119010 118429 gene locus_tag LOCUS_10690 119010 118429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 119166 119242 gene locus_tag LOCUS_t00110 119166 119242 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 120104 119319 gene locus_tag LOCUS_10700 120104 119319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192376.1 protein_id gnl|my_center|LOCUS_10700 121142 120135 gene locus_tag LOCUS_10710 121142 120135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004568579.1 protein_id gnl|my_center|LOCUS_10710 121278 123728 gene locus_tag LOCUS_10720 gene lon 121278 123728 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088915.1 protein_id gnl|my_center|LOCUS_10720 124062 123742 gene locus_tag LOCUS_10730 124062 123742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 124713 124300 gene locus_tag LOCUS_10740 124713 124300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340868.1 protein_id gnl|my_center|LOCUS_10740 125303 124800 gene locus_tag LOCUS_10750 125303 124800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 125302 127125 gene locus_tag LOCUS_10760 gene typA 125302 127125 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704285.1 protein_id gnl|my_center|LOCUS_10760 127182 127532 gene locus_tag LOCUS_10770 127182 127532 CDS product DUF3088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265530.1 protein_id gnl|my_center|LOCUS_10770 127634 129463 gene locus_tag LOCUS_10780 127634 129463 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529119.1 protein_id gnl|my_center|LOCUS_10780 129545 129739 gene locus_tag LOCUS_10790 129545 129739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 129945 130457 gene locus_tag LOCUS_10800 129945 130457 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084296.1 protein_id gnl|my_center|LOCUS_10800 131692 130454 gene locus_tag LOCUS_10810 131692 130454 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444859.1 protein_id gnl|my_center|LOCUS_10810 133171 131708 gene locus_tag LOCUS_10820 133171 131708 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895552.1 protein_id gnl|my_center|LOCUS_10820 133884 133159 gene locus_tag LOCUS_10830 133884 133159 CDS product C39 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444858.1 protein_id gnl|my_center|LOCUS_10830 134050 135246 gene locus_tag LOCUS_10840 134050 135246 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536130.1 protein_id gnl|my_center|LOCUS_10840 136255 135314 gene locus_tag LOCUS_10850 136255 135314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 136516 138912 gene locus_tag LOCUS_10860 136516 138912 CDS product bifunctional diguanylate cyclase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037666.1 protein_id gnl|my_center|LOCUS_10860 139532 138969 gene locus_tag LOCUS_10870 139532 138969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 139891 140289 gene locus_tag LOCUS_10880 139891 140289 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227446.1 protein_id gnl|my_center|LOCUS_10880 143140 140339 gene locus_tag LOCUS_10890 143140 140339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 144127 143189 gene locus_tag LOCUS_10900 144127 143189 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522039.1 protein_id gnl|my_center|LOCUS_10900 145634 144153 gene locus_tag LOCUS_10910 gene gcvPB 145634 144153 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_10910 147017 145644 gene locus_tag LOCUS_10920 gene gcvPA 147017 145644 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_10920 147421 147032 gene locus_tag LOCUS_10930 gene gcvH 147421 147032 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098622.1 protein_id gnl|my_center|LOCUS_10930 148545 147454 gene locus_tag LOCUS_10940 gene gcvT 148545 147454 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763440.1 protein_id gnl|my_center|LOCUS_10940 149833 148880 gene locus_tag LOCUS_10950 149833 148880 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087807.1 protein_id gnl|my_center|LOCUS_10950 151359 149833 gene locus_tag LOCUS_10960 151359 149833 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945845.1 protein_id gnl|my_center|LOCUS_10960 152751 151441 gene locus_tag LOCUS_10970 gene pepP 152751 151441 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_10970 153343 152762 gene locus_tag LOCUS_10980 153343 152762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 153478 153708 gene locus_tag LOCUS_10990 153478 153708 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_10990 153705 154016 gene locus_tag LOCUS_11000 153705 154016 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_11000 154312 154881 gene locus_tag LOCUS_11010 154312 154881 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_11010 155381 156043 gene locus_tag LOCUS_11020 gene rpiA 155381 156043 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770348.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence07 884 198 gene locus_tag LOCUS_11030 884 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1218 1565 gene locus_tag LOCUS_11040 1218 1565 CDS product arsenosugar biosynthesis-associated peroxidase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986517.1 protein_id gnl|my_center|LOCUS_11040 1615 1947 gene locus_tag LOCUS_11050 1615 1947 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810529.1 protein_id gnl|my_center|LOCUS_11050 2257 2541 gene locus_tag LOCUS_11060 2257 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 2552 3142 gene locus_tag LOCUS_11070 2552 3142 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_11070 3525 3193 gene locus_tag LOCUS_11080 3525 3193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4745 3522 gene locus_tag LOCUS_11090 4745 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 6952 5066 gene locus_tag LOCUS_11100 6952 5066 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909312.1 protein_id gnl|my_center|LOCUS_11100 9591 6949 gene locus_tag LOCUS_11110 9591 6949 CDS product glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141113.1 protein_id gnl|my_center|LOCUS_11110 10709 9588 gene locus_tag LOCUS_11120 10709 9588 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141167.1 protein_id gnl|my_center|LOCUS_11120 12544 10820 gene locus_tag LOCUS_11130 gene cysI 12544 10820 CDS product assimilatory sulfite reductase (NADPH) hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002470366.1 protein_id gnl|my_center|LOCUS_11130 14329 12551 gene locus_tag LOCUS_11140 14329 12551 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820020.1 protein_id gnl|my_center|LOCUS_11140 15245 14433 gene locus_tag LOCUS_11150 15245 14433 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942204.1 protein_id gnl|my_center|LOCUS_11150 15445 16947 gene locus_tag LOCUS_11160 15445 16947 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207262.1 protein_id gnl|my_center|LOCUS_11160 16978 18837 gene locus_tag LOCUS_11170 16978 18837 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530026.1 protein_id gnl|my_center|LOCUS_11170 18932 21637 gene locus_tag LOCUS_11180 gene polA 18932 21637 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004540200.1 protein_id gnl|my_center|LOCUS_11180 23023 22439 gene locus_tag LOCUS_11190 gene yihA 23023 22439 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958433.1 protein_id gnl|my_center|LOCUS_11190 23177 23821 gene locus_tag LOCUS_11200 23177 23821 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_11200 23860 24741 gene locus_tag LOCUS_11210 23860 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 25136 24783 gene locus_tag LOCUS_11220 25136 24783 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036203.1 protein_id gnl|my_center|LOCUS_11220 25531 25247 gene locus_tag LOCUS_11230 25531 25247 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036202.1 protein_id gnl|my_center|LOCUS_11230 26173 25577 gene locus_tag LOCUS_11240 26173 25577 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223758.1 protein_id gnl|my_center|LOCUS_11240 26400 27365 gene locus_tag LOCUS_11250 26400 27365 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112778.1 protein_id gnl|my_center|LOCUS_11250 27563 28738 gene locus_tag LOCUS_11260 27563 28738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 28746 29354 gene locus_tag LOCUS_11270 28746 29354 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083090.1 protein_id gnl|my_center|LOCUS_11270 29364 29738 gene locus_tag LOCUS_11280 29364 29738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 30800 29769 gene locus_tag LOCUS_11290 30800 29769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11290 31250 30849 gene locus_tag LOCUS_11300 31250 30849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 31739 31344 gene locus_tag LOCUS_11310 31739 31344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 32181 31780 gene locus_tag LOCUS_11320 32181 31780 CDS product DUF2784 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525171.1 protein_id gnl|my_center|LOCUS_11320 32756 32181 gene locus_tag LOCUS_11330 32756 32181 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705445.1 protein_id gnl|my_center|LOCUS_11330 33321 32872 gene locus_tag LOCUS_11340 33321 32872 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038290.1 protein_id gnl|my_center|LOCUS_11340 33962 33318 gene locus_tag LOCUS_11350 gene can 33962 33318 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_11350 34214 35626 gene locus_tag LOCUS_11360 34214 35626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 35669 36778 gene locus_tag LOCUS_11370 35669 36778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 40638 36814 gene locus_tag LOCUS_11380 40638 36814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 41960 41268 gene locus_tag LOCUS_11390 41960 41268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 43287 42049 gene locus_tag LOCUS_11400 43287 42049 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_11400 44869 43277 gene locus_tag LOCUS_11410 44869 43277 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_11410 45078 45326 gene locus_tag LOCUS_11420 45078 45326 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_11420 45326 46162 gene locus_tag LOCUS_11430 45326 46162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 46159 47019 gene locus_tag LOCUS_11440 46159 47019 CDS product hydrolase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390872.1 protein_id gnl|my_center|LOCUS_11440 47057 48823 gene locus_tag LOCUS_11450 gene asnB 47057 48823 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_11450 50024 48840 gene locus_tag LOCUS_11460 50024 48840 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390844.1 protein_id gnl|my_center|LOCUS_11460 51056 50070 gene locus_tag LOCUS_11470 51056 50070 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_11470 52286 51078 gene locus_tag LOCUS_11480 52286 51078 CDS product TIGR03087 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390853.1 protein_id gnl|my_center|LOCUS_11480 54232 52283 gene locus_tag LOCUS_11490 gene asnB 54232 52283 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_11490 56159 54264 gene locus_tag LOCUS_11500 56159 54264 CDS product amidotransferase 1, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390869.1 protein_id gnl|my_center|LOCUS_11500 57284 56163 gene locus_tag LOCUS_11510 57284 56163 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121265.1 protein_id gnl|my_center|LOCUS_11510 58223 57339 gene locus_tag LOCUS_11520 58223 57339 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_11520 59718 58228 gene locus_tag LOCUS_11530 59718 58228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 60556 59732 gene locus_tag LOCUS_11540 60556 59732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 62160 60553 gene locus_tag LOCUS_11550 62160 60553 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_11550 62764 62180 gene locus_tag LOCUS_11560 62764 62180 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_11560 63919 63140 gene locus_tag LOCUS_11570 63919 63140 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257230.1 protein_id gnl|my_center|LOCUS_11570 65588 63948 gene locus_tag LOCUS_11580 65588 63948 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257757.1 protein_id gnl|my_center|LOCUS_11580 65619 65936 gene locus_tag LOCUS_11590 65619 65936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 66186 66110 gene locus_tag LOCUS_t00120 66186 66110 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 66285 67001 gene locus_tag LOCUS_11600 gene fixK 66285 67001 CDS product transcriptional regulator FixK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918638.1 protein_id gnl|my_center|LOCUS_11600 67932 66961 gene locus_tag LOCUS_11610 gene yedA 67932 66961 CDS product drug/metabolite exporter YedA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112921.1 protein_id gnl|my_center|LOCUS_11610 69553 68054 gene locus_tag LOCUS_11620 69553 68054 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_11620 69838 69584 gene locus_tag LOCUS_11630 69838 69584 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369643.1 protein_id gnl|my_center|LOCUS_11630 70162 70500 gene locus_tag LOCUS_11640 gene glnK 70162 70500 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_11640 70542 71945 gene locus_tag LOCUS_11650 gene amt 70542 71945 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707418.1 protein_id gnl|my_center|LOCUS_11650 72434 72345 gene locus_tag LOCUS_t00130 72434 72345 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 72578 73717 gene locus_tag LOCUS_11660 72578 73717 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_11660 73687 74466 gene locus_tag LOCUS_11670 gene algR 73687 74466 CDS product alginate biosynthesis regulator AlgR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096397.1 protein_id gnl|my_center|LOCUS_11670 74509 75564 gene locus_tag LOCUS_11680 74509 75564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 75561 76829 gene locus_tag LOCUS_11690 75561 76829 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103004.1 protein_id gnl|my_center|LOCUS_11690 78399 77014 gene locus_tag LOCUS_11700 78399 77014 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_11700 79185 78538 gene locus_tag LOCUS_11710 79185 78538 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_11710 79404 80222 gene locus_tag LOCUS_11720 gene dapF 79404 80222 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_11720 80219 80917 gene locus_tag LOCUS_11730 80219 80917 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_11730 80985 81890 gene locus_tag LOCUS_11740 gene xerC 80985 81890 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246535.1 protein_id gnl|my_center|LOCUS_11740 82015 82530 gene locus_tag LOCUS_11750 82015 82530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 82729 83274 gene locus_tag LOCUS_11760 gene hslV 82729 83274 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_11760 83297 84640 gene locus_tag LOCUS_11770 gene hslU 83297 84640 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_11770 84661 85404 gene locus_tag LOCUS_11780 gene ubiE 84661 85404 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005416847.1 protein_id gnl|my_center|LOCUS_11780 85416 86021 gene locus_tag LOCUS_11790 85416 86021 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035478.1 protein_id gnl|my_center|LOCUS_11790 86093 87769 gene locus_tag LOCUS_11800 gene ubiB 86093 87769 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_11800 88590 87805 gene locus_tag LOCUS_11810 gene trpA 88590 87805 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937778.1 protein_id gnl|my_center|LOCUS_11810 89852 88599 gene locus_tag LOCUS_11820 gene trpB 89852 88599 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_11820 90477 89839 gene locus_tag LOCUS_11830 90477 89839 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603742.1 protein_id gnl|my_center|LOCUS_11830 91414 90569 gene locus_tag LOCUS_11840 gene trpC 91414 90569 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224167.1 protein_id gnl|my_center|LOCUS_11840 92442 91411 gene locus_tag LOCUS_11850 gene trpD 92442 91411 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257622.1 protein_id gnl|my_center|LOCUS_11850 93017 92439 gene locus_tag LOCUS_11860 gene pabA 93017 92439 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392854.1 protein_id gnl|my_center|LOCUS_11860 94405 93014 gene locus_tag LOCUS_11870 gene trpE 94405 93014 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_11870 96528 94720 gene locus_tag LOCUS_11880 96528 94720 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_11880 98346 96544 gene locus_tag LOCUS_11890 98346 96544 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720836.1 protein_id gnl|my_center|LOCUS_11890 99940 98537 gene locus_tag LOCUS_11900 99940 98537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 100111 102876 gene locus_tag LOCUS_11910 gene ppc 100111 102876 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035990.1 protein_id gnl|my_center|LOCUS_11910 102914 103888 gene locus_tag LOCUS_11920 102914 103888 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_11920 103951 104691 gene locus_tag LOCUS_11930 103951 104691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 105488 104880 gene locus_tag LOCUS_11940 105488 104880 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_11940 106442 105627 gene locus_tag LOCUS_11950 106442 105627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 107812 106436 gene locus_tag LOCUS_11960 107812 106436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 108422 107889 gene locus_tag LOCUS_11970 108422 107889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 109045 108419 gene locus_tag LOCUS_11980 109045 108419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 110582 109032 gene locus_tag LOCUS_11990 110582 109032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 111787 110582 gene locus_tag LOCUS_12000 111787 110582 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387875.1 protein_id gnl|my_center|LOCUS_12000 113553 111784 gene locus_tag LOCUS_12010 113553 111784 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_12010 114821 113559 gene locus_tag LOCUS_12020 114821 113559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 116557 114818 gene locus_tag LOCUS_12030 116557 114818 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_12030 117166 117858 gene locus_tag LOCUS_12040 117166 117858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 119928 117964 gene locus_tag LOCUS_12050 gene acs 119928 117964 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_12050 121357 120254 gene locus_tag LOCUS_12060 121357 120254 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_12060 121293 124217 gene locus_tag LOCUS_12070 121293 124217 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942486.1 protein_id gnl|my_center|LOCUS_12070 124246 125208 gene locus_tag LOCUS_12080 124246 125208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 125278 126594 gene locus_tag LOCUS_12090 125278 126594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 126591 127277 gene locus_tag LOCUS_12100 126591 127277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 127274 128527 gene locus_tag LOCUS_12110 127274 128527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 128610 129662 gene locus_tag LOCUS_12120 128610 129662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 129699 130835 gene locus_tag LOCUS_12130 129699 130835 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808458.1 protein_id gnl|my_center|LOCUS_12130 130836 131648 gene locus_tag LOCUS_12140 130836 131648 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121937.1 protein_id gnl|my_center|LOCUS_12140 132337 132834 gene locus_tag LOCUS_12150 132337 132834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 133137 132868 gene locus_tag LOCUS_12160 133137 132868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 133045 134853 gene locus_tag LOCUS_12170 gene asnB 133045 134853 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056091.1 protein_id gnl|my_center|LOCUS_12170 134841 135701 gene locus_tag LOCUS_12180 134841 135701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 135747 136877 gene locus_tag LOCUS_12190 135747 136877 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808460.1 protein_id gnl|my_center|LOCUS_12190 136862 137818 gene locus_tag LOCUS_12200 136862 137818 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226014007.1 protein_id gnl|my_center|LOCUS_12200 137866 138879 gene locus_tag LOCUS_12210 137866 138879 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_12210 139081 141093 gene locus_tag LOCUS_12220 139081 141093 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706692.1 protein_id gnl|my_center|LOCUS_12220 142593 141106 gene locus_tag LOCUS_12230 142593 141106 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074275.1 protein_id gnl|my_center|LOCUS_12230 143737 142862 gene locus_tag LOCUS_12240 143737 142862 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_12240 144504 144674 gene locus_tag LOCUS_12250 144504 144674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 144788 145087 gene locus_tag LOCUS_12260 144788 145087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence08 443 1693 gene locus_tag LOCUS_12270 443 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1733 2884 gene locus_tag LOCUS_12280 1733 2884 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_12280 2932 4020 gene locus_tag LOCUS_12290 2932 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4092 4817 gene locus_tag LOCUS_12300 4092 4817 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391054.1 protein_id gnl|my_center|LOCUS_12300 5361 4822 gene locus_tag LOCUS_12310 5361 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 5559 7274 gene locus_tag LOCUS_12320 5559 7274 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986802.1 protein_id gnl|my_center|LOCUS_12320 7271 7705 gene locus_tag LOCUS_12330 7271 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8936 7728 gene locus_tag LOCUS_12340 8936 7728 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922308.1 protein_id gnl|my_center|LOCUS_12340 10771 8936 gene locus_tag LOCUS_12350 10771 8936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 10919 12106 gene locus_tag LOCUS_12360 10919 12106 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_12360 12103 13608 gene locus_tag LOCUS_12370 12103 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 14551 13625 gene locus_tag LOCUS_12380 gene grxD 14551 13625 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038466.1 protein_id gnl|my_center|LOCUS_12380 14909 14583 gene locus_tag LOCUS_12390 gene iscA 14909 14583 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209834.1 protein_id gnl|my_center|LOCUS_12390 14908 15585 gene locus_tag LOCUS_12400 14908 15585 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089624.1 protein_id gnl|my_center|LOCUS_12400 15997 15605 gene locus_tag LOCUS_12410 gene erpA 15997 15605 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814883.1 protein_id gnl|my_center|LOCUS_12410 16043 17080 gene locus_tag LOCUS_12420 16043 17080 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_12420 17172 20612 gene locus_tag LOCUS_12430 17172 20612 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390034.1 protein_id gnl|my_center|LOCUS_12430 22013 20628 gene locus_tag LOCUS_12440 22013 20628 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099328.1 protein_id gnl|my_center|LOCUS_12440 23741 22062 gene locus_tag LOCUS_12450 23741 22062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 23634 23855 gene locus_tag LOCUS_12460 23634 23855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 23846 26200 gene locus_tag LOCUS_12470 23846 26200 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063689.1 protein_id gnl|my_center|LOCUS_12470 26324 26151 gene locus_tag LOCUS_12480 26324 26151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 28801 26321 gene locus_tag LOCUS_12490 28801 26321 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_12490 29298 28813 gene locus_tag LOCUS_12500 29298 28813 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103795.1 protein_id gnl|my_center|LOCUS_12500 30696 29308 gene locus_tag LOCUS_12510 gene ccoG 30696 29308 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_12510 31041 30721 gene locus_tag LOCUS_12520 31041 30721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 31955 31038 gene locus_tag LOCUS_12530 gene ccoP 31955 31038 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477628.1 protein_id gnl|my_center|LOCUS_12530 32143 31964 gene locus_tag LOCUS_12540 32143 31964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 32745 32140 gene locus_tag LOCUS_12550 gene ccoO 32745 32140 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261904.1 protein_id gnl|my_center|LOCUS_12550 34175 32757 gene locus_tag LOCUS_12560 gene ccoN 34175 32757 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477654.1 protein_id gnl|my_center|LOCUS_12560 36620 34455 gene locus_tag LOCUS_12570 36620 34455 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206773.1 protein_id gnl|my_center|LOCUS_12570 37381 36773 gene locus_tag LOCUS_12580 37381 36773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 37740 38405 gene locus_tag LOCUS_12590 37740 38405 CDS product N-carbamoylsarcosine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258125.1 protein_id gnl|my_center|LOCUS_12590 38421 39356 gene locus_tag LOCUS_12600 38421 39356 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729046.1 protein_id gnl|my_center|LOCUS_12600 39398 39664 gene locus_tag LOCUS_12610 39398 39664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 39740 40729 gene locus_tag LOCUS_12620 39740 40729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 40776 41762 gene locus_tag LOCUS_12630 40776 41762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 41803 42987 gene locus_tag LOCUS_12640 41803 42987 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141490.1 protein_id gnl|my_center|LOCUS_12640 43092 44231 gene locus_tag LOCUS_12650 43092 44231 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_12650 44274 45053 gene locus_tag LOCUS_12660 44274 45053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 45046 45897 gene locus_tag LOCUS_12670 45046 45897 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_12670 45959 46762 gene locus_tag LOCUS_12680 45959 46762 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389698.1 protein_id gnl|my_center|LOCUS_12680 47769 46837 gene locus_tag LOCUS_12690 47769 46837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 47872 48945 gene locus_tag LOCUS_12700 47872 48945 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_12700 49002 49802 gene locus_tag LOCUS_12710 49002 49802 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390537.1 protein_id gnl|my_center|LOCUS_12710 52812 50005 gene locus_tag LOCUS_12720 52812 50005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 53544 53840 gene locus_tag LOCUS_12730 53544 53840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 53954 54214 gene locus_tag LOCUS_12740 53954 54214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 54216 55313 gene locus_tag LOCUS_12750 54216 55313 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705342.1 protein_id gnl|my_center|LOCUS_12750 55514 56218 gene locus_tag LOCUS_12760 55514 56218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 56262 56834 gene locus_tag LOCUS_12770 56262 56834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 57143 57817 gene locus_tag LOCUS_12780 57143 57817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 58362 58589 gene locus_tag LOCUS_12790 58362 58589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 59088 58963 gene locus_tag LOCUS_12800 59088 58963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 59251 60021 gene locus_tag LOCUS_12810 59251 60021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 60611 60162 gene locus_tag LOCUS_12820 60611 60162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 60868 60605 gene locus_tag LOCUS_12830 60868 60605 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035652.1 protein_id gnl|my_center|LOCUS_12830 61008 61280 gene locus_tag LOCUS_12840 61008 61280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 61421 61813 gene locus_tag LOCUS_12850 gene crcB 61421 61813 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963905.1 protein_id gnl|my_center|LOCUS_12850 62775 61915 gene locus_tag LOCUS_12860 gene purU 62775 61915 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522850.1 protein_id gnl|my_center|LOCUS_12860 62963 64345 gene locus_tag LOCUS_12870 62963 64345 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112937.1 protein_id gnl|my_center|LOCUS_12870 64426 66201 gene locus_tag LOCUS_12880 64426 66201 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388194.1 protein_id gnl|my_center|LOCUS_12880 66551 66210 gene locus_tag LOCUS_12890 66551 66210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 66719 67876 gene locus_tag LOCUS_12900 66719 67876 CDS product bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001201908.1 protein_id gnl|my_center|LOCUS_12900 67990 68760 gene locus_tag LOCUS_12910 67990 68760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 68846 69292 gene locus_tag LOCUS_12920 68846 69292 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_12920 69727 69503 gene locus_tag LOCUS_12930 69727 69503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 69717 69989 gene locus_tag LOCUS_12940 69717 69989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 71116 70133 gene locus_tag LOCUS_12950 71116 70133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 71957 71148 gene locus_tag LOCUS_12960 71957 71148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 72583 72014 gene locus_tag LOCUS_12970 72583 72014 CDS product DUF1700 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921238.1 protein_id gnl|my_center|LOCUS_12970 72906 72580 gene locus_tag LOCUS_12980 72906 72580 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921237.1 protein_id gnl|my_center|LOCUS_12980 73051 74790 gene locus_tag LOCUS_12990 73051 74790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 75556 74966 gene locus_tag LOCUS_13000 gene idi 75556 74966 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_13000 77811 75553 gene locus_tag LOCUS_13010 77811 75553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 78018 80084 gene locus_tag LOCUS_13020 78018 80084 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_13020 80101 81786 gene locus_tag LOCUS_13030 gene fadD 80101 81786 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096142.1 protein_id gnl|my_center|LOCUS_13030 81937 83559 gene locus_tag LOCUS_13040 81937 83559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 84442 83672 gene locus_tag LOCUS_13050 84442 83672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 84922 84455 gene locus_tag LOCUS_13060 84922 84455 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940911.1 protein_id gnl|my_center|LOCUS_13060 85042 85716 gene locus_tag LOCUS_13070 85042 85716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 86205 86897 gene locus_tag LOCUS_13080 86205 86897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 86894 88105 gene locus_tag LOCUS_13090 86894 88105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 88118 90379 gene locus_tag LOCUS_13100 88118 90379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 90376 92778 gene locus_tag LOCUS_13110 90376 92778 CDS product PEGA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008292761.1 protein_id gnl|my_center|LOCUS_13110 92805 93119 gene locus_tag LOCUS_13120 92805 93119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 93157 93954 gene locus_tag LOCUS_13130 93157 93954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 93971 95332 gene locus_tag LOCUS_13140 93971 95332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 95322 96422 gene locus_tag LOCUS_13150 95322 96422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 96422 97411 gene locus_tag LOCUS_13160 96422 97411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 97444 97788 gene locus_tag LOCUS_13170 97444 97788 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947715.1 protein_id gnl|my_center|LOCUS_13170 100265 97866 gene locus_tag LOCUS_13180 100265 97866 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_13180 100541 101413 gene locus_tag LOCUS_13190 100541 101413 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_13190 101410 102864 gene locus_tag LOCUS_13200 101410 102864 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_13200 103021 104742 gene locus_tag LOCUS_13210 gene sulP 103021 104742 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937588.1 protein_id gnl|my_center|LOCUS_13210 104834 105733 gene locus_tag LOCUS_13220 104834 105733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 106824 105772 gene locus_tag LOCUS_13230 106824 105772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 107118 107480 gene locus_tag LOCUS_13240 107118 107480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 109456 107603 gene locus_tag LOCUS_13250 gene ilvB 109456 107603 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149674780.1 protein_id gnl|my_center|LOCUS_13250 109656 110162 gene locus_tag LOCUS_13260 gene ilvN 109656 110162 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186134.1 protein_id gnl|my_center|LOCUS_13260 110179 111330 gene locus_tag LOCUS_13270 gene proB 110179 111330 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388994.1 protein_id gnl|my_center|LOCUS_13270 111335 112621 gene locus_tag LOCUS_13280 111335 112621 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529069.1 protein_id gnl|my_center|LOCUS_13280 112699 113940 gene locus_tag LOCUS_13290 112699 113940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_13290 114042 114968 gene locus_tag LOCUS_13300 114042 114968 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_13300 115202 115927 gene locus_tag LOCUS_13310 115202 115927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 115997 116371 gene locus_tag LOCUS_13320 115997 116371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 116434 116685 gene locus_tag LOCUS_13330 116434 116685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 116682 118166 gene locus_tag LOCUS_13340 116682 118166 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_13340 118313 120595 gene locus_tag LOCUS_13350 118313 120595 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076057163.1 protein_id gnl|my_center|LOCUS_13350 120618 122372 gene locus_tag LOCUS_13360 120618 122372 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072956.1 protein_id gnl|my_center|LOCUS_13360 122680 122408 gene locus_tag LOCUS_13370 122680 122408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 124109 122826 gene locus_tag LOCUS_13380 124109 122826 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729591.1 protein_id gnl|my_center|LOCUS_13380 124350 125714 gene locus_tag LOCUS_13390 124350 125714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_13390 126848 125856 gene locus_tag LOCUS_13400 126848 125856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 127837 126833 gene locus_tag LOCUS_13410 127837 126833 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_13410 127923 128933 gene locus_tag LOCUS_13420 127923 128933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 129612 128968 gene locus_tag LOCUS_13430 gene mtgA 129612 128968 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023518284.1 protein_id gnl|my_center|LOCUS_13430 132329 129684 gene locus_tag LOCUS_13440 gene ndvB 132329 129684 CDS product glycosyltransferase NdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115817.1 protein_id gnl|my_center|LOCUS_13440 132760 133131 gene locus_tag LOCUS_13450 132760 133131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 133321 133596 gene locus_tag LOCUS_13460 133321 133596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence09 888 379 gene locus_tag LOCUS_13470 888 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1880 951 gene locus_tag LOCUS_13480 1880 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2159 2243 gene locus_tag LOCUS_t00140 2159 2243 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2293 3591 gene locus_tag LOCUS_13490 gene tig 2293 3591 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705880.1 protein_id gnl|my_center|LOCUS_13490 3626 4255 gene locus_tag LOCUS_13500 gene clpP 3626 4255 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_13500 4383 5702 gene locus_tag LOCUS_13510 gene clpX 4383 5702 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770751.1 