>Feature sequence001 560 2452 gene locus_tag LOCUS_00010 560 2452 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021597.1 protein_id gnl|my_center|LOCUS_00010 2449 3546 gene locus_tag LOCUS_00020 2449 3546 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065160.1 protein_id gnl|my_center|LOCUS_00020 3660 5429 gene locus_tag LOCUS_00030 3660 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 6084 6488 gene locus_tag LOCUS_00040 gene cfbA 6084 6488 CDS product sirohydrochlorin nickelochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023539.1 protein_id gnl|my_center|LOCUS_00040 6712 8028 gene locus_tag LOCUS_00050 gene cfbE 6712 8028 CDS product coenzyme F430 synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023538.1 protein_id gnl|my_center|LOCUS_00050 8432 8265 gene locus_tag LOCUS_00060 8432 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9266 8760 gene locus_tag LOCUS_00070 9266 8760 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_00070 10520 9267 gene locus_tag LOCUS_00080 10520 9267 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_00080 11398 10793 gene locus_tag LOCUS_00090 11398 10793 CDS product cobalt-factor II C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024143.1 protein_id gnl|my_center|LOCUS_00090 11973 11392 gene locus_tag LOCUS_00100 gene cbiT 11973 11392 CDS product precorrin-6Y C5,15-methyltransferase (decarboxylating) subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024144.1 protein_id gnl|my_center|LOCUS_00100 12510 12097 gene locus_tag LOCUS_00110 12510 12097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12729 13955 gene locus_tag LOCUS_00120 12729 13955 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289167.1 protein_id gnl|my_center|LOCUS_00120 15724 15083 gene locus_tag LOCUS_00130 15724 15083 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020735.1 protein_id gnl|my_center|LOCUS_00130 16440 15796 gene locus_tag LOCUS_00140 16440 15796 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020734.1 protein_id gnl|my_center|LOCUS_00140 17597 17007 gene locus_tag LOCUS_00150 17597 17007 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023341.1 protein_id gnl|my_center|LOCUS_00150 18582 18103 gene locus_tag LOCUS_00160 18582 18103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 18715 20013 gene locus_tag LOCUS_00170 18715 20013 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020230.1 protein_id gnl|my_center|LOCUS_00170 21542 20661 gene locus_tag LOCUS_00180 21542 20661 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023032.1 protein_id gnl|my_center|LOCUS_00180 23965 23306 gene locus_tag LOCUS_00190 23965 23306 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024281.1 protein_id gnl|my_center|LOCUS_00190 25153 23972 gene locus_tag LOCUS_00200 25153 23972 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024280.1 protein_id gnl|my_center|LOCUS_00200 25838 25914 gene locus_tag LOCUS_t00010 25838 25914 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 27645 26713 gene locus_tag LOCUS_00210 gene aglJ 27645 26713 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024210.1 protein_id gnl|my_center|LOCUS_00210 28201 27650 gene locus_tag LOCUS_00220 28201 27650 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024211.1 protein_id gnl|my_center|LOCUS_00220 <29121 28285 gene locus_tag LOCUS_00230 <29121 28285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023272.1:homocitrate synthase family protein >Feature sequence002 392 1312 gene locus_tag LOCUS_00240 gene cofD 392 1312 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066127.1 protein_id gnl|my_center|LOCUS_00240 2377 1337 gene locus_tag LOCUS_00250 gene dph2 2377 1337 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020763.1 protein_id gnl|my_center|LOCUS_00250 2945 2391 gene locus_tag LOCUS_00260 gene hpt 2945 2391 CDS product hypoxanthine/guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020762.1 protein_id gnl|my_center|LOCUS_00260 3896 3114 gene locus_tag LOCUS_00270 3896 3114 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457239.1 protein_id gnl|my_center|LOCUS_00270 4315 4118 gene locus_tag LOCUS_00280 4315 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 5466 4531 gene locus_tag LOCUS_00290 5466 4531 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963416.1 protein_id gnl|my_center|LOCUS_00290 6390 5941 gene locus_tag LOCUS_00300 6390 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 7446 6613 gene locus_tag LOCUS_00310 7446 6613 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878803.1 protein_id gnl|my_center|LOCUS_00310 7895 9040 gene locus_tag LOCUS_00320 7895 9040 CDS product methanogenesis marker 9 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020738.1 protein_id gnl|my_center|LOCUS_00320 9037 9996 gene locus_tag LOCUS_00330 9037 9996 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020739.1 protein_id gnl|my_center|LOCUS_00330 9999 10598 gene locus_tag LOCUS_00340 9999 10598 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020740.1 protein_id gnl|my_center|LOCUS_00340 10627 11001 gene locus_tag LOCUS_00350 10627 11001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 11670 12503 gene locus_tag LOCUS_00360 gene mtxX 11670 12503 CDS product methanogenesis marker protein Mmp4/MtxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065223.1 protein_id gnl|my_center|LOCUS_00360 12622 13218 gene locus_tag LOCUS_00370 12622 13218 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021808.1 protein_id gnl|my_center|LOCUS_00370 13608 14024 gene locus_tag LOCUS_00380 13608 14024 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_00380 14253 14423 gene locus_tag LOCUS_00390 14253 14423 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023214.1 protein_id gnl|my_center|LOCUS_00390 14574 15296 gene locus_tag LOCUS_00400 14574 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 15673 17256 gene locus_tag LOCUS_00410 gene pyrG 15673 17256 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023212.1 protein_id gnl|my_center|LOCUS_00410 17530 18000 gene locus_tag LOCUS_00420 17530 18000 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020196.1 protein_id gnl|my_center|LOCUS_00420 18938 18117 gene locus_tag LOCUS_00430 gene thiX 18938 18117 CDS product HMP/thiamine ABC transporter permease ThiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245037.1 protein_id gnl|my_center|LOCUS_00430 20692 18938 gene locus_tag LOCUS_00440 20692 18938 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245821.1 protein_id gnl|my_center|LOCUS_00440 21319 20705 gene locus_tag LOCUS_00450 21319 20705 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 protein_id gnl|my_center|LOCUS_00450 22539 21937 gene locus_tag LOCUS_00460 22539 21937 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_00460 23200 22601 gene locus_tag LOCUS_00470 23200 22601 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_00470 24464 23982 gene locus_tag LOCUS_00480 24464 23982 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869796.1 protein_id gnl|my_center|LOCUS_00480 25062 24478 gene locus_tag LOCUS_00490 25062 24478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 25286 25098 gene locus_tag LOCUS_00500 25286 25098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 25800 25438 gene locus_tag LOCUS_00510 25800 25438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 >Feature sequence003 888 1283 gene locus_tag LOCUS_00520 888 1283 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023067.1 protein_id gnl|my_center|LOCUS_00520 1928 2233 gene locus_tag LOCUS_00530 1928 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 2244 2642 gene locus_tag LOCUS_00540 2244 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022359.1 protein_id gnl|my_center|LOCUS_00540 3153 3225 gene locus_tag LOCUS_t00020 3153 3225 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3997 3239 gene locus_tag LOCUS_00550 3997 3239 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_00550 4103 4188 gene locus_tag LOCUS_t00030 4103 4188 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4636 4764 gene locus_tag LOCUS_00560 4636 4764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 5130 5534 gene locus_tag LOCUS_00570 5130 5534 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066255.1 protein_id gnl|my_center|LOCUS_00570 6066 5680 gene locus_tag LOCUS_00580 6066 5680 CDS product DUF2111 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589540.1 protein_id gnl|my_center|LOCUS_00580 6825 6307 gene locus_tag LOCUS_00590 6825 6307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065452.1 protein_id gnl|my_center|LOCUS_00590 8714 7470 gene locus_tag LOCUS_00600 gene mmp10 8714 7470 CDS product methyl coenzyme M reductase-arginine methyltransferase Mmp10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024424.1 protein_id gnl|my_center|LOCUS_00600 9566 9375 gene locus_tag LOCUS_00610 9566 9375 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755892.1 protein_id gnl|my_center|LOCUS_00610 11214 9688 gene locus_tag LOCUS_00620 11214 9688 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024485.1 protein_id gnl|my_center|LOCUS_00620 12762 11647 gene locus_tag LOCUS_00630 12762 11647 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024513.1 protein_id gnl|my_center|LOCUS_00630 13084 12899 gene locus_tag LOCUS_00640 13084 12899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 13041 13961 gene locus_tag LOCUS_00650 13041 13961 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066039.1 protein_id gnl|my_center|LOCUS_00650 15891 17165 gene locus_tag LOCUS_00660 15891 17165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17826 18119 gene locus_tag LOCUS_00670 17826 18119 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024502.1 protein_id gnl|my_center|LOCUS_00670 18679 18125 gene locus_tag LOCUS_00680 gene rimI 18679 18125 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066037.1 protein_id gnl|my_center|LOCUS_00680 19268 19510 gene locus_tag LOCUS_00690 19268 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 19613 20848 gene locus_tag LOCUS_00700 19613 20848 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021296.1 protein_id gnl|my_center|LOCUS_00700 21120 21860 gene locus_tag LOCUS_00710 21120 21860 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023957.1 protein_id gnl|my_center|LOCUS_00710 22189 22374 gene locus_tag LOCUS_00720 22189 22374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 22455 22970 gene locus_tag LOCUS_00730 22455 22970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 23395 26055 gene locus_tag LOCUS_00740 gene ppdK 23395 26055 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020657.1 protein_id gnl|my_center|LOCUS_00740 >Feature sequence004 2448 1702 gene locus_tag LOCUS_00750 gene mcrG 2448 1702 CDS product coenzyme-B sulfoethylthiotransferase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024420.1 protein_id gnl|my_center|LOCUS_00750 3108 2500 gene locus_tag LOCUS_00760 gene mcrC 3108 2500 CDS product methyl-coenzyme M reductase I operon protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024421.1 protein_id gnl|my_center|LOCUS_00760 3585 3115 gene locus_tag LOCUS_00770 gene mcrD 3585 3115 CDS product methyl-coenzyme M reductase operon protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024422.1 protein_id gnl|my_center|LOCUS_00770 4974 3670 gene locus_tag LOCUS_00780 gene mcrB 4974 3670 CDS product coenzyme-B sulfoethylthiotransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024423.1 protein_id gnl|my_center|LOCUS_00780 6005 7339 gene locus_tag LOCUS_00790 gene glnA 6005 7339 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024100.1 protein_id gnl|my_center|LOCUS_00790 8049 7552 gene locus_tag LOCUS_00800 gene purE 8049 7552 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249787.1 protein_id gnl|my_center|LOCUS_00800 8227 8439 gene locus_tag LOCUS_00810 8227 8439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 8505 9104 gene locus_tag LOCUS_00820 8505 9104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 9776 9171 gene locus_tag LOCUS_00830 9776 9171 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583586.1 protein_id gnl|my_center|LOCUS_00830 10920 9742 gene locus_tag LOCUS_00840 10920 9742 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876625.1 protein_id gnl|my_center|LOCUS_00840 11776 12660 gene locus_tag LOCUS_00850 11776 12660 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877777.1 protein_id gnl|my_center|LOCUS_00850 13660 14277 gene locus_tag LOCUS_00860 gene serB 13660 14277 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024307.1 protein_id gnl|my_center|LOCUS_00860 14432 15286 gene locus_tag LOCUS_00870 14432 15286 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867255.1 protein_id gnl|my_center|LOCUS_00870 17448 16522 gene locus_tag LOCUS_00880 gene nifB 17448 16522 CDS product nitrogenase cofactor biosynthesis protein NifB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024080.1 protein_id gnl|my_center|LOCUS_00880 19059 18127 gene locus_tag LOCUS_00890 19059 18127 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_00890 19283 19065 gene locus_tag LOCUS_00900 19283 19065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00900 19848 19222 gene locus_tag LOCUS_00910 19848 19222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 20665 19832 gene locus_tag LOCUS_00920 20665 19832 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393238.1 protein_id gnl|my_center|LOCUS_00920 21460 20675 gene locus_tag LOCUS_00930 21460 20675 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_00930 23254 21668 gene locus_tag LOCUS_00940 gene thsA 23254 21668 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021686.1 protein_id gnl|my_center|LOCUS_00940 24653 23337 gene locus_tag LOCUS_00950 24653 23337 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024460.1 protein_id gnl|my_center|LOCUS_00950 >Feature sequence005 1205 2104 gene locus_tag LOCUS_00960 1205 2104 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_00960 2109 3422 gene locus_tag LOCUS_00970 2109 3422 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870537.1 protein_id gnl|my_center|LOCUS_00970 3442 4611 gene locus_tag LOCUS_00980 3442 4611 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_00980 4866 6005 gene locus_tag LOCUS_00990 4866 6005 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066217.1 protein_id gnl|my_center|LOCUS_00990 5953 6789 gene locus_tag LOCUS_01000 gene mtnP 5953 6789 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021425.1 protein_id gnl|my_center|LOCUS_01000 7375 6806 gene locus_tag LOCUS_01010 7375 6806 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021972.1 protein_id gnl|my_center|LOCUS_01010 7654 8574 gene locus_tag LOCUS_01020 7654 8574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 8693 8917 gene locus_tag LOCUS_01030 8693 8917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8934 9575 gene locus_tag LOCUS_01040 gene tmk 8934 9575 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024311.1 protein_id gnl|my_center|LOCUS_01040 9725 10768 gene locus_tag LOCUS_01050 9725 10768 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020699.1 protein_id gnl|my_center|LOCUS_01050 11643 10780 gene locus_tag LOCUS_01060 11643 10780 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064938.1 protein_id gnl|my_center|LOCUS_01060 12035 12580 gene locus_tag LOCUS_01070 gene thpR 12035 12580 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066123.1 protein_id gnl|my_center|LOCUS_01070 12681 13448 gene locus_tag LOCUS_01080 12681 13448 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_01080 14848 13460 gene locus_tag LOCUS_01090 14848 13460 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064974.1 protein_id gnl|my_center|LOCUS_01090 15598 17838 gene locus_tag LOCUS_01100 15598 17838 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_01100 18854 20587 gene locus_tag LOCUS_01110 gene oadA 18854 20587 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020719.1 protein_id gnl|my_center|LOCUS_01110 20597 22075 gene locus_tag LOCUS_01120 20597 22075 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020720.1 protein_id gnl|my_center|LOCUS_01120 22097 23080 gene locus_tag LOCUS_01130 22097 23080 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence006 1106 186 gene locus_tag LOCUS_01140 gene nadA 1106 186 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020997.1 protein_id gnl|my_center|LOCUS_01140 2226 3047 gene locus_tag LOCUS_01150 gene nadC 2226 3047 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020993.1 protein_id gnl|my_center|LOCUS_01150 3253 3050 gene locus_tag LOCUS_01160 3253 3050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4320 3418 gene locus_tag LOCUS_01170 4320 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 5775 5182 gene locus_tag LOCUS_01180 5775 5182 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021454.1 protein_id gnl|my_center|LOCUS_01180 6710 5874 gene locus_tag LOCUS_01190 gene rsmA 6710 5874 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990848.1 protein_id gnl|my_center|LOCUS_01190 7399 6809 gene locus_tag LOCUS_01200 7399 6809 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065124.1 protein_id gnl|my_center|LOCUS_01200 8208 7855 gene locus_tag LOCUS_01210 8208 7855 CDS product RNA polymerase Rpb4 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021458.1 protein_id gnl|my_center|LOCUS_01210 9071 8775 gene locus_tag LOCUS_01220 9071 8775 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021460.1 protein_id gnl|my_center|LOCUS_01220 9798 9274 gene locus_tag LOCUS_01230 9798 9274 CDS product paREP15, coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546267.1 protein_id gnl|my_center|LOCUS_01230 11374 10070 gene locus_tag LOCUS_01240 11374 10070 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_01240 12680 12195 gene locus_tag LOCUS_01250 12680 12195 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024155.1 protein_id gnl|my_center|LOCUS_01250 14337 13870 gene locus_tag LOCUS_01260 14337 13870 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065945.1 protein_id gnl|my_center|LOCUS_01260 14522 14337 gene locus_tag LOCUS_01270 14522 14337 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024153.1 protein_id gnl|my_center|LOCUS_01270 15662 14556 gene locus_tag LOCUS_01280 gene ftsZ 15662 14556 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024152.1 protein_id gnl|my_center|LOCUS_01280 16842 16324 gene locus_tag LOCUS_01290 16842 16324 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023779.1 protein_id gnl|my_center|LOCUS_01290 17122 18294 gene locus_tag LOCUS_01300 17122 18294 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021469.1 protein_id gnl|my_center|LOCUS_01300 19160 19699 gene locus_tag LOCUS_01310 19160 19699 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021470.1 protein_id gnl|my_center|LOCUS_01310 19828 20349 gene locus_tag LOCUS_01320 19828 20349 CDS product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250954.1 protein_id gnl|my_center|LOCUS_01320 21149 22477 gene locus_tag LOCUS_01330 21149 22477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence007 1034 1567 gene locus_tag LOCUS_01340 1034 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 3318 3818 gene locus_tag LOCUS_01350 3318 3818 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065441.1 protein_id gnl|my_center|LOCUS_01350 3831 4832 gene locus_tag LOCUS_01360 3831 4832 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022537.1 protein_id gnl|my_center|LOCUS_01360 4834 5649 gene locus_tag LOCUS_01370 gene uppS 4834 5649 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990666.1 protein_id gnl|my_center|LOCUS_01370 5800 6018 gene locus_tag LOCUS_01380 gene hypC 5800 6018 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021164.1 protein_id gnl|my_center|LOCUS_01380 6039 7151 gene locus_tag LOCUS_01390 gene hypD 6039 7151 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066181.1 protein_id gnl|my_center|LOCUS_01390 7155 7526 gene locus_tag LOCUS_01400 gene hypA 7155 7526 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021162.1 protein_id gnl|my_center|LOCUS_01400 10022 8970 gene locus_tag LOCUS_01410 10022 8970 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_01410 10198 10719 gene locus_tag LOCUS_01420 10198 10719 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020126.1 protein_id gnl|my_center|LOCUS_01420 11027 10752 gene locus_tag LOCUS_01430 11027 10752 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064806.1 protein_id gnl|my_center|LOCUS_01430 14114 12045 gene locus_tag LOCUS_01440 14114 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 14023 14292 gene locus_tag LOCUS_01450 14023 14292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 16368 15373 gene locus_tag LOCUS_01460 gene trxB 16368 15373 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770716.1 protein_id gnl|my_center|LOCUS_01460 17323 16403 gene locus_tag LOCUS_01470 gene hemC 17323 16403 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020631.1 protein_id gnl|my_center|LOCUS_01470 18637 17324 gene locus_tag LOCUS_01480 gene hemL 18637 17324 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020630.1 protein_id gnl|my_center|LOCUS_01480 19480 19253 gene locus_tag LOCUS_01490 19480 19253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024312.1 protein_id gnl|my_center|LOCUS_01490 20361 19666 gene locus_tag LOCUS_01500 20361 19666 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024313.1 protein_id gnl|my_center|LOCUS_01500 20529 21230 gene locus_tag LOCUS_01510 20529 21230 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024314.1 protein_id gnl|my_center|LOCUS_01510 <21944 21233 gene locus_tag LOCUS_01520 <21944 21233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020999.1:geranylgeranylglycerol-phosphate geranylgeranyltransferase >Feature sequence008 1353 286 gene locus_tag LOCUS_01530 1353 286 CDS product putative sulfate/molybdate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925781.1 protein_id gnl|my_center|LOCUS_01530 1904 1359 gene locus_tag LOCUS_01540 1904 1359 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023634.1 protein_id gnl|my_center|LOCUS_01540 2282 2515 gene locus_tag LOCUS_01550 2282 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 3550 2978 gene locus_tag LOCUS_01560 3550 2978 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022926.1 protein_id gnl|my_center|LOCUS_01560 5103 3547 gene locus_tag LOCUS_01570 gene trpE 5103 3547 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022927.1 protein_id gnl|my_center|LOCUS_01570 5771 5100 gene locus_tag LOCUS_01580 5771 5100 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065580.1 protein_id gnl|my_center|LOCUS_01580 6769 5768 gene locus_tag LOCUS_01590 gene trpD 6769 5768 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022929.1 protein_id gnl|my_center|LOCUS_01590 7297 8775 gene locus_tag LOCUS_01600 7297 8775 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022909.1 protein_id gnl|my_center|LOCUS_01600 9073 9948 gene locus_tag LOCUS_01610 9073 9948 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021408.1 protein_id gnl|my_center|LOCUS_01610 10245 9949 gene locus_tag LOCUS_01620 gene hisE 10245 9949 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_01620 11891 10626 gene locus_tag LOCUS_01630 11891 10626 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589524.1 protein_id gnl|my_center|LOCUS_01630 12631 13431 gene locus_tag LOCUS_01640 12631 13431 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_01640 13443 14789 gene locus_tag LOCUS_01650 13443 14789 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_01650 16333 15092 gene locus_tag LOCUS_01660 gene hacA 16333 15092 CDS product homoaconitase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066440.1 protein_id gnl|my_center|LOCUS_01660 17437 16346 gene locus_tag LOCUS_01670 17437 16346 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024231.1 protein_id gnl|my_center|LOCUS_01670 19155 18466 gene locus_tag LOCUS_01680 19155 18466 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022418.1 protein_id gnl|my_center|LOCUS_01680 20166 19165 gene locus_tag LOCUS_01690 20166 19165 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990585.1 protein_id gnl|my_center|LOCUS_01690 >Feature sequence009 587 147 gene locus_tag LOCUS_01700 587 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 711 580 gene locus_tag LOCUS_01710 711 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 1546 1157 gene locus_tag LOCUS_01720 1546 1157 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_01720 2721 1549 gene locus_tag LOCUS_01730 2721 1549 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_01730 3814 2765 gene locus_tag LOCUS_01740 3814 2765 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023934.1 protein_id gnl|my_center|LOCUS_01740 4539 3811 gene locus_tag LOCUS_01750 4539 3811 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023933.1 protein_id gnl|my_center|LOCUS_01750 4856 5047 gene locus_tag LOCUS_01760 4856 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5049 5243 gene locus_tag LOCUS_01770 5049 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6234 5662 gene locus_tag LOCUS_01780 6234 5662 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392800.1 protein_id gnl|my_center|LOCUS_01780 7135 6602 gene locus_tag LOCUS_01790 gene afpA 7135 6602 CDS product archaeoflavoprotein AfpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870235.1 protein_id gnl|my_center|LOCUS_01790 7330 7166 gene locus_tag LOCUS_01800 7330 7166 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582562.1 protein_id gnl|my_center|LOCUS_01800 7940 7317 gene locus_tag LOCUS_01810 7940 7317 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870236.1 protein_id gnl|my_center|LOCUS_01810 9654 8461 gene locus_tag LOCUS_01820 9654 8461 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496601.1 protein_id gnl|my_center|LOCUS_01820 9922 9641 gene locus_tag LOCUS_01830 9922 9641 CDS product MTH865 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496607.1 protein_id gnl|my_center|LOCUS_01830 10429 10088 gene locus_tag LOCUS_01840 10429 10088 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870247.1 protein_id gnl|my_center|LOCUS_01840 11121 10474 gene locus_tag LOCUS_01850 11121 10474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 12052 11114 gene locus_tag LOCUS_01860 12052 11114 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877167.1 protein_id gnl|my_center|LOCUS_01860 13806 12049 gene locus_tag LOCUS_01870 13806 12049 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877166.1 protein_id gnl|my_center|LOCUS_01870 14069 13818 gene locus_tag LOCUS_01880 14069 13818 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870680.1 protein_id gnl|my_center|LOCUS_01880 15382 14066 gene locus_tag LOCUS_01890 15382 14066 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774548.1 protein_id gnl|my_center|LOCUS_01890 15838 15398 gene locus_tag LOCUS_01900 15838 15398 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020879.1 protein_id gnl|my_center|LOCUS_01900 16943 15840 gene locus_tag LOCUS_01910 16943 15840 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061086.1 protein_id gnl|my_center|LOCUS_01910 18293 18472 gene locus_tag LOCUS_01920 18293 18472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 >Feature sequence010 11 856 gene locus_tag LOCUS_01930 11 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 962 1630 gene locus_tag LOCUS_01940 962 1630 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023038.1 protein_id gnl|my_center|LOCUS_01940 1704 3074 gene locus_tag LOCUS_01950 1704 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4408 3176 gene locus_tag LOCUS_01960 gene glyA 4408 3176 CDS product bifunctional serine hydroxymethyltransferase/L-allo-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023436.1 protein_id gnl|my_center|LOCUS_01960 4506 4691 gene locus_tag LOCUS_01970 4506 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 4837 4688 gene locus_tag LOCUS_01980 4837 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 5581 4934 gene locus_tag LOCUS_01990 5581 4934 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_01990 7004 5607 gene locus_tag LOCUS_02000 7004 5607 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_02000 8772 7006 gene locus_tag LOCUS_02010 8772 7006 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876586.1 protein_id gnl|my_center|LOCUS_02010 9285 8956 gene locus_tag LOCUS_02020 9285 8956 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582970.1 protein_id gnl|my_center|LOCUS_02020 9552 9325 gene locus_tag LOCUS_02030 9552 9325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 10001 9696 gene locus_tag LOCUS_02040 10001 9696 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869714.1 protein_id gnl|my_center|LOCUS_02040 11194 9998 gene locus_tag LOCUS_02050 11194 9998 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 protein_id gnl|my_center|LOCUS_02050 11797 11198 gene locus_tag LOCUS_02060 11797 11198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 12809 11844 gene locus_tag LOCUS_02070 12809 11844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 15012 13021 gene locus_tag LOCUS_02080 15012 13021 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869718.1 protein_id gnl|my_center|LOCUS_02080 15329 15009 gene locus_tag LOCUS_02090 15329 15009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 16469 15924 gene locus_tag LOCUS_02100 16469 15924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 17076 17459 gene locus_tag LOCUS_02110 17076 17459 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023881.1 protein_id gnl|my_center|LOCUS_02110 >Feature sequence011 <1 1194 gene locus_tag LOCUS_02120 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023501.1:phosphoglycerate kinase 1273 1866 gene locus_tag LOCUS_02130 1273 1866 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023500.1 protein_id gnl|my_center|LOCUS_02130 1918 2967 gene locus_tag LOCUS_02140 1918 2967 CDS product eukaryotic peptide chain release factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021302.1 protein_id gnl|my_center|LOCUS_02140 2945 3625 gene locus_tag LOCUS_02150 2945 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6888 4276 gene locus_tag LOCUS_02160 6888 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 7570 7929 gene locus_tag LOCUS_02170 7570 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 8282 8704 gene locus_tag LOCUS_02180 8282 8704 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021290.1 protein_id gnl|my_center|LOCUS_02180 8761 9204 gene locus_tag LOCUS_02190 8761 9204 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731060.1 protein_id gnl|my_center|LOCUS_02190 11161 10295 gene locus_tag LOCUS_02200 11161 10295 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279214.1 protein_id gnl|my_center|LOCUS_02200 11700 13619 gene locus_tag LOCUS_02210 gene uvrC 11700 13619 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963830.1 protein_id gnl|my_center|LOCUS_02210 13889 14566 gene locus_tag LOCUS_02220 13889 14566 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021999.1 protein_id gnl|my_center|LOCUS_02220 14556 15158 gene locus_tag LOCUS_02230 14556 15158 CDS product DUF2119 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082089005.1 protein_id gnl|my_center|LOCUS_02230 15732 15656 gene locus_tag LOCUS_t00040 15732 15656 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 16134 15787 gene locus_tag LOCUS_02240 16134 15787 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589516.1 protein_id gnl|my_center|LOCUS_02240 16563 16345 gene locus_tag LOCUS_02250 16563 16345 CDS product Sm protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021429.1 protein_id gnl|my_center|LOCUS_02250 16979 16608 gene locus_tag LOCUS_02260 16979 16608 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021428.1 protein_id gnl|my_center|LOCUS_02260 >Feature sequence012 841 1575 gene locus_tag LOCUS_02270 841 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1831 2040 gene locus_tag LOCUS_02280 1831 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2984 3190 gene locus_tag LOCUS_02290 2984 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3345 3530 gene locus_tag LOCUS_02300 3345 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 3481 3705 gene locus_tag LOCUS_02310 3481 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4231 4007 gene locus_tag LOCUS_02320 4231 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5601 6164 gene locus_tag LOCUS_02330 5601 6164 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948910.1 protein_id gnl|my_center|LOCUS_02330 7070 8722 gene locus_tag LOCUS_02340 gene thsB 7070 8722 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020145.1 protein_id gnl|my_center|LOCUS_02340 9915 11132 gene locus_tag LOCUS_02350 gene prf1 9915 11132 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020101.1 protein_id gnl|my_center|LOCUS_02350 11136 12866 gene locus_tag LOCUS_02360 gene argS 11136 12866 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064797.1 protein_id gnl|my_center|LOCUS_02360 12903 13418 gene locus_tag LOCUS_02370 12903 13418 CDS product chorismate pyruvate-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024074.1 protein_id gnl|my_center|LOCUS_02370 13560 13856 gene locus_tag LOCUS_02380 13560 13856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 13958 14344 gene locus_tag LOCUS_02390 13958 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 14587 14658 gene locus_tag LOCUS_t00050 14587 14658 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 15061 16020 gene locus_tag LOCUS_02400 15061 16020 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021005.1 protein_id gnl|my_center|LOCUS_02400 16026 16916 gene locus_tag LOCUS_02410 gene cbiB 16026 16916 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877021.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence013 1463 576 gene locus_tag LOCUS_02420 1463 576 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022154.1 protein_id gnl|my_center|LOCUS_02420 2062 2829 gene locus_tag LOCUS_02430 gene larB 2062 2829 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869660.1 protein_id gnl|my_center|LOCUS_02430 2826 3941 gene locus_tag LOCUS_02440 gene purK 2826 3941 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081519.1 protein_id gnl|my_center|LOCUS_02440 4252 4713 gene locus_tag LOCUS_02450 4252 4713 CDS product methanogenesis marker 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066559.1 protein_id gnl|my_center|LOCUS_02450 4710 5939 gene locus_tag LOCUS_02460 4710 5939 CDS product methanogenesis marker 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023889.1 protein_id gnl|my_center|LOCUS_02460 5944 6627 gene locus_tag LOCUS_02470 5944 6627 CDS product methanogenesis marker 17 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023888.1 protein_id gnl|my_center|LOCUS_02470 6628 7551 gene locus_tag LOCUS_02480 6628 7551 CDS product methanogenesis marker 7 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023887.1 protein_id gnl|my_center|LOCUS_02480 8212 7874 gene locus_tag LOCUS_02490 8212 7874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 9486 8209 gene locus_tag LOCUS_02500 9486 8209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 9722 10741 gene locus_tag LOCUS_02510 9722 10741 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064802.1 protein_id gnl|my_center|LOCUS_02510 12221 11196 gene locus_tag LOCUS_02520 gene rtcA 12221 11196 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869517.1 protein_id gnl|my_center|LOCUS_02520 13169 12237 gene locus_tag LOCUS_02530 13169 12237 CDS product EF-Tu/IF-2/RF-3 family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869822.1 protein_id gnl|my_center|LOCUS_02530 15005 15205 gene locus_tag LOCUS_02540 15005 15205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15207 15479 gene locus_tag LOCUS_02550 15207 15479 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870423.1 protein_id gnl|my_center|LOCUS_02550 <16380 15842 gene locus_tag LOCUS_02560 <16380 15842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582681.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase >Feature sequence014 1256 411 gene locus_tag LOCUS_02570 1256 411 CDS product DUF2099 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022219.1 protein_id gnl|my_center|LOCUS_02570 1456 2148 gene locus_tag LOCUS_02580 1456 2148 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020625.1 protein_id gnl|my_center|LOCUS_02580 2189 3418 gene locus_tag LOCUS_02590 gene hemA 2189 3418 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020626.1 protein_id gnl|my_center|LOCUS_02590 4292 3882 gene locus_tag LOCUS_02600 4292 3882 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_02600 6382 4970 gene locus_tag LOCUS_02610 gene purF 6382 4970 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065634.1 protein_id gnl|my_center|LOCUS_02610 6952 6665 gene locus_tag LOCUS_02620 6952 6665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 7283 8629 gene locus_tag LOCUS_02630 gene thiD 7283 8629 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023132.1 protein_id gnl|my_center|LOCUS_02630 11307 9172 gene locus_tag LOCUS_02640 11307 9172 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064996.1 protein_id gnl|my_center|LOCUS_02640 12236 11673 gene locus_tag LOCUS_02650 12236 11673 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023516.1 protein_id gnl|my_center|LOCUS_02650 13750 12317 gene locus_tag LOCUS_02660 13750 12317 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_02660 15168 13762 gene locus_tag LOCUS_02670 gene trkA 15168 13762 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021496.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence015 1685 207 gene locus_tag LOCUS_02680 gene secY 1685 207 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021124.1 protein_id gnl|my_center|LOCUS_02680 2140 1712 gene locus_tag LOCUS_02690 2140 1712 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021123.1 protein_id gnl|my_center|LOCUS_02690 2608 2147 gene locus_tag LOCUS_02700 2608 2147 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021122.1 protein_id gnl|my_center|LOCUS_02700 3289 2612 gene locus_tag LOCUS_02710 3289 2612 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021121.1 protein_id gnl|my_center|LOCUS_02710 3793 3302 gene locus_tag LOCUS_02720 3793 3302 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021120.1 protein_id gnl|my_center|LOCUS_02720 4260 3796 gene locus_tag LOCUS_02730 4260 3796 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021119.1 protein_id gnl|my_center|LOCUS_02730 4697 4266 gene locus_tag LOCUS_02740 4697 4266 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066173.1 protein_id gnl|my_center|LOCUS_02740 5237 4707 gene locus_tag LOCUS_02750 gene rpl6p 5237 4707 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021117.1 protein_id gnl|my_center|LOCUS_02750 5642 5250 gene locus_tag LOCUS_02760 5642 5250 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021116.1 protein_id gnl|my_center|LOCUS_02760 6477 5968 gene locus_tag LOCUS_02770 6477 5968 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021114.1 protein_id gnl|my_center|LOCUS_02770 7195 6479 gene locus_tag LOCUS_02780 7195 6479 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021113.1 protein_id gnl|my_center|LOCUS_02780 7595 7203 gene locus_tag LOCUS_02790 gene rplX 7595 7203 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065039.1 protein_id gnl|my_center|LOCUS_02790 8005 7607 gene locus_tag LOCUS_02800 gene rpl14p 8005 7607 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021111.1 protein_id gnl|my_center|LOCUS_02800 8328 8002 gene locus_tag LOCUS_02810 8328 8002 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021110.1 protein_id gnl|my_center|LOCUS_02810 8775 8470 gene locus_tag LOCUS_02820 8775 8470 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021109.1 protein_id gnl|my_center|LOCUS_02820 9130 8930 gene locus_tag LOCUS_02830 gene rpmC 9130 8930 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021108.1 protein_id gnl|my_center|LOCUS_02830 10052 9135 gene locus_tag LOCUS_02840 10052 9135 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021107.1 protein_id gnl|my_center|LOCUS_02840 10506 10054 gene locus_tag LOCUS_02850 10506 10054 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021106.1 protein_id gnl|my_center|LOCUS_02850 10937 10515 gene locus_tag LOCUS_02860 10937 10515 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021105.1 protein_id gnl|my_center|LOCUS_02860 11661 10948 gene locus_tag LOCUS_02870 11661 10948 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021104.1 protein_id gnl|my_center|LOCUS_02870 11922 11671 gene locus_tag LOCUS_02880 11922 11671 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021103.1 protein_id gnl|my_center|LOCUS_02880 12709 11924 gene locus_tag LOCUS_02890 gene rpl4p 12709 11924 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021102.1 protein_id gnl|my_center|LOCUS_02890 13729 12716 gene locus_tag LOCUS_02900 gene rpl3p 13729 12716 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021101.