protein_id gnl|my_center|LOCUS_13510 5778 8207 gene locus_tag LOCUS_13520 gene lon 5778 8207 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 protein_id gnl|my_center|LOCUS_13520 8440 8712 gene locus_tag LOCUS_13530 gene hupB 8440 8712 CDS product DNA-binding protein HU-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087931.1 protein_id gnl|my_center|LOCUS_13530 8841 8916 gene locus_tag LOCUS_t00150 8841 8916 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8924 9000 gene locus_tag LOCUS_t00160 8924 9000 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 9145 11058 gene locus_tag LOCUS_13540 9145 11058 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 protein_id gnl|my_center|LOCUS_13540 11976 11197 gene locus_tag LOCUS_13550 gene fabI 11976 11197 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000506501.1 protein_id gnl|my_center|LOCUS_13550 12146 12967 gene locus_tag LOCUS_13560 12146 12967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 12964 13458 gene locus_tag LOCUS_13570 gene rnhA 12964 13458 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193456.1 protein_id gnl|my_center|LOCUS_13570 13455 14162 gene locus_tag LOCUS_13580 gene dnaQ 13455 14162 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_13580 14342 15631 gene locus_tag LOCUS_13590 gene tviB 14342 15631 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_13590 15657 16679 gene locus_tag LOCUS_13600 15657 16679 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_13600 16883 18226 gene locus_tag LOCUS_13610 16883 18226 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_13610 18269 19693 gene locus_tag LOCUS_13620 18269 19693 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_13620 19739 21103 gene locus_tag LOCUS_13630 gene cpsG 19739 21103 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350528.1 protein_id gnl|my_center|LOCUS_13630 21431 22462 gene locus_tag LOCUS_13640 21431 22462 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390861.1 protein_id gnl|my_center|LOCUS_13640 22743 24224 gene locus_tag LOCUS_13650 22743 24224 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_13650 25619 24297 gene locus_tag LOCUS_13660 25619 24297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 25779 25853 gene locus_tag LOCUS_t00170 25779 25853 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 27256 25940 gene locus_tag LOCUS_13670 27256 25940 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222478.1 protein_id gnl|my_center|LOCUS_13670 28723 27326 gene locus_tag LOCUS_13680 28723 27326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 29349 28759 gene locus_tag LOCUS_13690 29349 28759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 29730 31040 gene locus_tag LOCUS_13700 gene wecA 29730 31040 CDS product UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694200.1 protein_id gnl|my_center|LOCUS_13700 31665 31060 gene locus_tag LOCUS_13710 31665 31060 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031096.1 protein_id gnl|my_center|LOCUS_13710 31885 33291 gene locus_tag LOCUS_13720 gene gltX 31885 33291 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026051153.1 protein_id gnl|my_center|LOCUS_13720 33381 33456 gene locus_tag LOCUS_t00180 33381 33456 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 33484 33559 gene locus_tag LOCUS_t00190 33484 33559 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 33767 34534 gene locus_tag LOCUS_13730 33767 34534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 34622 36754 gene locus_tag LOCUS_13740 34622 36754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 36774 38141 gene locus_tag LOCUS_13750 gene prsR 36774 38141 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_13750 39149 38154 gene locus_tag LOCUS_13760 gene galE 39149 38154 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_13760 39352 40362 gene locus_tag LOCUS_13770 gene dusA 39352 40362 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477377.1 protein_id gnl|my_center|LOCUS_13770 40462 41247 gene locus_tag LOCUS_13780 40462 41247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 41369 42280 gene locus_tag LOCUS_13790 41369 42280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 44046 42304 gene locus_tag LOCUS_13800 44046 42304 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943996.1 protein_id gnl|my_center|LOCUS_13800 44188 46119 gene locus_tag LOCUS_13810 44188 46119 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_13810 46116 46799 gene locus_tag LOCUS_13820 gene tsaB 46116 46799 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113851.1 protein_id gnl|my_center|LOCUS_13820 46831 47319 gene locus_tag LOCUS_13830 46831 47319 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_13830 48480 47350 gene locus_tag LOCUS_13840 gene dapE 48480 47350 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_13840 49316 48495 gene locus_tag LOCUS_13850 gene dapD 49316 48495 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186656.1 protein_id gnl|my_center|LOCUS_13850 52115 49380 gene locus_tag LOCUS_13860 52115 49380 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_13860 52879 52112 gene locus_tag LOCUS_13870 gene map 52879 52112 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092395.1 protein_id gnl|my_center|LOCUS_13870 53193 54149 gene locus_tag LOCUS_13880 gene rpsB 53193 54149 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_13880 54195 55076 gene locus_tag LOCUS_13890 gene tsf 54195 55076 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_13890 55199 55927 gene locus_tag LOCUS_13900 gene pyrH 55199 55927 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_13900 55974 56531 gene locus_tag LOCUS_13910 gene frr 55974 56531 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_13910 56611 57306 gene locus_tag LOCUS_13920 gene uppS 56611 57306 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527291.1 protein_id gnl|my_center|LOCUS_13920 57353 58171 gene locus_tag LOCUS_13930 gene cdsA 57353 58171 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_13930 58295 59659 gene locus_tag LOCUS_13940 gene rseP 58295 59659 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704447.1 protein_id gnl|my_center|LOCUS_13940 59665 62076 gene locus_tag LOCUS_13950 gene bamA 59665 62076 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266976.1 protein_id gnl|my_center|LOCUS_13950 62108 62647 gene locus_tag LOCUS_13960 62108 62647 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216262.1 protein_id gnl|my_center|LOCUS_13960 62702 63739 gene locus_tag LOCUS_13970 gene lpxD 62702 63739 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_13970 63736 64506 gene locus_tag LOCUS_13980 gene lpxA 63736 64506 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193051.1 protein_id gnl|my_center|LOCUS_13980 64518 65669 gene locus_tag LOCUS_13990 gene lpxB 64518 65669 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029629001.1 protein_id gnl|my_center|LOCUS_13990 65710 66327 gene locus_tag LOCUS_14000 gene rnhB 65710 66327 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811770.1 protein_id gnl|my_center|LOCUS_14000 66324 69809 gene locus_tag LOCUS_14010 gene dnaE 66324 69809 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958160.1 protein_id gnl|my_center|LOCUS_14010 69866 70825 gene locus_tag LOCUS_14020 gene accA 69866 70825 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_14020 70871 72205 gene locus_tag LOCUS_14030 gene tilS 70871 72205 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705125.1 protein_id gnl|my_center|LOCUS_14030 72430 74076 gene locus_tag LOCUS_14040 72430 74076 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_14040 74073 74954 gene locus_tag LOCUS_14050 gene kdsA 74073 74954 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958364.1 protein_id gnl|my_center|LOCUS_14050 74951 76237 gene locus_tag LOCUS_14060 gene eno 74951 76237 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_14060 76244 76552 gene locus_tag LOCUS_14070 76244 76552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 76581 77327 gene locus_tag LOCUS_14080 76581 77327 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036346.1 protein_id gnl|my_center|LOCUS_14080 77921 77376 gene locus_tag LOCUS_14090 77921 77376 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161962652.1 protein_id gnl|my_center|LOCUS_14090 77986 78729 gene locus_tag LOCUS_14100 gene surE 77986 78729 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_14100 78714 79403 gene locus_tag LOCUS_14110 78714 79403 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406213.1 protein_id gnl|my_center|LOCUS_14110 79412 80152 gene locus_tag LOCUS_14120 79412 80152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 80553 80185 gene locus_tag LOCUS_14130 80553 80185 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_14130 80488 82362 gene locus_tag LOCUS_14140 gene recJ 80488 82362 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771237.1 protein_id gnl|my_center|LOCUS_14140 82391 83497 gene locus_tag LOCUS_14150 gene prfB 82391 83497 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111697003.1 protein_id gnl|my_center|LOCUS_14150 83597 85099 gene locus_tag LOCUS_14160 gene lysS 83597 85099 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_14160 86011 85139 gene locus_tag LOCUS_14170 86011 85139 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032622187.1 protein_id gnl|my_center|LOCUS_14170 86005 86280 gene locus_tag LOCUS_14180 86005 86280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 86414 86806 gene locus_tag LOCUS_14190 gene sdhC 86414 86806 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921358.1 protein_id gnl|my_center|LOCUS_14190 86809 87189 gene locus_tag LOCUS_14200 gene sdhD 86809 87189 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037282.1 protein_id gnl|my_center|LOCUS_14200 87233 89020 gene locus_tag LOCUS_14210 gene sdhA 87233 89020 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265974.1 protein_id gnl|my_center|LOCUS_14210 89115 89897 gene locus_tag LOCUS_14220 89115 89897 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_14220 89926 90186 gene locus_tag LOCUS_14230 89926 90186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 90170 90601 gene locus_tag LOCUS_14240 90170 90601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 90742 91320 gene locus_tag LOCUS_14250 gene rpoE 90742 91320 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_14250 91345 91941 gene locus_tag LOCUS_14260 91345 91941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 91931 92971 gene locus_tag LOCUS_14270 91931 92971 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042144922.1 protein_id gnl|my_center|LOCUS_14270 92971 93222 gene locus_tag LOCUS_14280 92971 93222 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222412.1 protein_id gnl|my_center|LOCUS_14280 93265 95082 gene locus_tag LOCUS_14290 gene lepA 93265 95082 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947592.1 protein_id gnl|my_center|LOCUS_14290 95135 95890 gene locus_tag LOCUS_14300 gene lepB 95135 95890 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090229819.1 protein_id gnl|my_center|LOCUS_14300 96045 96410 gene locus_tag LOCUS_14310 96045 96410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 96407 97093 gene locus_tag LOCUS_14320 gene rnc 96407 97093 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_14320 97097 97993 gene locus_tag LOCUS_14330 gene era 97097 97993 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_14330 97990 98712 gene locus_tag LOCUS_14340 gene recO 97990 98712 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192953.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14340 98790 99548 gene locus_tag LOCUS_14350 gene pdxJ 98790 99548 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101974.1 protein_id gnl|my_center|LOCUS_14350 99545 99943 gene locus_tag LOCUS_14360 gene acpS 99545 99943 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460687.1 protein_id gnl|my_center|LOCUS_14360 99940 100731 gene locus_tag LOCUS_14370 99940 100731 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_14370 100728 102074 gene locus_tag LOCUS_14380 gene rlmD 100728 102074 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926715.1 protein_id gnl|my_center|LOCUS_14380 102085 102564 gene locus_tag LOCUS_14390 102085 102564 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_14390 102561 103607 gene locus_tag LOCUS_14400 gene nagZ 102561 103607 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040152.1 protein_id gnl|my_center|LOCUS_14400 103600 104151 gene locus_tag LOCUS_14410 103600 104151 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941682.1 protein_id gnl|my_center|LOCUS_14410 104148 104891 gene locus_tag LOCUS_14420 104148 104891 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_14420 104958 105983 gene locus_tag LOCUS_14430 104958 105983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 106669 106025 gene locus_tag LOCUS_14440 106669 106025 CDS product CsiV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091190.1 protein_id gnl|my_center|LOCUS_14440 110274 106753 gene locus_tag LOCUS_14450 gene mfd 110274 106753 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113980.1 protein_id gnl|my_center|LOCUS_14450 112761 110344 gene locus_tag LOCUS_14460 112761 110344 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920521.1 protein_id gnl|my_center|LOCUS_14460 112952 114943 gene locus_tag LOCUS_14470 112952 114943 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074214.1 protein_id gnl|my_center|LOCUS_14470 115300 115010 gene locus_tag LOCUS_14480 115300 115010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 115576 116817 gene locus_tag LOCUS_14490 115576 116817 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_14490 116829 118076 gene locus_tag LOCUS_14500 116829 118076 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191984.1 protein_id gnl|my_center|LOCUS_14500 118097 118831 gene locus_tag LOCUS_14510 gene lolD 118097 118831 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172452211.1 protein_id gnl|my_center|LOCUS_14510 118855 119853 gene locus_tag LOCUS_14520 118855 119853 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_14520 120393 119869 gene locus_tag LOCUS_14530 120393 119869 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881633.1 protein_id gnl|my_center|LOCUS_14530 120493 122850 gene locus_tag LOCUS_14540 120493 122850 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_14540 122933 123583 gene locus_tag LOCUS_14550 122933 123583 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_14550 123564 123995 gene locus_tag LOCUS_14560 123564 123995 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459364.1 protein_id gnl|my_center|LOCUS_14560 124004 125764 gene locus_tag LOCUS_14570 gene msbA 124004 125764 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_14570 125757 126797 gene locus_tag LOCUS_14580 gene lpxK 125757 126797 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706582.1 protein_id gnl|my_center|LOCUS_14580 126781 127548 gene locus_tag LOCUS_14590 gene kdsB 126781 127548 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317470.1 protein_id gnl|my_center|LOCUS_14590 127570 128046 gene locus_tag LOCUS_14600 127570 128046 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_14600 128576 128088 gene locus_tag LOCUS_14610 128576 128088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 128484 128696 gene locus_tag LOCUS_14620 128484 128696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 128729 128914 gene locus_tag LOCUS_14630 128729 128914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 129277 131754 gene locus_tag LOCUS_14640 129277 131754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence10 53 125 gene locus_tag LOCUS_t00200 53 125 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 164 70 gene locus_tag LOCUS_t00210 164 70 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 463 765 gene locus_tag LOCUS_14650 463 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 762 1259 gene locus_tag LOCUS_14660 762 1259 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_14660 1256 2884 gene locus_tag LOCUS_14670 1256 2884 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082541.1 protein_id gnl|my_center|LOCUS_14670 2881 3282 gene locus_tag LOCUS_14680 2881 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 3406 5043 gene locus_tag LOCUS_14690 3406 5043 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403855.1 protein_id gnl|my_center|LOCUS_14690 5033 6142 gene locus_tag LOCUS_14700 gene rhuM 5033 6142 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280585.1 protein_id gnl|my_center|LOCUS_14700 6165 7481 gene locus_tag LOCUS_14710 6165 7481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 7495 7854 gene locus_tag LOCUS_14720 7495 7854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 7851 9581 gene locus_tag LOCUS_14730 7851 9581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 9581 12628 gene locus_tag LOCUS_14740 9581 12628 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403859.1 protein_id gnl|my_center|LOCUS_14740 12709 13071 gene locus_tag LOCUS_14750 12709 13071 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123225.1 protein_id gnl|my_center|LOCUS_14750 13071 13787 gene locus_tag LOCUS_14760 13071 13787 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_14760 14214 15140 gene locus_tag LOCUS_14770 14214 15140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 15413 15787 gene locus_tag LOCUS_14780 15413 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 15982 16566 gene locus_tag LOCUS_14790 15982 16566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 17085 17468 gene locus_tag LOCUS_14800 17085 17468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 17650 18315 gene locus_tag LOCUS_14810 17650 18315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 18312 18614 gene locus_tag LOCUS_14820 18312 18614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 18611 19438 gene locus_tag LOCUS_14830 18611 19438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 19545 20327 gene locus_tag LOCUS_14840 19545 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 20331 20789 gene locus_tag LOCUS_14850 20331 20789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 20777 21136 gene locus_tag LOCUS_14860 20777 21136 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140020.1 protein_id gnl|my_center|LOCUS_14860 21137 22810 gene locus_tag LOCUS_14870 21137 22810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 23261 25459 gene locus_tag LOCUS_14880 23261 25459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 25961 27301 gene locus_tag LOCUS_14890 25961 27301 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_14890 28185 27313 gene locus_tag LOCUS_14900 28185 27313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 28473 28246 gene locus_tag LOCUS_14910 28473 28246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 28755 28489 gene locus_tag LOCUS_14920 28755 28489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 29121 28771 gene locus_tag LOCUS_14930 29121 28771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 29321 29133 gene locus_tag LOCUS_14940 29321 29133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 29589 29338 gene locus_tag LOCUS_14950 29589 29338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 29784 30011 gene locus_tag LOCUS_14960 29784 30011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 30001 32277 gene locus_tag LOCUS_14970 30001 32277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 32805 32533 gene locus_tag LOCUS_14980 32805 32533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 33061 33285 gene locus_tag LOCUS_14990 33061 33285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 33299 33499 gene locus_tag LOCUS_15000 33299 33499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 33502 34962 gene locus_tag LOCUS_15010 33502 34962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 34949 36958 gene locus_tag LOCUS_15020 34949 36958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 36991 37335 gene locus_tag LOCUS_15030 36991 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 37371 37748 gene locus_tag LOCUS_15040 37371 37748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 37751 37918 gene locus_tag LOCUS_15050 37751 37918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 37922 38344 gene locus_tag LOCUS_15060 37922 38344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 38348 38689 gene locus_tag LOCUS_15070 38348 38689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 38699 38956 gene locus_tag LOCUS_15080 38699 38956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 38968 39390 gene locus_tag LOCUS_15090 38968 39390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 39439 39786 gene locus_tag LOCUS_15100 39439 39786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 39992 40150 gene locus_tag LOCUS_15110 39992 40150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 40169 40594 gene locus_tag LOCUS_15120 40169 40594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 40938 41378 gene locus_tag LOCUS_15130 40938 41378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 41382 43376 gene locus_tag LOCUS_15140 41382 43376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 43385 44209 gene locus_tag LOCUS_15150 43385 44209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 44225 45262 gene locus_tag LOCUS_15160 44225 45262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 45265 45807 gene locus_tag LOCUS_15170 45265 45807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 45804 46700 gene locus_tag LOCUS_15180 45804 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 47713 47225 gene locus_tag LOCUS_15190 47713 47225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 47913 47686 gene locus_tag LOCUS_15200 47913 47686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 47913 48461 gene locus_tag LOCUS_15210 47913 48461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 49103 50638 gene locus_tag LOCUS_15220 49103 50638 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087700.1 protein_id gnl|my_center|LOCUS_15220 50625 50819 gene locus_tag LOCUS_15230 50625 50819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 51033 52076 gene locus_tag LOCUS_15240 51033 52076 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763543.1 protein_id gnl|my_center|LOCUS_15240 52187 52459 gene locus_tag LOCUS_15250 52187 52459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 52521 52940 gene locus_tag LOCUS_15260 52521 52940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 52937 53278 gene locus_tag LOCUS_15270 52937 53278 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942779.1 protein_id gnl|my_center|LOCUS_15270 53278 55455 gene locus_tag LOCUS_15280 53278 55455 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045029.1 protein_id gnl|my_center|LOCUS_15280 55448 58855 gene locus_tag LOCUS_15290 55448 58855 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007003880.1 protein_id gnl|my_center|LOCUS_15290 59883 59029 gene locus_tag LOCUS_15300 59883 59029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 60314 60994 gene locus_tag LOCUS_15310 60314 60994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 61162 61575 gene locus_tag LOCUS_15320 61162 61575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 61772 61551 gene locus_tag LOCUS_15330 61772 61551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 62753 63379 gene locus_tag LOCUS_15340 62753 63379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 64135 64629 gene locus_tag LOCUS_15350 64135 64629 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870236.1 protein_id gnl|my_center|LOCUS_15350 64626 66248 gene locus_tag LOCUS_15360 64626 66248 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001244955.1 protein_id gnl|my_center|LOCUS_15360 66245 66709 gene locus_tag LOCUS_15370 66245 66709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 66761 68542 gene locus_tag LOCUS_15380 66761 68542 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074344.1 protein_id gnl|my_center|LOCUS_15380 69498 68509 gene locus_tag LOCUS_15390 69498 68509 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074343.1 protein_id gnl|my_center|LOCUS_15390 70582 69686 gene locus_tag LOCUS_15400 70582 69686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 70925 70521 gene locus_tag LOCUS_15410 70925 70521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 71545 70928 gene locus_tag LOCUS_15420 71545 70928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 71807 73003 gene locus_tag LOCUS_15430 71807 73003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 72981 73967 gene locus_tag LOCUS_15440 72981 73967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 74187 74768 gene locus_tag LOCUS_15450 74187 74768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 74888 74694 gene locus_tag LOCUS_15460 74888 74694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 74900 75712 gene locus_tag LOCUS_15470 74900 75712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 75832 76614 gene locus_tag LOCUS_15480 75832 76614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 76617 77075 gene locus_tag LOCUS_15490 76617 77075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 77151 77552 gene locus_tag LOCUS_15500 gene rusA 77151 77552 CDS product crossover junction endodeoxyribonuclease RusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099695.1 protein_id gnl|my_center|LOCUS_15500 77557 78207 gene locus_tag LOCUS_15510 77557 78207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 78207 78977 gene locus_tag LOCUS_15520 78207 78977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 79234 80910 gene locus_tag LOCUS_15530 79234 80910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 81361 83784 gene locus_tag LOCUS_15540 81361 83784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 84263 85636 gene locus_tag LOCUS_15550 84263 85636 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_15550 85840 85643 gene locus_tag LOCUS_15560 85840 85643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 86106 85837 gene locus_tag LOCUS_15570 86106 85837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 87006 86110 gene locus_tag LOCUS_15580 87006 86110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 87288 87067 gene locus_tag LOCUS_15590 87288 87067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 87534 87313 gene locus_tag LOCUS_15600 87534 87313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 87807 87553 gene locus_tag LOCUS_15610 87807 87553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 87969 88196 gene locus_tag LOCUS_15620 87969 88196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 88186 90462 gene locus_tag LOCUS_15630 88186 90462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 90833 91201 gene locus_tag LOCUS_15640 90833 91201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 91330 91524 gene locus_tag LOCUS_15650 91330 91524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 91527 93020 gene locus_tag LOCUS_15660 91527 93020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 92983 95079 gene locus_tag LOCUS_15670 92983 95079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 95321 95656 gene locus_tag LOCUS_15680 95321 95656 CDS product DUF2190 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272390.1 protein_id gnl|my_center|LOCUS_15680 95669 96007 gene locus_tag LOCUS_15690 95669 96007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 96018 96359 gene locus_tag LOCUS_15700 96018 96359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 96374 96757 gene locus_tag LOCUS_15710 96374 96757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 96754 97011 gene locus_tag LOCUS_15720 96754 97011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 97008 97430 gene locus_tag LOCUS_15730 97008 97430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 97437 97766 gene locus_tag LOCUS_15740 97437 97766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 97780 98031 gene locus_tag LOCUS_15750 97780 98031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 98050 98472 gene locus_tag LOCUS_15760 98050 98472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 98516 99016 gene locus_tag LOCUS_15770 98516 99016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 99052 99243 gene locus_tag LOCUS_15780 99052 99243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 99262 99687 gene locus_tag LOCUS_15790 99262 99687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 99768 100049 gene locus_tag LOCUS_15800 99768 100049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 100046 100486 gene locus_tag LOCUS_15810 100046 100486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 100490 102487 gene locus_tag LOCUS_15820 100490 102487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 102518 103324 gene locus_tag LOCUS_15830 102518 103324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 103337 105091 gene locus_tag LOCUS_15840 103337 105091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 105103 105636 gene locus_tag LOCUS_15850 105103 105636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 105636 107366 gene locus_tag LOCUS_15860 105636 107366 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922438.1 protein_id gnl|my_center|LOCUS_15860 107810 107370 gene locus_tag LOCUS_15870 107810 107370 CDS product chromate resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201060.1 protein_id gnl|my_center|LOCUS_15870 108007 108690 gene locus_tag LOCUS_15880 108007 108690 CDS product heavy metal response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943577.1 protein_id gnl|my_center|LOCUS_15880 108687 110069 gene locus_tag LOCUS_15890 108687 110069 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_15890 110327 111214 gene locus_tag LOCUS_15900 110327 111214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 111311 112561 gene locus_tag LOCUS_15910 111311 112561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 112770 113747 gene locus_tag LOCUS_15920 112770 113747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 113740 114969 gene locus_tag LOCUS_15930 113740 114969 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205325.1 protein_id gnl|my_center|LOCUS_15930 114989 115930 gene locus_tag LOCUS_15940 114989 115930 CDS product DUF1259 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921577.1 protein_id gnl|my_center|LOCUS_15940 115949 116665 gene locus_tag LOCUS_15950 115949 116665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967367.1 protein_id gnl|my_center|LOCUS_15950 116747 117604 gene locus_tag LOCUS_15960 116747 117604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 117740 118540 gene locus_tag LOCUS_15970 117740 118540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 118561 119583 gene locus_tag LOCUS_15980 118561 119583 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_15980 119586 121154 gene locus_tag LOCUS_15990 119586 121154 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812769.1 protein_id gnl|my_center|LOCUS_15990 121151 121909 gene locus_tag LOCUS_16000 121151 121909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence11 257 1102 gene locus_tag LOCUS_16010 257 1102 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192006.1 protein_id gnl|my_center|LOCUS_16010 1782 1618 gene locus_tag LOCUS_16020 1782 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1739 3547 gene locus_tag LOCUS_16030 1739 3547 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470598.1 protein_id gnl|my_center|LOCUS_16030 3671 4228 gene locus_tag LOCUS_16040 3671 4228 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_16040 5083 4238 gene locus_tag LOCUS_16050 5083 4238 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526312.1 protein_id gnl|my_center|LOCUS_16050 6060 5176 gene locus_tag LOCUS_16060 6060 5176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6685 6107 gene locus_tag LOCUS_16070 gene ampD 6685 6107 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095590.1 protein_id gnl|my_center|LOCUS_16070 6803 7531 gene locus_tag LOCUS_16080 6803 7531 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_16080 8602 7598 gene locus_tag LOCUS_16090 8602 7598 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193771.1 protein_id gnl|my_center|LOCUS_16090 9246 8605 gene locus_tag LOCUS_16100 9246 8605 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_16100 9890 9393 gene locus_tag LOCUS_16110 9890 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 15591 9898 gene locus_tag LOCUS_16120 15591 9898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 17654 15624 gene locus_tag LOCUS_16130 gene pilJ 17654 15624 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_16130 18355 17783 gene locus_tag LOCUS_16140 18355 17783 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105281.1 protein_id gnl|my_center|LOCUS_16140 18731 18366 gene locus_tag LOCUS_16150 gene pilH 18731 18366 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_16150 19162 18755 gene locus_tag LOCUS_16160 gene pilG 19162 18755 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038048.1 protein_id gnl|my_center|LOCUS_16160 19394 20395 gene locus_tag LOCUS_16170 gene gshB 19394 20395 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000593266.1 protein_id gnl|my_center|LOCUS_16170 20433 21476 gene locus_tag LOCUS_16180 20433 21476 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_16180 22669 21455 gene locus_tag LOCUS_16190 22669 21455 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 protein_id gnl|my_center|LOCUS_16190 22926 23873 gene locus_tag LOCUS_16200 22926 23873 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004414710.1 protein_id gnl|my_center|LOCUS_16200 23870 24460 gene locus_tag LOCUS_16210 23870 24460 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_16210 24671 25105 gene locus_tag LOCUS_16220 gene ruvX 24671 25105 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958649.1 protein_id gnl|my_center|LOCUS_16220 25110 26006 gene locus_tag LOCUS_16230 25110 26006 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_16230 27102 26017 gene locus_tag LOCUS_16240 27102 26017 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_16240 28285 27122 gene locus_tag LOCUS_16250 28285 27122 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980842.1 protein_id gnl|my_center|LOCUS_16250 29367 28315 gene locus_tag LOCUS_16260 29367 28315 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005070853.1 protein_id gnl|my_center|LOCUS_16260 29427 30155 gene locus_tag LOCUS_16270 29427 30155 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527690.1 protein_id gnl|my_center|LOCUS_16270 30157 30987 gene locus_tag LOCUS_16280 gene proC 30157 30987 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275316.1 protein_id gnl|my_center|LOCUS_16280 31013 31582 gene locus_tag LOCUS_16290 31013 31582 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_16290 31583 31888 gene locus_tag LOCUS_16300 gene yggU 31583 31888 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369728.1 protein_id gnl|my_center|LOCUS_16300 31953 32468 gene locus_tag LOCUS_16310 31953 32468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 32948 32478 gene locus_tag LOCUS_16320 32948 32478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 33610 32945 gene locus_tag LOCUS_16330 gene coxH3 33610 32945 CDS product Dot/Icm type IV secretion system effector CoxH3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770384.1 protein_id gnl|my_center|LOCUS_16330 33787 34407 gene locus_tag LOCUS_16340 33787 34407 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820605.1 protein_id gnl|my_center|LOCUS_16340 34460 35065 gene locus_tag LOCUS_16350 34460 35065 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705021.1 protein_id gnl|my_center|LOCUS_16350 36112 35114 gene locus_tag LOCUS_16360 36112 35114 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005901873.1 protein_id gnl|my_center|LOCUS_16360 36537 36250 gene locus_tag LOCUS_16370 36537 36250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 36463 37281 gene locus_tag LOCUS_16380 36463 37281 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_16380 39199 37322 gene locus_tag LOCUS_16390 gene htpG 39199 37322 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769616.1 protein_id gnl|my_center|LOCUS_16390 39536 39814 gene locus_tag LOCUS_16400 39536 39814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 39862 40953 gene locus_tag LOCUS_16410 39862 40953 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530538.1 protein_id gnl|my_center|LOCUS_16410 