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence016 2548 1952 gene locus_tag LOCUS_02910 2548 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 2792 5962 gene locus_tag LOCUS_02920 gene ileS 2792 5962 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022402.1 protein_id gnl|my_center|LOCUS_02920 5959 6594 gene locus_tag LOCUS_02930 5959 6594 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022401.1 protein_id gnl|my_center|LOCUS_02930 7235 6975 gene locus_tag LOCUS_02940 7235 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02940 7622 7314 gene locus_tag LOCUS_02950 7622 7314 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_02950 8592 7690 gene locus_tag LOCUS_02960 8592 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9867 8971 gene locus_tag LOCUS_02970 9867 8971 CDS product DUF1743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021976.1 protein_id gnl|my_center|LOCUS_02970 9991 10692 gene locus_tag LOCUS_02980 9991 10692 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021474.1 protein_id gnl|my_center|LOCUS_02980 10689 10967 gene locus_tag LOCUS_02990 10689 10967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976649.1 protein_id gnl|my_center|LOCUS_02990 11035 11622 gene locus_tag LOCUS_03000 11035 11622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03000 11643 11969 gene locus_tag LOCUS_03010 11643 11969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03010 12472 13359 gene locus_tag LOCUS_03020 gene htpX 12472 13359 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022098.1 protein_id gnl|my_center|LOCUS_03020 13359 13925 gene locus_tag LOCUS_03030 13359 13925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022099.1 protein_id gnl|my_center|LOCUS_03030 >Feature sequence017 1121 198 gene locus_tag LOCUS_03040 1121 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 2303 1167 gene locus_tag LOCUS_03050 gene mtaA 2303 1167 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_03050 3768 2662 gene locus_tag LOCUS_03060 gene mtaA 3768 2662 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021625.1 protein_id gnl|my_center|LOCUS_03060 4955 6223 gene locus_tag LOCUS_03070 4955 6223 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024009.1 protein_id gnl|my_center|LOCUS_03070 6574 7023 gene locus_tag LOCUS_03080 6574 7023 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024008.1 protein_id gnl|my_center|LOCUS_03080 7072 7419 gene locus_tag LOCUS_03090 7072 7419 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024007.1 protein_id gnl|my_center|LOCUS_03090 7416 8027 gene locus_tag LOCUS_03100 7416 8027 CDS product alpha hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024006.1 protein_id gnl|my_center|LOCUS_03100 8330 8602 gene locus_tag LOCUS_03110 8330 8602 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024004.1 protein_id gnl|my_center|LOCUS_03110 8629 9309 gene locus_tag LOCUS_03120 8629 9309 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024003.1 protein_id gnl|my_center|LOCUS_03120 9350 9532 gene locus_tag LOCUS_03130 gene rpl18a 9350 9532 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024002.1 protein_id gnl|my_center|LOCUS_03130 9539 9949 gene locus_tag LOCUS_03140 9539 9949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 10037 10351 gene locus_tag LOCUS_03150 10037 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 10387 10626 gene locus_tag LOCUS_03160 10387 10626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 12785 11184 gene locus_tag LOCUS_03170 12785 11184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 13411 12881 gene locus_tag LOCUS_03180 13411 12881 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence018 2984 858 gene locus_tag LOCUS_03190 2984 858 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_03190 5509 4283 gene locus_tag LOCUS_03200 5509 4283 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876774.1 protein_id gnl|my_center|LOCUS_03200 6225 5479 gene locus_tag LOCUS_03210 gene sufC 6225 5479 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876773.1 protein_id gnl|my_center|LOCUS_03210 7551 6721 gene locus_tag LOCUS_03220 7551 6721 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023442.1 protein_id gnl|my_center|LOCUS_03220 7984 8625 gene locus_tag LOCUS_03230 7984 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 11103 8938 gene locus_tag LOCUS_03240 11103 8938 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_03240 <13612 12201 gene locus_tag LOCUS_03250 <13612 12201 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065792.1:oligosaccharyl transferase, archaeosortase A system-associated >Feature sequence019 283 211 gene locus_tag LOCUS_t00060 283 211 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 351 1100 gene locus_tag LOCUS_03260 351 1100 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021299.1 protein_id gnl|my_center|LOCUS_03260 1084 1266 gene locus_tag LOCUS_03270 1084 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1313 1549 gene locus_tag LOCUS_03280 1313 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1748 2146 gene locus_tag LOCUS_03290 1748 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2293 3240 gene locus_tag LOCUS_03300 2293 3240 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690162.1 protein_id gnl|my_center|LOCUS_03300 3403 3741 gene locus_tag LOCUS_03310 3403 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020635.1 protein_id gnl|my_center|LOCUS_03310 3731 5434 gene locus_tag LOCUS_03320 3731 5434 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064918.1 protein_id gnl|my_center|LOCUS_03320 6588 5659 gene locus_tag LOCUS_03330 6588 5659 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257655.1 protein_id gnl|my_center|LOCUS_03330 6736 6563 gene locus_tag LOCUS_03340 6736 6563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 7039 8235 gene locus_tag LOCUS_03350 7039 8235 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020274.1 protein_id gnl|my_center|LOCUS_03350 8957 8625 gene locus_tag LOCUS_03360 8957 8625 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023991.1 protein_id gnl|my_center|LOCUS_03360 9871 8984 gene locus_tag LOCUS_03370 gene proC 9871 8984 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_03370 10423 9944 gene locus_tag LOCUS_03380 10423 9944 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_03380 11300 11704 gene locus_tag LOCUS_03390 11300 11704 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496415.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence020 1678 3801 gene locus_tag LOCUS_03400 1678 3801 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020726.1 protein_id gnl|my_center|LOCUS_03400 3940 4725 gene locus_tag LOCUS_03410 3940 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 4722 5639 gene locus_tag LOCUS_03420 4722 5639 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020723.1 protein_id gnl|my_center|LOCUS_03420 6112 6963 gene locus_tag LOCUS_03430 6112 6963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 8236 7097 gene locus_tag LOCUS_03440 gene dnaJ 8236 7097 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021493.1 protein_id gnl|my_center|LOCUS_03440 10858 9005 gene locus_tag LOCUS_03450 gene dnaK 10858 9005 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021492.1 protein_id gnl|my_center|LOCUS_03450 11255 11106 gene locus_tag LOCUS_03460 11255 11106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 11861 11277 gene locus_tag LOCUS_03470 11861 11277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 12377 12210 gene locus_tag LOCUS_03480 12377 12210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 >Feature sequence021 1169 126 gene locus_tag LOCUS_03490 gene hypE 1169 126 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021160.1 protein_id gnl|my_center|LOCUS_03490 1825 1175 gene locus_tag LOCUS_03500 gene hypB 1825 1175 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860109.1 protein_id gnl|my_center|LOCUS_03500 2062 2280 gene locus_tag LOCUS_03510 2062 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3806 2829 gene locus_tag LOCUS_03520 3806 2829 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021488.1 protein_id gnl|my_center|LOCUS_03520 4774 3803 gene locus_tag LOCUS_03530 4774 3803 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021489.1 protein_id gnl|my_center|LOCUS_03530 4923 4771 gene locus_tag LOCUS_03540 4923 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 4954 5526 gene locus_tag LOCUS_03550 4954 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066058.1 protein_id gnl|my_center|LOCUS_03550 7020 5623 gene locus_tag LOCUS_03560 7020 5623 CDS product lactaldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870928.1 protein_id gnl|my_center|LOCUS_03560 7887 7144 gene locus_tag LOCUS_03570 7887 7144 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878060.1 protein_id gnl|my_center|LOCUS_03570 8445 8717 gene locus_tag LOCUS_03580 8445 8717 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066211.1 protein_id gnl|my_center|LOCUS_03580 9139 9492 gene locus_tag LOCUS_03590 9139 9492 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021390.1 protein_id gnl|my_center|LOCUS_03590 9496 10383 gene locus_tag LOCUS_03600 9496 10383 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021391.1 protein_id gnl|my_center|LOCUS_03600 10397 11248 gene locus_tag LOCUS_03610 gene hisG 10397 11248 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_03610 11245 11973 gene locus_tag LOCUS_03620 gene hisA 11245 11973 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020276.1 protein_id gnl|my_center|LOCUS_03620 11975 12550 gene locus_tag LOCUS_03630 gene hisB 11975 12550 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020277.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence022 <1 6174 gene locus_tag LOCUS_03640 <1 6174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790938.1:S8 family peptidase 6330 8438 gene locus_tag LOCUS_03650 6330 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9686 10459 gene locus_tag LOCUS_03660 9686 10459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence023 1275 2591 gene locus_tag LOCUS_03670 1275 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 3088 2822 gene locus_tag LOCUS_03680 3088 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 4466 3990 gene locus_tag LOCUS_03690 4466 3990 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020642.1 protein_id gnl|my_center|LOCUS_03690 6741 5164 gene locus_tag LOCUS_03700 gene serA 6741 5164 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020641.1 protein_id gnl|my_center|LOCUS_03700 8138 7599 gene locus_tag LOCUS_03710 8138 7599 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023689.1 protein_id gnl|my_center|LOCUS_03710 9310 8153 gene locus_tag LOCUS_03720 9310 8153 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023078.1 protein_id gnl|my_center|LOCUS_03720 9807 9343 gene locus_tag LOCUS_03730 9807 9343 CDS product tRNA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065620.1 protein_id gnl|my_center|LOCUS_03730 11112 9883 gene locus_tag LOCUS_03740 11112 9883 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949022.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence024 1845 487 gene locus_tag LOCUS_03750 gene acsC 1845 487 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877321.1 protein_id gnl|my_center|LOCUS_03750 3036 1852 gene locus_tag LOCUS_03760 gene cdhD 3036 1852 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061126.1 protein_id gnl|my_center|LOCUS_03760 3872 3108 gene locus_tag LOCUS_03770 3872 3108 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870190.1 protein_id gnl|my_center|LOCUS_03770 4595 4395 gene locus_tag LOCUS_03780 4595 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 6287 4722 gene locus_tag LOCUS_03790 gene cdhC 6287 4722 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877318.1 protein_id gnl|my_center|LOCUS_03790 7150 6608 gene locus_tag LOCUS_03800 gene cdhB 7150 6608 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877317.1 protein_id gnl|my_center|LOCUS_03800 9463 7157 gene locus_tag LOCUS_03810 gene cdhA 9463 7157 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061124.1 protein_id gnl|my_center|LOCUS_03810 10473 11228 gene locus_tag LOCUS_03820 10473 11228 CDS product UDP-galactose-lipid carrier transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000427312.1 protein_id gnl|my_center|LOCUS_03820 11323 11928 gene locus_tag LOCUS_03830 11323 11928 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020764.1 protein_id gnl|my_center|LOCUS_03830 >Feature sequence025 308 1411 gene locus_tag LOCUS_03840 308 1411 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_03840 1423 2364 gene locus_tag LOCUS_03850 1423 2364 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_03850 2351 2929 gene locus_tag LOCUS_03860 2351 2929 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868278.1 protein_id gnl|my_center|LOCUS_03860 2978 4159 gene locus_tag LOCUS_03870 2978 4159 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868281.1 protein_id gnl|my_center|LOCUS_03870 4171 5268 gene locus_tag LOCUS_03880 gene wecB 4171 5268 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_03880 5273 5542 gene locus_tag LOCUS_03890 5273 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 5529 5783 gene locus_tag LOCUS_03900 5529 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6808 7266 gene locus_tag LOCUS_03910 6808 7266 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078799.1 protein_id gnl|my_center|LOCUS_03910 8219 9517 gene locus_tag LOCUS_03920 8219 9517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9530 11407 gene locus_tag LOCUS_03930 9530 11407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11423 11893 gene locus_tag LOCUS_03940 11423 11893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence026 1705 2838 gene locus_tag LOCUS_03950 1705 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3696 4037 gene locus_tag LOCUS_03960 3696 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4085 5464 gene locus_tag LOCUS_03970 4085 5464 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902126.1 protein_id gnl|my_center|LOCUS_03970 6148 6077 gene locus_tag LOCUS_t00070 6148 6077 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6233 6159 gene locus_tag LOCUS_t00080 6233 6159 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6316 6243 gene locus_tag LOCUS_t00090 6316 6243 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 7491 6400 gene locus_tag LOCUS_03980 gene glpX 7491 6400 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021176.1 protein_id gnl|my_center|LOCUS_03980 8188 7607 gene locus_tag LOCUS_03990 8188 7607 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024150.1 protein_id gnl|my_center|LOCUS_03990 9176 8142 gene locus_tag LOCUS_04000 9176 8142 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589523.1 protein_id gnl|my_center|LOCUS_04000 9588 10010 gene locus_tag LOCUS_04010 9588 10010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 10591 11334 gene locus_tag LOCUS_04020 10591 11334 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_04020 >Feature sequence027 538 614 gene locus_tag LOCUS_t00100 538 614 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 733 1017 gene locus_tag LOCUS_04030 733 1017 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023978.1 protein_id gnl|my_center|LOCUS_04030 2440 1628 gene locus_tag LOCUS_04040 2440 1628 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886270.1 protein_id gnl|my_center|LOCUS_04040 4144 2858 gene locus_tag LOCUS_04050 4144 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 5018 5773 gene locus_tag LOCUS_04060 5018 5773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5773 9177 gene locus_tag LOCUS_04070 5773 9177 CDS product tubulin-like doman-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147142.1 protein_id gnl|my_center|LOCUS_04070 9180 10892 gene locus_tag LOCUS_04080 9180 10892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 10898 11764 gene locus_tag LOCUS_04090 10898 11764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence028 339 1694 gene locus_tag LOCUS_04100 339 1694 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_04100 1722 2504 gene locus_tag LOCUS_04110 gene trpA 1722 2504 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022930.1 protein_id gnl|my_center|LOCUS_04110 4571 3090 gene locus_tag LOCUS_04120 4571 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4985 6343 gene locus_tag LOCUS_04130 4985 6343 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_04130 6492 7199 gene locus_tag LOCUS_04140 6492 7199 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_04140 7448 7777 gene locus_tag LOCUS_04150 7448 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 8220 7852 gene locus_tag LOCUS_04160 8220 7852 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020176.1 protein_id gnl|my_center|LOCUS_04160 10445 8217 gene locus_tag LOCUS_04170 10445 8217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 11236 11162 gene locus_tag LOCUS_t00110 11236 11162 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 404 1141 gene locus_tag LOCUS_04180 404 1141 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020169.1 protein_id gnl|my_center|LOCUS_04180 1207 2268 gene locus_tag LOCUS_04190 gene priL 1207 2268 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020168.1 protein_id gnl|my_center|LOCUS_04190 2860 3039 gene locus_tag LOCUS_04200 2860 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 3480 4037 gene locus_tag LOCUS_04210 3480 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4483 4965 gene locus_tag LOCUS_04220 4483 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 6014 6472 gene locus_tag LOCUS_04230 6014 6472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 6859 8580 gene locus_tag LOCUS_04240 6859 8580 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_04240 9161 8577 gene locus_tag LOCUS_04250 9161 8577 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990667.1 protein_id gnl|my_center|LOCUS_04250 10378 9818 gene locus_tag LOCUS_04260 10378 9818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 11043 10903 gene locus_tag LOCUS_04270 11043 10903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence030 135 542 gene locus_tag LOCUS_04280 135 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 875 1063 gene locus_tag LOCUS_04290 875 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3673 1205 gene locus_tag LOCUS_04300 3673 1205 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877365.1 protein_id gnl|my_center|LOCUS_04300 4380 3679 gene locus_tag LOCUS_04310 4380 3679 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064947.1 protein_id gnl|my_center|LOCUS_04310 4456 4947 gene locus_tag LOCUS_04320 4456 4947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5630 4977 gene locus_tag LOCUS_04330 5630 4977 CDS product DUF1048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890838.1 protein_id gnl|my_center|LOCUS_04330 5832 5905 gene locus_tag LOCUS_t00120 5832 5905 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6443 6021 gene locus_tag LOCUS_04340 6443 6021 CDS product DUF1284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879309.1 protein_id gnl|my_center|LOCUS_04340 7010 6717 gene locus_tag LOCUS_04350 7010 6717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 7297 7962 gene locus_tag LOCUS_04360 7297 7962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 8662 7982 gene locus_tag LOCUS_04370 8662 7982 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963651.1 protein_id gnl|my_center|LOCUS_04370 <11842 8664 gene locus_tag LOCUS_04380 <11842 8664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041594898.1:HsdR family type I site-specific deoxyribonuclease >Feature sequence031 1138 191 gene locus_tag LOCUS_04390 1138 191 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_04390 2093 1152 gene locus_tag LOCUS_04400 2093 1152 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_04400 3277 2090 gene locus_tag LOCUS_04410 3277 2090 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868819.1 protein_id gnl|my_center|LOCUS_04410 5753 3384 gene locus_tag LOCUS_04420 gene leuS 5753 3384 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830785.1 protein_id gnl|my_center|LOCUS_04420 6511 5759 gene locus_tag LOCUS_04430 6511 5759 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_04430 8033 6594 gene locus_tag LOCUS_04440 gene metG 8033 6594 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041424295.1 protein_id gnl|my_center|LOCUS_04440 8755 8039 gene locus_tag LOCUS_04450 gene rsmI 8755 8039 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903175.1 protein_id gnl|my_center|LOCUS_04450 9782 8757 gene locus_tag LOCUS_04460 9782 8757 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989612.1 protein_id gnl|my_center|LOCUS_04460 11167 9905 gene locus_tag LOCUS_04470 11167 9905 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245717.1 protein_id gnl|my_center|LOCUS_04470 11596 11273 gene locus_tag LOCUS_04480 11596 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence032 426 172 gene locus_tag LOCUS_04490 426 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1958 522 gene locus_tag LOCUS_04500 1958 522 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064301.1 protein_id gnl|my_center|LOCUS_04500 2524 1955 gene locus_tag LOCUS_04510 gene ruvA 2524 1955 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545070.1 protein_id gnl|my_center|LOCUS_04510 2708 2974 gene locus_tag LOCUS_04520 gene rpsT 2708 2974 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583468.1 protein_id gnl|my_center|LOCUS_04520 3923 3036 gene locus_tag LOCUS_04530 3923 3036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4496 4122 gene locus_tag LOCUS_04540 4496 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 4932 4561 gene locus_tag LOCUS_04550 4932 4561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 6263 5076 gene locus_tag LOCUS_04560 6263 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 7270 6329 gene locus_tag LOCUS_04570 7270 6329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 8409 7378 gene locus_tag LOCUS_04580 gene ruvB 8409 7378 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_04580 9908 8601 gene locus_tag LOCUS_04590 9908 8601 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_04590 11108 9915 gene locus_tag LOCUS_04600 11108 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 11187 11390 gene locus_tag LOCUS_04610 11187 11390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence033 1235 534 gene locus_tag LOCUS_04620 gene aroD 1235 534 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_04620 2383 1235 gene locus_tag LOCUS_04630 2383 1235 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024465.1 protein_id gnl|my_center|LOCUS_04630 3179 2373 gene locus_tag LOCUS_04640 3179 2373 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024464.1 protein_id gnl|my_center|LOCUS_04640 3813 3604 gene locus_tag LOCUS_04650 3813 3604 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545347.1 protein_id gnl|my_center|LOCUS_04650 4063 3800 gene locus_tag LOCUS_04660 4063 3800 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_04660 6284 4590 gene locus_tag LOCUS_04670 6284 4590 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_04670 7128 8309 gene locus_tag LOCUS_04680 7128 8309 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496817.1 protein_id gnl|my_center|LOCUS_04680 8439 8627 gene locus_tag LOCUS_04690 8439 8627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 8682 9212 gene locus_tag LOCUS_04700 8682 9212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 9273 9821 gene locus_tag LOCUS_04710 9273 9821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 10092 10631 gene locus_tag LOCUS_04720 10092 10631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence034 623 1567 gene locus_tag LOCUS_04730 623 1567 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879648.1 protein_id gnl|my_center|LOCUS_04730 1543 1761 gene locus_tag LOCUS_04740 1543 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2870 3721 gene locus_tag LOCUS_04750 gene nifH 2870 3721 CDS product nitrogenase iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061088.1 protein_id gnl|my_center|LOCUS_04750 3730 4047 gene locus_tag LOCUS_04760 3730 4047 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546547.1 protein_id gnl|my_center|LOCUS_04760 4069 4455 gene locus_tag LOCUS_04770 4069 4455 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877171.1 protein_id gnl|my_center|LOCUS_04770 4472 5905 gene locus_tag LOCUS_04780 4472 5905 CDS product nitrogenase component I subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392088.1 protein_id gnl|my_center|LOCUS_04780 5908 7299 gene locus_tag LOCUS_04790 5908 7299 CDS product nitrogenase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877173.1 protein_id gnl|my_center|LOCUS_04790 7307 7636 gene locus_tag LOCUS_04800 7307 7636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8084 9418 gene locus_tag LOCUS_04810 8084 9418 CDS product nitrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877172.1 protein_id gnl|my_center|LOCUS_04810 10301 9579 gene locus_tag LOCUS_04820 10301 9579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 10871 10371 gene locus_tag LOCUS_04830 10871 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 11072 10887 gene locus_tag LOCUS_04840 11072 10887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence035 1203 598 gene locus_tag LOCUS_04850 1203 598 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020976.1 protein_id gnl|my_center|LOCUS_04850 1976 1209 gene locus_tag LOCUS_04860 gene cobS 1976 1209 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020977.1 protein_id gnl|my_center|LOCUS_04860 2546 1998 gene locus_tag LOCUS_04870 gene cobZ 2546 1998 CDS product alpha-ribazole phosphatase CobZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065005.1 protein_id gnl|my_center|LOCUS_04870 4363 5286 gene locus_tag LOCUS_04880 gene mtrE 4363 5286 CDS product tetrahydromethanopterin S-methyltransferase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020334.1 protein_id gnl|my_center|LOCUS_04880 5283 6011 gene locus_tag LOCUS_04890 gene mtrD 5283 6011 CDS product tetrahydromethanopterin S-methyltransferase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020333.1 protein_id gnl|my_center|LOCUS_04890 6013 6807 gene locus_tag LOCUS_04900 gene mtrC 6013 6807 CDS product tetrahydromethanopterin S-methyltransferase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020332.1 protein_id gnl|my_center|LOCUS_04900 6804 7130 gene locus_tag LOCUS_04910 6804 7130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 7133 7858 gene locus_tag LOCUS_04920 gene mtrA 7133 7858 CDS product tetrahydromethanopterin S-methyltransferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020330.1 protein_id gnl|my_center|LOCUS_04920 7860 8084 gene locus_tag LOCUS_04930 gene mtrF 7860 8084 CDS product tetrahydromethanopterin S-methyltransferase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020329.1 protein_id gnl|my_center|LOCUS_04930 8088 8303 gene locus_tag LOCUS_04940 gene mtrG 8088 8303 CDS product tetrahydromethanopterin S-methyltransferase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020328.1 protein_id gnl|my_center|LOCUS_04940 8330 9277 gene locus_tag LOCUS_04950 gene mtrH 8330 9277 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020327.1 protein_id gnl|my_center|LOCUS_04950 10452 9520 gene locus_tag LOCUS_04960 10452 9520 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence036 252 485 gene locus_tag LOCUS_04970 252 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04970 2599 956 gene locus_tag LOCUS_04980 gene ilvD 2599 956 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021805.1 protein_id gnl|my_center|LOCUS_04980 2804 2610 gene locus_tag LOCUS_04990 2804 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3466 2789 gene locus_tag LOCUS_05000 3466 2789 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880733.1 protein_id gnl|my_center|LOCUS_05000 4287 3463 gene locus_tag LOCUS_05010 4287 3463 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880732.1 protein_id gnl|my_center|LOCUS_05010 5432 4287 gene locus_tag LOCUS_05020 5432 4287 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880731.1 protein_id gnl|my_center|LOCUS_05020 6028 5432 gene locus_tag LOCUS_05030 6028 5432 CDS product carbon monoxide dehydrogenase beta subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930681.1 protein_id gnl|my_center|LOCUS_05030 6409 7656 gene locus_tag LOCUS_05040 gene larA 6409 7656 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_05040 7814 9688 gene locus_tag LOCUS_05050 gene gatE 7814 9688 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022814.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence037 394 1698 gene locus_tag LOCUS_05060 394 1698 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065771.1 protein_id gnl|my_center|LOCUS_05060 1970 2233 gene locus_tag LOCUS_05070 1970 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2428 2580 gene locus_tag LOCUS_05080 2428 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 3478 3645 gene locus_tag LOCUS_05090 3478 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3945 5837 gene locus_tag LOCUS_05100 gene glgB 3945 5837 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_05100 5834 8278 gene locus_tag LOCUS_05110 5834 8278 CDS product DUF3536 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393310.1 protein_id gnl|my_center|LOCUS_05110 10188 9142 gene locus_tag LOCUS_05120 10188 9142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence038 309 470 gene locus_tag LOCUS_05130 309 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 919 656 gene locus_tag LOCUS_05140 919 656 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877866.1 protein_id gnl|my_center|LOCUS_05140 3145 947 gene locus_tag LOCUS_05150 3145 947 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903216.1 protein_id gnl|my_center|LOCUS_05150 3734 5311 gene locus_tag LOCUS_05160 3734 5311 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_05160 5345 6412 gene locus_tag LOCUS_05170 5345 6412 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064232.1 protein_id gnl|my_center|LOCUS_05170 6424 7986 gene locus_tag LOCUS_05180 6424 7986 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_05180 8034 9599 gene locus_tag LOCUS_05190 8034 9599 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_05190 9648 10121 gene locus_tag LOCUS_05200 9648 10121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 >Feature sequence039 355 1926 gene locus_tag LOCUS_05210 355 1926 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_05210 1929 2954 gene locus_tag LOCUS_05220 1929 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 2954 3850 gene locus_tag LOCUS_05230 2954 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 5323 3863 gene locus_tag LOCUS_05240 gene ppcA 5323 3863 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_05240 5726 5457 gene locus_tag LOCUS_05250 gene trxA 5726 5457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065637.1 protein_id gnl|my_center|LOCUS_05250 7208 6393 gene locus_tag LOCUS_05260 7208 6393 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034581407.1 protein_id gnl|my_center|LOCUS_05260 7622 8155 gene locus_tag LOCUS_05270 7622 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 8152 9897 gene locus_tag LOCUS_05280 8152 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence040 3419 150 gene locus_tag LOCUS_05290 3419 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 4222 3416 gene locus_tag LOCUS_05300 4222 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6120 4219 gene locus_tag LOCUS_05310 6120 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 9401 6123 gene locus_tag LOCUS_05320 9401 6123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence041 107 322 gene locus_tag LOCUS_05330 107 322 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065141.1 protein_id gnl|my_center|LOCUS_05330 330 518 gene locus_tag LOCUS_05340 330 518 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021537.1 protein_id gnl|my_center|LOCUS_05340 544 993 gene locus_tag LOCUS_05350 gene ndk 544 993 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065142.1 protein_id gnl|my_center|LOCUS_05350 1093 2874 gene locus_tag LOCUS_05360 gene infB 1093 2874 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065143.1 protein_id gnl|my_center|LOCUS_05360 2931 3338 gene locus_tag LOCUS_05370 2931 3338 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021540.1 protein_id gnl|my_center|LOCUS_05370 4322 3825 gene locus_tag LOCUS_05380 4322 3825 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870057.1 protein_id gnl|my_center|LOCUS_05380 5029 4640 gene locus_tag LOCUS_05390 5029 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 6067 5042 gene locus_tag LOCUS_05400 6067 5042 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_05400 7316 6054 gene locus_tag LOCUS_05410 7316 6054 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251041.1 protein_id gnl|my_center|LOCUS_05410 7861 7313 gene locus_tag LOCUS_05420 7861 7313 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867843.1 protein_id gnl|my_center|LOCUS_05420 8373 7858 gene locus_tag LOCUS_05430 8373 7858 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 protein_id gnl|my_center|LOCUS_05430 8766 8374 gene locus_tag LOCUS_05440 8766 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10225 8744 gene locus_tag LOCUS_05450 10225 8744 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence042 1921 989 gene locus_tag LOCUS_05460 gene mtrH 1921 989 CDS product tetrahydromethanopterin S-methyltransferase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021807.1 protein_id gnl|my_center|LOCUS_05460 2352 2068 gene locus_tag LOCUS_05470 2352 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05470 3378 2608 gene locus_tag LOCUS_05480 3378 2608 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875872.1 protein_id gnl|my_center|LOCUS_05480 4593 3406 gene locus_tag LOCUS_05490 gene hflX 4593 3406 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755955.1 protein_id gnl|my_center|LOCUS_05490 6859 5351 gene locus_tag LOCUS_05500 gene serS 6859 5351 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870589.1 protein_id gnl|my_center|LOCUS_05500 7140 6892 gene locus_tag LOCUS_05510 7140 6892 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023356.1 protein_id gnl|my_center|LOCUS_05510 8468 7137 gene locus_tag LOCUS_05520 8468 7137 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023357.1 protein_id gnl|my_center|LOCUS_05520 9359 8901 gene locus_tag LOCUS_05530 9359 8901 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020987.1 protein_id gnl|my_center|LOCUS_05530 9921 10115 gene locus_tag LOCUS_05540 9921 10115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 >Feature sequence043 503 1858 gene locus_tag LOCUS_05550 gene purB 503 1858 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066555.1 protein_id gnl|my_center|LOCUS_05550 3123 2146 gene locus_tag LOCUS_05560 gene radA 3123 2146 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023460.1 protein_id gnl|my_center|LOCUS_05560 3989 3429 gene locus_tag LOCUS_05570 3989 3429 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021817.1 protein_id gnl|my_center|LOCUS_05570 4982 4275 gene locus_tag LOCUS_05580 4982 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5823 5260 gene locus_tag LOCUS_05590 5823 5260 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065077.1 protein_id gnl|my_center|LOCUS_05590 6453 7367 gene locus_tag LOCUS_05600 gene guaA 6453 7367 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024387.1 protein_id gnl|my_center|LOCUS_05600 7374 8411 gene locus_tag LOCUS_05610 7374 8411 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066004.1 protein_id gnl|my_center|LOCUS_05610 9292 8381 gene locus_tag LOCUS_05620 gene argB 9292 8381 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024391.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence044 4254 2413 gene locus_tag LOCUS_05630 gene pcrA 4254 2413 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002265517.1 protein_id gnl|my_center|LOCUS_05630 5620 4247 gene locus_tag LOCUS_05640 5620 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6019 5864 gene locus_tag LOCUS_05650 6019 5864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 6810 6169 gene locus_tag LOCUS_05660 6810 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 8783 6813 gene locus_tag LOCUS_05670 8783 6813 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_05670 9655 8831 gene locus_tag LOCUS_05680 9655 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence045 965 804 gene locus_tag LOCUS_05690 965 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 4515 1195 gene locus_tag LOCUS_05700 gene carB 4515 1195 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022129.1 protein_id gnl|my_center|LOCUS_05700 5645 4512 gene locus_tag LOCUS_05710 gene carA 5645 4512 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022130.1 protein_id gnl|my_center|LOCUS_05710 6371 6446 gene locus_tag LOCUS_t00130 6371 6446 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6499 6882 gene locus_tag LOCUS_05720 6499 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7511 9298 gene locus_tag LOCUS_05730 7511 9298 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023139.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence046 622 894 gene locus_tag LOCUS_05740 622 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05740 921 1901 gene locus_tag LOCUS_05750 gene hemB 921 1901 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020627.1 protein_id gnl|my_center|LOCUS_05750 2213 2653 gene locus_tag LOCUS_05760 2213 2653 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022659.1 protein_id gnl|my_center|LOCUS_05760 3548 5395 gene locus_tag LOCUS_05770 gene arcS 3548 5395 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024500.1 protein_id gnl|my_center|LOCUS_05770 5981 7048 gene locus_tag LOCUS_05780 5981 7048 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_05780 7358 8779 gene locus_tag LOCUS_05790 7358 8779 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878898.1 protein_id gnl|my_center|LOCUS_05790 8811 9461 gene locus_tag LOCUS_05800 8811 9461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979265.