41123 40962 gene locus_tag LOCUS_16420 41123 40962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 41434 41144 gene locus_tag LOCUS_16430 41434 41144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 41724 41434 gene locus_tag LOCUS_16440 41724 41434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 43238 41865 gene locus_tag LOCUS_16450 gene ppnN 43238 41865 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_16450 43836 43318 gene locus_tag LOCUS_16460 43836 43318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 46015 43859 gene locus_tag LOCUS_16470 46015 43859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 46383 47735 gene locus_tag LOCUS_16480 46383 47735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 48656 47769 gene locus_tag LOCUS_16490 gene htpX 48656 47769 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705391.1 protein_id gnl|my_center|LOCUS_16490 48833 49780 gene locus_tag LOCUS_16500 48833 49780 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245818.1 protein_id gnl|my_center|LOCUS_16500 50599 49808 gene locus_tag LOCUS_16510 50599 49808 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_16510 50502 51659 gene locus_tag LOCUS_16520 50502 51659 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055064632.1 protein_id gnl|my_center|LOCUS_16520 51744 52325 gene locus_tag LOCUS_16530 51744 52325 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088447.1 protein_id gnl|my_center|LOCUS_16530 52349 52669 gene locus_tag LOCUS_16540 52349 52669 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_16540 52669 53760 gene locus_tag LOCUS_16550 52669 53760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550161.1 protein_id gnl|my_center|LOCUS_16550 53809 54399 gene locus_tag LOCUS_16560 53809 54399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 54396 55349 gene locus_tag LOCUS_16570 54396 55349 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005061547.1 protein_id gnl|my_center|LOCUS_16570 55445 57082 gene locus_tag LOCUS_16580 55445 57082 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_16580 58141 57122 gene locus_tag LOCUS_16590 gene waaF 58141 57122 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105268.1 protein_id gnl|my_center|LOCUS_16590 59134 58181 gene locus_tag LOCUS_16600 gene rfaD 59134 58181 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530069.1 protein_id gnl|my_center|LOCUS_16600 60228 59131 gene locus_tag LOCUS_16610 60228 59131 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260993.1 protein_id gnl|my_center|LOCUS_16610 60496 60290 gene locus_tag LOCUS_16620 60496 60290 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_16620 63521 60555 gene locus_tag LOCUS_16630 gene glnE 63521 60555 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_16630 63940 63719 gene locus_tag LOCUS_16640 63940 63719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 64588 64061 gene locus_tag LOCUS_16650 64588 64061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 65913 64906 gene locus_tag LOCUS_16660 65913 64906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 67775 66573 gene locus_tag LOCUS_16670 67775 66573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 68599 67856 gene locus_tag LOCUS_16680 68599 67856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 68489 68836 gene locus_tag LOCUS_16690 68489 68836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 69714 68863 gene locus_tag LOCUS_16700 69714 68863 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142885.1 protein_id gnl|my_center|LOCUS_16700 69879 70544 gene locus_tag LOCUS_16710 69879 70544 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_16710 70642 71037 gene locus_tag LOCUS_16720 70642 71037 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403014.1 protein_id gnl|my_center|LOCUS_16720 71340 72422 gene locus_tag LOCUS_16730 71340 72422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 73299 72445 gene locus_tag LOCUS_16740 73299 72445 CDS product carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459311.1 protein_id gnl|my_center|LOCUS_16740 76259 73299 gene locus_tag LOCUS_16750 76259 73299 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809161.1 protein_id gnl|my_center|LOCUS_16750 76755 77027 gene locus_tag LOCUS_16760 76755 77027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 78842 77082 gene locus_tag LOCUS_16770 78842 77082 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090055.1 protein_id gnl|my_center|LOCUS_16770 79193 78849 gene locus_tag LOCUS_16780 79193 78849 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090054.1 protein_id gnl|my_center|LOCUS_16780 80125 79190 gene locus_tag LOCUS_16790 80125 79190 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090053.1 protein_id gnl|my_center|LOCUS_16790 80415 80122 gene locus_tag LOCUS_16800 80415 80122 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090052.1 protein_id gnl|my_center|LOCUS_16800 80672 80412 gene locus_tag LOCUS_16810 80672 80412 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090051.1 protein_id gnl|my_center|LOCUS_16810 81157 80669 gene locus_tag LOCUS_16820 81157 80669 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090050.1 protein_id gnl|my_center|LOCUS_16820 81708 81154 gene locus_tag LOCUS_16830 81708 81154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 84787 81722 gene locus_tag LOCUS_16840 84787 81722 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090047.1 protein_id gnl|my_center|LOCUS_16840 85899 84784 gene locus_tag LOCUS_16850 85899 84784 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965440.1 protein_id gnl|my_center|LOCUS_16850 87031 86036 gene locus_tag LOCUS_16860 87031 86036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 88132 87188 gene locus_tag LOCUS_16870 88132 87188 CDS product aldo/keto reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776829.1 protein_id gnl|my_center|LOCUS_16870 88834 88154 gene locus_tag LOCUS_16880 88834 88154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 89926 88883 gene locus_tag LOCUS_16890 89926 88883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 90208 90032 gene locus_tag LOCUS_16900 90208 90032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 90232 91635 gene locus_tag LOCUS_16910 90232 91635 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_16910 92803 91721 gene locus_tag LOCUS_16920 92803 91721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 93485 92814 gene locus_tag LOCUS_16930 93485 92814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 95063 93648 gene locus_tag LOCUS_16940 95063 93648 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_16940 95720 95166 gene locus_tag LOCUS_16950 95720 95166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 96079 96591 gene locus_tag LOCUS_16960 96079 96591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 96581 96793 gene locus_tag LOCUS_16970 96581 96793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 97882 96842 gene locus_tag LOCUS_16980 97882 96842 CDS product DUF2860 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461468.1 protein_id gnl|my_center|LOCUS_16980 98285 99478 gene locus_tag LOCUS_16990 98285 99478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 99556 101025 gene locus_tag LOCUS_17000 99556 101025 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096548.1 protein_id gnl|my_center|LOCUS_17000 101799 101032 gene locus_tag LOCUS_17010 101799 101032 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_17010 102459 101839 gene locus_tag LOCUS_17020 102459 101839 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810329.1 protein_id gnl|my_center|LOCUS_17020 102655 103662 gene locus_tag LOCUS_17030 102655 103662 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206954.1 protein_id gnl|my_center|LOCUS_17030 104320 105741 gene locus_tag LOCUS_17040 gene nhaC 104320 105741 CDS product Na+/H+ antiporter NhaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870142.1 protein_id gnl|my_center|LOCUS_17040 107050 105791 gene locus_tag LOCUS_17050 gene arcA 107050 105791 CDS product arginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090045.1 protein_id gnl|my_center|LOCUS_17050 107967 107296 gene locus_tag LOCUS_17060 107967 107296 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811810.1 protein_id gnl|my_center|LOCUS_17060 109692 108088 gene locus_tag LOCUS_17070 gene pgi 109692 108088 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141691.1 protein_id gnl|my_center|LOCUS_17070 110786 109689 gene locus_tag LOCUS_17080 gene tal 110786 109689 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence12 359 269 gene locus_tag LOCUS_t00220 359 269 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 912 604 gene locus_tag LOCUS_17090 912 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 1789 914 gene locus_tag LOCUS_17100 gene dapA 1789 914 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191516.1 protein_id gnl|my_center|LOCUS_17100 1925 2452 gene locus_tag LOCUS_17110 1925 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17110 2490 2957 gene locus_tag LOCUS_17120 2490 2957 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086262.1 protein_id gnl|my_center|LOCUS_17120 2979 4466 gene locus_tag LOCUS_17130 2979 4466 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_17130 4466 5209 gene locus_tag LOCUS_17140 4466 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 5604 5305 gene locus_tag LOCUS_17150 5604 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6257 5601 gene locus_tag LOCUS_17160 6257 5601 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039271.1 protein_id gnl|my_center|LOCUS_17160 6720 6235 gene locus_tag LOCUS_17170 gene mlaD 6720 6235 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_17170 7500 6733 gene locus_tag LOCUS_17180 gene mlaE 7500 6733 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815775.1 protein_id gnl|my_center|LOCUS_17180 8290 7493 gene locus_tag LOCUS_17190 8290 7493 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620333.1 protein_id gnl|my_center|LOCUS_17190 9374 8358 gene locus_tag LOCUS_17200 9374 8358 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084336.1 protein_id gnl|my_center|LOCUS_17200 9545 10015 gene locus_tag LOCUS_17210 9545 10015 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_17210 10031 11479 gene locus_tag LOCUS_17220 gene sufB 10031 11479 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_17220 11504 12271 gene locus_tag LOCUS_17230 gene sufC 11504 12271 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037895.1 protein_id gnl|my_center|LOCUS_17230 12276 13607 gene locus_tag LOCUS_17240 gene sufD 12276 13607 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037896.1 protein_id gnl|my_center|LOCUS_17240 13604 14869 gene locus_tag LOCUS_17250 13604 14869 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_17250 14866 15324 gene locus_tag LOCUS_17260 14866 15324 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_17260 15328 15879 gene locus_tag LOCUS_17270 gene sufT 15328 15879 CDS product putative Fe-S cluster assembly protein SufT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036085.1 protein_id gnl|my_center|LOCUS_17270 15883 16389 gene locus_tag LOCUS_17280 gene sixA 15883 16389 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_17280 19558 16424 gene locus_tag LOCUS_17290 gene putA 19558 16424 CDS product bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114187.1 protein_id gnl|my_center|LOCUS_17290 21479 19626 gene locus_tag LOCUS_17300 gene sppA 21479 19626 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707123.1 protein_id gnl|my_center|LOCUS_17300 22650 21538 gene locus_tag LOCUS_17310 22650 21538 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_17310 23942 22686 gene locus_tag LOCUS_17320 23942 22686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 24400 23939 gene locus_tag LOCUS_17330 24400 23939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 25479 24448 gene locus_tag LOCUS_17340 25479 24448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 26392 25511 gene locus_tag LOCUS_17350 26392 25511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 26776 26432 gene locus_tag LOCUS_17360 gene rplS 26776 26432 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771383.1 protein_id gnl|my_center|LOCUS_17360 27590 26832 gene locus_tag LOCUS_17370 gene trmD 27590 26832 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765874.1 protein_id gnl|my_center|LOCUS_17370 28133 27609 gene locus_tag LOCUS_17380 gene rimM 28133 27609 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000043335.1 protein_id gnl|my_center|LOCUS_17380 28432 28157 gene locus_tag LOCUS_17390 gene rpsP 28432 28157 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092643.1 protein_id gnl|my_center|LOCUS_17390 29967 28603 gene locus_tag LOCUS_17400 gene ffh 29967 28603 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946149.1 protein_id gnl|my_center|LOCUS_17400 30238 31446 gene locus_tag LOCUS_17410 30238 31446 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_17410 32662 31457 gene locus_tag LOCUS_17420 gene radA 32662 31457 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770187.1 protein_id gnl|my_center|LOCUS_17420 32899 35481 gene locus_tag LOCUS_17430 32899 35481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 35505 36329 gene locus_tag LOCUS_17440 35505 36329 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_17440 36342 37031 gene locus_tag LOCUS_17450 36342 37031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 38139 37048 gene locus_tag LOCUS_17460 gene alr 38139 37048 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209096.1 protein_id gnl|my_center|LOCUS_17460 39506 38136 gene locus_tag LOCUS_17470 gene dnaB 39506 38136 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112283.1 protein_id gnl|my_center|LOCUS_17470 40005 39544 gene locus_tag LOCUS_17480 gene rplI 40005 39544 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095627.1 protein_id gnl|my_center|LOCUS_17480 40946 40065 gene locus_tag LOCUS_17490 40946 40065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 41204 40980 gene locus_tag LOCUS_17500 gene rpsR 41204 40980 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_17500 41657 41235 gene locus_tag LOCUS_17510 gene rpsF 41657 41235 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036747.1 protein_id gnl|my_center|LOCUS_17510 42504 41749 gene locus_tag LOCUS_17520 gene rlmB 42504 41749 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073677.1 protein_id gnl|my_center|LOCUS_17520 44694 42520 gene locus_tag LOCUS_17530 gene rnr 44694 42520 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_17530 44851 44935 gene locus_tag LOCUS_t00230 44851 44935 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 45584 45009 gene locus_tag LOCUS_17540 45584 45009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 45680 46819 gene locus_tag LOCUS_17550 45680 46819 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_17550 47800 46904 gene locus_tag LOCUS_17560 47800 46904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 49108 47816 gene locus_tag LOCUS_17570 49108 47816 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422343.1 protein_id gnl|my_center|LOCUS_17570 49388 49161 gene locus_tag LOCUS_17580 49388 49161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 50274 49405 gene locus_tag LOCUS_17590 gene hflC 50274 49405 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_17590 51437 50274 gene locus_tag LOCUS_17600 gene hflK 51437 50274 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930788.1 protein_id gnl|my_center|LOCUS_17600 52781 51441 gene locus_tag LOCUS_17610 gene hflX 52781 51441 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000460362.1 protein_id gnl|my_center|LOCUS_17610 53095 52856 gene locus_tag LOCUS_17620 gene hfq 53095 52856 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_17620 54207 53203 gene locus_tag LOCUS_17630 gene miaA 54207 53203 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527674.1 protein_id gnl|my_center|LOCUS_17630 55945 54197 gene locus_tag LOCUS_17640 gene mutL 55945 54197 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_17640 57615 56038 gene locus_tag LOCUS_17650 gene amiB 57615 56038 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_17650 58245 57772 gene locus_tag LOCUS_17660 gene tsaE 58245 57772 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704166.1 protein_id gnl|my_center|LOCUS_17660 59717 58224 gene locus_tag LOCUS_17670 59717 58224 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_17670 59716 60828 gene locus_tag LOCUS_17680 gene queG 59716 60828 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_17680 61698 60847 gene locus_tag LOCUS_17690 gene panC 61698 60847 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246105.1 protein_id gnl|my_center|LOCUS_17690 62566 61733 gene locus_tag LOCUS_17700 gene panB 62566 61733 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_17700 63241 62594 gene locus_tag LOCUS_17710 63241 62594 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_17710 63839 63300 gene locus_tag LOCUS_17720 gene folK 63839 63300 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_17720 65167 63836 gene locus_tag LOCUS_17730 gene pcnB 65167 63836 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095630.1 protein_id gnl|my_center|LOCUS_17730 65270 65345 gene locus_tag LOCUS_t00240 65270 65345 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 66942 65875 gene locus_tag LOCUS_17740 66942 65875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 68063 66939 gene locus_tag LOCUS_17750 gene lptF 68063 66939 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316899.1 protein_id gnl|my_center|LOCUS_17750 68242 69726 gene locus_tag LOCUS_17760 68242 69726 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092867.1 protein_id gnl|my_center|LOCUS_17760 69735 70217 gene locus_tag LOCUS_17770 gene holC 69735 70217 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_17770 70214 70504 gene locus_tag LOCUS_17780 70214 70504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 70508 73300 gene locus_tag LOCUS_17790 70508 73300 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_17790 73433 78058 gene locus_tag LOCUS_17800 gene gltB 73433 78058 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926853.1 protein_id gnl|my_center|LOCUS_17800 78060 79544 gene locus_tag LOCUS_17810 78060 79544 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932093.1 protein_id gnl|my_center|LOCUS_17810 79734 80699 gene locus_tag LOCUS_17820 79734 80699 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814565.1 protein_id gnl|my_center|LOCUS_17820 80714 81103 gene locus_tag LOCUS_17830 80714 81103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 81109 81546 gene locus_tag LOCUS_17840 81109 81546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 81774 82736 gene locus_tag LOCUS_17850 81774 82736 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_17850 82776 83765 gene locus_tag LOCUS_17860 82776 83765 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_17860 83765 85753 gene locus_tag LOCUS_17870 gene tgpA 83765 85753 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_17870 86987 85713 gene locus_tag LOCUS_17880 86987 85713 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738818.1 protein_id gnl|my_center|LOCUS_17880 87469 86984 gene locus_tag LOCUS_17890 gene rimI 87469 86984 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_17890 88155 87466 gene locus_tag LOCUS_17900 88155 87466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 88952 88158 gene locus_tag LOCUS_17910 gene pssA 88952 88158 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957377.1 protein_id gnl|my_center|LOCUS_17910 89091 90809 gene locus_tag LOCUS_17920 89091 90809 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_17920 90760 91380 gene locus_tag LOCUS_17930 90760 91380 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_17930 91823 91536 gene locus_tag LOCUS_17940 91823 91536 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036098.1 protein_id gnl|my_center|LOCUS_17940 91930 92538 gene locus_tag LOCUS_17950 gene wrbA 91930 92538 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036095.1 protein_id gnl|my_center|LOCUS_17950 92535 92837 gene locus_tag LOCUS_17960 92535 92837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 93542 92847 gene locus_tag LOCUS_17970 gene hda 93542 92847 CDS product DnaA inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815818.1 protein_id gnl|my_center|LOCUS_17970 94114 93563 gene locus_tag LOCUS_17980 94114 93563 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086898.1 protein_id gnl|my_center|LOCUS_17980 95208 94135 gene locus_tag LOCUS_17990 95208 94135 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_17990 95302 96336 gene locus_tag LOCUS_18000 gene purM 95302 96336 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706623.1 protein_id gnl|my_center|LOCUS_18000 96333 97004 gene locus_tag LOCUS_18010 gene purN 96333 97004 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001028626.1 protein_id gnl|my_center|LOCUS_18010 97662 97096 gene locus_tag LOCUS_18020 gene dcd 97662 97096 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037700.1 protein_id gnl|my_center|LOCUS_18020 98756 97659 gene locus_tag LOCUS_18030 gene apbC 98756 97659 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448044.1 protein_id gnl|my_center|LOCUS_18030 98982 101363 gene locus_tag LOCUS_18040 98982 101363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 101380 102471 gene locus_tag LOCUS_18050 101380 102471 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_18050 102458 103558 gene locus_tag LOCUS_18060 102458 103558 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938558.1 protein_id gnl|my_center|LOCUS_18060 >Feature sequence13 142 345 gene locus_tag LOCUS_18070 142 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1105 317 gene locus_tag LOCUS_18080 1105 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1864 1112 gene locus_tag LOCUS_18090 1864 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 4317 1957 gene locus_tag LOCUS_18100 4317 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 4733 4314 gene locus_tag LOCUS_18110 4733 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 4931 5239 gene locus_tag LOCUS_18120 4931 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 5236 5661 gene locus_tag LOCUS_18130 5236 5661 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417916.1 protein_id gnl|my_center|LOCUS_18130 6431 6015 gene locus_tag LOCUS_18140 6431 6015 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391491.1 protein_id gnl|my_center|LOCUS_18140 7825 6869 gene locus_tag LOCUS_18150 7825 6869 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_18150 7944 8360 gene locus_tag LOCUS_18160 7944 8360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943077.1 protein_id gnl|my_center|LOCUS_18160 8399 9379 gene locus_tag LOCUS_18170 8399 9379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 10083 10319 gene locus_tag LOCUS_18180 10083 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 10368 11882 gene locus_tag LOCUS_18190 10368 11882 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_18190 11932 13443 gene locus_tag LOCUS_18200 11932 13443 CDS product DUF1254 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061798.1 protein_id gnl|my_center|LOCUS_18200 13771 14454 gene locus_tag LOCUS_18210 13771 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 14476 15264 gene locus_tag LOCUS_18220 14476 15264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15483 15671 gene locus_tag LOCUS_18230 15483 15671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 16337 15699 gene locus_tag LOCUS_18240 16337 15699 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115027.1 protein_id gnl|my_center|LOCUS_18240 17083 16391 gene locus_tag LOCUS_18250 gene kdpE 17083 16391 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 protein_id gnl|my_center|LOCUS_18250 19782 17080 gene locus_tag LOCUS_18260 19782 17080 CDS product DUF4118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526440.1 protein_id gnl|my_center|LOCUS_18260 22070 19965 gene locus_tag LOCUS_18270 gene kdpB 22070 19965 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_18270 22730 22092 gene locus_tag LOCUS_18280 22730 22092 CDS product K(+)-transporting ATPase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405322.1 protein_id gnl|my_center|LOCUS_18280 24455 22749 gene locus_tag LOCUS_18290 gene kdpA 24455 22749 CDS product potassium-transporting ATPase subunit KdpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883954.1 protein_id gnl|my_center|LOCUS_18290 24756 24559 gene locus_tag LOCUS_18300 24756 24559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 25107 24796 gene locus_tag LOCUS_18310 25107 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 26036 25425 gene locus_tag LOCUS_18320 26036 25425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 27406 26033 gene locus_tag LOCUS_18330 27406 26033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 27947 28630 gene locus_tag LOCUS_18340 27947 28630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 29149 30357 gene locus_tag LOCUS_18350 29149 30357 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_18350 30964 30533 gene locus_tag LOCUS_18360 30964 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 31003 31554 gene locus_tag LOCUS_18370 gene tadA 31003 31554 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_18370 33009 31573 gene locus_tag LOCUS_18380 gene mltF 33009 31573 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266923.1 protein_id gnl|my_center|LOCUS_18380 33244 33561 gene locus_tag LOCUS_18390 33244 33561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 33635 33722 gene locus_tag LOCUS_t00250 33635 33722 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 33964 34275 gene locus_tag LOCUS_18400 33964 34275 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737444.1 protein_id gnl|my_center|LOCUS_18400 34286 34591 gene locus_tag LOCUS_18410 34286 34591 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092409793.1 protein_id gnl|my_center|LOCUS_18410 34871 34698 gene locus_tag LOCUS_18420 34871 34698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 37110 34903 gene locus_tag LOCUS_18430 gene feoB 37110 34903 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_18430 37334 37107 gene locus_tag LOCUS_18440 37334 37107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 38660 37464 gene locus_tag LOCUS_18450 gene tagH 38660 37464 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114611.1 protein_id gnl|my_center|LOCUS_18450 38901 39242 gene locus_tag LOCUS_18460 38901 39242 CDS product DUF1820 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093157.1 protein_id gnl|my_center|LOCUS_18460 39273 43169 gene locus_tag LOCUS_18470 gene purL 39273 43169 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_18470 43909 43187 gene locus_tag LOCUS_18480 43909 43187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 45618 43945 gene locus_tag LOCUS_18490 gene ettA 45618 43945 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946440.1 protein_id gnl|my_center|LOCUS_18490 45842 47095 gene locus_tag LOCUS_18500 45842 47095 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946462.1 protein_id gnl|my_center|LOCUS_18500 47123 47626 gene locus_tag LOCUS_18510 gene nrdR 47123 47626 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_18510 47623 48726 gene locus_tag LOCUS_18520 gene ribD 47623 48726 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_18520 48726 49322 gene locus_tag LOCUS_18530 48726 49322 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035934.1 protein_id gnl|my_center|LOCUS_18530 49359 50498 gene locus_tag LOCUS_18540 gene ribBA 49359 50498 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_18540 50518 50985 gene locus_tag LOCUS_18550 gene ribE 50518 50985 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073313.1 protein_id gnl|my_center|LOCUS_18550 51001 51432 gene locus_tag LOCUS_18560 gene nusB 51001 51432 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119137.1 protein_id gnl|my_center|LOCUS_18560 51508 52446 gene locus_tag LOCUS_18570 gene thiL 51508 52446 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073311.1 protein_id gnl|my_center|LOCUS_18570 52459 52956 gene locus_tag LOCUS_18580 52459 52956 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_18580 53010 54281 gene locus_tag LOCUS_18590 53010 54281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 54559 54293 gene locus_tag LOCUS_18600 54559 54293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 54741 55160 gene locus_tag LOCUS_18610 54741 55160 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_18610 55258 56598 gene locus_tag LOCUS_18620 55258 56598 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_18620 56623 57207 gene locus_tag LOCUS_18630 56623 57207 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_18630 57421 59313 gene locus_tag LOCUS_18640 gene parE 57421 59313 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_18640 59338 61608 gene locus_tag LOCUS_18650 gene parC 59338 61608 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_18650 63511 61616 gene locus_tag LOCUS_18660 63511 61616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 65804 63690 gene locus_tag LOCUS_18670 gene fimX 65804 63690 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_18670 66921 65878 gene locus_tag LOCUS_18680 gene epmB 66921 65878 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_18680 67058 67624 gene locus_tag LOCUS_18690 gene efp 67058 67624 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_18690 68593 67634 gene locus_tag LOCUS_18700 gene epmA 68593 67634 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368646.1 protein_id gnl|my_center|LOCUS_18700 69594 68635 gene locus_tag LOCUS_18710 69594 68635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18710 69764 69546 gene locus_tag LOCUS_18720 69764 69546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 69825 70526 gene locus_tag LOCUS_18730 69825 70526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 70537 71643 gene locus_tag LOCUS_18740 gene aroC 70537 71643 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706197.1 protein_id gnl|my_center|LOCUS_18740 71769 72791 gene locus_tag LOCUS_18750 71769 72791 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948008.1 protein_id gnl|my_center|LOCUS_18750 72894 75683 gene locus_tag LOCUS_18760 gene fimV 72894 75683 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_18760 75760 76545 gene locus_tag LOCUS_18770 gene truA 75760 76545 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770596.1 protein_id gnl|my_center|LOCUS_18770 76573 77436 gene locus_tag LOCUS_18780 gene accD 76573 77436 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_18780 77444 78709 gene locus_tag LOCUS_18790 gene folC 77444 78709 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039854.1 protein_id gnl|my_center|LOCUS_18790 78737 79381 gene locus_tag LOCUS_18800 78737 79381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 79402 79950 gene locus_tag LOCUS_18810 79402 79950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 79958 81508 gene locus_tag LOCUS_18820 gene purF 79958 81508 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003347797.1 protein_id gnl|my_center|LOCUS_18820 81660 82808 gene locus_tag LOCUS_18830 81660 82808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 83538 82810 gene locus_tag LOCUS_18840 gene lpxH 83538 82810 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_18840 84107 83535 gene locus_tag LOCUS_18850 84107 83535 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222405.1 protein_id gnl|my_center|LOCUS_18850 85028 84144 gene locus_tag LOCUS_18860 gene folD 85028 84144 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 protein_id gnl|my_center|LOCUS_18860 85195 85271 gene locus_tag LOCUS_t00260 85195 85271 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 85324 85399 gene locus_tag LOCUS_t00270 85324 85399 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 85437 85512 gene locus_tag LOCUS_t00280 85437 85512 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 85635 85710 gene locus_tag LOCUS_t00290 85635 85710 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence14 436 1269 gene locus_tag LOCUS_18870 436 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1732 2511 gene locus_tag LOCUS_18880 1732 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 2827 3273 gene locus_tag LOCUS_18890 2827 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3306 4145 gene locus_tag LOCUS_18900 3306 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 4138 5577 gene locus_tag LOCUS_18910 4138 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 5908 5681 gene locus_tag LOCUS_18920 5908 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 6608 5874 gene locus_tag LOCUS_18930 6608 5874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 6690 7049 gene locus_tag LOCUS_18940 6690 7049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 7092 8744 gene locus_tag LOCUS_18950 7092 8744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 8747 8953 gene locus_tag LOCUS_18960 8747 8953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 10657 8897 gene locus_tag LOCUS_18970 10657 8897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 12843 11008 gene locus_tag LOCUS_18980 12843 11008 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_18980 13514 12840 gene locus_tag LOCUS_18990 13514 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 15164 13530 gene locus_tag LOCUS_19000 15164 13530 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_19000 16220 15309 gene locus_tag LOCUS_19010 16220 15309 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_19010 16309 17277 gene locus_tag LOCUS_19020 gene mvaD 16309 17277 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_19020 17270 18289 gene locus_tag LOCUS_19030 17270 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 18769 18410 gene locus_tag LOCUS_19040 18769 18410 CDS product DUF4399 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084345.1 protein_id gnl|my_center|LOCUS_19040 20990 19599 gene locus_tag LOCUS_19050 gene nhaA 20990 19599 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_19050 23568 21115 gene locus_tag LOCUS_19060 gene fadE 23568 21115 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_19060 24680 23697 gene locus_tag LOCUS_19070 24680 23697 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886970.1 protein_id gnl|my_center|LOCUS_19070 25183 24842 gene locus_tag LOCUS_19080 25183 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 27808 25337 gene locus_tag LOCUS_19090 27808 25337 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941614.1 protein_id gnl|my_center|LOCUS_19090 28168 27995 gene locus_tag LOCUS_19100 28168 27995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 28085 29380 gene locus_tag LOCUS_19110 28085 29380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 29391 30383 gene locus_tag LOCUS_19120 29391 30383 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035437.1 protein_id gnl|my_center|LOCUS_19120 30766 30371 gene locus_tag LOCUS_19130 30766 30371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 30904 32466 gene locus_tag LOCUS_19140 gene gshA 30904 32466 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073388.1 protein_id gnl|my_center|LOCUS_19140 32557 33231 gene locus_tag LOCUS_19150 32557 33231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 33231 33884 gene locus_tag LOCUS_19160 33231 33884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 35185 33908 gene locus_tag LOCUS_19170 35185 33908 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086617.1 protein_id gnl|my_center|LOCUS_19170 35251 36222 gene locus_tag LOCUS_19180 35251 36222 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088878.1 protein_id gnl|my_center|LOCUS_19180 38680 36263 gene locus_tag LOCUS_19190 38680 36263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 38766 39173 gene locus_tag LOCUS_19200 38766 39173 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037708.1 protein_id gnl|my_center|LOCUS_19200 39170 39679 gene locus_tag LOCUS_19210 39170 39679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 40612 39674 gene locus_tag LOCUS_19220 40612 39674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 41717 41499 gene locus_tag LOCUS_19230 41717 41499 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388803.1 protein_id gnl|my_center|LOCUS_19230 42709 41882 gene locus_tag LOCUS_19240 gene cysQ 42709 41882 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_19240 42782 43459 gene locus_tag LOCUS_19250 gene yrfG 42782 43459 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704552.1 protein_id gnl|my_center|LOCUS_19250 44750 43467 gene locus_tag LOCUS_19260 44750 43467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19260 45039 45359 gene locus_tag LOCUS_19270 gene trxA 45039 45359 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_19270 45356 46819 gene locus_tag LOCUS_19280 gene rho 45356 46819 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_19280 46842 47267 gene locus_tag LOCUS_19290 46842 47267 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328825.1 protein_id gnl|my_center|LOCUS_19290 48599 47289 gene locus_tag LOCUS_19300 gene purD 48599 47289 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035746.1 protein_id gnl|my_center|LOCUS_19300 50214 48658 gene locus_tag LOCUS_19310 gene purH 50214 48658 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175670.1 protein_id gnl|my_center|LOCUS_19310 50541 50299 gene locus_tag LOCUS_19320 gene fis 50541 50299 CDS product DNA-binding transcriptional regulator Fis inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000462905.1 protein_id gnl|my_center|LOCUS_19320 52259 50991 gene locus_tag LOCUS_19330 52259 50991 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105208.1 protein_id gnl|my_center|LOCUS_19330 53253 52336 gene locus_tag LOCUS_19340 gene prmA 53253 52336 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675412.1 protein_id gnl|my_center|LOCUS_19340 54595 53255 gene locus_tag LOCUS_19350 gene accC 54595 53255 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369455.1 protein_id gnl|my_center|LOCUS_19350 55106 54627 gene locus_tag LOCUS_19360 gene accB 55106 54627 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_19360 55579 55133 gene locus_tag LOCUS_19370 gene aroQ 55579 55133 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_19370 56301 55669 gene locus_tag LOCUS_19380 56301 55669 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040551.1 protein_id gnl|my_center|LOCUS_19380 58552 56306 gene locus_tag LOCUS_19390 gene dsbD 58552 56306 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926979.1 protein_id gnl|my_center|LOCUS_19390 58872 58549 gene locus_tag LOCUS_19400 58872 58549 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_19400 59130 59420 gene locus_tag LOCUS_19410 gene groES 59130 59420 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_19410 59484 61115 gene locus_tag LOCUS_19420 gene groL 59484 61115 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_19420 62018 61530 gene locus_tag LOCUS_19430 62018 61530 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943286.1 protein_id gnl|my_center|LOCUS_19430 62114 62362 gene locus_tag LOCUS_19440 62114 62362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 62818 62417 gene locus_tag LOCUS_19450 62818 62417 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681217.1 protein_id gnl|my_center|LOCUS_19450 63020 62802 gene locus_tag LOCUS_19460 63020 62802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 63201 63407 gene locus_tag LOCUS_19470 63201 63407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 63670 64014 gene locus_tag LOCUS_19480 63670 64014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 64296 65870 gene locus_tag LOCUS_19490 64296 65870 CDS product carboxylesterase/lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366380.1 protein_id gnl|my_center|LOCUS_19490 66086 68959 gene locus_tag LOCUS_19500 66086 68959 CDS product monovalent cation/H+ antiporter subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810967.1 protein_id gnl|my_center|LOCUS_19500 68962 69303 gene locus_tag LOCUS_19510 68962 69303 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810969.1 protein_id gnl|my_center|LOCUS_19510 69300 70973 gene locus_tag LOCUS_19520 69300 70973 CDS product monovalent cation/H+ antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810971.1 protein_id gnl|my_center|LOCUS_19520 70982 71458 gene locus_tag LOCUS_19530 70982 71458 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810973.1 protein_id gnl|my_center|LOCUS_19530 71455 71736 gene locus_tag LOCUS_19540 71455 71736 CDS product K+/H+ antiporter subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810975.1 protein_id gnl|my_center|LOCUS_19540 71733 72074 gene locus_tag LOCUS_19550 71733 72074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 72589 73662 gene locus_tag LOCUS_19560 72589 73662 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524995.1 protein_id gnl|my_center|LOCUS_19560 73667 76426 gene locus_tag LOCUS_19570 gene rbbA 73667 76426 CDS product ribosome-associated ATPase/putative transporter RbbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114043.1 protein_id gnl|my_center|LOCUS_19570 76426 77553 gene locus_tag LOCUS_19580 76426 77553 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943323.