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence047 259 1539 gene locus_tag LOCUS_05810 gene thiC 259 1539 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024209.1 protein_id gnl|my_center|LOCUS_05810 1656 2840 gene locus_tag LOCUS_05820 1656 2840 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022128.1 protein_id gnl|my_center|LOCUS_05820 5018 3273 gene locus_tag LOCUS_05830 5018 3273 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878560.1 protein_id gnl|my_center|LOCUS_05830 5773 5555 gene locus_tag LOCUS_05840 5773 5555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7079 6540 gene locus_tag LOCUS_05850 7079 6540 CDS product molybdenum cofactor biosynthesis protein MoaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064835.1 protein_id gnl|my_center|LOCUS_05850 7144 8262 gene locus_tag LOCUS_05860 7144 8262 CDS product DUF1786 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020242.1 protein_id gnl|my_center|LOCUS_05860 9033 9269 gene locus_tag LOCUS_05870 9033 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence048 356 2902 gene locus_tag LOCUS_05880 356 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 3112 2996 gene locus_tag LOCUS_r00010 3112 2996 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3264 3193 gene locus_tag LOCUS_t00140 3264 3193 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 6359 3447 gene locus_tag LOCUS_r00020 6359 3447 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 6627 6554 gene locus_tag LOCUS_t00150 6627 6554 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8189 6719 gene locus_tag LOCUS_r00030 8189 6719 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence049 1622 915 gene locus_tag LOCUS_05890 1622 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 2403 2681 gene locus_tag LOCUS_05900 2403 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2833 4254 gene locus_tag LOCUS_05910 2833 4254 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_05910 5692 5402 gene locus_tag LOCUS_05920 5692 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6757 5744 gene locus_tag LOCUS_05930 6757 5744 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_05930 8138 7206 gene locus_tag LOCUS_05940 8138 7206 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022166.1 protein_id gnl|my_center|LOCUS_05940 8715 8179 gene locus_tag LOCUS_05950 8715 8179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 <9320 8730 gene locus_tag LOCUS_05960 <9320 8730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392272.1:NAD-dependent 4,6-dehydratase LegB >Feature sequence050 937 161 gene locus_tag LOCUS_05970 937 161 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020652.1 protein_id gnl|my_center|LOCUS_05970 1851 934 gene locus_tag LOCUS_05980 1851 934 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064922.1 protein_id gnl|my_center|LOCUS_05980 2700 1885 gene locus_tag LOCUS_05990 2700 1885 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_05990 3396 2713 gene locus_tag LOCUS_06000 gene rpsB 3396 2713 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020649.1 protein_id gnl|my_center|LOCUS_06000 3587 3414 gene locus_tag LOCUS_06010 3587 3414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3788 3600 gene locus_tag LOCUS_06020 3788 3600 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020647.1 protein_id gnl|my_center|LOCUS_06020 4220 3816 gene locus_tag LOCUS_06030 4220 3816 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020646.1 protein_id gnl|my_center|LOCUS_06030 4651 4220 gene locus_tag LOCUS_06040 4651 4220 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020645.1 protein_id gnl|my_center|LOCUS_06040 5036 4662 gene locus_tag LOCUS_06050 5036 4662 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064921.1 protein_id gnl|my_center|LOCUS_06050 5715 5383 gene locus_tag LOCUS_06060 5715 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 6333 6593 gene locus_tag LOCUS_06070 6333 6593 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_06070 6580 6804 gene locus_tag LOCUS_06080 6580 6804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 7479 7324 gene locus_tag LOCUS_06090 7479 7324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 7903 7499 gene locus_tag LOCUS_06100 7903 7499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 8820 7966 gene locus_tag LOCUS_06110 8820 7966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence051 1423 3111 gene locus_tag LOCUS_06120 1423 3111 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022536.1 protein_id gnl|my_center|LOCUS_06120 3270 4307 gene locus_tag LOCUS_06130 gene asd 3270 4307 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020482.1 protein_id gnl|my_center|LOCUS_06130 4335 5054 gene locus_tag LOCUS_06140 gene pyrH 4335 5054 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020429.1 protein_id gnl|my_center|LOCUS_06140 5366 5548 gene locus_tag LOCUS_06150 5366 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5475 6551 gene locus_tag LOCUS_06160 5475 6551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6792 8534 gene locus_tag LOCUS_06170 gene dnaK 6792 8534 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582444.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence052 404 1621 gene locus_tag LOCUS_06180 gene larC 404 1621 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020481.1 protein_id gnl|my_center|LOCUS_06180 1661 2338 gene locus_tag LOCUS_06190 1661 2338 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_06190 2433 2507 gene locus_tag LOCUS_t00160 2433 2507 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 3150 3689 gene locus_tag LOCUS_06200 3150 3689 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024447.1 protein_id gnl|my_center|LOCUS_06200 3780 4226 gene locus_tag LOCUS_06210 3780 4226 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_06210 4789 5025 gene locus_tag LOCUS_06220 4789 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5022 5201 gene locus_tag LOCUS_06230 5022 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 5757 6230 gene locus_tag LOCUS_06240 5757 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06240 6295 6486 gene locus_tag LOCUS_06250 6295 6486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06250 6548 6970 gene locus_tag LOCUS_06260 6548 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 7184 8677 gene locus_tag LOCUS_06270 7184 8677 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020324.1 protein_id gnl|my_center|LOCUS_06270 8674 9156 gene locus_tag LOCUS_06280 8674 9156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020180.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence053 374 1030 gene locus_tag LOCUS_06290 374 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 1056 1328 gene locus_tag LOCUS_06300 1056 1328 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020766.1 protein_id gnl|my_center|LOCUS_06300 1835 2329 gene locus_tag LOCUS_06310 1835 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2557 2982 gene locus_tag LOCUS_06320 2557 2982 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876102.1 protein_id gnl|my_center|LOCUS_06320 4570 3491 gene locus_tag LOCUS_06330 4570 3491 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496803.1 protein_id gnl|my_center|LOCUS_06330 5362 4580 gene locus_tag LOCUS_06340 5362 4580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496804.1 protein_id gnl|my_center|LOCUS_06340 6877 5363 gene locus_tag LOCUS_06350 6877 5363 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870869.1 protein_id gnl|my_center|LOCUS_06350 8137 7043 gene locus_tag LOCUS_06360 8137 7043 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496805.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence054 1268 1723 gene locus_tag LOCUS_06370 1268 1723 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020220.1 protein_id gnl|my_center|LOCUS_06370 1788 2642 gene locus_tag LOCUS_06380 1788 2642 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023985.1 protein_id gnl|my_center|LOCUS_06380 2644 3339 gene locus_tag LOCUS_06390 2644 3339 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023984.1 protein_id gnl|my_center|LOCUS_06390 3326 4081 gene locus_tag LOCUS_06400 3326 4081 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022780.1 protein_id gnl|my_center|LOCUS_06400 4269 5474 gene locus_tag LOCUS_06410 gene thrC 4269 5474 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_06410 5673 5909 gene locus_tag LOCUS_06420 5673 5909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 6221 5919 gene locus_tag LOCUS_06430 6221 5919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06430 8544 7060 gene locus_tag LOCUS_06440 8544 7060 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065053.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence055 >Feature sequence056 1156 5376 gene locus_tag LOCUS_06450 1156 5376 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094228360.1 protein_id gnl|my_center|LOCUS_06450 5455 5811 gene locus_tag LOCUS_06460 5455 5811 CDS product DUF2149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024510.1 protein_id gnl|my_center|LOCUS_06460 5824 6636 gene locus_tag LOCUS_06470 5824 6636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 7161 7958 gene locus_tag LOCUS_06480 7161 7958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 7958 8587 gene locus_tag LOCUS_06490 7958 8587 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020402.1 protein_id gnl|my_center|LOCUS_06490 >Feature sequence057 352 2745 gene locus_tag LOCUS_06500 352 2745 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_06500 2746 4182 gene locus_tag LOCUS_06510 2746 4182 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939433.1 protein_id gnl|my_center|LOCUS_06510 4179 5531 gene locus_tag LOCUS_06520 4179 5531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5528 7390 gene locus_tag LOCUS_06530 5528 7390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 7403 8461 gene locus_tag LOCUS_06540 7403 8461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 8451 8618 gene locus_tag LOCUS_06550 8451 8618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence058 491 1687 gene locus_tag LOCUS_06560 491 1687 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066527.1 protein_id gnl|my_center|LOCUS_06560 1687 2052 gene locus_tag LOCUS_06570 1687 2052 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023598.1 protein_id gnl|my_center|LOCUS_06570 2589 3161 gene locus_tag LOCUS_06580 2589 3161 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023599.1 protein_id gnl|my_center|LOCUS_06580 3154 3339 gene locus_tag LOCUS_06590 3154 3339 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023600.1 protein_id gnl|my_center|LOCUS_06590 3336 4025 gene locus_tag LOCUS_06600 3336 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 4015 4311 gene locus_tag LOCUS_06610 4015 4311 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023602.1 protein_id gnl|my_center|LOCUS_06610 4317 4472 gene locus_tag LOCUS_06620 4317 4472 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011032551.1 protein_id gnl|my_center|LOCUS_06620 5105 5965 gene locus_tag LOCUS_06630 5105 5965 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928717.1 protein_id gnl|my_center|LOCUS_06630 5983 6333 gene locus_tag LOCUS_06640 5983 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 6495 6890 gene locus_tag LOCUS_06650 6495 6890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6979 8082 gene locus_tag LOCUS_06660 6979 8082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence059 306 22 gene locus_tag LOCUS_06670 306 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 633 2639 gene locus_tag LOCUS_06680 gene uvrB 633 2639 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_06680 2774 2971 gene locus_tag LOCUS_06690 2774 2971 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024348.1 protein_id gnl|my_center|LOCUS_06690 3089 3961 gene locus_tag LOCUS_06700 gene dapA 3089 3961 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024349.1 protein_id gnl|my_center|LOCUS_06700 3961 4752 gene locus_tag LOCUS_06710 gene dapB 3961 4752 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024350.1 protein_id gnl|my_center|LOCUS_06710 5585 6103 gene locus_tag LOCUS_06720 5585 6103 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020241.1 protein_id gnl|my_center|LOCUS_06720 6536 7198 gene locus_tag LOCUS_06730 6536 7198 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020240.1 protein_id gnl|my_center|LOCUS_06730 7585 7274 gene locus_tag LOCUS_06740 7585 7274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7888 7700 gene locus_tag LOCUS_06750 7888 7700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 8138 8449 gene locus_tag LOCUS_06760 8138 8449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence060 253 89 gene locus_tag LOCUS_06770 253 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 1290 445 gene locus_tag LOCUS_06780 1290 445 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024467.1 protein_id gnl|my_center|LOCUS_06780 1859 2404 gene locus_tag LOCUS_06790 1859 2404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2774 2502 gene locus_tag LOCUS_06800 2774 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3278 4150 gene locus_tag LOCUS_06810 3278 4150 CDS product DUF1616 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065996.1 protein_id gnl|my_center|LOCUS_06810 4806 6038 gene locus_tag LOCUS_06820 gene hisS 4806 6038 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020981.1 protein_id gnl|my_center|LOCUS_06820 7003 8325 gene locus_tag LOCUS_06830 gene truD 7003 8325 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065655.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence061 583 1443 gene locus_tag LOCUS_06840 583 1443 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021396.1 protein_id gnl|my_center|LOCUS_06840 1492 1779 gene locus_tag LOCUS_06850 1492 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1866 2090 gene locus_tag LOCUS_06860 1866 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 4067 2877 gene locus_tag LOCUS_06870 4067 2877 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021450.1 protein_id gnl|my_center|LOCUS_06870 4667 4110 gene locus_tag LOCUS_06880 4667 4110 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066220.1 protein_id gnl|my_center|LOCUS_06880 5257 4664 gene locus_tag LOCUS_06890 5257 4664 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021452.1 protein_id gnl|my_center|LOCUS_06890 6747 5419 gene locus_tag LOCUS_06900 6747 5419 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583649.1 protein_id gnl|my_center|LOCUS_06900 7539 6934 gene locus_tag LOCUS_06910 gene engB 7539 6934 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022535.1 protein_id gnl|my_center|LOCUS_06910 8500 7550 gene locus_tag LOCUS_06920 gene twy1 8500 7550 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020099.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence062 2558 978 gene locus_tag LOCUS_06930 gene nadB 2558 978 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_06930 3558 2560 gene locus_tag LOCUS_06940 gene nadA 3558 2560 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_06940 5380 3710 gene locus_tag LOCUS_06950 5380 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 6940 5390 gene locus_tag LOCUS_06960 6940 5390 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034322.1 protein_id gnl|my_center|LOCUS_06960 8086 6947 gene locus_tag LOCUS_06970 8086 6947 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839396.1 protein_id gnl|my_center|LOCUS_06970 <8709 8090 gene locus_tag LOCUS_06980 <8709 8090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868491.1:aspartate racemase >Feature sequence063 3218 303 gene locus_tag LOCUS_06990 gene leuS 3218 303 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021621.1 protein_id gnl|my_center|LOCUS_06990 5839 3515 gene locus_tag LOCUS_07000 5839 3515 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092520565.1 protein_id gnl|my_center|LOCUS_07000 6764 5832 gene locus_tag LOCUS_07010 6764 5832 CDS product DUF1837 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837429.1 protein_id gnl|my_center|LOCUS_07010 7875 6865 gene locus_tag LOCUS_07020 7875 6865 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994644.1 protein_id gnl|my_center|LOCUS_07020 8179 7865 gene locus_tag LOCUS_07030 8179 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence064 455 616 gene locus_tag LOCUS_07040 455 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 666 860 gene locus_tag LOCUS_07050 666 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 872 1102 gene locus_tag LOCUS_07060 872 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 1132 1542 gene locus_tag LOCUS_07070 1132 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1599 1820 gene locus_tag LOCUS_07080 1599 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1814 2080 gene locus_tag LOCUS_07090 1814 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2055 2846 gene locus_tag LOCUS_07100 2055 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3107 3403 gene locus_tag LOCUS_07110 3107 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3387 4766 gene locus_tag LOCUS_07120 3387 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 4763 5440 gene locus_tag LOCUS_07130 4763 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 5491 5739 gene locus_tag LOCUS_07140 5491 5739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 5751 6023 gene locus_tag LOCUS_07150 5751 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 6025 7371 gene locus_tag LOCUS_07160 6025 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 7429 7821 gene locus_tag LOCUS_07170 7429 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence065 1472 927 gene locus_tag LOCUS_07180 1472 927 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023613.1 protein_id gnl|my_center|LOCUS_07180 2055 1474 gene locus_tag LOCUS_07190 2055 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07190 3059 2058 gene locus_tag LOCUS_07200 3059 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07200 3329 3730 gene locus_tag LOCUS_07210 3329 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 3737 5215 gene locus_tag LOCUS_07220 gene malQ 3737 5215 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880435.1 protein_id gnl|my_center|LOCUS_07220 5433 7631 gene locus_tag LOCUS_07230 gene glgP 5433 7631 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_07230 >Feature sequence066 3456 679 gene locus_tag LOCUS_07240 gene alaS 3456 679 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020252.1 protein_id gnl|my_center|LOCUS_07240 4748 3507 gene locus_tag LOCUS_07250 4748 3507 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021498.1 protein_id gnl|my_center|LOCUS_07250 4912 4721 gene locus_tag LOCUS_07260 4912 4721 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065133.1 protein_id gnl|my_center|LOCUS_07260 6504 5347 gene locus_tag LOCUS_07270 6504 5347 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_07270 8034 6718 gene locus_tag LOCUS_07280 8034 6718 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024468.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence067 709 20 gene locus_tag LOCUS_07290 709 20 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964017.1 protein_id gnl|my_center|LOCUS_07290 1911 730 gene locus_tag LOCUS_07300 1911 730 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964016.1 protein_id gnl|my_center|LOCUS_07300 3007 2057 gene locus_tag LOCUS_07310 3007 2057 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962800.1 protein_id gnl|my_center|LOCUS_07310 4125 3067 gene locus_tag LOCUS_07320 gene serC 4125 3067 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962801.1 protein_id gnl|my_center|LOCUS_07320 5511 4507 gene locus_tag LOCUS_07330 5511 4507 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_07330 5796 7724 gene locus_tag LOCUS_07340 gene htpG 5796 7724 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963627.1 protein_id gnl|my_center|LOCUS_07340 <8510 7799 gene locus_tag LOCUS_07350 <8510 7799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000237711.1:M15 family metallopeptidase >Feature sequence068 1772 1428 gene locus_tag LOCUS_07360 1772 1428 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546363.1 protein_id gnl|my_center|LOCUS_07360 2062 1769 gene locus_tag LOCUS_07370 2062 1769 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022117.1 protein_id gnl|my_center|LOCUS_07370 4194 2242 gene locus_tag LOCUS_07380 4194 2242 CDS product magnesium chelatase subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932111.1 protein_id gnl|my_center|LOCUS_07380 5230 4199 gene locus_tag LOCUS_07390 5230 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 6019 5249 gene locus_tag LOCUS_07400 6019 5249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496386.1 protein_id gnl|my_center|LOCUS_07400 7152 6013 gene locus_tag LOCUS_07410 7152 6013 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860150.1 protein_id gnl|my_center|LOCUS_07410 7755 7492 gene locus_tag LOCUS_07420 7755 7492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 8200 7979 gene locus_tag LOCUS_07430 8200 7979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence069 1 246 gene locus_tag LOCUS_07440 1 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 464 282 gene locus_tag LOCUS_07450 464 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1511 861 gene locus_tag LOCUS_07460 gene frhG 1511 861 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876913.1 protein_id gnl|my_center|LOCUS_07460 2674 1511 gene locus_tag LOCUS_07470 gene frhA 2674 1511 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774535.1 protein_id gnl|my_center|LOCUS_07470 3811 4068 gene locus_tag LOCUS_07480 3811 4068 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064801.1 protein_id gnl|my_center|LOCUS_07480 4417 6801 gene locus_tag LOCUS_07490 gene nrdD 4417 6801 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020131.1 protein_id gnl|my_center|LOCUS_07490 6875 7657 gene locus_tag LOCUS_07500 6875 7657 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020130.1 protein_id gnl|my_center|LOCUS_07500 8150 7776 gene locus_tag LOCUS_07510 8150 7776 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence070 <1 992 gene locus_tag LOCUS_07520 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114402.1:type I restriction endonuclease subunit R 1274 3025 gene locus_tag LOCUS_07530 1274 3025 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_07530 3085 5061 gene locus_tag LOCUS_07540 3085 5061 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206614.1 protein_id gnl|my_center|LOCUS_07540 5108 5593 gene locus_tag LOCUS_07550 5108 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5777 8116 gene locus_tag LOCUS_07560 gene nrdJ 5777 8116 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence071 594 3881 gene locus_tag LOCUS_07570 594 3881 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_07570 3898 6540 gene locus_tag LOCUS_07580 3898 6540 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021284.1 protein_id gnl|my_center|LOCUS_07580 6698 7918 gene locus_tag LOCUS_07590 gene rpoA2 6698 7918 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066196.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence072 457 1659 gene locus_tag LOCUS_07600 457 1659 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_07600 1797 3986 gene locus_tag LOCUS_07610 gene metG 1797 3986 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065884.1 protein_id gnl|my_center|LOCUS_07610 5228 4320 gene locus_tag LOCUS_07620 gene moaA 5228 4320 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020164.1 protein_id gnl|my_center|LOCUS_07620 5290 6726 gene locus_tag LOCUS_07630 5290 6726 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence073 1175 888 gene locus_tag LOCUS_07640 1175 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2319 1654 gene locus_tag LOCUS_07650 2319 1654 CDS product TfuA-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020222.1 protein_id gnl|my_center|LOCUS_07650 3541 2321 gene locus_tag LOCUS_07660 3541 2321 CDS product YcaO-related McrA-glycine thioamidation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020223.1 protein_id gnl|my_center|LOCUS_07660 3936 4481 gene locus_tag LOCUS_07670 gene cgi121 3936 4481 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021174.1 protein_id gnl|my_center|LOCUS_07670 5762 4494 gene locus_tag LOCUS_07680 gene eno 5762 4494 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065179.1 protein_id gnl|my_center|LOCUS_07680 6586 6041 gene locus_tag LOCUS_07690 6586 6041 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_07690 6836 6672 gene locus_tag LOCUS_07700 6836 6672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 <8357 7703 gene locus_tag LOCUS_07710 <8357 7703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870133.1:sodium-dependent transporter >Feature sequence074 1873 527 gene locus_tag LOCUS_07720 gene glmM 1873 527 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020299.1 protein_id gnl|my_center|LOCUS_07720 2343 3095 gene locus_tag LOCUS_07730 gene arsM 2343 3095 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023683.1 protein_id gnl|my_center|LOCUS_07730 4348 3494 gene locus_tag LOCUS_07740 4348 3494 CDS product NOP5/NOP56 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020398.1 protein_id gnl|my_center|LOCUS_07740 5353 4394 gene locus_tag LOCUS_07750 5353 4394 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064863.1 protein_id gnl|my_center|LOCUS_07750 7601 5346 gene locus_tag LOCUS_07760 7601 5346 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903824.1 protein_id gnl|my_center|LOCUS_07760 8246 8055 gene locus_tag LOCUS_07770 8246 8055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence075 1076 2062 gene locus_tag LOCUS_07780 1076 2062 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066092.1 protein_id gnl|my_center|LOCUS_07780 2415 4748 gene locus_tag LOCUS_07790 2415 4748 CDS product DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021792.1 protein_id gnl|my_center|LOCUS_07790 5304 5633 gene locus_tag LOCUS_07800 5304 5633 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020942.1 protein_id gnl|my_center|LOCUS_07800 5774 6121 gene locus_tag LOCUS_07810 5774 6121 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064993.1 protein_id gnl|my_center|LOCUS_07810 <8320 6434 gene locus_tag LOCUS_07820 <8320 6434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024425.1:DNA polymerase II large subunit >Feature sequence076 1670 3103 gene locus_tag LOCUS_07830 1670 3103 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065226.1 protein_id gnl|my_center|LOCUS_07830 4676 6163 gene locus_tag LOCUS_07840 4676 6163 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291837.1 protein_id gnl|my_center|LOCUS_07840 6160 6981 gene locus_tag LOCUS_07850 6160 6981 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020194.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence077 >Feature sequence078 1255 590 gene locus_tag LOCUS_07860 1255 590 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060986.1 protein_id gnl|my_center|LOCUS_07860 2827 1664 gene locus_tag LOCUS_07870 gene argJ 2827 1664 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869681.1 protein_id gnl|my_center|LOCUS_07870 4660 2846 gene locus_tag LOCUS_07880 4660 2846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 5202 4780 gene locus_tag LOCUS_07890 5202 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 6769 5195 gene locus_tag LOCUS_07900 gene flaJ 6769 5195 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023022.1 protein_id gnl|my_center|LOCUS_07900 <8295 6797 gene locus_tag LOCUS_07910 <8295 6797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023021.1:type II/IV secretion system ATPase subunit >Feature sequence079 441 250 gene locus_tag LOCUS_07920 441 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 793 1512 gene locus_tag LOCUS_07930 793 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1748 2593 gene locus_tag LOCUS_07940 1748 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2664 3401 gene locus_tag LOCUS_07950 2664 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3432 4709 gene locus_tag LOCUS_07960 3432 4709 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860554.1 protein_id gnl|my_center|LOCUS_07960 4710 5477 gene locus_tag LOCUS_07970 4710 5477 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020568.1 protein_id gnl|my_center|LOCUS_07970 5480 6679 gene locus_tag LOCUS_07980 5480 6679 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020191.1 protein_id gnl|my_center|LOCUS_07980 6897 7946 gene locus_tag LOCUS_07990 6897 7946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence080 462 37 gene locus_tag LOCUS_08000 462 37 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021822.1 protein_id gnl|my_center|LOCUS_08000 636 2138 gene locus_tag LOCUS_08010 636 2138 CDS product L-aspartate semialdehyde sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021823.1 protein_id gnl|my_center|LOCUS_08010 2161 2877 gene locus_tag LOCUS_08020 2161 2877 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021719.1 protein_id gnl|my_center|LOCUS_08020 3105 3782 gene locus_tag LOCUS_08030 3105 3782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921026.1 protein_id gnl|my_center|LOCUS_08030 4814 6124 gene locus_tag LOCUS_08040 4814 6124 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020067.1 protein_id gnl|my_center|LOCUS_08040 6135 6806 gene locus_tag LOCUS_08050 gene radC 6135 6806 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932298.1 protein_id gnl|my_center|LOCUS_08050 7738 6821 gene locus_tag LOCUS_08060 gene rnz 7738 6821 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence081 1726 833 gene locus_tag LOCUS_08070 1726 833 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870112.1 protein_id gnl|my_center|LOCUS_08070 1879 1730 gene locus_tag LOCUS_08080 1879 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3094 2048 gene locus_tag LOCUS_08090 3094 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 5531 3333 gene locus_tag LOCUS_08100 5531 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 7004 5763 gene locus_tag LOCUS_08110 7004 5763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence082 2708 2154 gene locus_tag LOCUS_08120 2708 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 4098 3172 gene locus_tag LOCUS_08130 gene trxB 4098 3172 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_08130 6914 4230 gene locus_tag LOCUS_08140 6914 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 7655 7020 gene locus_tag LOCUS_08150 7655 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence083 3 494 gene locus_tag LOCUS_08160 3 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 885 1052 gene locus_tag LOCUS_08170 885 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 1380 2285 gene locus_tag LOCUS_08180 1380 2285 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941290.1 protein_id gnl|my_center|LOCUS_08180 2677 3762 gene locus_tag LOCUS_08190 2677 3762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3883 4644 gene locus_tag LOCUS_08200 3883 4644 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_08200 4657 5811 gene locus_tag LOCUS_08210 4657 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 6478 5990 gene locus_tag LOCUS_08220 6478 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 6901 6527 gene locus_tag LOCUS_08230 6901 6527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <7963 7273 gene locus_tag LOCUS_08240 <7963 7273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066186.1:GDP-mannose 4,6-dehydratase >Feature sequence084 709 2196 gene locus_tag LOCUS_08250 709 2196 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023773.1 protein_id gnl|my_center|LOCUS_08250 2196 2561 gene locus_tag LOCUS_08260 gene hisI 2196 2561 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020946.1 protein_id gnl|my_center|LOCUS_08260 4088 3081 gene locus_tag LOCUS_08270 4088 3081 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023275.1 protein_id gnl|my_center|LOCUS_08270 4520 4329 gene locus_tag LOCUS_08280 4520 4329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 5514 4522 gene locus_tag LOCUS_08290 gene sppA 5514 4522 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065885.1 protein_id gnl|my_center|LOCUS_08290 6597 5806 gene locus_tag LOCUS_08300 6597 5806 CDS product C15orf41 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065051.1 protein_id gnl|my_center|LOCUS_08300 7317 6637 gene locus_tag LOCUS_08310 7317 6637 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence085 380 532 gene locus_tag LOCUS_08320 380 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08320 529 669 gene locus_tag LOCUS_08330 529 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 940 1743 gene locus_tag LOCUS_08340 940 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 2039 3166 gene locus_tag LOCUS_08350 2039 3166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 3207 3512 gene locus_tag LOCUS_08360 3207 3512 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877119.1 protein_id gnl|my_center|LOCUS_08360 5471 3516 gene locus_tag LOCUS_08370 gene acs 5471 3516 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319494.1 protein_id gnl|my_center|LOCUS_08370 6009 5482 gene locus_tag LOCUS_08380 6009 5482 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021476.1 protein_id gnl|my_center|LOCUS_08380 7543 6083 gene locus_tag LOCUS_08390 7543 6083 CDS product DUF3360 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457552.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence086 594 680 gene locus_tag LOCUS_t00170 594 680 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 896 741 gene locus_tag LOCUS_08400 896 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 1187 1774 gene locus_tag LOCUS_08410 1187 1774 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020569.1 protein_id gnl|my_center|LOCUS_08410 2826 1882 gene locus_tag LOCUS_08420 2826 1882 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020859.1 protein_id gnl|my_center|LOCUS_08420 3786 3028 gene locus_tag LOCUS_08430 3786 3028 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_08430 4070 3822 gene locus_tag LOCUS_08440 4070 3822 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020862.1 protein_id gnl|my_center|LOCUS_08440 5073 4150 gene locus_tag LOCUS_08450 gene mdh 5073 4150 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020863.1 protein_id gnl|my_center|LOCUS_08450 6197 5079 gene locus_tag LOCUS_08460 gene hisC 6197 5079 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064817.1 protein_id gnl|my_center|LOCUS_08460 7362 6178 gene locus_tag LOCUS_08470 7362 6178 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_08470 >Feature sequence087 907 119 gene locus_tag LOCUS_08480 907 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 3448 3774 gene locus_tag LOCUS_08490 3448 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 5878 4214 gene locus_tag LOCUS_08500 gene atwA 5878 4214 CDS product methyl coenzyme M reductase system, component A2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023893.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence088 <1 530 gene locus_tag LOCUS_08510 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860184.1:flippase 2073 859 gene locus_tag LOCUS_08520 2073 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 2567 2070 gene locus_tag LOCUS_08530 2567 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 4090 2789 gene locus_tag LOCUS_08540 gene rfbH 4090 2789 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_08540 5198 4068 gene locus_tag LOCUS_08550 gene rfbG 5198 4068 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565909.1 protein_id gnl|my_center|LOCUS_08550 6103 5195 gene locus_tag LOCUS_08560 6103 5195 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208595.1 protein_id gnl|my_center|LOCUS_08560 6886 6113 gene locus_tag LOCUS_08570 gene rfbF 6886 6113 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987009.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence089 1208 351 gene locus_tag LOCUS_08580 1208 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 2625 1774 gene locus_tag LOCUS_08590 2625 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 4384 3401 gene locus_tag LOCUS_08600 4384 3401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 6234 5434 gene locus_tag LOCUS_08610 6234 5434 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870482.1 protein_id gnl|my_center|LOCUS_08610 6774 6568 gene locus_tag LOCUS_08620 6774 6568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 7001 6771 gene locus_tag LOCUS_08630 7001 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 7831 7670 gene locus_tag LOCUS_08640 7831 7670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence090 650 216 gene locus_tag LOCUS_08650 650 216 CDS product DUF367 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065425.1 protein_id gnl|my_center|LOCUS_08650 937 1009 gene locus_tag LOCUS_t00180 937 1009 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2021 2362 gene locus_tag LOCUS_08660 2021 2362 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 protein_id gnl|my_center|LOCUS_08660 2401 3507 gene locus_tag LOCUS_08670 2401 3507 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020066.1 protein_id gnl|my_center|LOCUS_08670 3943 4485 gene locus_tag LOCUS_08680 3943 4485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08680 4504 4941 gene locus_tag LOCUS_08690 4504 4941 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066042.1 protein_id gnl|my_center|LOCUS_08690 4951 5724 gene locus_tag LOCUS_08700 4951 5724 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_08700 6602 5835 gene locus_tag LOCUS_08710 gene cbiQ 6602 5835 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496721.1 protein_id gnl|my_center|LOCUS_08710 6901 6602 gene locus_tag LOCUS_08720 6901 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 7575 6898 gene locus_tag LOCUS_08730 7575 6898 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023469.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence091 >Feature sequence092 <1 862 gene locus_tag LOCUS_08740 <1 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024395.1:methanogenesis marker 14 protein 1149 967 gene locus_tag LOCUS_08750 1149 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1391 3211 gene locus_tag LOCUS_08760 1391 3211 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020947.1 protein_id gnl|my_center|LOCUS_08760 3371 3538 gene locus_tag LOCUS_08770 3371 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 5232 4423 gene locus_tag LOCUS_08780 gene dapF 5232 4423 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_08780 7625 5229 gene locus_tag LOCUS_08790 gene hypF 7625 5229 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024049.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence093 2857 332 gene locus_tag LOCUS_08800 2857 332 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257770.1 protein_id gnl|my_center|LOCUS_08800 3573 3088 gene locus_tag LOCUS_08810 gene ruvC 3573 3088 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_08810 4103 3570 gene locus_tag LOCUS_08820 4103 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 5252 4230 gene locus_tag LOCUS_08830 gene ruvB 5252 4230 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723536.1 protein_id gnl|my_center|LOCUS_08830 7188 5509 gene locus_tag LOCUS_08840 gene pilB 7188 5509 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence094 846 256 gene locus_tag LOCUS_08850 gene cas4 846 256 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_08850 1154 864 gene locus_tag LOCUS_08860 gene cas2 1154 864 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846123.1 protein_id gnl|my_center|LOCUS_08860 2139 1171 gene locus_tag LOCUS_08870 gene cas1 2139 1171 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_08870 2845 2171 gene locus_tag LOCUS_08880 2845 2171 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_08880 5457 2860 gene locus_tag LOCUS_08890 5457 2860 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_08890 6224 5457 gene locus_tag LOCUS_08900 gene cas5b 6224 5457 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_08900 7187 6240 gene locus_tag LOCUS_08910 gene cas7b 7187 6240 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence095 <1 1587 gene locus_tag LOCUS_08920 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962492.1:OmpA family protein >Feature sequence096 6 125 gene locus_tag LOCUS_08930 6 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1155 2762 gene locus_tag LOCUS_08940 gene thsB 1155 2762 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024292.1 protein_id gnl|my_center|LOCUS_08940 3384 3890 gene locus_tag LOCUS_08950 3384 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4105 4770 gene locus_tag LOCUS_08960 gene npdG 4105 4770 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279215.1 protein_id gnl|my_center|LOCUS_08960 4877 4947 gene locus_tag LOCUS_t00190 4877 4947 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 5616 5702 gene locus_tag LOCUS_t00200 5616 5702 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5773 6879 gene locus_tag LOCUS_08970 gene aroC 5773 6879 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_08970 7195 6959 gene locus_tag LOCUS_08980 7195 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence097 302 808 gene locus_tag LOCUS_08990 302 808 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065176.1 protein_id gnl|my_center|LOCUS_08990 946 1827 gene locus_tag LOCUS_09000 946 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2288 2115 gene locus_tag LOCUS_09010 2288 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2744 3412 gene locus_tag LOCUS_09020 2744 3412 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435698.1 protein_id gnl|my_center|LOCUS_09020 3831 4205 gene locus_tag LOCUS_09030 3831 4205 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020961.1 protein_id gnl|my_center|LOCUS_09030 4276 4770 gene locus_tag LOCUS_09040 4276 4770 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020962.1 protein_id gnl|my_center|LOCUS_09040 4786 5955 gene locus_tag LOCUS_09050 4786 5955 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020963.1 protein_id gnl|my_center|LOCUS_09050 6420 7097 gene locus_tag LOCUS_09060 gene radB 6420 7097 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860416.