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence15 921 244 gene locus_tag LOCUS_19590 921 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 1063 1473 gene locus_tag LOCUS_19600 1063 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 1588 3273 gene locus_tag LOCUS_19610 1588 3273 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267104.1 protein_id gnl|my_center|LOCUS_19610 3263 4045 gene locus_tag LOCUS_19620 3263 4045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 7189 4076 gene locus_tag LOCUS_19630 7189 4076 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920248.1 protein_id gnl|my_center|LOCUS_19630 8215 7253 gene locus_tag LOCUS_19640 8215 7253 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087701.1 protein_id gnl|my_center|LOCUS_19640 9527 8247 gene locus_tag LOCUS_19650 9527 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 9753 9529 gene locus_tag LOCUS_19660 9753 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 10176 9859 gene locus_tag LOCUS_19670 10176 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 10295 11332 gene locus_tag LOCUS_19680 10295 11332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 12033 11383 gene locus_tag LOCUS_19690 gene pdxH 12033 11383 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705310.1 protein_id gnl|my_center|LOCUS_19690 12843 12067 gene locus_tag LOCUS_19700 12843 12067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 13835 12921 gene locus_tag LOCUS_19710 13835 12921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 13970 15643 gene locus_tag LOCUS_19720 13970 15643 CDS product autotransporter assembly complex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004343881.1 protein_id gnl|my_center|LOCUS_19720 15643 19065 gene locus_tag LOCUS_19730 15643 19065 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267710.1 protein_id gnl|my_center|LOCUS_19730 19878 19216 gene locus_tag LOCUS_19740 19878 19216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706996.1 protein_id gnl|my_center|LOCUS_19740 20711 19875 gene locus_tag LOCUS_19750 20711 19875 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706995.1 protein_id gnl|my_center|LOCUS_19750 21397 20708 gene locus_tag LOCUS_19760 21397 20708 CDS product iron-containing redox enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706994.1 protein_id gnl|my_center|LOCUS_19760 22836 21376 gene locus_tag LOCUS_19770 22836 21376 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706993.1 protein_id gnl|my_center|LOCUS_19770 23492 22881 gene locus_tag LOCUS_19780 23492 22881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 23739 24380 gene locus_tag LOCUS_19790 23739 24380 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615565.1 protein_id gnl|my_center|LOCUS_19790 24377 25402 gene locus_tag LOCUS_19800 24377 25402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19800 27122 25440 gene locus_tag LOCUS_19810 27122 25440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 26809 26733 gene locus_tag LOCUS_t00300 26809 26733 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 28417 27119 gene locus_tag LOCUS_19820 28417 27119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 29177 28404 gene locus_tag LOCUS_19830 29177 28404 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269433.1 protein_id gnl|my_center|LOCUS_19830 29306 30382 gene locus_tag LOCUS_19840 29306 30382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 30500 32986 gene locus_tag LOCUS_19850 30500 32986 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403520.1 protein_id gnl|my_center|LOCUS_19850 34045 33026 gene locus_tag LOCUS_19860 34045 33026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 34602 34210 gene locus_tag LOCUS_19870 34602 34210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 34796 34620 gene locus_tag LOCUS_19880 34796 34620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 35191 35931 gene locus_tag LOCUS_19890 35191 35931 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339467.1 protein_id gnl|my_center|LOCUS_19890 37052 36117 gene locus_tag LOCUS_19900 37052 36117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 37158 37658 gene locus_tag LOCUS_19910 37158 37658 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087757.1 protein_id gnl|my_center|LOCUS_19910 39014 37779 gene locus_tag LOCUS_19920 39014 37779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_19920 39194 40048 gene locus_tag LOCUS_19930 39194 40048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 42083 40050 gene locus_tag LOCUS_19940 42083 40050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 42606 42352 gene locus_tag LOCUS_19950 42606 42352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 43527 42823 gene locus_tag LOCUS_19960 43527 42823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 43690 44571 gene locus_tag LOCUS_19970 43690 44571 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_19970 44651 44884 gene locus_tag LOCUS_19980 44651 44884 CDS product antitoxin VapB48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419787.1 protein_id gnl|my_center|LOCUS_19980 44881 45366 gene locus_tag LOCUS_19990 44881 45366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 46019 45579 gene locus_tag LOCUS_20000 46019 45579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 46143 47216 gene locus_tag LOCUS_20010 46143 47216 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810382.1 protein_id gnl|my_center|LOCUS_20010 47254 50037 gene locus_tag LOCUS_20020 47254 50037 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_20020 50096 51130 gene locus_tag LOCUS_20030 gene narH 50096 51130 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810456.1 protein_id gnl|my_center|LOCUS_20030 51677 51168 gene locus_tag LOCUS_20040 51677 51168 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024945508.1 protein_id gnl|my_center|LOCUS_20040 51841 52833 gene locus_tag LOCUS_20050 gene gnd 51841 52833 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974205.1 protein_id gnl|my_center|LOCUS_20050 52830 54230 gene locus_tag LOCUS_20060 gene zwf 52830 54230 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528919.1 protein_id gnl|my_center|LOCUS_20060 54239 54925 gene locus_tag LOCUS_20070 54239 54925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 56074 54968 gene locus_tag LOCUS_20080 56074 54968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 57478 56234 gene locus_tag LOCUS_20090 gene ubiM 57478 56234 CDS product 5-demethoxyubiquinol-8 5-hydroxylase UbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037777.1 protein_id gnl|my_center|LOCUS_20090 57547 58704 gene locus_tag LOCUS_20100 57547 58704 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_20100 58750 59568 gene locus_tag LOCUS_20110 58750 59568 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919885.1 protein_id gnl|my_center|LOCUS_20110 59713 60480 gene locus_tag LOCUS_20120 59713 60480 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 protein_id gnl|my_center|LOCUS_20120 60477 61391 gene locus_tag LOCUS_20130 60477 61391 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144321.1 protein_id gnl|my_center|LOCUS_20130 61599 61790 gene locus_tag LOCUS_20140 61599 61790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20140 61897 62211 gene locus_tag LOCUS_20150 61897 62211 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_20150 62574 62332 gene locus_tag LOCUS_20160 62574 62332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 62783 63154 gene locus_tag LOCUS_20170 62783 63154 CDS product translation initiation factor Sui1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941351.1 protein_id gnl|my_center|LOCUS_20170 63165 63545 gene locus_tag LOCUS_20180 63165 63545 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640659.1 protein_id gnl|my_center|LOCUS_20180 63686 63991 gene locus_tag LOCUS_20190 63686 63991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 64526 64050 gene locus_tag LOCUS_20200 64526 64050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 64724 65629 gene locus_tag LOCUS_20210 64724 65629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 65635 66075 gene locus_tag LOCUS_20220 65635 66075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 67325 66084 gene locus_tag LOCUS_20230 67325 66084 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_20230 68793 67336 gene locus_tag LOCUS_20240 68793 67336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 70436 68877 gene locus_tag LOCUS_20250 70436 68877 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966490.1 protein_id gnl|my_center|LOCUS_20250 70595 73084 gene locus_tag LOCUS_20260 70595 73084 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_20260 73231 74379 gene locus_tag LOCUS_20270 73231 74379 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_20270 >Feature sequence16 539 318 gene locus_tag LOCUS_20280 539 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3398 852 gene locus_tag LOCUS_20290 3398 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3783 4769 gene locus_tag LOCUS_20300 gene rluC 3783 4769 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000846342.1 protein_id gnl|my_center|LOCUS_20300 5368 4781 gene locus_tag LOCUS_20310 5368 4781 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817289.1 protein_id gnl|my_center|LOCUS_20310 5464 6015 gene locus_tag LOCUS_20320 5464 6015 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_20320 6040 6228 gene locus_tag LOCUS_20330 gene rpmF 6040 6228 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947121.1 protein_id gnl|my_center|LOCUS_20330 6295 7305 gene locus_tag LOCUS_20340 gene plsX 6295 7305 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_20340 7306 8271 gene locus_tag LOCUS_20350 7306 8271 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_20350 8370 9374 gene locus_tag LOCUS_20360 8370 9374 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090946.1 protein_id gnl|my_center|LOCUS_20360 9755 9444 gene locus_tag LOCUS_20370 9755 9444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 10200 10742 gene locus_tag LOCUS_20380 gene lexA 10200 10742 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004704739.1 protein_id gnl|my_center|LOCUS_20380 10897 11421 gene locus_tag LOCUS_20390 10897 11421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 11512 12993 gene locus_tag LOCUS_20400 11512 12993 CDS product DNA polymerase Y family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112733.1 protein_id gnl|my_center|LOCUS_20400 13163 16084 gene locus_tag LOCUS_20410 gene dnaE2 13163 16084 CDS product error-prone DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895514.1 protein_id gnl|my_center|LOCUS_20410 16544 16131 gene locus_tag LOCUS_20420 16544 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 17800 16586 gene locus_tag LOCUS_20430 gene xcpS 17800 16586 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_20430 19408 17837 gene locus_tag LOCUS_20440 gene xcpR 19408 17837 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_20440 21434 19377 gene locus_tag LOCUS_20450 gene xcpQ 21434 19377 CDS product GspD family T2SS secretin variant XcpQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113934.1 protein_id gnl|my_center|LOCUS_20450 22360 21431 gene locus_tag LOCUS_20460 gene gspC 22360 21431 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000394676.1 protein_id gnl|my_center|LOCUS_20460 22650 23027 gene locus_tag LOCUS_20470 gene clpS 22650 23027 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097649.1 protein_id gnl|my_center|LOCUS_20470 23035 25314 gene locus_tag LOCUS_20480 gene clpA 23035 25314 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_20480 25719 25369 gene locus_tag LOCUS_20490 25719 25369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 26858 25716 gene locus_tag LOCUS_20500 26858 25716 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813554.1 protein_id gnl|my_center|LOCUS_20500 27891 26929 gene locus_tag LOCUS_20510 gene trxB 27891 26929 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770716.1 protein_id gnl|my_center|LOCUS_20510 28144 30420 gene locus_tag LOCUS_20520 28144 30420 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037136.1 protein_id gnl|my_center|LOCUS_20520 30424 31065 gene locus_tag LOCUS_20530 gene lolA 30424 31065 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_20530 31079 31486 gene locus_tag LOCUS_20540 31079 31486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 31473 32798 gene locus_tag LOCUS_20550 31473 32798 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_20550 33005 34291 gene locus_tag LOCUS_20560 gene serS 33005 34291 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_20560 34288 36453 gene locus_tag LOCUS_20570 34288 36453 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140627.1 protein_id gnl|my_center|LOCUS_20570 36496 36407 gene locus_tag LOCUS_t00310 36496 36407 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 36670 37287 gene locus_tag LOCUS_20580 36670 37287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20580 37921 37214 gene locus_tag LOCUS_20590 gene trmH 37921 37214 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_20590 37981 38397 gene locus_tag LOCUS_20600 37981 38397 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_20600 39461 38418 gene locus_tag LOCUS_20610 39461 38418 CDS product isocitrate dehydrogenase (NAD(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964290.1 protein_id gnl|my_center|LOCUS_20610 39583 39658 gene locus_tag LOCUS_t00320 39583 39658 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 39802 40425 gene locus_tag LOCUS_20620 39802 40425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 42145 40682 gene locus_tag LOCUS_20630 42145 40682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070880.1 protein_id gnl|my_center|LOCUS_20630 42597 42142 gene locus_tag LOCUS_20640 42597 42142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 42621 43130 gene locus_tag LOCUS_20650 42621 43130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 43585 43022 gene locus_tag LOCUS_20660 43585 43022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 43475 43717 gene locus_tag LOCUS_20670 43475 43717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 44414 43728 gene locus_tag LOCUS_20680 gene narI 44414 43728 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096259.1 protein_id gnl|my_center|LOCUS_20680 45179 44421 gene locus_tag LOCUS_20690 gene narJ 45179 44421 CDS product nitrate reductase molybdenum cofactor assembly chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096258.1 protein_id gnl|my_center|LOCUS_20690 46762 45167 gene locus_tag LOCUS_20700 gene narH 46762 45167 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205549.1 protein_id gnl|my_center|LOCUS_20700 50514 46759 gene locus_tag LOCUS_20710 50514 46759 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205550.1 protein_id gnl|my_center|LOCUS_20710 51914 50511 gene locus_tag LOCUS_20720 51914 50511 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_20720 52045 52923 gene locus_tag LOCUS_20730 52045 52923 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045033.1 protein_id gnl|my_center|LOCUS_20730 53152 53904 gene locus_tag LOCUS_20740 53152 53904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 54385 55239 gene locus_tag LOCUS_20750 54385 55239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 55754 55302 gene locus_tag LOCUS_20760 55754 55302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 56171 56734 gene locus_tag LOCUS_20770 56171 56734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 56856 59672 gene locus_tag LOCUS_20780 56856 59672 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_20780 59709 60980 gene locus_tag LOCUS_20790 gene odhB 59709 60980 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_20790 61009 62436 gene locus_tag LOCUS_20800 gene lpdA 61009 62436 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_20800 62580 63323 gene locus_tag LOCUS_20810 62580 63323 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072407.1 protein_id gnl|my_center|LOCUS_20810 63355 63879 gene locus_tag LOCUS_20820 gene ruvC 63355 63879 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298649.1 protein_id gnl|my_center|LOCUS_20820 63876 64493 gene locus_tag LOCUS_20830 gene ruvA 63876 64493 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 protein_id gnl|my_center|LOCUS_20830 64497 65591 gene locus_tag LOCUS_20840 gene ruvB 64497 65591 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862355.1 protein_id gnl|my_center|LOCUS_20840 65598 66299 gene locus_tag LOCUS_20850 gene tolQ 65598 66299 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086125.1 protein_id gnl|my_center|LOCUS_20850 66300 66761 gene locus_tag LOCUS_20860 gene tolR 66300 66761 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072689.1 protein_id gnl|my_center|LOCUS_20860 66777 67703 gene locus_tag LOCUS_20870 66777 67703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 67795 69102 gene locus_tag LOCUS_20880 gene tolB 67795 69102 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_20880 69156 69701 gene locus_tag LOCUS_20890 gene pal 69156 69701 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038133.1 protein_id gnl|my_center|LOCUS_20890 69714 70502 gene locus_tag LOCUS_20900 gene ybgF 69714 70502 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_20900 70537 71211 gene locus_tag LOCUS_20910 gene queE 70537 71211 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947757.1 protein_id gnl|my_center|LOCUS_20910 71261 71956 gene locus_tag LOCUS_20920 gene queC 71261 71956 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_20920 72127 72202 gene locus_tag LOCUS_t00330 72127 72202 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 72445 73092 gene locus_tag LOCUS_20930 72445 73092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence17 377 162 gene locus_tag LOCUS_20940 377 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 1167 448 gene locus_tag LOCUS_20950 1167 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 1143 2018 gene locus_tag LOCUS_20960 1143 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 2021 2620 gene locus_tag LOCUS_20970 2021 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 3238 2789 gene locus_tag LOCUS_20980 3238 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 4654 3449 gene locus_tag LOCUS_20990 4654 3449 CDS product phage major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257523.1 protein_id gnl|my_center|LOCUS_20990 5108 4851 gene locus_tag LOCUS_21000 5108 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 6681 5188 gene locus_tag LOCUS_21010 6681 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 7151 6969 gene locus_tag LOCUS_21020 7151 6969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 7360 7148 gene locus_tag LOCUS_21030 7360 7148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 7451 8125 gene locus_tag LOCUS_21040 7451 8125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 8122 9771 gene locus_tag LOCUS_21050 8122 9771 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197647811.1 protein_id gnl|my_center|LOCUS_21050 9804 9728 gene locus_tag LOCUS_t00340 9804 9728 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 11324 9888 gene locus_tag LOCUS_21060 gene nuoN 11324 9888 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_21060 12838 11321 gene locus_tag LOCUS_21070 12838 11321 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_21070 14821 12866 gene locus_tag LOCUS_21080 gene nuoL 14821 12866 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_21080 15130 14825 gene locus_tag LOCUS_21090 gene nuoK 15130 14825 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005914274.1 protein_id gnl|my_center|LOCUS_21090 15726 15130 gene locus_tag LOCUS_21100 15726 15130 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_21100 16256 15753 gene locus_tag LOCUS_21110 gene nuoI 16256 15753 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017376.1 protein_id gnl|my_center|LOCUS_21110 17317 16238 gene locus_tag LOCUS_21120 gene nuoH 17317 16238 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_21120 19528 17327 gene locus_tag LOCUS_21130 gene nuoG 19528 17327 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813928.1 protein_id gnl|my_center|LOCUS_21130 20864 19551 gene locus_tag LOCUS_21140 gene nuoF 20864 19551 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037654.1 protein_id gnl|my_center|LOCUS_21140 21361 20861 gene locus_tag LOCUS_21150 gene nuoE 21361 20861 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_21150 22624 21371 gene locus_tag LOCUS_21160 22624 21371 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068422.1 protein_id gnl|my_center|LOCUS_21160 23321 22629 gene locus_tag LOCUS_21170 23321 22629 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_21170 23820 23329 gene locus_tag LOCUS_21180 23820 23329 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944318.1 protein_id gnl|my_center|LOCUS_21180 24167 23811 gene locus_tag LOCUS_21190 24167 23811 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813943.1 protein_id gnl|my_center|LOCUS_21190 24344 24260 gene locus_tag LOCUS_t00350 24344 24260 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 24777 24373 gene locus_tag LOCUS_21200 gene secG 24777 24373 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095194.1 protein_id gnl|my_center|LOCUS_21200 25538 24777 gene locus_tag LOCUS_21210 gene tpiA 25538 24777 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037661.1 protein_id gnl|my_center|LOCUS_21210 26981 25638 gene locus_tag LOCUS_21220 gene glmM 26981 25638 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_21220 27762 26974 gene locus_tag LOCUS_21230 gene folP 27762 26974 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_21230 29848 27932 gene locus_tag LOCUS_21240 gene ftsH 29848 27932 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443940.1 protein_id gnl|my_center|LOCUS_21240 30525 29905 gene locus_tag LOCUS_21250 gene rlmE 30525 29905 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443939.1 protein_id gnl|my_center|LOCUS_21250 30566 30880 gene locus_tag LOCUS_21260 gene yhbY 30566 30880 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480467.1 protein_id gnl|my_center|LOCUS_21260 31353 30877 gene locus_tag LOCUS_21270 gene greA 31353 30877 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707083.1 protein_id gnl|my_center|LOCUS_21270 34574 31350 gene locus_tag LOCUS_21280 gene carB 34574 31350 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037013.1 protein_id gnl|my_center|LOCUS_21280 35765 34587 gene locus_tag LOCUS_21290 gene carA 35765 34587 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045131.1 protein_id gnl|my_center|LOCUS_21290 36741 35914 gene locus_tag LOCUS_21300 gene dapB 36741 35914 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119175.1 protein_id gnl|my_center|LOCUS_21300 37904 36768 gene locus_tag LOCUS_21310 gene dnaJ 37904 36768 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095211.1 protein_id gnl|my_center|LOCUS_21310 39942 38008 gene locus_tag LOCUS_21320 gene dnaK 39942 38008 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_21320 40566 40012 gene locus_tag LOCUS_21330 gene grpE 40566 40012 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706782.1 protein_id gnl|my_center|LOCUS_21330 41709 40633 gene locus_tag LOCUS_21340 gene hrcA 41709 40633 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_21340 41899 42804 gene locus_tag LOCUS_21350 41899 42804 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_21350 42811 44499 gene locus_tag LOCUS_21360 gene recN 42811 44499 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105025.1 protein_id gnl|my_center|LOCUS_21360 44578 44919 gene locus_tag LOCUS_21370 44578 44919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21370 45372 44944 gene locus_tag LOCUS_21380 45372 44944 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811752.1 protein_id gnl|my_center|LOCUS_21380 45439 45954 gene locus_tag LOCUS_21390 gene smpB 45439 45954 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948526.1 protein_id gnl|my_center|LOCUS_21390 46108 46472 gene locus_tag LOCUS_tm00010 46108 46472 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 46900 46700 gene locus_tag LOCUS_21400 46900 46700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 47566 47060 gene locus_tag LOCUS_21410 47566 47060 CDS product type II toxin-antitoxin system YhaV family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084500.1 protein_id gnl|my_center|LOCUS_21410 47893 47570 gene locus_tag LOCUS_21420 47893 47570 CDS product type II toxin-antitoxin system PrlF family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087280.1 protein_id gnl|my_center|LOCUS_21420 48704 48084 gene locus_tag LOCUS_21430 48704 48084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 50065 48800 gene locus_tag LOCUS_21440 50065 48800 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194502.1 protein_id gnl|my_center|LOCUS_21440 50632 50204 gene locus_tag LOCUS_21450 50632 50204 CDS product host attachment family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529560.1 protein_id gnl|my_center|LOCUS_21450 50857 51819 gene locus_tag LOCUS_21460 50857 51819 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390378.1 protein_id gnl|my_center|LOCUS_21460 52433 51843 gene locus_tag LOCUS_21470 52433 51843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 52458 53093 gene locus_tag LOCUS_21480 52458 53093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 53083 53772 gene locus_tag LOCUS_21490 53083 53772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 53853 55067 gene locus_tag LOCUS_21500 53853 55067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 55142 55435 gene locus_tag LOCUS_21510 55142 55435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 55518 55784 gene locus_tag LOCUS_21520 55518 55784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 56199 55912 gene locus_tag LOCUS_21530 56199 55912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 56304 58442 gene locus_tag LOCUS_21540 56304 58442 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091593.1 protein_id gnl|my_center|LOCUS_21540 59507 58461 gene locus_tag LOCUS_21550 59507 58461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 60080 59619 gene locus_tag LOCUS_21560 60080 59619 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037310.1 protein_id gnl|my_center|LOCUS_21560 60165 61811 gene locus_tag LOCUS_21570 60165 61811 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337820.1 protein_id gnl|my_center|LOCUS_21570 62641 61817 gene locus_tag LOCUS_21580 62641 61817 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947257.1 protein_id gnl|my_center|LOCUS_21580 62727 65105 gene locus_tag LOCUS_21590 gene ppsA 62727 65105 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098065.1 protein_id gnl|my_center|LOCUS_21590 65818 65102 gene locus_tag LOCUS_21600 65818 65102 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125332.1 protein_id gnl|my_center|LOCUS_21600 66686 66108 gene locus_tag LOCUS_21610 gene orn 66686 66108 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_21610 66783 67664 gene locus_tag LOCUS_21620 gene rsgA 66783 67664 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 protein_id gnl|my_center|LOCUS_21620 68324 67710 gene locus_tag LOCUS_21630 gene recR 68324 67710 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036206.1 protein_id gnl|my_center|LOCUS_21630 68673 68347 gene locus_tag LOCUS_21640 68673 68347 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809572.1 protein_id gnl|my_center|LOCUS_21640 70304 68670 gene locus_tag LOCUS_21650 70304 68670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 70570 71244 gene locus_tag LOCUS_21660 70570 71244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21660 71755 71267 gene locus_tag LOCUS_21670 71755 71267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 >Feature sequence18 1534 551 gene locus_tag LOCUS_21680 1534 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2121 1780 gene locus_tag LOCUS_21690 2121 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3076 2198 gene locus_tag LOCUS_21700 3076 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 3554 3120 gene locus_tag LOCUS_21710 3554 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 6999 3679 gene locus_tag LOCUS_21720 6999 3679 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090811.1 protein_id gnl|my_center|LOCUS_21720 9659 6996 gene locus_tag LOCUS_21730 9659 6996 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162494176.1 protein_id gnl|my_center|LOCUS_21730 11145 9838 gene locus_tag LOCUS_21740 11145 9838 CDS product DUF2130 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211409870.1 protein_id gnl|my_center|LOCUS_21740 11527 12156 gene locus_tag LOCUS_21750 11527 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 12596 12859 gene locus_tag LOCUS_21760 12596 12859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 13632 12985 gene locus_tag LOCUS_21770 13632 12985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 14266 13655 gene locus_tag LOCUS_21780 14266 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 15673 14429 gene locus_tag LOCUS_21790 15673 14429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 16420 15842 gene locus_tag LOCUS_21800 16420 15842 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446889.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21800 16597 17790 gene locus_tag LOCUS_21810 16597 17790 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_21810 19369 18377 gene locus_tag LOCUS_21820 19369 18377 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011840243.1 protein_id gnl|my_center|LOCUS_21820 20876 19362 gene locus_tag LOCUS_21830 20876 19362 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528520.1 protein_id gnl|my_center|LOCUS_21830 21950 20916 gene locus_tag LOCUS_21840 21950 20916 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327978.1 protein_id gnl|my_center|LOCUS_21840 23002 21947 gene locus_tag LOCUS_21850 23002 21947 CDS product putative zinc-binding metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090184.1 protein_id gnl|my_center|LOCUS_21850 24050 23115 gene locus_tag LOCUS_21860 24050 23115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 24229 27612 gene locus_tag LOCUS_21870 24229 27612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 27612 29243 gene locus_tag LOCUS_21880 27612 29243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 29728 29327 gene locus_tag LOCUS_21890 29728 29327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 32485 29762 gene locus_tag LOCUS_21900 32485 29762 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038275.1 protein_id gnl|my_center|LOCUS_21900 32597 33958 gene locus_tag LOCUS_21910 32597 33958 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639931.1 protein_id gnl|my_center|LOCUS_21910 34044 35177 gene locus_tag LOCUS_21920 34044 35177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 35183 37153 gene locus_tag LOCUS_21930 35183 37153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 37150 39879 gene locus_tag LOCUS_21940 37150 39879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 41362 40586 gene locus_tag LOCUS_21950 gene hutG 41362 40586 CDS product N-formylglutamate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524693.1 protein_id gnl|my_center|LOCUS_21950 42898 41363 gene locus_tag LOCUS_21960 gene hutH 42898 41363 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704356.1 protein_id gnl|my_center|LOCUS_21960 44574 42895 gene locus_tag LOCUS_21970 gene hutU 44574 42895 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389059.1 protein_id gnl|my_center|LOCUS_21970 45341 44574 gene locus_tag LOCUS_21980 gene hutC 45341 44574 CDS product histidine utilization repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169053.1 protein_id gnl|my_center|LOCUS_21980 46760 45351 gene locus_tag LOCUS_21990 46760 45351 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114467.1 protein_id gnl|my_center|LOCUS_21990 46917 48152 gene locus_tag LOCUS_22000 gene hutI 46917 48152 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389058.1 protein_id gnl|my_center|LOCUS_22000 48180 49430 gene locus_tag LOCUS_22010 48180 49430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 50822 50043 gene locus_tag LOCUS_22020 50822 50043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 53037 51229 gene locus_tag LOCUS_22030 53037 51229 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_22030 53449 56703 gene locus_tag LOCUS_22040 53449 56703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 56717 56941 gene locus_tag LOCUS_22050 56717 56941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 59567 57150 gene locus_tag LOCUS_22060 59567 57150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 60441 59680 gene locus_tag LOCUS_22070 60441 59680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 64049 61266 gene locus_tag LOCUS_22080 64049 61266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 66375 64417 gene locus_tag LOCUS_22090 66375 64417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 66870 66652 gene locus_tag LOCUS_22100 66870 66652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 >Feature sequence19 887 222 gene locus_tag LOCUS_22110 887 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 1492 1205 gene locus_tag LOCUS_22120 1492 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 1464 2096 gene locus_tag LOCUS_22130 1464 2096 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550955.1 protein_id gnl|my_center|LOCUS_22130 2113 2985 gene locus_tag LOCUS_22140 2113 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 2989 3486 gene locus_tag LOCUS_22150 2989 3486 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090000.1 protein_id gnl|my_center|LOCUS_22150 5307 3874 gene locus_tag LOCUS_22160 gene iaaH 5307 3874 CDS product indoleacetamide hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921522.1 protein_id gnl|my_center|LOCUS_22160 6876 5452 gene locus_tag LOCUS_22170 6876 5452 CDS product basic amino acid/polyamine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090046.1 protein_id gnl|my_center|LOCUS_22170 8457 7003 gene locus_tag LOCUS_22180 8457 7003 CDS product GntP family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090686.1 protein_id gnl|my_center|LOCUS_22180 9518 8460 gene locus_tag LOCUS_22190 9518 8460 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966094.1 protein_id gnl|my_center|LOCUS_22190 9821 10963 gene locus_tag LOCUS_22200 9821 10963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 10960 11358 gene locus_tag LOCUS_22210 10960 11358 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023551.1 protein_id gnl|my_center|LOCUS_22210 11582 12031 gene locus_tag LOCUS_22220 11582 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 12028 12393 gene locus_tag LOCUS_22230 12028 12393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 12467 14068 gene locus_tag LOCUS_22240 12467 14068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 14885 14106 gene locus_tag LOCUS_22250 14885 14106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 16308 14887 gene locus_tag LOCUS_22260 16308 14887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 17288 16329 gene locus_tag LOCUS_22270 17288 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 17572 18882 gene locus_tag LOCUS_22280 17572 18882 CDS product ferredoxin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027856.1 protein_id gnl|my_center|LOCUS_22280 19077 20000 gene locus_tag LOCUS_22290 19077 20000 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387829.1 protein_id gnl|my_center|LOCUS_22290 20220 20438 gene locus_tag LOCUS_22300 20220 20438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 23472 20593 gene locus_tag LOCUS_22310 23472 20593 CDS product DUF748 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060708255.1 protein_id gnl|my_center|LOCUS_22310 24748 23774 gene locus_tag LOCUS_22320 24748 23774 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969428.1 protein_id gnl|my_center|LOCUS_22320 26413 24833 gene locus_tag LOCUS_22330 26413 24833 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037201681.1 protein_id gnl|my_center|LOCUS_22330 26589 27569 gene locus_tag LOCUS_22340 26589 27569 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114165.1 protein_id gnl|my_center|LOCUS_22340 29243 27630 gene locus_tag LOCUS_22350 29243 27630 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942368.1 protein_id gnl|my_center|LOCUS_22350 30003 29338 gene locus_tag LOCUS_22360 30003 29338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 30554 30114 gene locus_tag LOCUS_22370 30554 30114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 31477 30551 gene locus_tag LOCUS_22380 31477 30551 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029642.1 protein_id gnl|my_center|LOCUS_22380 32045 31479 gene locus_tag LOCUS_22390 32045 31479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 32468 32067 gene locus_tag LOCUS_22400 32468 32067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 32603 33271 gene locus_tag LOCUS_22410 32603 33271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 33385 33921 gene locus_tag LOCUS_22420 33385 33921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 35494 33968 gene locus_tag LOCUS_22430 35494 33968 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214443067.1 protein_id gnl|my_center|LOCUS_22430 36299 35541 gene locus_tag LOCUS_22440 36299 35541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 37707 36316 gene locus_tag LOCUS_22450 37707 36316 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_22450 40097 37731 gene locus_tag LOCUS_22460 40097 37731 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_22460 42652 40133 gene locus_tag LOCUS_22470 42652 40133 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141000.1 protein_id gnl|my_center|LOCUS_22470 42911 43699 gene locus_tag LOCUS_22480 gene ppk2 42911 43699 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705517.1 protein_id gnl|my_center|LOCUS_22480 43943 43770 gene locus_tag LOCUS_22490 43943 43770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 44644 43976 gene locus_tag LOCUS_22500 44644 43976 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919535.1 protein_id gnl|my_center|LOCUS_22500 44913 44692 gene locus_tag LOCUS_22510 44913 44692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 45929 45039 gene locus_tag LOCUS_22520 45929 45039 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338971.1 protein_id gnl|my_center|LOCUS_22520 46179 47873 gene locus_tag LOCUS_22530 46179 47873 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705399.1 protein_id gnl|my_center|LOCUS_22530 48057 50378 gene locus_tag LOCUS_22540 48057 50378 CDS product DUF3141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947872.1 protein_id gnl|my_center|LOCUS_22540 50400 51185 gene locus_tag LOCUS_22550 gene fabI 50400 51185 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391723.1 protein_id gnl|my_center|LOCUS_22550 52393 51266 gene locus_tag LOCUS_22560 52393 51266 CDS product heparan-alpha-glucosaminide N-acetyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112330.1 protein_id gnl|my_center|LOCUS_22560 53334 52489 gene locus_tag LOCUS_22570 gene pflA 53334 52489 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068217.1 protein_id gnl|my_center|LOCUS_22570 55606 53339 gene locus_tag LOCUS_22580 gene pflB 55606 53339 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056834.1 protein_id gnl|my_center|LOCUS_22580 56858 55674 gene locus_tag LOCUS_22590 56858 55674 CDS product acetate/propionate family kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389221.1 protein_id gnl|my_center|LOCUS_22590 57939 57004 gene locus_tag LOCUS_22600 57939 57004 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086241.1 protein_id gnl|my_center|LOCUS_22600 59213 57936 gene locus_tag LOCUS_22610 59213 57936 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958048.1 protein_id gnl|my_center|LOCUS_22610 60836 59232 gene locus_tag LOCUS_22620 60836 59232 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529993.1 protein_id gnl|my_center|LOCUS_22620 61984 60926 gene locus_tag LOCUS_22630 gene ansB 61984 60926 CDS product L-asparaginase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005652322.1 protein_id gnl|my_center|LOCUS_22630 63697 62036 gene locus_tag LOCUS_22640 gene aspD 63697 62036 CDS product aspartate 4-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086261.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence20 2130 1906 gene locus_tag LOCUS_22650 2130 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 2455 2183 gene locus_tag LOCUS_22660 2455 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 6055 2573 gene locus_tag LOCUS_22670 6055 2573 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920570.1 protein_id gnl|my_center|LOCUS_22670 6655 6113 gene locus_tag LOCUS_22680 6655 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 7907 6678 gene locus_tag LOCUS_22690 7907 6678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 9742 8216 gene locus_tag LOCUS_22700 9742 8216 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244563.1 protein_id gnl|my_center|LOCUS_22700 10189 9851 gene locus_tag LOCUS_22710 10189 9851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 10688 10206 gene locus_tag LOCUS_22720 10688 10206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 11073 10705 gene locus_tag LOCUS_22730 11073 10705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 14232 11083 gene locus_tag LOCUS_22740 14232 11083 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087702.1 protein_id gnl|my_center|LOCUS_22740 15945 14254 gene locus_tag LOCUS_22750 15945 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 16384 16046 gene locus_tag LOCUS_22760 16384 16046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 17962 16532 gene locus_tag LOCUS_22770 17962 16532 CDS product glycosyltransferase family 25 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922438.1 protein_id gnl|my_center|LOCUS_22770 18687 18151 gene locus_tag LOCUS_22780 18687 18151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 19253 18699 gene locus_tag LOCUS_22790 19253 18699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 19348 20016 gene locus_tag LOCUS_22800 19348 20016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 20013 20471 gene locus_tag LOCUS_22810 20013 20471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 21302 20493 gene locus_tag LOCUS_22820 21302 20493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 23309 21315 gene locus_tag LOCUS_22830 23309 21315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 23708 23313 gene locus_tag LOCUS_22840 23708 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 24034 23750 gene locus_tag LOCUS_22850 24034 23750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 24633 24181 gene locus_tag LOCUS_22860 24633 24181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 24858 24652 gene locus_tag LOCUS_22870 24858 24652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 25364 24879 gene locus_tag LOCUS_22880 25364 24879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 25819 25397 gene locus_tag LOCUS_22890 25819 25397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 26091 25810 gene locus_tag LOCUS_22900 26091 25810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 26526 26098 gene locus_tag LOCUS_22910 26526 26098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 26697 26530 gene locus_tag LOCUS_22920 26697 26530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 27080 26694 gene locus_tag LOCUS_22930 27080 26694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 27427 27089 gene locus_tag LOCUS_22940 27427 27089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 27807 27469 gene locus_tag LOCUS_22950 27807 27469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 29889 27859 gene locus_tag LOCUS_22960 29889 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 31336 29849 gene locus_tag LOCUS_22970 31336 29849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 31531 31337 gene locus_tag LOCUS_22980 31531 31337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 32028 31657 gene locus_tag LOCUS_22990 32028 31657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 32428 32255 gene locus_tag LOCUS_23000 32428 32255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23000 32768 32478 gene locus_tag LOCUS_23010 32768 32478 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043551648.1 protein_id gnl|my_center|LOCUS_23010 35309 33033 gene locus_tag LOCUS_23020 35309 33033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 35526 35299 gene locus_tag LOCUS_23030 35526 35299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 35788 36162 gene locus_tag LOCUS_23040 35788 36162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 36190 36474 gene locus_tag LOCUS_23050 36190 36474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 36550 36783 gene locus_tag LOCUS_23060 36550 36783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 36802 37335 gene locus_tag LOCUS_23070 36802 37335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 37345 37608 gene locus_tag LOCUS_23080 37345 37608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 37608 37901 gene locus_tag LOCUS_23090 37608 37901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 38032 38637 gene locus_tag LOCUS_23100 38032 38637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 40005 38539 gene locus_tag LOCUS_23110 40005 38539 CDS product DNA modification methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922072.1 protein_id gnl|my_center|LOCUS_23110 42710 40518 gene locus_tag LOCUS_23120 42710 40518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 44386 42710 gene locus_tag LOCUS_23130 44386 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 44733 44386 gene locus_tag LOCUS_23140 44733 44386 CDS product RusA family crossover junction endodeoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904141.1 protein_id gnl|my_center|LOCUS_23140 45248 44793 gene locus_tag LOCUS_23150 45248 44793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 46063 45254 gene locus_tag LOCUS_23160 46063 45254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 46972 46145 gene locus_tag LOCUS_23170 46972 46145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 47271 46969 gene locus_tag LOCUS_23180 47271 46969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 47932 47348 gene locus_tag LOCUS_23190 47932 47348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 49125 48142 gene locus_tag LOCUS_23200 49125 48142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 50300 49122 gene locus_tag LOCUS_23210 50300 49122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 51110 50394 gene locus_tag LOCUS_23220 51110 50394 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922416.1 protein_id gnl|my_center|LOCUS_23220 51472 51110 gene locus_tag LOCUS_23230 51472 51110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 54302 51492 gene locus_tag LOCUS_23240 54302 51492 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148590534.1 protein_id gnl|my_center|LOCUS_23240 54660 54295 gene locus_tag LOCUS_23250 54660 54295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 57694 54686 gene locus_tag LOCUS_23260 57694 54686 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020506622.1 protein_id gnl|my_center|LOCUS_23260 57982 58179 gene locus_tag LOCUS_23270 57982 58179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 59188 58166 gene locus_tag LOCUS_23280 59188 58166 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014665.1 protein_id gnl|my_center|LOCUS_23280 62622 59188 gene locus_tag LOCUS_23290 62622 59188 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_23290 >Feature sequence21 304 231 gene locus_tag LOCUS_t00360 304 231 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 739 347 gene locus_tag LOCUS_23300 gene rpsI 739 347 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555064.1 protein_id gnl|my_center|LOCUS_23300 1188 760 gene locus_tag LOCUS_23310 gene rplM 1188 760 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003483082.1 protein_id gnl|my_center|LOCUS_23310 1734 2426 gene locus_tag LOCUS_23320 gene crp 1734 2426 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000242746.1 protein_id gnl|my_center|LOCUS_23320 3142 2459 gene locus_tag LOCUS_23330 gene rpe 3142 2459 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_23330 3991 3185 gene locus_tag LOCUS_23340 gene djlA 3991 3185 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220839.1 protein_id gnl|my_center|LOCUS_23340 4106 5011 gene locus_tag LOCUS_23350 4106 5011 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_23350 5023 6354 gene locus_tag LOCUS_23360 5023 6354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 7711 6371 gene locus_tag LOCUS_23370 gene pmbA 7711 6371 CDS product metalloprotease PmbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037734.1 protein_id gnl|my_center|LOCUS_23370 7829 8323 gene locus_tag LOCUS_23380 gene purE 7829 8323 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_23380 8547 8350 gene locus_tag LOCUS_23390 8547 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 10024 8570 gene locus_tag LOCUS_23400 gene tldD 10024 8570 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098866.1 protein_id gnl|my_center|LOCUS_23400 10890 10021 gene locus_tag LOCUS_23410 10890 10021 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_23410 14805 10891 gene locus_tag LOCUS_23420 14805 10891 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105014.1 protein_id gnl|my_center|LOCUS_23420 16302 14812 gene locus_tag LOCUS_23430 gene rng 16302 14812 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_23430 16865 16275 gene locus_tag LOCUS_23440 16865 16275 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_23440 17365 16895 gene locus_tag LOCUS_23450 gene rlmH 17365 16895 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093193.1 protein_id gnl|my_center|LOCUS_23450 17818 17468 gene locus_tag LOCUS_23460 gene rsfS 17818 17468 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_23460 18509 17811 gene locus_tag LOCUS_23470 gene nadD 18509 17811 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_23470 19534 18506 gene locus_tag LOCUS_23480 gene holA 19534 18506 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_23480 19847 19590 gene locus_tag LOCUS_23490 19847 19590 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037637.1 protein_id gnl|my_center|LOCUS_23490 20637 20215 gene locus_tag LOCUS_23500 20637 20215 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055037.1 protein_id gnl|my_center|LOCUS_23500 22030 20651 gene locus_tag LOCUS_23510 gene cysS 22030 20651 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275351.1 protein_id gnl|my_center|LOCUS_23510 22152 22646 gene locus_tag LOCUS_23520 gene hisI 22152 22646 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037400419.1 protein_id gnl|my_center|LOCUS_23520 23183 22674 gene locus_tag LOCUS_23530 23183 22674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 23364 23756 gene locus_tag LOCUS_23540 23364 23756 CDS product HsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986720.1 protein_id gnl|my_center|LOCUS_23540 26375 23787 gene locus_tag LOCUS_23550 gene leuS 26375 23787 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_23550 27058 26606 gene locus_tag LOCUS_23560 27058 26606 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730468.1 protein_id gnl|my_center|LOCUS_23560 27890 27156 gene locus_tag LOCUS_23570 27890 27156 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269436.1 protein_id gnl|my_center|LOCUS_23570 28385 27966 gene locus_tag LOCUS_23580 28385 27966 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064372.1 protein_id gnl|my_center|LOCUS_23580 30078 28582 gene locus_tag LOCUS_23590 gene lnt 30078 28582 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118259.1 protein_id gnl|my_center|LOCUS_23590 30958 30095 gene locus_tag LOCUS_23600 30958 30095 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368790.1 protein_id gnl|my_center|LOCUS_23600 31437 30955 gene locus_tag LOCUS_23610 gene ybeY 31437 30955 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093160.1 protein_id gnl|my_center|LOCUS_23610 32491 31448 gene locus_tag LOCUS_23620 32491 31448 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_23620 33862 32507 gene locus_tag LOCUS_23630 gene miaB 33862 32507 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771098.1 protein_id gnl|my_center|LOCUS_23630 35606 33894 gene locus_tag LOCUS_23640 35606 33894 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_23640 36335 35889 gene locus_tag LOCUS_23650 gene ssb 36335 35889 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114685.1 protein_id gnl|my_center|LOCUS_23650 36544 39393 gene locus_tag LOCUS_23660 gene uvrA 36544 39393 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707637.1 protein_id gnl|my_center|LOCUS_23660 40351 39965 gene locus_tag LOCUS_23670 40351 39965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 41438 40422 gene locus_tag LOCUS_23680 41438 40422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 41590 42918 gene locus_tag LOCUS_23690 gene pepQ 41590 42918 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038359.1 protein_id gnl|my_center|LOCUS_23690 43175 44197 gene locus_tag LOCUS_23700 43175 44197 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389848.1 protein_id gnl|my_center|LOCUS_23700 44209 47349 gene locus_tag LOCUS_23710 44209 47349 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071991.1 protein_id gnl|my_center|LOCUS_23710 47543 47890 gene locus_tag LOCUS_23720 gene crcB 47543 47890 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764721.1 protein_id gnl|my_center|LOCUS_23720 48447 48064 gene locus_tag LOCUS_23730 gene rplQ 48447 48064 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 protein_id gnl|my_center|LOCUS_23730 49488 48487 gene locus_tag LOCUS_23740 gene rpoA 49488 48487 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_23740 50128 49505 gene locus_tag LOCUS_23750 gene rpsD 50128 49505 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383146.1 protein_id gnl|my_center|LOCUS_23750 50543 50142 gene locus_tag LOCUS_23760 gene rpsK 50543 50142 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486671.1 protein_id gnl|my_center|LOCUS_23760 50929 50573 gene locus_tag LOCUS_23770 gene rpsM 50929 50573 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307991.1 protein_id gnl|my_center|LOCUS_23770 52458 51115 gene locus_tag LOCUS_23780 gene secY 52458 51115 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863305.1 protein_id gnl|my_center|LOCUS_23780 52942 52514 gene locus_tag LOCUS_23790 gene rplO 52942 52514 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957463.1 protein_id gnl|my_center|LOCUS_23790 53130 52942 gene locus_tag LOCUS_23800 gene rpmD 53130 52942 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_23800 53647 53135 gene locus_tag LOCUS_23810 gene rpsE 53647 53135 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317099.1 protein_id gnl|my_center|LOCUS_23810 53949 53662 gene locus_tag LOCUS_23820 gene rplR 53949 53662 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_23820 54518 54054 gene locus_tag LOCUS_23830 gene rplF 54518 54054 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197947.1 protein_id gnl|my_center|LOCUS_23830 55030 54632 gene locus_tag LOCUS_23840 gene rpsH 55030 54632 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625877.1 protein_id gnl|my_center|LOCUS_23840 55343 55053 gene locus_tag LOCUS_23850 gene rpsN 55343 55053 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197948.1 protein_id gnl|my_center|LOCUS_23850 55930 55391 gene locus_tag LOCUS_23860 gene rplE 55930 55391 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093703.1 protein_id gnl|my_center|LOCUS_23860 56276 55962 gene locus_tag LOCUS_23870 gene rplX 56276 55962 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_23870 56715 56299 gene locus_tag LOCUS_23880 gene rplN 56715 56299 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690075.1 protein_id gnl|my_center|LOCUS_23880 56999 56712 gene locus_tag LOCUS_23890 gene rpsQ 56999 56712 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070622.1 protein_id gnl|my_center|LOCUS_23890 57211 56996 gene locus_tag LOCUS_23900 gene rpmC 57211 56996 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215432.1 protein_id gnl|my_center|LOCUS_23900 57624 57211 gene locus_tag LOCUS_23910 gene rplP 57624 57211 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_23910 58323 57640 gene locus_tag LOCUS_23920 gene rpsC 58323 57640 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036126.1 protein_id gnl|my_center|LOCUS_23920 58680 58348 gene locus_tag LOCUS_23930 gene rplV 58680 58348 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_23930 58865 58686 gene locus_tag LOCUS_23940 58865 58686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 59841 59014 gene locus_tag LOCUS_23950 gene rplB 59841 59014 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070620.1 protein_id gnl|my_center|LOCUS_23950 60172 59864 gene locus_tag LOCUS_23960 gene rplW 60172 59864 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037421480.1 protein_id gnl|my_center|LOCUS_23960 60774 60169 gene locus_tag LOCUS_23970 gene rplD 60774 60169 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093737.1 protein_id gnl|my_center|LOCUS_23970 61445 60783 gene locus_tag LOCUS_23980 gene rplC 61445 60783 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103877.1 protein_id gnl|my_center|LOCUS_23980 62011 61697 gene locus_tag LOCUS_23990 gene rpsJ 62011 61697 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_23990 >Feature sequence22 <1 829 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgcggcatcgctgccgcggaaatc 1323 1030 gene locus_tag LOCUS_24000 gene cas2 1323 1030 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387937.1 protein_id gnl|my_center|LOCUS_24000 3059 1326 gene locus_tag LOCUS_24010 gene cas1 3059 1326 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940735.1 protein_id gnl|my_center|LOCUS_24010 3102 3401 gene locus_tag LOCUS_24020 3102 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 3401 3745 gene locus_tag LOCUS_24030 3401 3745 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_24030 3998 3795 gene locus_tag LOCUS_24040 3998 3795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 4209 4003 gene locus_tag LOCUS_24050 4209 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 5889 4360 gene locus_tag LOCUS_24060 gene csb2 5889 4360 CDS product type I-U CRISPR-associated protein Csb2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940732.1 protein_id gnl|my_center|LOCUS_24060 7382 5889 gene locus_tag LOCUS_24070 7382 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 8349 7375 gene locus_tag LOCUS_24080 8349 7375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 11123 8346 gene locus_tag LOCUS_24090 gene cas3u 11123 8346 CDS product type I-U CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930412.1 protein_id gnl|my_center|LOCUS_24090 12501 11488 gene locus_tag LOCUS_24100 12501 11488 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_24100 14093 12603 gene locus_tag LOCUS_24110 14093 12603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24110 15898 14093 gene locus_tag LOCUS_24120 15898 14093 CDS product DUF3413 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925712.1 protein_id gnl|my_center|LOCUS_24120 17088 15904 gene locus_tag LOCUS_24130 17088 15904 CDS product CDP-glycerol glycerophosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679056.1 protein_id gnl|my_center|LOCUS_24130 17400 17155 gene locus_tag LOCUS_24140 17400 17155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 18237 17470 gene locus_tag LOCUS_24150 18237 17470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 19358 18234 gene locus_tag LOCUS_24160 19358 18234 CDS product 2-aminoethylphosphonate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525538.1 protein_id gnl|my_center|LOCUS_24160 19991 19425 gene locus_tag LOCUS_24170 19991 19425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 21391 19988 gene locus_tag LOCUS_24180 21391 19988 CDS product MipA/OmpV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483426.1 protein_id gnl|my_center|LOCUS_24180 22716 21520 gene locus_tag LOCUS_24190 gene aepY 22716 21520 CDS product phosphonopyruvate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530031.1 protein_id gnl|my_center|LOCUS_24190 24452 22713 gene locus_tag LOCUS_24200 gene aepX 24452 22713 CDS product phosphoenolpyruvate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525540.1 protein_id gnl|my_center|LOCUS_24200 25234 24449 gene locus_tag LOCUS_24210 25234 24449 CDS product phytanoyl-CoA dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121414.1 protein_id gnl|my_center|LOCUS_24210 25487 25254 gene locus_tag LOCUS_24220 25487 25254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 26381 25518 gene locus_tag LOCUS_24230 26381 25518 CDS product isocitrate lyase/phosphoenolpyruvate mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064986.1 protein_id gnl|my_center|LOCUS_24230 26890 26381 gene locus_tag LOCUS_24240 gene leuD 26890 26381 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868466.1 protein_id gnl|my_center|LOCUS_24240 28152 26887 gene locus_tag LOCUS_24250 28152 26887 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064988.1 protein_id gnl|my_center|LOCUS_24250 29140 28160 gene locus_tag LOCUS_24260 29140 28160 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085931.1 protein_id gnl|my_center|LOCUS_24260 30670 29174 gene locus_tag LOCUS_24270 30670 29174 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_24270 30697 30876 gene locus_tag LOCUS_24280 30697 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 30926 31720 gene locus_tag LOCUS_24290 30926 31720 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640550.1 protein_id gnl|my_center|LOCUS_24290 32407 31751 gene locus_tag LOCUS_24300 32407 31751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 33003 32527 gene locus_tag LOCUS_24310 33003 32527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 33590 33000 gene locus_tag LOCUS_24320 33590 33000 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706171.1 protein_id gnl|my_center|LOCUS_24320 34278 33928 gene locus_tag LOCUS_24330 34278 33928 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210705.1 protein_id gnl|my_center|LOCUS_24330 34568 34248 gene locus_tag LOCUS_24340 34568 34248 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147119.1 protein_id gnl|my_center|LOCUS_24340 34968 37313 gene locus_tag LOCUS_24350 34968 37313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 37541 38005 gene locus_tag LOCUS_24360 37541 38005 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112629.1 protein_id gnl|my_center|LOCUS_24360 38285 38210 gene locus_tag LOCUS_t00370 38285 38210 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 38735 38322 gene locus_tag LOCUS_24370 38735 38322 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_24370 38904 39434 gene locus_tag LOCUS_24380 38904 39434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 39535 40161 gene locus_tag LOCUS_24390 39535 40161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 40161 40619 gene locus_tag LOCUS_24400 gene pilV 40161 40619 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_24400 40619 41605 gene locus_tag LOCUS_24410 40619 41605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 41602 42084 gene locus_tag LOCUS_24420 41602 42084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 42089 42445 gene locus_tag LOCUS_24430 42089 42445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 42462 45722 gene locus_tag LOCUS_24440 42462 45722 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_24440 45722 46183 gene locus_tag LOCUS_24450 45722 46183 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103296.1 protein_id gnl|my_center|LOCUS_24450 46731 46198 gene locus_tag LOCUS_24460 gene lspA 46731 46198 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_24460 49559 46731 gene locus_tag LOCUS_24470 gene ileS 49559 46731 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036353.1 protein_id gnl|my_center|LOCUS_24470 50457 49576 gene locus_tag LOCUS_24480 gene ribF 50457 49576 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_24480 52159 50537 gene locus_tag LOCUS_24490 gene murJ 52159 50537 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_24490 52267 52536 gene locus_tag LOCUS_24500 gene rpsT 52267 52536 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073368.1 protein_id gnl|my_center|LOCUS_24500 53575 52514 gene locus_tag LOCUS_24510 gene cgtA 53575 52514 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_24510 53905 53645 gene locus_tag LOCUS_24520 gene rpmA 53905 53645 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_24520 54243 53911 gene locus_tag LOCUS_24530 gene rplU 54243 53911 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_24530 54506 55504 gene locus_tag LOCUS_24540 gene ispB 54506 55504 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_24540 55627 55703 gene locus_tag LOCUS_t00380 55627 55703 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 56196 55831 gene locus_tag LOCUS_24550 56196 55831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 56791 56201 gene locus_tag LOCUS_24560 gene nthA 56791 56201 CDS product nitrile hydratase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174055.1 protein_id gnl|my_center|LOCUS_24560 57513 56788 gene locus_tag LOCUS_24570 gene nthB 57513 56788 CDS product nitrile hydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976132.1 protein_id gnl|my_center|LOCUS_24570 58335 57523 gene locus_tag LOCUS_24580 58335 57523 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_24580 59569 58457 gene locus_tag LOCUS_24590 59569 58457 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970396.