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence098 2226 574 gene locus_tag LOCUS_09070 gene pheT 2226 574 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021951.1 protein_id gnl|my_center|LOCUS_09070 2438 2304 gene locus_tag LOCUS_09080 2438 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 4026 4973 gene locus_tag LOCUS_09090 4026 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 5060 6271 gene locus_tag LOCUS_09100 5060 6271 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence099 2682 1036 gene locus_tag LOCUS_09110 2682 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 4758 3076 gene locus_tag LOCUS_09120 4758 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 5583 5347 gene locus_tag LOCUS_09130 5583 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963364.1 protein_id gnl|my_center|LOCUS_09130 6735 5590 gene locus_tag LOCUS_09140 6735 5590 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence100 1394 585 gene locus_tag LOCUS_09150 1394 585 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962288.1 protein_id gnl|my_center|LOCUS_09150 1496 2338 gene locus_tag LOCUS_09160 gene panC 1496 2338 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962287.1 protein_id gnl|my_center|LOCUS_09160 2371 2721 gene locus_tag LOCUS_09170 2371 2721 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962286.1 protein_id gnl|my_center|LOCUS_09170 2725 3696 gene locus_tag LOCUS_09180 2725 3696 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962285.1 protein_id gnl|my_center|LOCUS_09180 3700 4629 gene locus_tag LOCUS_09190 3700 4629 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964431.1 protein_id gnl|my_center|LOCUS_09190 4772 5980 gene locus_tag LOCUS_09200 4772 5980 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962479.1 protein_id gnl|my_center|LOCUS_09200 6422 6000 gene locus_tag LOCUS_09210 6422 6000 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_09210 6673 6422 gene locus_tag LOCUS_09220 6673 6422 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence101 503 1084 gene locus_tag LOCUS_09230 503 1084 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020321.1 protein_id gnl|my_center|LOCUS_09230 1503 2954 gene locus_tag LOCUS_09240 1503 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 4009 3191 gene locus_tag LOCUS_09250 4009 3191 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020996.1 protein_id gnl|my_center|LOCUS_09250 4840 6522 gene locus_tag LOCUS_09260 4840 6522 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021977.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence102 474 992 gene locus_tag LOCUS_09270 474 992 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022953.1 protein_id gnl|my_center|LOCUS_09270 1044 2429 gene locus_tag LOCUS_09280 1044 2429 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020190.1 protein_id gnl|my_center|LOCUS_09280 2606 2382 gene locus_tag LOCUS_09290 2606 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3541 4842 gene locus_tag LOCUS_09300 3541 4842 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774553.1 protein_id gnl|my_center|LOCUS_09300 5944 5048 gene locus_tag LOCUS_09310 gene fhcD 5944 5048 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020069.1 protein_id gnl|my_center|LOCUS_09310 <7084 6514 gene locus_tag LOCUS_09320 <7084 6514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021577.1:pyridoxal 5'-phosphate synthase glutaminase subunit PdxT >Feature sequence103 245 1045 gene locus_tag LOCUS_09330 245 1045 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963194.1 protein_id gnl|my_center|LOCUS_09330 1928 1236 gene locus_tag LOCUS_09340 1928 1236 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226198.1 protein_id gnl|my_center|LOCUS_09340 2080 2733 gene locus_tag LOCUS_09350 gene fsa 2080 2733 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963193.1 protein_id gnl|my_center|LOCUS_09350 2900 3499 gene locus_tag LOCUS_09360 2900 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 5512 3524 gene locus_tag LOCUS_09370 gene uvrB 5512 3524 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963054.1 protein_id gnl|my_center|LOCUS_09370 6570 5734 gene locus_tag LOCUS_09380 6570 5734 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963772.1 protein_id gnl|my_center|LOCUS_09380 7043 6576 gene locus_tag LOCUS_09390 7043 6576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 >Feature sequence104 894 487 gene locus_tag LOCUS_09400 894 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1179 955 gene locus_tag LOCUS_09410 1179 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2678 1554 gene locus_tag LOCUS_09420 2678 1554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_09420 3040 3324 gene locus_tag LOCUS_09430 3040 3324 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964182.1 protein_id gnl|my_center|LOCUS_09430 3326 3907 gene locus_tag LOCUS_09440 3326 3907 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964181.1 protein_id gnl|my_center|LOCUS_09440 4920 3943 gene locus_tag LOCUS_09450 4920 3943 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_09450 5022 5471 gene locus_tag LOCUS_09460 5022 5471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150543285.1 protein_id gnl|my_center|LOCUS_09460 5485 5982 gene locus_tag LOCUS_09470 5485 5982 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence105 <1 1054 gene locus_tag LOCUS_09480 <1 1054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963817.1:3-dehydroquinate synthase 2178 1051 gene locus_tag LOCUS_09490 gene bshA 2178 1051 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962921.1 protein_id gnl|my_center|LOCUS_09490 2402 3061 gene locus_tag LOCUS_09500 2402 3061 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_09500 3101 3913 gene locus_tag LOCUS_09510 3101 3913 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964038.1 protein_id gnl|my_center|LOCUS_09510 4437 3967 gene locus_tag LOCUS_09520 4437 3967 CDS product Dps family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000224703.1 protein_id gnl|my_center|LOCUS_09520 4541 5488 gene locus_tag LOCUS_09530 4541 5488 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_09530 5710 5513 gene locus_tag LOCUS_09540 5710 5513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963849.1 protein_id gnl|my_center|LOCUS_09540 6089 5817 gene locus_tag LOCUS_09550 6089 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 6778 6155 gene locus_tag LOCUS_09560 6778 6155 CDS product chloramphenicol acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387519.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence106 2182 848 gene locus_tag LOCUS_09570 2182 848 CDS product cysteate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066469.1 protein_id gnl|my_center|LOCUS_09570 3527 2877 gene locus_tag LOCUS_09580 3527 2877 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877278.1 protein_id gnl|my_center|LOCUS_09580 4232 3534 gene locus_tag LOCUS_09590 4232 3534 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402640.1 protein_id gnl|my_center|LOCUS_09590 4999 4229 gene locus_tag LOCUS_09600 4999 4229 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877280.1 protein_id gnl|my_center|LOCUS_09600 5484 5347 gene locus_tag LOCUS_09610 5484 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence107 1799 123 gene locus_tag LOCUS_09620 1799 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2725 1796 gene locus_tag LOCUS_09630 2725 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 3816 2890 gene locus_tag LOCUS_09640 3816 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09640 3910 3770 gene locus_tag LOCUS_09650 3910 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 4562 3912 gene locus_tag LOCUS_09660 4562 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 <6757 4559 gene locus_tag LOCUS_09670 <6757 4559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000401853.1:helicase-related protein >Feature sequence108 485 1249 gene locus_tag LOCUS_09680 485 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 3653 2076 gene locus_tag LOCUS_09690 3653 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 4083 4916 gene locus_tag LOCUS_09700 4083 4916 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889182.1 protein_id gnl|my_center|LOCUS_09700 5446 5282 gene locus_tag LOCUS_09710 5446 5282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09710 5577 5428 gene locus_tag LOCUS_09720 5577 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 5906 5604 gene locus_tag LOCUS_09730 5906 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 >Feature sequence109 <6717 244 gene locus_tag LOCUS_09740 <6717 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070065546.1:enhanced entry virulence factor RtxA >Feature sequence110 1189 407 gene locus_tag LOCUS_09750 1189 407 CDS product TdeIII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682206.1 protein_id gnl|my_center|LOCUS_09750 2928 1189 gene locus_tag LOCUS_09760 2928 1189 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929046.1 protein_id gnl|my_center|LOCUS_09760 4507 2930 gene locus_tag LOCUS_09770 4507 2930 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682204.1 protein_id gnl|my_center|LOCUS_09770 5488 4721 gene locus_tag LOCUS_09780 5488 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6484 5501 gene locus_tag LOCUS_09790 6484 5501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 >Feature sequence111 2282 858 gene locus_tag LOCUS_09800 gene gatB 2282 858 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_09800 3675 2284 gene locus_tag LOCUS_09810 gene gatA 3675 2284 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066007.1 protein_id gnl|my_center|LOCUS_09810 3981 3700 gene locus_tag LOCUS_09820 gene gatC 3981 3700 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024398.1 protein_id gnl|my_center|LOCUS_09820 4312 3983 gene locus_tag LOCUS_09830 4312 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 6130 4544 gene locus_tag LOCUS_09840 gene lysS 6130 4544 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066108.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence112 2506 1205 gene locus_tag LOCUS_09850 2506 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5182 2522 gene locus_tag LOCUS_09860 gene aceE 5182 2522 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691347.1 protein_id gnl|my_center|LOCUS_09860 5771 5286 gene locus_tag LOCUS_09870 5771 5286 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_09870 5863 6516 gene locus_tag LOCUS_09880 5863 6516 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence113 184 2007 gene locus_tag LOCUS_09890 184 2007 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_09890 2914 2015 gene locus_tag LOCUS_09900 2914 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 3018 4061 gene locus_tag LOCUS_09910 gene thiL 3018 4061 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_09910 4586 4065 gene locus_tag LOCUS_09920 4586 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 5254 4622 gene locus_tag LOCUS_09930 5254 4622 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478721.1 protein_id gnl|my_center|LOCUS_09930 6035 5259 gene locus_tag LOCUS_09940 6035 5259 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_09940 6086 6619 gene locus_tag LOCUS_09950 6086 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence114 272 1471 gene locus_tag LOCUS_09960 272 1471 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_09960 1471 2532 gene locus_tag LOCUS_09970 1471 2532 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_09970 2526 3302 gene locus_tag LOCUS_09980 2526 3302 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_09980 3370 3930 gene locus_tag LOCUS_09990 3370 3930 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964352.1 protein_id gnl|my_center|LOCUS_09990 3908 4531 gene locus_tag LOCUS_10000 3908 4531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503758.1 protein_id gnl|my_center|LOCUS_10000 4580 4954 gene locus_tag LOCUS_10010 4580 4954 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_10010 4970 5464 gene locus_tag LOCUS_10020 4970 5464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964348.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence115 317 1096 gene locus_tag LOCUS_10030 gene rfbF 317 1096 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937383.1 protein_id gnl|my_center|LOCUS_10030 1093 2178 gene locus_tag LOCUS_10040 gene rfbG 1093 2178 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_10040 2171 3400 gene locus_tag LOCUS_10050 2171 3400 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_10050 3403 3966 gene locus_tag LOCUS_10060 gene rfbC 3403 3966 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_10060 3977 4858 gene locus_tag LOCUS_10070 gene rfbD 3977 4858 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_10070 4870 6054 gene locus_tag LOCUS_10080 4870 6054 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987004.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence116 1057 833 gene locus_tag LOCUS_10090 1057 833 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_10090 1263 1057 gene locus_tag LOCUS_10100 1263 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3364 2036 gene locus_tag LOCUS_10110 3364 2036 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_10110 4725 3361 gene locus_tag LOCUS_10120 4725 3361 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990640.1 protein_id gnl|my_center|LOCUS_10120 <6548 4744 gene locus_tag LOCUS_10130 <6548 4744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023222.1:ATP-dependent protease LonB >Feature sequence117 842 279 gene locus_tag LOCUS_10140 gene efp 842 279 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_10140 1532 864 gene locus_tag LOCUS_10150 1532 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1969 1673 gene locus_tag LOCUS_10160 1969 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2077 3600 gene locus_tag LOCUS_10170 2077 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3629 5080 gene locus_tag LOCUS_10180 3629 5080 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_10180 5133 6323 gene locus_tag LOCUS_10190 5133 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence118 543 1301 gene locus_tag LOCUS_10200 543 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 1704 2666 gene locus_tag LOCUS_10210 1704 2666 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_10210 2667 3683 gene locus_tag LOCUS_10220 2667 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 3826 5532 gene locus_tag LOCUS_10230 3826 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10230 5575 6141 gene locus_tag LOCUS_10240 5575 6141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10240 >Feature sequence119 1678 200 gene locus_tag LOCUS_10250 1678 200 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545971.1 protein_id gnl|my_center|LOCUS_10250 3444 1945 gene locus_tag LOCUS_10260 3444 1945 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_10260 3809 3441 gene locus_tag LOCUS_10270 3809 3441 CDS product cation:proton antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389326.1 protein_id gnl|my_center|LOCUS_10270 4233 3802 gene locus_tag LOCUS_10280 4233 3802 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902378.1 protein_id gnl|my_center|LOCUS_10280 4451 4230 gene locus_tag LOCUS_10290 4451 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10290 4757 4518 gene locus_tag LOCUS_10300 4757 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 5093 4758 gene locus_tag LOCUS_10310 gene mnhG 5093 4758 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958313.1 protein_id gnl|my_center|LOCUS_10310 5272 5090 gene locus_tag LOCUS_10320 5272 5090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 5853 5356 gene locus_tag LOCUS_10330 5853 5356 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence120 3038 339 gene locus_tag LOCUS_10340 3038 339 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970308.1 protein_id gnl|my_center|LOCUS_10340 5194 3038 gene locus_tag LOCUS_10350 5194 3038 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_10350 5823 5347 gene locus_tag LOCUS_10360 5823 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_10360 6306 5896 gene locus_tag LOCUS_10370 6306 5896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence121 742 392 gene locus_tag LOCUS_10380 gene rplS 742 392 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_10380 1561 851 gene locus_tag LOCUS_10390 gene trmD 1561 851 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071568.1 protein_id gnl|my_center|LOCUS_10390 2127 1579 gene locus_tag LOCUS_10400 gene rimM 2127 1579 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 protein_id gnl|my_center|LOCUS_10400 2384 2142 gene locus_tag LOCUS_10410 gene rpsP 2384 2142 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256449.1 protein_id gnl|my_center|LOCUS_10410 3670 2654 gene locus_tag LOCUS_10420 gene ilvC 3670 2654 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614924.1 protein_id gnl|my_center|LOCUS_10420 4231 3740 gene locus_tag LOCUS_10430 gene ilvN 4231 3740 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040280.1 protein_id gnl|my_center|LOCUS_10430 5946 4243 gene locus_tag LOCUS_10440 5946 4243 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_10440 >Feature sequence122 2464 1124 gene locus_tag LOCUS_10450 2464 1124 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020936.1 protein_id gnl|my_center|LOCUS_10450 3486 2653 gene locus_tag LOCUS_10460 3486 2653 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023463.1 protein_id gnl|my_center|LOCUS_10460 3826 3494 gene locus_tag LOCUS_10470 3826 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023462.1 protein_id gnl|my_center|LOCUS_10470 4296 3823 gene locus_tag LOCUS_10480 4296 3823 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023461.1 protein_id gnl|my_center|LOCUS_10480 5282 4530 gene locus_tag LOCUS_10490 5282 4530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10490 5782 5333 gene locus_tag LOCUS_10500 5782 5333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6213 5809 gene locus_tag LOCUS_10510 6213 5809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence123 1353 694 gene locus_tag LOCUS_10520 1353 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2506 1610 gene locus_tag LOCUS_10530 2506 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5087 3702 gene locus_tag LOCUS_10540 5087 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 6071 5199 gene locus_tag LOCUS_10550 6071 5199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence124 66 797 gene locus_tag LOCUS_10560 66 797 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024130.1 protein_id gnl|my_center|LOCUS_10560 835 1623 gene locus_tag LOCUS_10570 835 1623 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021151.1 protein_id gnl|my_center|LOCUS_10570 1669 2571 gene locus_tag LOCUS_10580 1669 2571 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023386.1 protein_id gnl|my_center|LOCUS_10580 2575 3456 gene locus_tag LOCUS_10590 2575 3456 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990759.1 protein_id gnl|my_center|LOCUS_10590 3469 4266 gene locus_tag LOCUS_10600 3469 4266 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_10600 4398 5369 gene locus_tag LOCUS_10610 4398 5369 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence125 1358 306 gene locus_tag LOCUS_10620 1358 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 3392 1587 gene locus_tag LOCUS_10630 gene asnB 3392 1587 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_10630 4512 3394 gene