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence23 1351 392 gene locus_tag LOCUS_24600 1351 392 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036068.1 protein_id gnl|my_center|LOCUS_24600 1448 2191 gene locus_tag LOCUS_24610 1448 2191 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_24610 2255 3229 gene locus_tag LOCUS_24620 gene fabD 2255 3229 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036219.1 protein_id gnl|my_center|LOCUS_24620 3337 3786 gene locus_tag LOCUS_24630 3337 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 3812 4942 gene locus_tag LOCUS_24640 3812 4942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 5165 6106 gene locus_tag LOCUS_24650 5165 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_24650 6183 6584 gene locus_tag LOCUS_24660 6183 6584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 7438 7034 gene locus_tag LOCUS_24670 gene mce 7438 7034 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389447.1 protein_id gnl|my_center|LOCUS_24670 8463 7453 gene locus_tag LOCUS_24680 gene meaB 8463 7453 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085832.1 protein_id gnl|my_center|LOCUS_24680 10525 8540 gene locus_tag LOCUS_24690 10525 8540 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387813.1 protein_id gnl|my_center|LOCUS_24690 12084 10552 gene locus_tag LOCUS_24700 12084 10552 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_24700 14263 12119 gene locus_tag LOCUS_24710 gene scpA 14263 12119 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337301.1 protein_id gnl|my_center|LOCUS_24710 15174 14260 gene locus_tag LOCUS_24720 15174 14260 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388955.1 protein_id gnl|my_center|LOCUS_24720 16765 15167 gene locus_tag LOCUS_24730 16765 15167 CDS product malonyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528581.1 protein_id gnl|my_center|LOCUS_24730 17079 17786 gene locus_tag LOCUS_24740 17079 17786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 17992 18762 gene locus_tag LOCUS_24750 17992 18762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 18933 19661 gene locus_tag LOCUS_24760 18933 19661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 22477 19766 gene locus_tag LOCUS_24770 gene aceE 22477 19766 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227763.1 protein_id gnl|my_center|LOCUS_24770 22827 23957 gene locus_tag LOCUS_24780 22827 23957 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222805.1 protein_id gnl|my_center|LOCUS_24780 25796 24192 gene locus_tag LOCUS_24790 gene nadB 25796 24192 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186553.1 protein_id gnl|my_center|LOCUS_24790 26906 25881 gene locus_tag LOCUS_24800 gene nadA 26906 25881 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085329.1 protein_id gnl|my_center|LOCUS_24800 27995 27015 gene locus_tag LOCUS_24810 27995 27015 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973562.1 protein_id gnl|my_center|LOCUS_24810 28164 30332 gene locus_tag LOCUS_24820 28164 30332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 30499 31317 gene locus_tag LOCUS_24830 30499 31317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 32014 31448 gene locus_tag LOCUS_24840 32014 31448 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533965.1 protein_id gnl|my_center|LOCUS_24840 33968 32100 gene locus_tag LOCUS_24850 33968 32100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 34879 34211 gene locus_tag LOCUS_24860 34879 34211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 37832 34857 gene locus_tag LOCUS_24870 37832 34857 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640599.1 protein_id gnl|my_center|LOCUS_24870 38491 38045 gene locus_tag LOCUS_24880 38491 38045 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186322.1 protein_id gnl|my_center|LOCUS_24880 41830 38510 gene locus_tag LOCUS_24890 41830 38510 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073358.1 protein_id gnl|my_center|LOCUS_24890 42212 41859 gene locus_tag LOCUS_24900 42212 41859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 42723 42241 gene locus_tag LOCUS_24910 42723 42241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 43708 42710 gene locus_tag LOCUS_24920 43708 42710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 44187 43705 gene locus_tag LOCUS_24930 gene pilV 44187 43705 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_24930 44817 44194 gene locus_tag LOCUS_24940 44817 44194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 45377 44814 gene locus_tag LOCUS_24950 45377 44814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 45863 46528 gene locus_tag LOCUS_24960 45863 46528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 46542 48524 gene locus_tag LOCUS_24970 46542 48524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 48815 48630 gene locus_tag LOCUS_24980 48815 48630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 49181 49002 gene locus_tag LOCUS_24990 49181 49002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 49340 49843 gene locus_tag LOCUS_25000 gene tamR 49340 49843 CDS product MarR family transcriptional regulator TamR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975680.1 protein_id gnl|my_center|LOCUS_25000 50289 49879 gene locus_tag LOCUS_25010 gene mscL 50289 49879 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_25010 50497 52068 gene locus_tag LOCUS_25020 50497 52068 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706470.1 protein_id gnl|my_center|LOCUS_25020 57675 52150 gene locus_tag LOCUS_25030 gene uvrA 57675 52150 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814283.1 protein_id gnl|my_center|LOCUS_25030 >Feature sequence24 2014 314 gene locus_tag LOCUS_25040 2014 314 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_25040 2881 2060 gene locus_tag LOCUS_25050 2881 2060 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259119.1 protein_id gnl|my_center|LOCUS_25050 2847 3059 gene locus_tag LOCUS_25060 2847 3059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3198 5705 gene locus_tag LOCUS_25070 3198 5705 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918875.1 protein_id gnl|my_center|LOCUS_25070 6219 6614 gene locus_tag LOCUS_25080 6219 6614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 8322 6850 gene locus_tag LOCUS_25090 gene allB 8322 6850 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006871.1 protein_id gnl|my_center|LOCUS_25090 9635 8874 gene locus_tag LOCUS_25100 9635 8874 CDS product serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041449629.1 protein_id gnl|my_center|LOCUS_25100 11485 9632 gene locus_tag LOCUS_25110 gene asnB 11485 9632 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533108.1 protein_id gnl|my_center|LOCUS_25110 11638 12750 gene locus_tag LOCUS_25120 11638 12750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 12853 14730 gene locus_tag LOCUS_25130 12853 14730 CDS product alginate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484340.1 protein_id gnl|my_center|LOCUS_25130 14828 16015 gene locus_tag LOCUS_25140 14828 16015 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484336.1 protein_id gnl|my_center|LOCUS_25140 16051 16590 gene locus_tag LOCUS_25150 16051 16590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 16880 17857 gene locus_tag LOCUS_25160 16880 17857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 19049 17913 gene locus_tag LOCUS_25170 19049 17913 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_25170 20812 19067 gene locus_tag LOCUS_25180 20812 19067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 21923 20817 gene locus_tag LOCUS_25190 21923 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 23373 21934 gene locus_tag LOCUS_25200 23373 21934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 24812 23370 gene locus_tag LOCUS_25210 24812 23370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 26347 24809 gene locus_tag LOCUS_25220 26347 24809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 26669 26517 gene locus_tag LOCUS_25230 26669 26517 CDS product DUF5989 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975331.1 protein_id gnl|my_center|LOCUS_25230 27073 26669 gene locus_tag LOCUS_25240 27073 26669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 29024 27183 gene locus_tag LOCUS_25250 29024 27183 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_25250 29287 30402 gene locus_tag LOCUS_25260 gene gmd 29287 30402 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_25260 30395 31390 gene locus_tag LOCUS_25270 30395 31390 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331384.1 protein_id gnl|my_center|LOCUS_25270 33191 31602 gene locus_tag LOCUS_25280 33191 31602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 34644 33241 gene locus_tag LOCUS_25290 34644 33241 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121014.1 protein_id gnl|my_center|LOCUS_25290 35648 34884 gene locus_tag LOCUS_25300 35648 34884 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_25300 36856 35657 gene locus_tag LOCUS_25310 36856 35657 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142192.1 protein_id gnl|my_center|LOCUS_25310 38347 36875 gene locus_tag LOCUS_25320 38347 36875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 38779 40203 gene locus_tag LOCUS_25330 38779 40203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 40200 41498 gene locus_tag LOCUS_25340 40200 41498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 41510 42166 gene locus_tag LOCUS_25350 41510 42166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 42201 43637 gene locus_tag LOCUS_25360 42201 43637 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_25360 43777 45105 gene locus_tag LOCUS_25370 43777 45105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 47753 45171 gene locus_tag LOCUS_25380 47753 45171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 49155 48301 gene locus_tag LOCUS_25390 49155 48301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 50930 49176 gene locus_tag LOCUS_25400 50930 49176 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_25400 51929 51048 gene locus_tag LOCUS_25410 51929 51048 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132696218.1 protein_id gnl|my_center|LOCUS_25410 53212 52385 gene locus_tag LOCUS_25420 53212 52385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 54993 53227 gene locus_tag LOCUS_25430 54993 53227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence25 210 695 gene locus_tag LOCUS_25440 gene moaC 210 695 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036201.1 protein_id gnl|my_center|LOCUS_25440 702 1289 gene locus_tag LOCUS_25450 702 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1402 1929 gene locus_tag LOCUS_25460 1402 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 1942 2406 gene locus_tag LOCUS_25470 1942 2406 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977127.1 protein_id gnl|my_center|LOCUS_25470 2470 3951 gene locus_tag LOCUS_25480 2470 3951 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284768.1 protein_id gnl|my_center|LOCUS_25480 4400 4005 gene locus_tag LOCUS_25490 4400 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 5598 4588 gene locus_tag LOCUS_25500 5598 4588 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_25500 9235 5603 gene locus_tag LOCUS_25510 gene nifJ 9235 5603 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933292.1 protein_id gnl|my_center|LOCUS_25510 9369 9692 gene locus_tag LOCUS_25520 9369 9692 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_25520 10172 9792 gene locus_tag LOCUS_25530 10172 9792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 10669 10244 gene locus_tag LOCUS_25540 10669 10244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 11340 10780 gene locus_tag LOCUS_25550 11340 10780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25550 12137 11358 gene locus_tag LOCUS_25560 12137 11358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_25560 12452 14857 gene locus_tag LOCUS_25570 12452 14857 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776827.1 protein_id gnl|my_center|LOCUS_25570 15953 15114 gene locus_tag LOCUS_25580 15953 15114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 16708 15965 gene locus_tag LOCUS_25590 16708 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 16814 17689 gene locus_tag LOCUS_25600 gene tesB 16814 17689 CDS product acyl-CoA thioesterase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036345.1 protein_id gnl|my_center|LOCUS_25600 18229 17708 gene locus_tag LOCUS_25610 18229 17708 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531337.1 protein_id gnl|my_center|LOCUS_25610 18969 18226 gene locus_tag LOCUS_25620 gene gpmA 18969 18226 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942257.1 protein_id gnl|my_center|LOCUS_25620 20027 19113 gene locus_tag LOCUS_25630 gene zapE 20027 19113 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187998.1 protein_id gnl|my_center|LOCUS_25630 19920 20201 gene locus_tag LOCUS_25640 19920 20201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 20333 21988 gene locus_tag LOCUS_25650 20333 21988 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406170.1 protein_id gnl|my_center|LOCUS_25650 23355 22174 gene locus_tag LOCUS_25660 23355 22174 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036490.1 protein_id gnl|my_center|LOCUS_25660 24207 23500 gene locus_tag LOCUS_25670 24207 23500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 24529 25467 gene locus_tag LOCUS_25680 gene xerD 24529 25467 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266933.1 protein_id gnl|my_center|LOCUS_25680 25644 26378 gene locus_tag LOCUS_25690 gene dsbC 25644 26378 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209932.1 protein_id gnl|my_center|LOCUS_25690 26727 26404 gene locus_tag LOCUS_25700 26727 26404 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947640.1 protein_id gnl|my_center|LOCUS_25700 27440 26901 gene locus_tag LOCUS_25710 27440 26901 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421963.1 protein_id gnl|my_center|LOCUS_25710 27579 28037 gene locus_tag LOCUS_25720 27579 28037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 28047 28457 gene locus_tag LOCUS_25730 28047 28457 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125389.1 protein_id gnl|my_center|LOCUS_25730 28563 28477 gene locus_tag LOCUS_t00390 28563 28477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28682 29707 gene locus_tag LOCUS_25740 gene queA 28682 29707 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_25740 29739 30914 gene locus_tag LOCUS_25750 gene tgt 29739 30914 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201420264.1 protein_id gnl|my_center|LOCUS_25750 30959 31285 gene locus_tag LOCUS_25760 30959 31285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 31303 33147 gene locus_tag LOCUS_25770 gene secD 31303 33147 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_25770 33160 34104 gene locus_tag LOCUS_25780 gene secF 33160 34104 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_25780 34961 34179 gene locus_tag LOCUS_25790 34961 34179 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_25790 35209 35973 gene locus_tag LOCUS_25800 gene trmJ 35209 35973 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217034.1 protein_id gnl|my_center|LOCUS_25800 35970 37130 gene locus_tag LOCUS_25810 35970 37130 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705635.1 protein_id gnl|my_center|LOCUS_25810 37140 37562 gene locus_tag LOCUS_25820 37140 37562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 37596 38027 gene locus_tag LOCUS_25830 gene ndk 37596 38027 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_25830 38031 39134 gene locus_tag LOCUS_25840 38031 39134 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_25840 39122 39910 gene locus_tag LOCUS_25850 gene pilF 39122 39910 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_25850 39900 40451 gene locus_tag LOCUS_25860 39900 40451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 40455 41735 gene locus_tag LOCUS_25870 gene hisS 40455 41735 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001140461.1 protein_id gnl|my_center|LOCUS_25870 41813 42490 gene locus_tag LOCUS_25880 41813 42490 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_25880 42548 43723 gene locus_tag LOCUS_25890 gene bamB 42548 43723 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_25890 43745 45121 gene locus_tag LOCUS_25900 gene der 43745 45121 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_25900 45275 46468 gene locus_tag LOCUS_25910 45275 46468 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037373.1 protein_id gnl|my_center|LOCUS_25910 47693 46350 gene locus_tag LOCUS_25920 gene xseA 47693 46350 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705853.1 protein_id gnl|my_center|LOCUS_25920 47813 49282 gene locus_tag LOCUS_25930 gene guaB 47813 49282 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_25930 49355 50947 gene locus_tag LOCUS_25940 gene guaA 49355 50947 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence26 67 2028 gene locus_tag LOCUS_25950 67 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 2168 2572 gene locus_tag LOCUS_25960 2168 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 3528 2578 gene locus_tag LOCUS_25970 3528 2578 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203754103.1 protein_id gnl|my_center|LOCUS_25970 4636 3578 gene locus_tag LOCUS_25980 4636 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 4731 5489 gene locus_tag LOCUS_25990 4731 5489 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812103.1 protein_id gnl|my_center|LOCUS_25990 5516 7186 gene locus_tag LOCUS_26000 5516 7186 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050983977.1 protein_id gnl|my_center|LOCUS_26000 7294 8580 gene locus_tag LOCUS_26010 7294 8580 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140914.1 protein_id gnl|my_center|LOCUS_26010 8942 8640 gene locus_tag LOCUS_26020 8942 8640 CDS product DUF1330 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049831911.1 protein_id gnl|my_center|LOCUS_26020 9993 8995 gene locus_tag LOCUS_26030 9993 8995 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388346.1 protein_id gnl|my_center|LOCUS_26030 10973 9990 gene locus_tag LOCUS_26040 10973 9990 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706427.1 protein_id gnl|my_center|LOCUS_26040 11906 10995 gene locus_tag LOCUS_26050 11906 10995 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_26050 12832 11903 gene locus_tag LOCUS_26060 gene oppB 12832 11903 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388349.1 protein_id gnl|my_center|LOCUS_26060 14144 12915 gene locus_tag LOCUS_26070 14144 12915 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918931.1 protein_id gnl|my_center|LOCUS_26070 14187 16370 gene locus_tag LOCUS_26080 14187 16370 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114948.1 protein_id gnl|my_center|LOCUS_26080 16371 17300 gene locus_tag LOCUS_26090 16371 17300 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267351.1 protein_id gnl|my_center|LOCUS_26090 17290 18756 gene locus_tag LOCUS_26100 17290 18756 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225339.1 protein_id gnl|my_center|LOCUS_26100 18768 20351 gene locus_tag LOCUS_26110 gene abfD 18768 20351 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_26110 20620 22101 gene locus_tag LOCUS_26120 20620 22101 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005098467.1 protein_id gnl|my_center|LOCUS_26120 22550 22347 gene locus_tag LOCUS_26130 22550 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 23069 23803 gene locus_tag LOCUS_26140 23069 23803 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088801.1 protein_id gnl|my_center|LOCUS_26140 24482 23964 gene locus_tag LOCUS_26150 24482 23964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26150 24788 27001 gene locus_tag LOCUS_26160 24788 27001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 27171 30509 gene locus_tag LOCUS_26170 27171 30509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 30648 30998 gene locus_tag LOCUS_26180 30648 30998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 31174 31515 gene locus_tag LOCUS_26190 31174 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 31512 32180 gene locus_tag LOCUS_26200 31512 32180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 32337 32651 gene locus_tag LOCUS_26210 32337 32651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 32714 32863 gene locus_tag LOCUS_26220 32714 32863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 32957 34597 gene locus_tag LOCUS_26230 32957 34597 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530017.1 protein_id gnl|my_center|LOCUS_26230 35154 36098 gene locus_tag LOCUS_26240 35154 36098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 36328 37095 gene locus_tag LOCUS_26250 36328 37095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 37383 38681 gene locus_tag LOCUS_26260 37383 38681 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197309.1 protein_id gnl|my_center|LOCUS_26260 38715 39962 gene locus_tag LOCUS_26270 38715 39962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26270 40391 39972 gene locus_tag LOCUS_26280 40391 39972 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459934.1 protein_id gnl|my_center|LOCUS_26280 41818 40406 gene locus_tag LOCUS_26290 41818 40406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257654.1 protein_id gnl|my_center|LOCUS_26290 42671 42045 gene locus_tag LOCUS_26300 42671 42045 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_26300 43465 42731 gene locus_tag LOCUS_26310 43465 42731 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_26310 44395 43469 gene locus_tag LOCUS_26320 44395 43469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 46118 44427 gene locus_tag LOCUS_26330 46118 44427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 47201 46191 gene locus_tag LOCUS_26340 gene mer 47201 46191 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_26340 47409 48593 gene locus_tag LOCUS_26350 gene bioF 47409 48593 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_26350 48599 49294 gene locus_tag LOCUS_26360 gene bioD 48599 49294 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103336.1 protein_id gnl|my_center|LOCUS_26360 49298 50563 gene locus_tag LOCUS_26370 gene bioA 49298 50563 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816798.1 protein_id gnl|my_center|LOCUS_26370 >Feature sequence27 1086 217 gene locus_tag LOCUS_26380 1086 217 CDS product DUF3883 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338943.1 protein_id gnl|my_center|LOCUS_26380 1360 1650 gene locus_tag LOCUS_26390 1360 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 3085 1850 gene locus_tag LOCUS_26400 3085 1850 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173094.1 protein_id gnl|my_center|LOCUS_26400 4319 3096 gene locus_tag LOCUS_26410 4319 3096 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_26410 5036 4332 gene locus_tag LOCUS_26420 5036 4332 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941164.1 protein_id gnl|my_center|LOCUS_26420 6121 5033 gene locus_tag LOCUS_26430 6121 5033 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_26430 6589 6122 gene locus_tag LOCUS_26440 6589 6122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 7314 6640 gene locus_tag LOCUS_26450 7314 6640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 7769 7389 gene locus_tag LOCUS_26460 7769 7389 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161790920.1 protein_id gnl|my_center|LOCUS_26460 8218 7790 gene locus_tag LOCUS_26470 8218 7790 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811322.1 protein_id gnl|my_center|LOCUS_26470 8949 8230 gene locus_tag LOCUS_26480 8949 8230 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106697.1 protein_id gnl|my_center|LOCUS_26480 9364 8993 gene locus_tag LOCUS_26490 9364 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 9685 9383 gene locus_tag LOCUS_26500 9685 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 10465 9704 gene locus_tag LOCUS_26510 10465 9704 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479544.1 protein_id gnl|my_center|LOCUS_26510 10614 11603 gene locus_tag LOCUS_26520 10614 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 13706 11700 gene locus_tag LOCUS_26530 13706 11700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 13833 14480 gene locus_tag LOCUS_26540 13833 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 15498 14608 gene locus_tag LOCUS_26550 gene ilvY 15498 14608 CDS product HTH-type transcriptional activator IlvY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704174.1 protein_id gnl|my_center|LOCUS_26550 15635 16651 gene locus_tag LOCUS_26560 gene ilvC 15635 16651 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_26560 18520 16916 gene locus_tag LOCUS_26570 18520 16916 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037984.1 protein_id gnl|my_center|LOCUS_26570 19370 18615 gene locus_tag LOCUS_26580 19370 18615 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929865.1 protein_id gnl|my_center|LOCUS_26580 21129 19780 gene locus_tag LOCUS_26590 gene gdhA 21129 19780 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941959.1 protein_id gnl|my_center|LOCUS_26590 21290 22228 gene locus_tag LOCUS_26600 gene dusB 21290 22228 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035999.1 protein_id gnl|my_center|LOCUS_26600 22245 23294 gene locus_tag LOCUS_26610 22245 23294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 23357 25276 gene locus_tag LOCUS_26620 23357 25276 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_26620 25365 25874 gene locus_tag LOCUS_26630 25365 25874 CDS product DUF1993 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083593.1 protein_id gnl|my_center|LOCUS_26630 26255 25875 gene locus_tag LOCUS_26640 26255 25875 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811318.1 protein_id gnl|my_center|LOCUS_26640 27337 26255 gene locus_tag LOCUS_26650 27337 26255 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088017.1 protein_id gnl|my_center|LOCUS_26650 28780 27347 gene locus_tag LOCUS_26660 gene glpK 28780 27347 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389762.1 protein_id gnl|my_center|LOCUS_26660 29773 28898 gene locus_tag LOCUS_26670 29773 28898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 30009 30614 gene locus_tag LOCUS_26680 30009 30614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 30636 31679 gene locus_tag LOCUS_26690 30636 31679 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128948458.1 protein_id gnl|my_center|LOCUS_26690 31715 34222 gene locus_tag LOCUS_26700 gene hrpB 31715 34222 CDS product ATP-dependent helicase HrpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405451.1 protein_id gnl|my_center|LOCUS_26700 34433 34233 gene locus_tag LOCUS_26710 34433 34233 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028171494.1 protein_id gnl|my_center|LOCUS_26710 35102 34485 gene locus_tag LOCUS_26720 35102 34485 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_26720 35878 35120 gene locus_tag LOCUS_26730 35878 35120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 36779 36003 gene locus_tag LOCUS_26740 36779 36003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 38086 36791 gene locus_tag LOCUS_26750 38086 36791 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338191.1 protein_id gnl|my_center|LOCUS_26750 39322 38135 gene locus_tag LOCUS_26760 39322 38135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227815.1 protein_id gnl|my_center|LOCUS_26760 41007 39319 gene locus_tag LOCUS_26770 41007 39319 CDS product carboxylesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966490.1 protein_id gnl|my_center|LOCUS_26770 41257 41916 gene locus_tag LOCUS_26780 41257 41916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26780 43302 41935 gene locus_tag LOCUS_26790 43302 41935 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707798.1 protein_id gnl|my_center|LOCUS_26790 44687 43347 gene locus_tag LOCUS_26800 44687 43347 CDS product glutamine synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529984.1 protein_id gnl|my_center|LOCUS_26800 45470 44718 gene locus_tag LOCUS_26810 45470 44718 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112938.1 protein_id gnl|my_center|LOCUS_26810 47079 45637 gene locus_tag LOCUS_26820 gene nhaD 47079 45637 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721316.1 protein_id gnl|my_center|LOCUS_26820 47188 47619 gene locus_tag LOCUS_26830 47188 47619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 48518 47616 gene locus_tag LOCUS_26840 gene nhaR 48518 47616 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405479.1 protein_id gnl|my_center|LOCUS_26840 48887 48588 gene locus_tag LOCUS_26850 48887 48588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 >Feature sequence28 452 377 gene locus_tag LOCUS_t00400 452 377 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 833 516 gene locus_tag LOCUS_26860 833 516 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069456649.1 protein_id gnl|my_center|LOCUS_26860 1258 950 gene locus_tag LOCUS_26870 1258 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 2009 1356 gene locus_tag LOCUS_26880 2009 1356 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073435.1 protein_id gnl|my_center|LOCUS_26880 2738 2061 gene locus_tag LOCUS_26890 2738 2061 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 protein_id gnl|my_center|LOCUS_26890 4185 2821 gene locus_tag LOCUS_26900 4185 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26900 4883 4182 gene locus_tag LOCUS_26910 4883 4182 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401395.1 protein_id gnl|my_center|LOCUS_26910 6272 5448 gene locus_tag LOCUS_26920 6272 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 6486 7289 gene locus_tag LOCUS_26930 6486 7289 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974684.1 protein_id gnl|my_center|LOCUS_26930 7294 7671 gene locus_tag LOCUS_26940 7294 7671 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771057.1 protein_id gnl|my_center|LOCUS_26940 7771 7980 gene locus_tag LOCUS_26950 7771 7980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 8809 9495 gene locus_tag LOCUS_26960 8809 9495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9506 10210 gene locus_tag LOCUS_26970 9506 10210 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403947.1 protein_id gnl|my_center|LOCUS_26970 10207 11115 gene locus_tag LOCUS_26980 10207 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26980 11148 12056 gene locus_tag LOCUS_26990 11148 12056 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727336.1 protein_id gnl|my_center|LOCUS_26990 13026 12085 gene locus_tag LOCUS_27000 13026 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 13538 13023 gene locus_tag LOCUS_27010 13538 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 14044 13535 gene locus_tag LOCUS_27020 14044 13535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 14758 14048 gene locus_tag LOCUS_27030 14758 14048 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267143.1 protein_id gnl|my_center|LOCUS_27030 15187 14825 gene locus_tag LOCUS_27040 15187 14825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 15855 15256 gene locus_tag LOCUS_27050 15855 15256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 18901 16097 gene locus_tag LOCUS_27060 18901 16097 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_27060 20787 18898 gene locus_tag LOCUS_27070 20787 18898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 21333 20791 gene locus_tag LOCUS_27080 21333 20791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 21874 21371 gene locus_tag LOCUS_27090 21874 21371 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258358.1 protein_id gnl|my_center|LOCUS_27090 23488 22520 gene locus_tag LOCUS_27100 23488 22520 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020704.1 protein_id gnl|my_center|LOCUS_27100 25491 23590 gene locus_tag LOCUS_27110 25491 23590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 26522 25488 gene locus_tag LOCUS_27120 26522 25488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 27135 26722 gene locus_tag LOCUS_27130 27135 26722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 28679 27483 gene locus_tag LOCUS_27140 28679 27483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 28923 28702 gene locus_tag LOCUS_27150 28923 28702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 29417 28920 gene locus_tag LOCUS_27160 29417 28920 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932750.1 protein_id gnl|my_center|LOCUS_27160 30210 29536 gene locus_tag LOCUS_27170 30210 29536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 30923 30180 gene locus_tag LOCUS_27180 30923 30180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 33564 30928 gene locus_tag LOCUS_27190 33564 30928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 33718 34968 gene locus_tag LOCUS_27200 33718 34968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 34971 37499 gene locus_tag LOCUS_27210 34971 37499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 37587 39179 gene locus_tag LOCUS_27220 37587 39179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 40232 39450 gene locus_tag LOCUS_27230 40232 39450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 40979 40401 gene locus_tag LOCUS_27240 40979 40401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 41243 43084 gene locus_tag LOCUS_27250 41243 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 >Feature sequence29 630 848 gene locus_tag LOCUS_27260 630 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 845 1255 gene locus_tag LOCUS_27270 845 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1871 1428 gene locus_tag LOCUS_27280 1871 1428 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119010463.1 protein_id gnl|my_center|LOCUS_27280 6024 1975 gene locus_tag LOCUS_27290 6024 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 6222 6695 gene locus_tag LOCUS_27300 6222 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 6739 6981 gene locus_tag LOCUS_27310 6739 6981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 7011 9065 gene locus_tag LOCUS_27320 7011 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27320 9191 10489 gene locus_tag LOCUS_27330 9191 10489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 10515 10823 gene locus_tag LOCUS_27340 10515 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10820 11173 gene locus_tag LOCUS_27350 10820 11173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 12385 11156 gene locus_tag LOCUS_27360 12385 11156 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_27360 14075 12489 gene locus_tag LOCUS_27370 14075 12489 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975360.1 protein_id gnl|my_center|LOCUS_27370 14053 14463 gene locus_tag LOCUS_27380 14053 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 14520 15212 gene locus_tag LOCUS_27390 14520 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27390 16540 15329 gene locus_tag LOCUS_27400 16540 15329 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972472.1 protein_id gnl|my_center|LOCUS_27400 17160 16546 gene locus_tag LOCUS_27410 17160 16546 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072123.1 protein_id gnl|my_center|LOCUS_27410 17750 17433 gene locus_tag LOCUS_27420 17750 17433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 17819 17743 gene locus_tag LOCUS_t00410 17819 17743 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18691 18029 gene locus_tag LOCUS_27430 18691 18029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 21162 19042 gene locus_tag LOCUS_27440 21162 19042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 22202 21363 gene locus_tag LOCUS_27450 22202 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 23009 22620 gene locus_tag LOCUS_27460 23009 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 23173 24078 gene locus_tag LOCUS_27470 23173 24078 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339002.1 protein_id gnl|my_center|LOCUS_27470 25221 24094 gene locus_tag LOCUS_27480 gene moeB 25221 24094 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259329.1 protein_id gnl|my_center|LOCUS_27480 25288 26403 gene locus_tag LOCUS_27490 25288 26403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258442.1 protein_id gnl|my_center|LOCUS_27490 26400 26696 gene locus_tag LOCUS_27500 26400 26696 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258441.1 protein_id gnl|my_center|LOCUS_27500 26774 27823 gene locus_tag LOCUS_27510 26774 27823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 27828 29078 gene locus_tag LOCUS_27520 27828 29078 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531469.1 protein_id gnl|my_center|LOCUS_27520 30214 29180 gene locus_tag LOCUS_27530 30214 29180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 31250 30225 gene locus_tag LOCUS_27540 31250 30225 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407530.1 protein_id gnl|my_center|LOCUS_27540 32176 31247 gene locus_tag LOCUS_27550 32176 31247 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407529.1 protein_id gnl|my_center|LOCUS_27550 33108 32200 gene locus_tag LOCUS_27560 33108 32200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794270.1 protein_id gnl|my_center|LOCUS_27560 34218 33196 gene locus_tag LOCUS_27570 34218 33196 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226781.1 protein_id gnl|my_center|LOCUS_27570 35281 34253 gene locus_tag LOCUS_27580 35281 34253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 35687 35950 gene locus_tag LOCUS_27590 35687 35950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27590 35961 36368 gene locus_tag LOCUS_27600 35961 36368 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545933.1 protein_id gnl|my_center|LOCUS_27600 36450 36914 gene locus_tag LOCUS_27610 36450 36914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 37050 37391 gene locus_tag LOCUS_27620 37050 37391 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_27620 37391 37708 gene locus_tag LOCUS_27630 37391 37708 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000071008.1 protein_id gnl|my_center|LOCUS_27630 37972 38517 gene locus_tag LOCUS_27640 37972 38517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence30 473 171 gene locus_tag LOCUS_27650 473 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 558 1100 gene locus_tag LOCUS_27660 558 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 1125 1658 gene locus_tag LOCUS_27670 1125 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 1682 2989 gene locus_tag LOCUS_27680 1682 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 3572 3015 gene locus_tag LOCUS_27690 3572 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 3737 4693 gene locus_tag LOCUS_27700 3737 4693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 4690 6027 gene locus_tag LOCUS_27710 4690 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 7073 6096 gene locus_tag LOCUS_27720 7073 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 7376 9454 gene locus_tag LOCUS_27730 7376 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 11180 9486 gene locus_tag LOCUS_27740 11180 9486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 11376 12251 gene locus_tag LOCUS_27750 11376 12251 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929974.1 protein_id gnl|my_center|LOCUS_27750 12933 12268 gene locus_tag LOCUS_27760 12933 12268 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940717.1 protein_id gnl|my_center|LOCUS_27760 13811 13038 gene locus_tag LOCUS_27770 13811 13038 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090884.1 protein_id gnl|my_center|LOCUS_27770 14740 13808 gene locus_tag LOCUS_27780 14740 13808 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_27780 15427 14795 gene locus_tag LOCUS_27790 15427 14795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 15559 16191 gene locus_tag LOCUS_27800 15559 16191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 16199 17137 gene locus_tag LOCUS_27810 gene nudC 16199 17137 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327228.1 protein_id gnl|my_center|LOCUS_27810 17137 17889 gene locus_tag LOCUS_27820 17137 17889 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404272.1 protein_id gnl|my_center|LOCUS_27820 18633 17914 gene locus_tag LOCUS_27830 18633 17914 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529987.1 protein_id gnl|my_center|LOCUS_27830 18859 19323 gene locus_tag LOCUS_27840 gene argR 18859 19323 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633181.1 protein_id gnl|my_center|LOCUS_27840 19394 20626 gene locus_tag LOCUS_27850 gene argG 19394 20626 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404940.1 protein_id gnl|my_center|LOCUS_27850 20623 21690 gene locus_tag LOCUS_27860 20623 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_27860 21687 22745 gene locus_tag LOCUS_27870 gene argC 21687 22745 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887608.1 protein_id gnl|my_center|LOCUS_27870 22750 23904 gene locus_tag LOCUS_27880 22750 23904 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_27880 23951 24964 gene locus_tag LOCUS_27890 23951 24964 CDS product N-acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404944.1 protein_id gnl|my_center|LOCUS_27890 24968 25903 gene locus_tag LOCUS_27900 gene argB 24968 25903 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_27900 25947 27137 gene locus_tag LOCUS_27910 gene argH 25947 27137 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404947.1 protein_id gnl|my_center|LOCUS_27910 28681 27167 gene locus_tag LOCUS_27920 28681 27167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27920 29021 29185 gene locus_tag LOCUS_27930 29021 29185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 29199 30248 gene locus_tag LOCUS_27940 29199 30248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 32002 30281 gene locus_tag LOCUS_27950 32002 30281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 32327 32992 gene locus_tag LOCUS_27960 32327 32992 CDS product glutathione S-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071742.1 protein_id gnl|my_center|LOCUS_27960 33367 33011 gene locus_tag LOCUS_27970 33367 33011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 34365 33466 gene locus_tag LOCUS_27980 34365 33466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 35128 34385 gene locus_tag LOCUS_27990 35128 34385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence31 1288 269 gene locus_tag LOCUS_28000 1288 269 CDS product IS110-like element ISPa11 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147159.1 protein_id gnl|my_center|LOCUS_28000 1713 2447 gene locus_tag LOCUS_28010 1713 2447 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036109.1 protein_id gnl|my_center|LOCUS_28010 2535 3149 gene locus_tag LOCUS_28020 gene pth 2535 3149 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000152942.1 protein_id gnl|my_center|LOCUS_28020 3183 4253 gene locus_tag LOCUS_28030 gene ydiK 3183 4253 CDS product AI-2E family transporter YdiK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011416681.1 protein_id gnl|my_center|LOCUS_28030 5319 4279 gene locus_tag LOCUS_28040 5319 4279 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455969.1 protein_id gnl|my_center|LOCUS_28040 5470 7962 gene locus_tag LOCUS_28050 5470 7962 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110390.1 protein_id gnl|my_center|LOCUS_28050 8480 7959 gene locus_tag LOCUS_28060 8480 7959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 8577 10853 gene locus_tag LOCUS_28070 gene plpD 8577 10853 CDS product patatin-like phospholipase PlpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113139.1 protein_id gnl|my_center|LOCUS_28070 11026 11784 gene locus_tag LOCUS_28080 11026 11784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973986.1 protein_id gnl|my_center|LOCUS_28080 14004 11803 gene locus_tag LOCUS_28090 14004 11803 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085445.1 protein_id gnl|my_center|LOCUS_28090 15050 14028 gene locus_tag LOCUS_28100 15050 14028 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481684.1 protein_id gnl|my_center|LOCUS_28100 18541 15116 gene locus_tag LOCUS_28110 18541 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 20038 18587 gene locus_tag LOCUS_28120 20038 18587 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186277841.1 protein_id gnl|my_center|LOCUS_28120 20207 21298 gene locus_tag LOCUS_28130 gene ychF 20207 21298 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948354.1 protein_id gnl|my_center|LOCUS_28130 21362 22030 gene locus_tag LOCUS_28140 21362 22030 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_28140 22144 22220 gene locus_tag LOCUS_t00420 22144 22220 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 23339 22227 gene locus_tag LOCUS_28150 23339 22227 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087144570.1 protein_id gnl|my_center|LOCUS_28150 23682 24614 gene locus_tag LOCUS_28160 23682 24614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 24756 25511 gene locus_tag LOCUS_28170 24756 25511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 25511 27268 gene locus_tag LOCUS_28180 25511 27268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 28453 28974 gene locus_tag LOCUS_28190 28453 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 29219 29623 gene locus_tag LOCUS_28200 29219 29623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 29574 29936 gene locus_tag LOCUS_28210 29574 29936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 32066 30342 gene locus_tag LOCUS_28220 32066 30342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 32520 33002 gene locus_tag LOCUS_28230 32520 33002 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071115951.1 protein_id gnl|my_center|LOCUS_28230 33120 33548 gene locus_tag LOCUS_28240 33120 33548 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114206.1 protein_id gnl|my_center|LOCUS_28240 33618 34139 gene locus_tag LOCUS_28250 33618 34139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 34136 35053 gene locus_tag LOCUS_28260 34136 35053 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920800.1 protein_id gnl|my_center|LOCUS_28260 >Feature sequence32 2533 1232 gene locus_tag LOCUS_28270 2533 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 3881 2544 gene locus_tag LOCUS_28280 3881 2544 CDS product HD-GYP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937797.1 protein_id gnl|my_center|LOCUS_28280 3988 4335 gene locus_tag LOCUS_28290 3988 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 4353 5165 gene locus_tag LOCUS_28300 4353 5165 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140939.1 protein_id gnl|my_center|LOCUS_28300 5334 7814 gene locus_tag LOCUS_28310 5334 7814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 8208 7822 gene locus_tag LOCUS_28320 8208 7822 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944052.1 protein_id gnl|my_center|LOCUS_28320 8318 9001 gene locus_tag LOCUS_28330 8318 9001 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_28330 8998 10302 gene locus_tag LOCUS_28340 8998 10302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 10366 10725 gene locus_tag LOCUS_28350 10366 10725 CDS product NirD/YgiW/YdeI family stress tolerance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262443.1 protein_id gnl|my_center|LOCUS_28350 10722 11468 gene locus_tag LOCUS_28360 10722 11468 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072670.1 protein_id gnl|my_center|LOCUS_28360 11733 11497 gene locus_tag LOCUS_28370 11733 11497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 13970 11739 gene locus_tag LOCUS_28380 13970 11739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 15539 13986 gene locus_tag LOCUS_28390 15539 13986 CDS product acyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005094018.1 protein_id gnl|my_center|LOCUS_28390 16029 16802 gene locus_tag LOCUS_28400 16029 16802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 16920 17666 gene locus_tag LOCUS_28410 16920 17666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 17817 19976 gene locus_tag LOCUS_28420 17817 19976 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385729.1 protein_id gnl|my_center|LOCUS_28420 20127 20696 gene locus_tag LOCUS_28430 20127 20696 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_28430 20693 21628 gene locus_tag LOCUS_28440 20693 21628 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_28440 21625 21816 gene locus_tag LOCUS_28450 21625 21816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 21813 23189 gene locus_tag LOCUS_28460 21813 23189 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_28460 23186 26719 gene locus_tag LOCUS_28470 23186 26719 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_28470 27258 26716 gene locus_tag LOCUS_28480 27258 26716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 27641 28453 gene locus_tag LOCUS_28490 gene blaOXA 27641 28453 CDS product class D beta-lactamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531977.1 protein_id gnl|my_center|LOCUS_28490 28725 28952 gene locus_tag LOCUS_28500 28725 28952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 28949 29683 gene locus_tag LOCUS_28510 28949 29683 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207910.1 protein_id gnl|my_center|LOCUS_28510 29770 30762 gene locus_tag LOCUS_28520 29770 30762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 32364 30949 gene locus_tag LOCUS_28530 32364 30949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 32791 33063 gene locus_tag LOCUS_28540 32791 33063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 33083 33304 gene locus_tag LOCUS_28550 33083 33304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 >Feature sequence33 1410 238 gene locus_tag LOCUS_28560 1410 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28560 1487 2689 gene locus_tag LOCUS_28570 1487 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 2686 3720 gene locus_tag LOCUS_28580 2686 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 4966 3737 gene locus_tag LOCUS_28590 4966 3737 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_28590 5477 5109 gene locus_tag LOCUS_28600 5477 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 6651 5626 gene locus_tag LOCUS_28610 6651 5626 CDS product urea transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938457.1 protein_id gnl|my_center|LOCUS_28610 7260 6721 gene locus_tag LOCUS_28620 7260 6721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 8168 7362 gene locus_tag LOCUS_28630 8168 7362 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222374.1 protein_id gnl|my_center|LOCUS_28630 9024 8263 gene locus_tag LOCUS_28640 9024 8263 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919678.1 protein_id gnl|my_center|LOCUS_28640 9368 9120 gene locus_tag LOCUS_28650 9368 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 10660 9794 gene locus_tag LOCUS_28660 10660 9794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_28660 11966 10851 gene locus_tag LOCUS_28670 11966 10851 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_28670 13965 12292 gene locus_tag LOCUS_28680 13965 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929090.1 protein_id gnl|my_center|LOCUS_28680 14292 14047 gene locus_tag LOCUS_28690 14292 14047 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346198.1 protein_id gnl|my_center|LOCUS_28690 14730 16022 gene locus_tag LOCUS_28700 14730 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 16923 15946 gene locus_tag LOCUS_28710 16923 15946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399936.1 protein_id gnl|my_center|LOCUS_28710 17347 18513 gene locus_tag LOCUS_28720 17347 18513 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_28720 18461 19315 gene locus_tag LOCUS_28730 18461 19315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 19320 21362 gene locus_tag LOCUS_28740 19320 21362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 21364 23361 gene locus_tag LOCUS_28750 21364 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 23351 24298 gene locus_tag LOCUS_28760 23351 24298 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525046.1 protein_id gnl|my_center|LOCUS_28760 26405 24192 gene locus_tag LOCUS_28770 gene cphA 26405 24192 CDS product cyanophycin synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603497.1 protein_id gnl|my_center|LOCUS_28770 27444 26563 gene locus_tag LOCUS_28780 27444 26563 CDS product DUF1838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027099.1 protein_id gnl|my_center|LOCUS_28780 27724 28530 gene locus_tag LOCUS_28790 gene murI 27724 28530 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938069.1 protein_id gnl|my_center|LOCUS_28790 29741 28896 gene locus_tag LOCUS_28800 29741 28896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 29759 31108 gene locus_tag LOCUS_28810 29759 31108 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224260.1 protein_id gnl|my_center|LOCUS_28810 31105 32136 gene locus_tag LOCUS_28820 31105 32136 CDS product NADP-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816621.1 protein_id gnl|my_center|LOCUS_28820 32167 32808 gene locus_tag LOCUS_28830 32167 32808 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113262.1 protein_id gnl|my_center|LOCUS_28830 >Feature sequence34 708 364 gene locus_tag LOCUS_28840 708 364 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_28840 860 1072 gene locus_tag LOCUS_28850 860 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 1069 1605 gene locus_tag LOCUS_28860 1069 1605 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369672.1 protein_id gnl|my_center|LOCUS_28860 1605 2633 gene locus_tag LOCUS_28870 1605 2633 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728353.1 protein_id gnl|my_center|LOCUS_28870 3466 2645 gene locus_tag LOCUS_28880 3466 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 4100 3582 gene locus_tag LOCUS_28890 4100 3582 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932860.1 protein_id gnl|my_center|LOCUS_28890 4671 4093 gene locus_tag LOCUS_28900 4671 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 5801 4671 gene locus_tag LOCUS_28910 5801 4671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 6449 5898 gene locus_tag LOCUS_28920 6449 5898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 6523 7182 gene locus_tag LOCUS_28930 6523 7182 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705578.1 protein_id gnl|my_center|LOCUS_28930 7624 7184 gene locus_tag LOCUS_28940 7624 7184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 8304 7621 gene locus_tag LOCUS_28950 8304 7621 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969365.1 protein_id gnl|my_center|LOCUS_28950 8404 8958 gene locus_tag LOCUS_28960 8404 8958 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142106.1 protein_id gnl|my_center|LOCUS_28960 8993 9763 gene locus_tag LOCUS_28970 8993 9763 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337281.1 protein_id gnl|my_center|LOCUS_28970 12653 9837 gene locus_tag LOCUS_28980 12653 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 12817 14583 gene locus_tag LOCUS_28990 12817 14583 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141300.1 protein_id gnl|my_center|LOCUS_28990 14597 16426 gene locus_tag LOCUS_29000 gene cydC 14597 16426 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208974886.1 protein_id gnl|my_center|LOCUS_29000 16579 18942 gene locus_tag LOCUS_29010 16579 18942 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211632.1 protein_id gnl|my_center|LOCUS_29010 19477 19013 gene locus_tag LOCUS_29020 gene nsrR 19477 19013 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_29020 21821 19542 gene locus_tag LOCUS_29030 21821 19542 CDS product nitric-oxide reductase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197954.1 protein_id gnl|my_center|LOCUS_29030 22812 22054 gene locus_tag LOCUS_29040 22812 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 24393 22900 gene locus_tag LOCUS_29050 24393 22900 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919385.1 protein_id gnl|my_center|LOCUS_29050 24997 24404 gene locus_tag LOCUS_29060 24997 24404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 26231 25023 gene locus_tag LOCUS_29070 26231 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 27758 26472 gene locus_tag LOCUS_29080 27758 26472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29080 27820 28476 gene locus_tag LOCUS_29090 27820 28476 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294588.1 protein_id gnl|my_center|LOCUS_29090 28509 30533 gene locus_tag LOCUS_29100 28509 30533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 30570 31034 gene locus_tag LOCUS_29110 30570 31034 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918163.1 protein_id gnl|my_center|LOCUS_29110 32453 31074 gene locus_tag LOCUS_29120 32453 31074 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945788.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence35 2381 243 gene locus_tag LOCUS_29130 gene nirS 2381 243 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_29130 4903 2609 gene locus_tag LOCUS_29140 4903 2609 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265961.1 protein_id gnl|my_center|LOCUS_29140 5385 6341 gene locus_tag LOCUS_29150 5385 6341 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389282.1 protein_id gnl|my_center|LOCUS_29150 6331 7236 gene locus_tag LOCUS_29160 gene metF 6331 7236 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389283.1 protein_id gnl|my_center|LOCUS_29160 7233 10940 gene locus_tag LOCUS_29170 gene metH 7233 10940 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704406.1 protein_id gnl|my_center|LOCUS_29170 11344 12534 gene locus_tag LOCUS_29180 11344 12534 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064290.1 protein_id gnl|my_center|LOCUS_29180 12841 12545 gene locus_tag LOCUS_29190 12841 12545 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189573.1 protein_id gnl|my_center|LOCUS_29190 13427 12891 gene locus_tag LOCUS_29200 13427 12891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29200 14287 13424 gene locus_tag LOCUS_29210 gene prmC 14287 13424 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186904.1 protein_id gnl|my_center|LOCUS_29210 14305 15465 gene locus_tag LOCUS_29220 14305 15465 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035842.1 protein_id gnl|my_center|LOCUS_29220 15754 18882 gene locus_tag LOCUS_29230 15754 18882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29230 19046 19849 gene locus_tag LOCUS_29240 gene modA 19046 19849 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074080.1 protein_id gnl|my_center|LOCUS_29240 19854 20528 gene locus_tag LOCUS_29250 gene modB 19854 20528 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_29250 20531 21610 gene locus_tag LOCUS_29260 gene modC 20531 21610 CDS product molybdenum ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925958.1 protein_id gnl|my_center|LOCUS_29260 22018 21632 gene locus_tag LOCUS_29270 22018 21632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29270 22219 24246 gene locus_tag LOCUS_29280 22219 24246 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390968.1 protein_id gnl|my_center|LOCUS_29280 24259 24765 gene locus_tag LOCUS_29290 24259 24765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967700.1 protein_id gnl|my_center|LOCUS_29290 24762 26081 gene locus_tag LOCUS_29300 24762 26081 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842701.1 protein_id gnl|my_center|LOCUS_29300 27250 26192 gene locus_tag LOCUS_29310 gene prfA 27250 26192 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772919.1 protein_id gnl|my_center|LOCUS_29310 27349 29118 gene locus_tag LOCUS_29320 27349 29118 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_29320 29149 29757 gene locus_tag LOCUS_29330 gene lolB 29149 29757 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_29330 29850 29924 gene locus_tag LOCUS_t00430 29850 29924 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 29958 30929 gene locus_tag LOCUS_29340 29958 30929 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687900.1 protein_id gnl|my_center|LOCUS_29340 >Feature sequence36 8754 5824 gene locus_tag LOCUS_29350 8754 5824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29350 9548 8751 gene locus_tag LOCUS_29360 9548 8751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 10042 9545 gene locus_tag LOCUS_29370 gene tadA 10042 9545 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001934843.1 protein_id gnl|my_center|LOCUS_29370 10410 10039 gene locus_tag LOCUS_29380 gene queD 10410 10039 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008576903.1 protein_id gnl|my_center|LOCUS_29380 10685 11725 gene locus_tag LOCUS_29390 gene mer 10685 11725 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_29390 11805 12488 gene locus_tag LOCUS_29400 gene npdG 11805 12488 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_29400 12527 13291 gene locus_tag LOCUS_29410 gene cofE 12527 13291 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_29410 13302 14261 gene locus_tag LOCUS_29420 gene cofD 13302 14261 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_29420 14266 14949 gene locus_tag LOCUS_29430 gene cofC 14266 14949 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256112.1 protein_id gnl|my_center|LOCUS_29430 14957 17344 gene locus_tag LOCUS_29440 14957 17344 CDS product bifunctional FO biosynthesis protein CofGH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167455006.1 protein_id gnl|my_center|LOCUS_29440 17341 17526 gene locus_tag LOCUS_29450 17341 17526 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081984.1 protein_id gnl|my_center|LOCUS_29450 17548 17946 gene locus_tag LOCUS_29460 gene arfB 17548 17946 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_29460 17971 18468 gene locus_tag LOCUS_29470 17971 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 19586 18528 gene locus_tag LOCUS_29480 gene mer 19586 18528 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_29480 20656 19619 gene locus_tag LOCUS_29490 20656 19619 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226841.1 protein_id gnl|my_center|LOCUS_29490 21494 20922 gene locus_tag LOCUS_29500 21494 20922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 23639 21648 gene locus_tag LOCUS_29510 23639 21648 CDS product glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337648.1 protein_id gnl|my_center|LOCUS_29510 24276 23674 gene locus_tag LOCUS_29520 24276 23674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 24315 26015 gene locus_tag LOCUS_29530 24315 26015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 25610 25519 gene locus_tag LOCUS_t00440 25610 25519 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 26160 26345 gene locus_tag LOCUS_29540 26160 26345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 26330 26698 gene locus_tag LOCUS_29550 26330 26698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041065645.1 protein_id gnl|my_center|LOCUS_29550 >Feature sequence37 489 3077 gene locus_tag LOCUS_29560 489 3077 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923250.1 protein_id gnl|my_center|LOCUS_29560 3135 4091 gene locus_tag LOCUS_29570 3135 4091 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_29570 4507 4115 gene locus_tag LOCUS_29580 4507 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 4844 5953 gene locus_tag LOCUS_29590 4844 5953 CDS product S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144408.1 protein_id gnl|my_center|LOCUS_29590 7304 6024 gene locus_tag LOCUS_29600 7304 6024 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200164.1 protein_id gnl|my_center|LOCUS_29600 8268 7387 gene locus_tag LOCUS_29610 gene gluQRS 8268 7387 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391481.1 protein_id gnl|my_center|LOCUS_29610 8431 9441 gene locus_tag LOCUS_29620 8431 9441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29620 10824 9847 gene locus_tag LOCUS_29630 10824 9847 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090157.1 protein_id gnl|my_center|LOCUS_29630 12779 10866 gene locus_tag LOCUS_29640 12779 10866 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090330.1 protein_id gnl|my_center|LOCUS_29640 13118 13732 gene locus_tag LOCUS_29650 13118 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 13729 14664 gene locus_tag LOCUS_29660 13729 14664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787364.1 protein_id gnl|my_center|LOCUS_29660 16016 14697 gene locus_tag LOCUS_29670 16016 14697 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_29670 18121 16694 gene locus_tag LOCUS_29680 18121 16694 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066878442.1 protein_id gnl|my_center|LOCUS_29680 18240 18932 gene locus_tag LOCUS_29690 18240 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29690 18929 20383 gene locus_tag LOCUS_29700 18929 20383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29700 20519 21214 gene locus_tag LOCUS_29710 20519 21214 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_29710 21211 22497 gene locus_tag LOCUS_29720 21211 22497 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670439.1 protein_id gnl|my_center|LOCUS_29720 22484 23692 gene locus_tag LOCUS_29730 22484 23692 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_29730 23829 25007 gene locus_tag LOCUS_29740 23829 25007 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_29740 >Feature sequence38 496 1869 gene locus_tag LOCUS_29750 496 1869 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222955.1 protein_id gnl|my_center|LOCUS_29750 2055 5111 gene locus_tag LOCUS_29760 2055 5111 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020677315.1 protein_id gnl|my_center|LOCUS_29760 5122 8034 gene locus_tag LOCUS_29770 5122 8034 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_29770 8133 8543 gene locus_tag LOCUS_29780 8133 8543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29780 8650 8937 gene locus_tag LOCUS_29790 8650 8937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29790 8943 9440 gene locus_tag LOCUS_29800 8943 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 9684 10508 gene locus_tag LOCUS_29810 9684 10508 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175136.1 protein_id gnl|my_center|LOCUS_29810 11390 10524 gene locus_tag LOCUS_29820 11390 10524 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216609.1 protein_id gnl|my_center|LOCUS_29820 11504 14017 gene locus_tag LOCUS_29830 11504 14017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 14037 14468 gene locus_tag LOCUS_29840 14037 14468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 14776 15387 gene locus_tag LOCUS_29850 14776 15387 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057359.1 protein_id gnl|my_center|LOCUS_29850 15394 15810 gene locus_tag LOCUS_29860 15394 15810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 15815 16429 gene locus_tag LOCUS_29870 15815 16429 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391391.1 protein_id gnl|my_center|LOCUS_29870 16426 17010 gene locus_tag LOCUS_29880 16426 17010 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_29880 18848 16956 gene locus_tag LOCUS_29890 18848 16956 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_29890 20148 18922 gene locus_tag LOCUS_29900 20148 18922 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810358.1 protein_id gnl|my_center|LOCUS_29900 20807 20145 gene locus_tag LOCUS_29910 20807 20145 CDS product DUF480 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706673.1 protein_id gnl|my_center|LOCUS_29910 22493 21006 gene locus_tag LOCUS_29920 22493 21006 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225993.1 protein_id gnl|my_center|LOCUS_29920 22671 23144 gene locus_tag LOCUS_29930 22671 23144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 23533 23135 gene locus_tag LOCUS_29940 23533 23135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 >Feature sequence39 243 1598 gene locus_tag LOCUS_29950 243 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 2188 1604 gene locus_tag LOCUS_29960 2188 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 2308 3495 gene locus_tag LOCUS_29970 2308 3495 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975703.1 protein_id gnl|my_center|LOCUS_29970 3496 5025 gene locus_tag LOCUS_29980 3496 5025 CDS product putative 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265854.1 protein_id gnl|my_center|LOCUS_29980 6327 5059 gene locus_tag LOCUS_29990 6327 5059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 6308 7132 gene locus_tag LOCUS_30000 6308 7132 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933720.1 protein_id gnl|my_center|LOCUS_30000 7142 9463 gene locus_tag LOCUS_30010 gene mrcB 7142 9463 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_30010 9488 9979 gene locus_tag LOCUS_30020 9488 9979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 10017 11933 gene locus_tag LOCUS_30030 10017 11933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30030 12757 11948 gene locus_tag LOCUS_30040 12757 11948 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389556.1 protein_id gnl|my_center|LOCUS_30040 12957 14384 gene locus_tag LOCUS_30050 12957 14384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30050 14412 15191 gene locus_tag LOCUS_30060 14412 15191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_30060 15306 15566 gene locus_tag LOCUS_30070 15306 15566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_30070 17442 16231 gene locus_tag LOCUS_30080 gene nirN 17442 16231 CDS product dihydro-heme d1 dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113244.1 protein_id gnl|my_center|LOCUS_30080 18434 17574 gene locus_tag LOCUS_30090 18434 17574 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928448.1 protein_id gnl|my_center|LOCUS_30090 18540 20948 gene locus_tag LOCUS_30100 18540 20948 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121001.1 protein_id gnl|my_center|LOCUS_30100 >Feature sequence40 1903 332 gene locus_tag LOCUS_30110 1903 332 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528246.1 protein_id gnl|my_center|LOCUS_30110 2014 2967 gene locus_tag LOCUS_30120 2014 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 2973 3821 gene locus_tag LOCUS_30130 2973 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30130 3837 4688 gene locus_tag LOCUS_30140 3837 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 5366 4722 gene locus_tag LOCUS_30150 5366 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30150 7216 5447 gene locus_tag LOCUS_30160 7216 5447 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_30160 9201 7228 gene locus_tag LOCUS_30170 9201 7228 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189933.1 protein_id gnl|my_center|LOCUS_30170 10159 9263 gene locus_tag LOCUS_30180 10159 9263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 10291 11658 gene locus_tag LOCUS_30190 10291 11658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 11795 12073 gene locus_tag LOCUS_30200 11795 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 12074 12619 gene locus_tag LOCUS_30210 12074 12619 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970806.1 protein_id gnl|my_center|LOCUS_30210 12721 13203 gene locus_tag LOCUS_30220 12721 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 13226 14374 gene locus_tag LOCUS_30230 13226 14374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 17248 14576 gene locus_tag LOCUS_30240 17248 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 17322 17999 gene locus_tag LOCUS_30250 17322 17999 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525684.1 protein_id gnl|my_center|LOCUS_30250 19526 18078 gene locus_tag LOCUS_30260 19526 18078 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262914.1 protein_id gnl|my_center|LOCUS_30260 19864 20410 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gcttcaatgaggccgcggcatcgctgccgcggaaatc >Feature sequence41 1064 417 gene locus_tag LOCUS_30270 1064 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 1300 1737 gene locus_tag LOCUS_30280 gene secB 1300 1737 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772050.1 protein_id gnl|my_center|LOCUS_30280 1794 3200 gene locus_tag LOCUS_30290 gene tig 1794 3200 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267215.1 protein_id gnl|my_center|LOCUS_30290 3218 3694 gene locus_tag LOCUS_30300 gene secB 3218 3694 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208976.1 protein_id gnl|my_center|LOCUS_30300 3781 4353 gene locus_tag LOCUS_30310 3781 4353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 5836 4361 gene locus_tag LOCUS_30320 5836 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 7832 5874 gene locus_tag LOCUS_30330 7832 5874 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_30330 8094 8573 gene locus_tag LOCUS_30340 8094 8573 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_30340 9451 8660 gene locus_tag LOCUS_30350 9451 8660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 10326 9451 gene locus_tag LOCUS_30360 gene nadC 10326 9451 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_30360 11038 10445 gene locus_tag LOCUS_30370 11038 10445 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_30370 11779 11111 gene locus_tag LOCUS_30380 gene rnt 11779 11111 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_30380 13336 11792 gene locus_tag LOCUS_30390 13336 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 13471 16176 gene locus_tag LOCUS_30400 gene aceE 13471 16176 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422379.1 protein_id gnl|my_center|LOCUS_30400 16196 17491 gene locus_tag LOCUS_30410 gene aceF 16196 17491 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_30410 17499 19262 gene locus_tag LOCUS_30420 gene lpdA 17499 19262 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527370.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence42 399 175 gene locus_tag LOCUS_30430 399 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 914 549 gene locus_tag LOCUS_30440 914 549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 1575 1021 gene locus_tag LOCUS_30450 1575 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30450 2091 3110 gene locus_tag LOCUS_30460 2091 3110 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_30460 3838 3191 gene locus_tag LOCUS_30470 3838 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 4640 4068 gene locus_tag LOCUS_30480 4640 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30480 5681 4749 gene locus_tag LOCUS_30490 5681 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 6621 5686 gene locus_tag LOCUS_30500 6621 5686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 7025 6714 gene locus_tag LOCUS_30510 7025 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 7393 8376 gene locus_tag LOCUS_30520 7393 8376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30520 8609 9277 gene locus_tag LOCUS_30530 8609 9277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 10413 9373 gene locus_tag LOCUS_30540 10413 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 11303 10536 gene locus_tag LOCUS_30550 11303 10536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30550 11520 14264 gene locus_tag LOCUS_30560 11520 14264 CDS product bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141077.1 protein_id gnl|my_center|LOCUS_30560 14385 14639 gene locus_tag LOCUS_30570 14385 14639 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252128.1 protein_id gnl|my_center|LOCUS_30570 14694 16052 gene locus_tag LOCUS_30580 14694 16052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967665.1 protein_id gnl|my_center|LOCUS_30580 16049 16603 gene locus_tag LOCUS_30590 16049 16603 CDS product DUF2249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327929.1 protein_id gnl|my_center|LOCUS_30590 16643 17263 gene locus_tag LOCUS_30600 16643 17263 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083622.1 protein_id gnl|my_center|LOCUS_30600 17275 17553 gene locus_tag LOCUS_30610 17275 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30610 17679 18257 gene locus_tag LOCUS_30620 17679 18257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence43 372 106 gene locus_tag LOCUS_30630 372 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 260 835 gene locus_tag LOCUS_30640 260 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1013 2950 gene locus_tag LOCUS_30650 gene asnB 1013 2950 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976178.1 protein_id gnl|my_center|LOCUS_30650 2950 3519 gene locus_tag LOCUS_30660 2950 3519 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103394993.1 protein_id gnl|my_center|LOCUS_30660 3606 4388 gene locus_tag LOCUS_30670 3606 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 4385 4735 gene locus_tag LOCUS_30680 4385 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 4743 6254 gene locus_tag LOCUS_30690 4743 6254 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393478.1 protein_id gnl|my_center|LOCUS_30690 6251 7261 gene locus_tag LOCUS_30700 gene nadE 6251 7261 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525354.1 protein_id gnl|my_center|LOCUS_30700 8681 7281 gene locus_tag LOCUS_30710 8681 7281 CDS product virulence factor family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036514.1 protein_id gnl|my_center|LOCUS_30710 11245 8678 gene locus_tag LOCUS_30720 gene mprF 11245 8678 CDS product bifunctional lysylphosphatidylglycerol flippase/synthetase MprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706484.1 protein_id gnl|my_center|LOCUS_30720 11487 12554 gene locus_tag LOCUS_30730 11487 12554 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_30730 14067 12721 gene locus_tag LOCUS_30740 gene chrA 14067 12721 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096587.1 protein_id gnl|my_center|LOCUS_30740 14556 14155 gene locus_tag LOCUS_30750 14556 14155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 15005 15523 gene locus_tag LOCUS_30760 15005 15523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 15591 17948 gene locus_tag LOCUS_30770 15591 17948 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844465.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence44 393 1712 gene locus_tag LOCUS_30780 393 1712 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933141.1 protein_id gnl|my_center|LOCUS_30780 3027 1684 gene locus_tag LOCUS_30790 3027 1684 CDS product DUF418 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265603.1 protein_id gnl|my_center|LOCUS_30790 5047 3740 gene locus_tag LOCUS_30800 5047 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 5335 5991 gene locus_tag LOCUS_30810 5335 5991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30810 6909 6007 gene locus_tag LOCUS_30820 6909 6007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038714.1 protein_id gnl|my_center|LOCUS_30820 7274 6909 gene locus_tag LOCUS_30830 7274 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 7955 7305 gene locus_tag LOCUS_30840 gene nth 7955 7305 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036717.1 protein_id gnl|my_center|LOCUS_30840 8599 7952 gene locus_tag LOCUS_30850 8599 7952 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261584.1 protein_id gnl|my_center|LOCUS_30850 8695 9387 gene locus_tag LOCUS_30860 8695 9387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30860 9384 9800 gene locus_tag LOCUS_30870 9384 9800 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528643.1 protein_id gnl|my_center|LOCUS_30870 9797 10204 gene locus_tag LOCUS_30880 9797 10204 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973065.1 protein_id gnl|my_center|LOCUS_30880 10865 10212 gene locus_tag LOCUS_30890 gene rsxG 10865 10212 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_30890 11886 10855 gene locus_tag LOCUS_30900 gene rsxD 11886 10855 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_30900 13220 11883 gene locus_tag LOCUS_30910 13220 11883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 13883 13317 gene locus_tag LOCUS_30920 13883 13317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 15927 13891 gene locus_tag LOCUS_30930 gene metG 15927 13891 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262543.1 protein_id gnl|my_center|LOCUS_30930 16140 17210 gene locus_tag LOCUS_30940 16140 17210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence45 802 119 gene locus_tag LOCUS_30950 802 119 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707254.1 protein_id gnl|my_center|LOCUS_30950 1323 2258 gene locus_tag LOCUS_30960 1323 2258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114721.1 protein_id gnl|my_center|LOCUS_30960 2412 2212 gene locus_tag LOCUS_30970 2412 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 3336 2440 gene locus_tag LOCUS_30980 3336 2440 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_30980 5315 3342 gene locus_tag LOCUS_30990 gene speA 5315 3342 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144058.1 protein_id gnl|my_center|LOCUS_30990 6307 5336 gene locus_tag LOCUS_31000 6307 5336 CDS product deoxyhypusine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256447.1 protein_id gnl|my_center|LOCUS_31000 7378 6323 gene locus_tag LOCUS_31010 7378 6323 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259146.1 protein_id gnl|my_center|LOCUS_31010 7465 8685 gene locus_tag LOCUS_31020 7465 8685 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390627.1 protein_id gnl|my_center|LOCUS_31020 9279 8749 gene locus_tag LOCUS_31030 9279 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31030 10089 9391 gene locus_tag LOCUS_31040 10089 9391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 10251 10823 gene locus_tag LOCUS_31050 10251 10823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 11882 10839 gene locus_tag LOCUS_31060 11882 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 12188 13336 gene locus_tag LOCUS_31070 12188 13336 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328247.1 protein_id gnl|my_center|LOCUS_31070 13342 16428 gene locus_tag LOCUS_31080 13342 16428 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328246.1 protein_id gnl|my_center|LOCUS_31080 16987 16472 gene locus_tag LOCUS_31090 16987 16472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence46 526 1434 gene locus_tag LOCUS_31100 526 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 2949 1960 gene locus_tag LOCUS_31110 2949 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 3761 3111 gene locus_tag LOCUS_31120 gene aat 3761 3111 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 protein_id gnl|my_center|LOCUS_31120 4764 3781 gene locus_tag LOCUS_31130 4764 3781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 5836 4859 gene locus_tag LOCUS_31140 5836 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 7260 5920 gene locus_tag LOCUS_31150 7260 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 7355 7711 gene locus_tag LOCUS_31160 7355 7711 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_31160 8141 7818 gene locus_tag LOCUS_31170 8141 7818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 8899 8309 gene locus_tag LOCUS_31180 8899 8309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 10079 9333 gene locus_tag LOCUS_31190 10079 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 12506 10083 gene locus_tag LOCUS_31200 12506 10083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 13340 15091 gene locus_tag LOCUS_31210 13340 15091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 15104 15727 gene locus_tag LOCUS_31220 15104 15727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31220 >Feature sequence47 2780 222 gene locus_tag LOCUS_31230 gene mutS 2780 222 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_31230 2885 3976 gene locus_tag LOCUS_31240 2885 3976 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010925739.1 protein_id gnl|my_center|LOCUS_31240 4052 4579 gene locus_tag LOCUS_31250 4052 4579 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_31250 4626 5174 gene locus_tag LOCUS_31260 gene thpR 4626 5174 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_31260 5327 6376 gene locus_tag LOCUS_31270 gene recA 5327 6376 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_31270 6533 6946 gene locus_tag LOCUS_31280 gene recX 6533 6946 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098485.1 protein_id gnl|my_center|LOCUS_31280 7057 9663 gene locus_tag LOCUS_31290 gene alaS 7057 9663 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047238.1 protein_id gnl|my_center|LOCUS_31290 9819 10034 gene locus_tag LOCUS_31300 gene csrA 9819 10034 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415691.1 protein_id gnl|my_center|LOCUS_31300 10201 10293 gene locus_tag LOCUS_t00450 10201 10293 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11626 10538 gene locus_tag LOCUS_31310 11626 10538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 11805 12086 gene locus_tag LOCUS_31320 11805 12086 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389773.1 protein_id gnl|my_center|LOCUS_31320 12096 12419 gene locus_tag LOCUS_31330 12096 12419 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389772.1 protein_id gnl|my_center|LOCUS_31330 15463 12773 gene locus_tag LOCUS_31340 15463 12773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 16295 15957 gene locus_tag LOCUS_31350 16295 15957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31350 >Feature sequence48 774 205 gene locus_tag LOCUS_31360 774 205 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931004.1 protein_id gnl|my_center|LOCUS_31360 1583 879 gene locus_tag LOCUS_31370 1583 879 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038602.1 protein_id gnl|my_center|LOCUS_31370 2794 1649 gene locus_tag LOCUS_31380 2794 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 2984 2802 gene locus_tag LOCUS_31390 2984 2802 CDS product PLDc N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552853.1 protein_id gnl|my_center|LOCUS_31390 3853 3071 gene locus_tag LOCUS_31400 3853 3071 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_31400 3898 4428 gene locus_tag LOCUS_31410 gene rfbC 3898 4428 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257099.1 protein_id gnl|my_center|LOCUS_31410 4461 5753 gene locus_tag LOCUS_31420 4461 5753 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142200.1 protein_id gnl|my_center|LOCUS_31420 6631 5750 gene locus_tag LOCUS_31430 6631 5750 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027083.1 protein_id gnl|my_center|LOCUS_31430 7956 6640 gene locus_tag LOCUS_31440 7956 6640 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208594.1 protein_id gnl|my_center|LOCUS_31440 8756 7953 gene locus_tag LOCUS_31450 8756 7953 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_31450 10273 8912 gene locus_tag LOCUS_31460 10273 8912 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024335.1 protein_id gnl|my_center|LOCUS_31460 11397 10270 gene locus_tag LOCUS_31470 11397 10270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338283.1 protein_id gnl|my_center|LOCUS_31470 12059 11394 gene locus_tag LOCUS_31480 12059 11394 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142181.1 protein_id gnl|my_center|LOCUS_31480 12623 12225 gene locus_tag LOCUS_31490 12623 12225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 14372 12627 gene locus_tag LOCUS_31500 14372 12627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 15471 14413 gene locus_tag LOCUS_31510 15471 14413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31510 <16348 15609 gene locus_tag LOCUS_31520 <16348 15609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202144.1:lipopolysaccharide biosynthesis protein >Feature sequence49 374 811 gene locus_tag LOCUS_31530 374 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 1606 845 gene locus_tag LOCUS_31540 1606 845 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104991.1 protein_id gnl|my_center|LOCUS_31540 1762 2556 gene locus_tag LOCUS_31550 1762 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 2872 4788 gene locus_tag LOCUS_31560 2872 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 5050 5760 gene locus_tag LOCUS_31570 5050 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31570 6845 7564 gene locus_tag LOCUS_31580 6845 7564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 8289 10661 gene locus_tag LOCUS_31590 8289 10661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 11203 11658 gene locus_tag LOCUS_31600 11203 11658 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_31600 11655 12623 gene locus_tag LOCUS_31610 11655 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 12827 14311 gene locus_tag LOCUS_31620 12827 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 14311 15090 gene locus_tag LOCUS_31630 14311 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 15087 16001 gene locus_tag LOCUS_31640 15087 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31640 >Feature sequence50 1718 24 gene locus_tag LOCUS_31650 gene aspT 1718 24 CDS product aspartate-alanine antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107422.1 protein_id gnl|my_center|LOCUS_31650 2202 1750 gene locus_tag LOCUS_31660 2202 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 5023 2294 gene locus_tag LOCUS_31670 5023 2294 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965961.1 protein_id gnl|my_center|LOCUS_31670 6066 5047 gene locus_tag LOCUS_31680 gene glsA 6066 5047 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000883017.1 protein_id gnl|my_center|LOCUS_31680 7333 6098 gene locus_tag LOCUS_31690 7333 6098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 7565 8194 gene locus_tag LOCUS_31700 7565 8194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 8461 8973 gene locus_tag LOCUS_31710 8461 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 8973 10109 gene locus_tag LOCUS_31720 8973 10109 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364884.1 protein_id gnl|my_center|LOCUS_31720 10114 11490 gene locus_tag LOCUS_31730 10114 11490 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937373.1 protein_id gnl|my_center|LOCUS_31730 12471 11560 gene locus_tag LOCUS_31740 12471 11560 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_31740 12743 12471 gene locus_tag LOCUS_31750 12743 12471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 12872 13915 gene locus_tag LOCUS_31760 12872 13915 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405967.1 protein_id gnl|my_center|LOCUS_31760 14684 13962 gene locus_tag LOCUS_31770 14684 13962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence51 538 1827 gene locus_tag LOCUS_31780 538 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31780 1827 2081 gene locus_tag LOCUS_31790 1827 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 3016 2108 gene locus_tag LOCUS_31800 3016 2108 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921521.1 protein_id gnl|my_center|LOCUS_31800 3465 3097 gene locus_tag LOCUS_31810 3465 3097 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085543.1 protein_id gnl|my_center|LOCUS_31810 4705 3716 gene locus_tag LOCUS_31820 gene narH 4705 3716 CDS product nitrate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775896.1 protein_id gnl|my_center|LOCUS_31820 5387 4698 gene locus_tag LOCUS_31830 5387 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31830 8149 5384 gene locus_tag LOCUS_31840 8149 5384 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877688.1 protein_id gnl|my_center|LOCUS_31840 8319 9572 gene locus_tag LOCUS_31850 8319 9572 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037163.1 protein_id gnl|my_center|LOCUS_31850 10237 9905 gene locus_tag LOCUS_31860 10237 9905 CDS product high-potential iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197194.1 protein_id gnl|my_center|LOCUS_31860 10714 11943 gene locus_tag LOCUS_31870 gene vmeJ 10714 11943 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479099.1 protein_id gnl|my_center|LOCUS_31870 11940 15098 gene locus_tag LOCUS_31880 gene vexF 11940 15098 CDS product multidrug efflux RND transporter permease subunit VexF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000494544.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence52 986 279 gene locus_tag LOCUS_31890 986 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 2162 1284 gene locus_tag LOCUS_31900 2162 1284 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817953.1 protein_id gnl|my_center|LOCUS_31900 2746 2159 gene locus_tag LOCUS_31910 gene pnuC 2746 2159 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072658.1 protein_id gnl|my_center|LOCUS_31910 3052 2777 gene locus_tag LOCUS_31920 3052 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072659.1 protein_id gnl|my_center|LOCUS_31920 5329 3149 gene locus_tag LOCUS_31930 5329 3149 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072660.1 protein_id gnl|my_center|LOCUS_31930 5646 6518 gene locus_tag LOCUS_31940 5646 6518 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810287.1 protein_id gnl|my_center|LOCUS_31940 8100 6901 gene locus_tag LOCUS_31950 8100 6901 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814691.1 protein_id gnl|my_center|LOCUS_31950 8505 8191 gene locus_tag LOCUS_31960 8505 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31960 11015 8562 gene locus_tag LOCUS_31970 11015 8562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31970 12290 11184 gene locus_tag LOCUS_31980 gene wecB 12290 11184 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_31980 13921 12290 gene locus_tag LOCUS_31990 13921 12290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31990 >Feature sequence53 1528 347 gene locus_tag LOCUS_32000 gene tyrS 1528 347 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_32000 1959 3266 gene locus_tag LOCUS_32010 1959 3266 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_32010 3475 5610 gene locus_tag LOCUS_32020 gene ppk1 3475 5610 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099209.1 protein_id gnl|my_center|LOCUS_32020 7105 5579 gene locus_tag LOCUS_32030 gene ppx 7105 5579 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621407.1 protein_id gnl|my_center|LOCUS_32030 7826 7116 gene locus_tag LOCUS_32040 7826 7116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 8371 7823 gene locus_tag LOCUS_32050 8371 7823 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_32050 8572 9546 gene locus_tag LOCUS_32060 8572 9546 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192857.1 protein_id gnl|my_center|LOCUS_32060 10645 9557 gene locus_tag LOCUS_32070 gene tyrA 10645 9557 CDS product bifunctional chorismate mutase/prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000257629.1 protein_id gnl|my_center|LOCUS_32070 10757 13666 gene locus_tag LOCUS_32080 10757 13666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32080 >Feature sequence54 517 627 gene locus_tag LOCUS_r00010 517 627 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 843 2735 gene locus_tag LOCUS_32090 gene asnB 843 2735 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808454.1 protein_id gnl|my_center|LOCUS_32090 3668 2799 gene locus_tag LOCUS_32100 3668 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 3738 4835 gene locus_tag LOCUS_32110 3738 4835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 5624 4851 gene locus_tag LOCUS_32120 5624 4851 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_32120 6585 5725 gene locus_tag LOCUS_32130 6585 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32130 6924 7814 gene locus_tag LOCUS_32140 6924 7814 CDS product arginine deiminase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963436.1 protein_id gnl|my_center|LOCUS_32140 7855 9687 gene locus_tag LOCUS_32150 7855 9687 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527796.1 protein_id gnl|my_center|LOCUS_32150 9737 10414 gene locus_tag LOCUS_32160 gene plsY 9737 10414 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_32160 10422 11414 gene locus_tag LOCUS_32170 gene birA 10422 11414 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039011.1 protein_id gnl|my_center|LOCUS_32170 11411 12175 gene locus_tag LOCUS_32180 11411 12175 CDS product pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093768.1 protein_id gnl|my_center|LOCUS_32180 12221 12916 gene locus_tag LOCUS_32190 12221 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 12957 13032 gene locus_tag LOCUS_t00460 12957 13032 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 13126 13208 gene locus_tag LOCUS_t00470 13126 13208 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 13494 13567 gene locus_tag LOCUS_t00480 13494 13567 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 13643 13718 gene locus_tag LOCUS_t00490 13643 13718 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence55 233 538 gene locus_tag LOCUS_32200 233 538 CDS product metal-sensing transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764692.1 protein_id gnl|my_center|LOCUS_32200 554 1597 gene locus_tag LOCUS_32210 554 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 2178 1618 gene locus_tag LOCUS_32220 2178 1618 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395104.1 protein_id gnl|my_center|LOCUS_32220 3470 2175 gene locus_tag LOCUS_32230 3470 2175 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_32230 4062 3478 gene locus_tag LOCUS_32240 4062 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 4250 4744 gene locus_tag LOCUS_32250 4250 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32250 5710 4811 gene locus_tag LOCUS_32260 5710 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 6679 5819 gene locus_tag LOCUS_32270 6679 5819 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092499.1 protein_id gnl|my_center|LOCUS_32270 7239 6676 gene locus_tag LOCUS_32280 7239 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 8713 7199 gene locus_tag LOCUS_32290 8713 7199 CDS product trehalose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869048.1 protein_id gnl|my_center|LOCUS_32290 9777 8713 gene locus_tag LOCUS_32300 9777 8713 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104649.1 protein_id gnl|my_center|LOCUS_32300 10586 9777 gene locus_tag LOCUS_32310 gene otsB 10586 9777 CDS product trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869049.1 protein_id gnl|my_center|LOCUS_32310 11840 10593 gene locus_tag LOCUS_32320 11840 10593 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869050.1 protein_id gnl|my_center|LOCUS_32320 12499 11837 gene locus_tag LOCUS_32330 12499 11837 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869051.1 protein_id gnl|my_center|LOCUS_32330 13233 12505 gene locus_tag LOCUS_32340 gene sodB 13233 12505 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_32340 >Feature sequence56 1140 148 gene locus_tag LOCUS_32350 1140 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32350 1841 1143 gene locus_tag LOCUS_32360 1841 1143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 2835 1825 gene locus_tag LOCUS_32370 gene traU 2835 1825 CDS product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947798.1 protein_id gnl|my_center|LOCUS_32370 3502 2840 gene locus_tag LOCUS_32380 gene traW 3502 2840 CDS product type-F conjugative transfer system protein TraW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947799.1 protein_id gnl|my_center|LOCUS_32380 4043 3489 gene locus_tag LOCUS_32390 4043 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 4427 4062 gene locus_tag LOCUS_32400 4427 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 6997 4424 gene locus_tag LOCUS_32410 gene traC 6997 4424 CDS product type IV secretion system protein TraC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947800.1 protein_id gnl|my_center|LOCUS_32410 7597 7001 gene locus_tag LOCUS_32420 7597 7001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 8424 7594 gene locus_tag LOCUS_32430 8424 7594 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186871.1 protein_id gnl|my_center|LOCUS_32430 9775 8411 gene locus_tag LOCUS_32440 9775 8411 CDS product TraB/VirB10 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331475.1 protein_id gnl|my_center|LOCUS_32440 10496 9768 gene locus_tag LOCUS_32450 10496 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 11052 10429 gene locus_tag LOCUS_32460 11052 10429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 11339 11049 gene locus_tag LOCUS_32470 11339 11049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 11576 11352 gene locus_tag LOCUS_32480 11576 11352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 11488 11673 gene locus_tag LOCUS_32490 11488 11673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 12200 11697 gene locus_tag LOCUS_32500 12200 11697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence57 388 98 gene locus_tag LOCUS_32510 388 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 691 1701 gene locus_tag LOCUS_32520 691 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 1806 2327 gene locus_tag LOCUS_32530 1806 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32530 2336 3382 gene locus_tag LOCUS_32540 2336 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 3997 3524 gene locus_tag LOCUS_32550 3997 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 4602 3994 gene locus_tag LOCUS_32560 4602 3994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 4750 6009 gene locus_tag LOCUS_32570 4750 6009 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_32570 6439 6020 gene locus_tag LOCUS_32580 gene gloA 6439 6020 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390219.1 protein_id gnl|my_center|LOCUS_32580 6556 7242 gene locus_tag LOCUS_32590 6556 7242 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038978.1 protein_id gnl|my_center|LOCUS_32590 7239 8156 gene locus_tag LOCUS_32600 7239 8156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 8268 8465 gene locus_tag LOCUS_32610 8268 8465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence58 1665 595 gene locus_tag LOCUS_32620 1665 595 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_32620 1831 2988 gene locus_tag LOCUS_32630 1831 2988 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989913.1 protein_id gnl|my_center|LOCUS_32630 4714 3650 gene locus_tag LOCUS_32640 4714 3650 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003410070.1 protein_id gnl|my_center|LOCUS_32640 5257 4886 gene locus_tag LOCUS_32650 5257 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32650 5386 5826 gene locus_tag LOCUS_32660 5386 5826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32660 6088 6393 gene locus_tag LOCUS_32670 6088 6393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32670 6980 6594 gene locus_tag LOCUS_32680 6980 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32680 7266 7054 gene locus_tag LOCUS_32690 7266 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32690 7160 7402 gene locus_tag LOCUS_32700 7160 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32700 >Feature sequence59 389 54 gene locus_tag LOCUS_32710 389 54 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 1378 440 gene locus_tag LOCUS_32720 1378 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 2796 1375 gene locus_tag LOCUS_32730 2796 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 3192 2818 gene locus_tag LOCUS_32740 3192 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 3731 3189 gene locus_tag LOCUS_32750 3731 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 5044 3731 gene locus_tag LOCUS_32760 5044 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32760 5886 5041 gene locus_tag LOCUS_32770 5886 5041 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018076212.1 protein_id gnl|my_center|LOCUS_32770 6538 5948 gene locus_tag LOCUS_32780 6538 5948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32780 >Feature sequence60 2474 285 gene locus_tag LOCUS_32790 2474 285 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100007.1 protein_id gnl|my_center|LOCUS_32790 2473 3135 gene locus_tag LOCUS_32800 2473 3135 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_32800 3132 4442 gene locus_tag LOCUS_32810 3132 4442 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190128.1 protein_id gnl|my_center|LOCUS_32810 5016 6296 gene locus_tag LOCUS_32820 gene mucD 5016 6296 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence61 1013 2215 gene locus_tag LOCUS_32830 1013 2215 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965461.1 protein_id gnl|my_center|LOCUS_32830 2217 2525 gene locus_tag LOCUS_32840 2217 2525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 3341 2535 gene locus_tag LOCUS_32850 3341 2535 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_32850 3556 4074 gene locus_tag LOCUS_32860 3556 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4105 5214 gene locus_tag LOCUS_32870 4105 5214 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_32870 5356 5703 gene locus_tag LOCUS_32880 5356 5703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 >Feature sequence62 2545 461 gene locus_tag LOCUS_32890 2545 461 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_32890 2669 3214 gene locus_tag LOCUS_32900 2669 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 3230 5104 gene locus_tag LOCUS_32910 3230 5104 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943238.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence63 342 608 gene locus_tag LOCUS_32920 342 608 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706878.1 protein_id gnl|my_center|LOCUS_32920 669 1493 gene locus_tag LOCUS_32930 669 1493 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706877.1 protein_id gnl|my_center|LOCUS_32930 1477 2268 gene locus_tag LOCUS_32940 1477 2268 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_32940 2481 3767 gene locus_tag LOCUS_32950 2481 3767 CDS product alginate export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265575.1 protein_id gnl|my_center|LOCUS_32950 3899 4666 gene locus_tag LOCUS_32960 3899 4666 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence64 <1 1230 gene locus_tag LOCUS_32970 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:TAT-variant-translocated molybdopterin oxidoreductase 1234 2664 gene locus_tag LOCUS_32980 gene nrfD 1234 2664 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_32980 2666 3169 gene locus_tag LOCUS_32990 2666 3169 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404832.1 protein_id gnl|my_center|LOCUS_32990 3156 3851 gene locus_tag LOCUS_33000 3156 3851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 >Feature sequence65 <1 1188 gene locus_tag LOCUS_33010 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947796.1:type-F conjugative transfer system mating-pair stabilization protein TraN 1185 1583 gene locus_tag LOCUS_33020 1185 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 1584 2438 gene locus_tag LOCUS_33030 gene traF 1584 2438 CDS product type-F conjugative transfer system pilin assembly protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947795.1 protein_id gnl|my_center|LOCUS_33030 2449 3921 gene locus_tag LOCUS_33040 gene traH 2449 3921 CDS product conjugal transfer pilus assembly protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087223.1 protein_id gnl|my_center|LOCUS_33040 >Feature sequence66 1835 417 gene locus_tag LOCUS_33050 1835 417 CDS product copper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529973.1 protein_id gnl|my_center|LOCUS_33050 3311 1860 gene locus_tag LOCUS_33060 3311 1860 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529972.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_33060 3672 3322 gene locus_tag LOCUS_33070 3672 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 4559 4350 gene locus_tag LOCUS_33080 4559 4350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence67 1710 499 gene locus_tag LOCUS_33090 1710 499 CDS product aromatic ring-hydroxylating dioxygenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530079.1 protein_id gnl|my_center|LOCUS_33090 2146 1757 gene locus_tag LOCUS_33100 2146 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33100 3028 2306 gene locus_tag LOCUS_33110 3028 2306 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_33110 3126 3965 gene locus_tag LOCUS_33120 gene rlmJ 3126 3965 CDS product 23S rRNA (adenine(2030)-N(6))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301854.1 protein_id gnl|my_center|LOCUS_33120 >Feature sequence68 1173 259 gene locus_tag LOCUS_33130 1173 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 1161 1982 gene locus_tag LOCUS_33140 1161 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33140 2012 3676 gene locus_tag LOCUS_33150 2012 3676 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_33150 >Feature sequence69 <1 958 gene locus_tag LOCUS_33160 <1 958 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943238.1:tetratricopeptide repeat protein 937 2763 gene locus_tag LOCUS_33170 937 2763 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_33170 2928 3392 gene locus_tag LOCUS_33180 2928 3392 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036240.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence70 2276 2088 gene locus_tag LOCUS_33190 2276 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33190 2557 2291 gene locus_tag LOCUS_33200 2557 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 2780 2544 gene locus_tag LOCUS_33210 2780 2544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 >Feature sequence71 2270 117 gene locus_tag LOCUS_33220 2270 117 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986774.1 protein_id gnl|my_center|LOCUS_33220 2793 2497 gene locus_tag LOCUS_33230 2793 2497 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104666.1 protein_id gnl|my_center|LOCUS_33230 3063 2821 gene locus_tag LOCUS_33240 3063 2821 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939316.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence72 61 1374 gene locus_tag LOCUS_33250 61 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 2206 1532 gene locus_tag LOCUS_33260 2206 1532 CDS product YceH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477153.1 protein_id gnl|my_center|LOCUS_33260 3090 2203 gene locus_tag LOCUS_33270 3090 2203 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_33270 >Feature sequence73 371 769 gene locus_tag LOCUS_33280 371 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 774 1160 gene locus_tag LOCUS_33290 774 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461613.1 protein_id gnl|my_center|LOCUS_33290 1184 2335 gene locus_tag LOCUS_33300 gene arsB 1184 2335 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107455.1 protein_id gnl|my_center|LOCUS_33300 2332 2757 gene locus_tag LOCUS_33310 2332 2757 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_33310 3148 3076 gene locus_tag LOCUS_t00500 3148 3076 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence74 382 723 gene locus_tag LOCUS_33320 382 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 727 1086 gene locus_tag LOCUS_33330 727 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 1130 1471 gene locus_tag LOCUS_33340 1130 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 >Feature sequence75 195 896 gene locus_tag LOCUS_33350 195 896 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170621.1 protein_id gnl|my_center|LOCUS_33350 905 1543 gene locus_tag LOCUS_33360 gene maiA 905 1543 CDS product maleylacetoacetate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810527.1 protein_id gnl|my_center|LOCUS_33360 <2710 1567 gene locus_tag LOCUS_33370 <2710 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024666240.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence76 768 115 gene locus_tag LOCUS_33380 768 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 2205 874 gene locus_tag LOCUS_33390 2205 874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206913.1 protein_id gnl|my_center|LOCUS_33390