locus_tag LOCUS_10640 4512 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6179 4758 gene locus_tag LOCUS_10650 6179 4758 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence126 966 184 gene locus_tag LOCUS_10660 966 184 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_10660 1359 1192 gene locus_tag LOCUS_10670 1359 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 3312 1417 gene locus_tag LOCUS_10680 gene gyrB 3312 1417 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434229.1 protein_id gnl|my_center|LOCUS_10680 3843 3598 gene locus_tag LOCUS_10690 3843 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 4089 3847 gene locus_tag LOCUS_10700 4089 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4538 4323 gene locus_tag LOCUS_10710 4538 4323 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867396.1 protein_id gnl|my_center|LOCUS_10710 <6315 4635 gene locus_tag LOCUS_10720 <6315 4635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002663481.1:lysine--tRNA ligase >Feature sequence127 1034 462 gene locus_tag LOCUS_10730 1034 462 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024515.1 protein_id gnl|my_center|LOCUS_10730 2309 1383 gene locus_tag LOCUS_10740 2309 1383 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_10740 2769 2329 gene locus_tag LOCUS_10750 2769 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 3383 3574 gene locus_tag LOCUS_10760 3383 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 4252 4446 gene locus_tag LOCUS_10770 4252 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 5221 5146 gene locus_tag LOCUS_t00210 5221 5146 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence128 <1 4818 gene locus_tag LOCUS_10780 <1 4818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011024461.1:DUF2341 domain-containing protein 4956 5222 gene locus_tag LOCUS_10790 4956 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5219 5584 gene locus_tag LOCUS_10800 5219 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence129 1865 2332 gene locus_tag LOCUS_10810 1865 2332 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_10810 2543 4780 gene locus_tag LOCUS_10820 2543 4780 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022481.1 protein_id gnl|my_center|LOCUS_10820 5238 5417 gene locus_tag LOCUS_10830 5238 5417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5775 5404 gene locus_tag LOCUS_10840 5775 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence130 2114 1083 gene locus_tag LOCUS_10850 2114 1083 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020113.1 protein_id gnl|my_center|LOCUS_10850 2941 2426 gene locus_tag LOCUS_10860 2941 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 3417 2989 gene locus_tag LOCUS_10870 3417 2989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3893 5185 gene locus_tag LOCUS_10880 3893 5185 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021506.1 protein_id gnl|my_center|LOCUS_10880 >Feature sequence131 359 1702 gene locus_tag LOCUS_10890 gene murD 359 1702 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_10890 1786 2970 gene locus_tag LOCUS_10900 1786 2970 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_10900 3050 4516 gene locus_tag LOCUS_10910 3050 4516 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_10910 4649 5905 gene locus_tag LOCUS_10920 gene mraY 4649 5905 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence132 779 138 gene locus_tag LOCUS_10930 779 138 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_10930 2225 789 gene locus_tag LOCUS_10940 2225 789 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000799204.1 protein_id gnl|my_center|LOCUS_10940 2576 2325 gene locus_tag LOCUS_10950 2576 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 3152 2583 gene locus_tag LOCUS_10960 3152 2583 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_10960 3989 3240 gene locus_tag LOCUS_10970 3989 3240 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_10970 5996 4083 gene locus_tag LOCUS_10980 5996 4083 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence133 185 270 gene locus_tag LOCUS_t00220 185 270 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 309 2819 gene locus_tag LOCUS_10990 309 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 2822 3862 gene locus_tag LOCUS_11000 2822 3862 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681769.1 protein_id gnl|my_center|LOCUS_11000 3865 5268 gene locus_tag LOCUS_11010 3865 5268 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence134 790 1191 gene locus_tag LOCUS_11020 790 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1194 1844 gene locus_tag LOCUS_11030 1194 1844 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024137.1 protein_id gnl|my_center|LOCUS_11030 2211 1981 gene locus_tag LOCUS_11040 2211 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3622 3098 gene locus_tag LOCUS_11050 3622 3098 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359122.1 protein_id gnl|my_center|LOCUS_11050 4286 3630 gene locus_tag LOCUS_11060 4286 3630 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940758.1 protein_id gnl|my_center|LOCUS_11060 <6073 4587 gene locus_tag LOCUS_11070 <6073 4587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878540.1:chemotaxis protein CheA >Feature sequence135 858 1703 gene locus_tag LOCUS_11080 858 1703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2923 2141 gene locus_tag LOCUS_11090 2923 2141 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024223.1 protein_id gnl|my_center|LOCUS_11090 3899 2934 gene locus_tag LOCUS_11100 3899 2934 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024222.1 protein_id gnl|my_center|LOCUS_11100 4714 3875 gene locus_tag LOCUS_11110 4714 3875 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024221.1 protein_id gnl|my_center|LOCUS_11110 5189 4707 gene locus_tag LOCUS_11120 5189 4707 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024220.1 protein_id gnl|my_center|LOCUS_11120 5095 5283 gene locus_tag LOCUS_11130 5095 5283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 5451 5729 gene locus_tag LOCUS_11140 5451 5729 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022822.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence136 37 513 gene locus_tag LOCUS_11150 37 513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 641 5110 gene locus_tag LOCUS_11160 641 5110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 <6062 5387 gene locus_tag LOCUS_11170 <6062 5387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964372.1:lipid A biosynthesis acyltransferase >Feature sequence137 1 1068 gene locus_tag LOCUS_11180 gene ackA 1 1068 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_11180 1286 1438 gene locus_tag LOCUS_11190 1286 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2010 1465 gene locus_tag LOCUS_11200 gene guaD 2010 1465 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_11200 3117 2062 gene locus_tag LOCUS_11210 3117 2062 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_11210 3882 3145 gene locus_tag LOCUS_11220 3882 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 4893 4051 gene locus_tag LOCUS_11230 4893 4051 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_11230 <6060 4982 gene locus_tag LOCUS_11240 <6060 4982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963229.1:gliding motility-associated ABC transporter substrate-binding protein GldG >Feature sequence138 3376 374 gene locus_tag LOCUS_11250 3376 374 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_11250 4199 3378 gene locus_tag LOCUS_11260 4199 3378 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_11260 5455 4196 gene locus_tag LOCUS_11270 5455 4196 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918507.1 protein_id gnl|my_center|LOCUS_11270 5877 5452 gene locus_tag LOCUS_11280 5877 5452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence139 1118 3805 gene locus_tag LOCUS_11290 1118 3805 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022991.1 protein_id gnl|my_center|LOCUS_11290 4618 4424 gene locus_tag LOCUS_11300 4618 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 4647 4823 gene locus_tag LOCUS_11310 4647 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence140 840 268 gene locus_tag LOCUS_11320 840 268 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024142.1 protein_id gnl|my_center|LOCUS_11320 1339 917 gene locus_tag LOCUS_11330 1339 917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11330 1493 1293 gene locus_tag LOCUS_11340 1493 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11340 1645 4686 gene locus_tag LOCUS_11350 1645 4686 CDS product TaqI-like C-terminal specificity domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962421.1 protein_id gnl|my_center|LOCUS_11350 4683 5735 gene locus_tag LOCUS_11360 4683 5735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 >Feature sequence141 72 1661 gene locus_tag LOCUS_11370 72 1661 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020927.1 protein_id gnl|my_center|LOCUS_11370 1689 2267 gene locus_tag LOCUS_11380 1689 2267 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024475.1 protein_id gnl|my_center|LOCUS_11380 2270 3820 gene locus_tag LOCUS_11390 2270 3820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_11390 3996 5585 gene locus_tag LOCUS_11400 3996 5585 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065068.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence142 3716 192 gene locus_tag LOCUS_11410 gene smc 3716 192 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024214.1 protein_id gnl|my_center|LOCUS_11410 4398 3814 gene locus_tag LOCUS_11420 4398 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 4633 5781 gene locus_tag LOCUS_11430 gene pscS 4633 5781 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020767.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence143 317 1009 gene locus_tag LOCUS_11440 317 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1201 959 gene locus_tag LOCUS_11450 1201 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2032 1235 gene locus_tag LOCUS_11460 2032 1235 CDS product AIM24 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022579.1 protein_id gnl|my_center|LOCUS_11460 4237 2804 gene locus_tag LOCUS_11470 gene proS 4237 2804 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023782.1 protein_id gnl|my_center|LOCUS_11470 4373 5668 gene locus_tag LOCUS_11480 gene thiC 4373 5668 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021793.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence144 2793 1165 gene locus_tag LOCUS_11490 2793 1165 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688773.1 protein_id gnl|my_center|LOCUS_11490 5792 2787 gene locus_tag LOCUS_11500 5792 2787 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025455799.1 protein_id gnl|my_center|LOCUS_11500 >Feature sequence145 712 861 gene locus_tag LOCUS_11510 712 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1257 1475 gene locus_tag LOCUS_11520 1257 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1444 1629 gene locus_tag LOCUS_11530 1444 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 1824 2000 gene locus_tag LOCUS_11540 1824 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 2009 2263 gene locus_tag LOCUS_11550 2009 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 3161 3871 gene locus_tag LOCUS_11560 3161 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 4629 5579 gene locus_tag LOCUS_11570 gene mch 4629 5579 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021714.1 protein_id gnl|my_center|LOCUS_11570 5654 5863 gene locus_tag LOCUS_11580 5654 5863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence146 319 1002 gene locus_tag LOCUS_11590 gene queC 319 1002 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024084.1 protein_id gnl|my_center|LOCUS_11590 1650 3371 gene locus_tag LOCUS_11600 1650 3371 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948014.1 protein_id gnl|my_center|LOCUS_11600 3368 4414 gene locus_tag LOCUS_11610 3368 4414 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023617.1 protein_id gnl|my_center|LOCUS_11610 <5961 5117 gene locus_tag LOCUS_11620 <5961 5117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023231.1:sulfopyruvate decarboxylase subunit beta >Feature sequence147 1780 26 gene locus_tag LOCUS_11630 1780 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 2534 1770 gene locus_tag LOCUS_11640 2534 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 3031 2546 gene locus_tag LOCUS_11650 3031 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3273 3100 gene locus_tag LOCUS_11660 3273 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3723 3556 gene locus_tag LOCUS_11670 3723 3556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 4197 3796 gene locus_tag LOCUS_11680 4197 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 4435 4250 gene locus_tag LOCUS_11690 4435 4250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 4718 4437 gene locus_tag LOCUS_11700 4718 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence148 789 1031 gene locus_tag LOCUS_11710 789 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1071 1364 gene locus_tag LOCUS_11720 1071 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2189 2016 gene locus_tag LOCUS_11730 2189 2016 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_11730 2945 3583 gene locus_tag LOCUS_11740 2945 3583 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020542.1 protein_id gnl|my_center|LOCUS_11740 5064 4012 gene locus_tag LOCUS_11750 5064 4012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence149 356 1414 gene locus_tag LOCUS_11760 356 1414 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973815.1 protein_id gnl|my_center|LOCUS_11760 1740 2759 gene locus_tag LOCUS_11770 1740 2759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_11770 2812 3204 gene locus_tag LOCUS_11780 2812 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3279 4070 gene locus_tag LOCUS_11790 3279 4070 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948970.1 protein_id gnl|my_center|LOCUS_11790 4067 4876 gene locus_tag LOCUS_11800 4067 4876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193907.1 protein_id gnl|my_center|LOCUS_11800 4873 5454 gene locus_tag LOCUS_11810 4873 5454 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869613.1 protein_id gnl|my_center|LOCUS_11810 5480 5680 gene locus_tag LOCUS_11820 5480 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence150 618 496 gene locus_tag LOCUS_11830 618 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 1965 943 gene locus_tag LOCUS_11840 gene purM 1965 943 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066059.1 protein_id gnl|my_center|LOCUS_11840 2827 2198 gene locus_tag LOCUS_11850 2827 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11850 3226 2882 gene locus_tag LOCUS_11860 3226 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11860 3531 3376 gene locus_tag LOCUS_11870 3531 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 3942 3643 gene locus_tag LOCUS_11880 3942 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 4665 4060 gene locus_tag LOCUS_11890 gene pyrE 4665 4060 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023240.1 protein_id gnl|my_center|LOCUS_11890 5424 4924 gene locus_tag LOCUS_11900 5424 4924 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023239.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence151 351 1007 gene locus_tag LOCUS_11910 351 1007 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_11910 1439 1206 gene locus_tag LOCUS_11920 1439 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022618.1 protein_id gnl|my_center|LOCUS_11920 1766 1542 gene locus_tag LOCUS_11930 1766 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 3831 1849 gene locus_tag LOCUS_11940 gene rqcH 3831 1849 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020698.1 protein_id gnl|my_center|LOCUS_11940 4527 3853 gene locus_tag LOCUS_11950 4527 3853 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020593.1 protein_id gnl|my_center|LOCUS_11950 5132 4509 gene locus_tag LOCUS_11960 5132 4509 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020594.1 protein_id gnl|my_center|LOCUS_11960 5223 5435 gene locus_tag LOCUS_11970 5223 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence152 269 3652 gene locus_tag LOCUS_11980 269 3652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 5232 3973 gene locus_tag LOCUS_11990 5232 3973 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence153 759 127 gene locus_tag LOCUS_12000 759 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 1939 770 gene locus_tag LOCUS_12010 gene pseC 1939 770 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_12010 2344 1940 gene locus_tag LOCUS_12020 2344 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 3315 2341 gene locus_tag LOCUS_12030 gene pseB 3315 2341 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_12030 4972 3317 gene locus_tag LOCUS_12040 4972 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 5435 5088 gene locus_tag LOCUS_12050 5435 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence154 904 2904 gene locus_tag LOCUS_12060 904 2904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3947 4597 gene locus_tag LOCUS_12070 3947 4597 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence155 462 1646 gene locus_tag LOCUS_12080 462 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1680 2690 gene locus_tag LOCUS_12090 1680 2690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3458 3895 gene locus_tag LOCUS_12100 3458 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3989 5125 gene locus_tag LOCUS_12110 3989 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence156 1093 356 gene locus_tag LOCUS_12120 1093 356 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064805.1 protein_id gnl|my_center|LOCUS_12120 2752 1142 gene locus_tag LOCUS_12130 gene sepS 2752 1142 CDS product O-phosphoserine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020149.1 protein_id gnl|my_center|LOCUS_12130 5096 3708 gene locus_tag LOCUS_12140 5096 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 >Feature sequence157 <5670 2450 gene locus_tag LOCUS_12150 <5670 2450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204874017.1:helicase-related protein >Feature sequence158 1978 581 gene locus_tag LOCUS_12160 1978 581 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560515.1 protein_id gnl|my_center|LOCUS_12160 2520 5039 gene locus_tag LOCUS_12170 2520 5039 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021427.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence159 638 1468 gene locus_tag LOCUS_12180 638 1468 CDS product molybdopterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065273.1 protein_id gnl|my_center|LOCUS_12180 1492 1821 gene locus_tag LOCUS_12190 1492 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1823 2515 gene locus_tag LOCUS_12200 gene purQ 1823 2515 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021958.1 protein_id gnl|my_center|LOCUS_12200 2519 3805 gene locus_tag LOCUS_12210 2519 3805 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_12210 3863 4837 gene locus_tag LOCUS_12220 3863 4837 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876118.1 protein_id gnl|my_center|LOCUS_12220 4838 5518 gene locus_tag LOCUS_12230 4838 5518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060828.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence160 862 647 gene locus_tag LOCUS_12240 862 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12240 >Feature sequence161 <1 524 gene locus_tag LOCUS_12250 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496851.1:ABC transporter permease 610 1833 gene locus_tag LOCUS_12260 610 1833 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_12260 1814 2599 gene locus_tag LOCUS_12270 1814 2599 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869449.1 protein_id gnl|my_center|LOCUS_12270 3276 2926 gene locus_tag LOCUS_12280 3276 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 4007 3291 gene locus_tag LOCUS_12290 4007 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 4053 4631 gene locus_tag LOCUS_12300 gene thpR 4053 4631 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence162 2719 1769 gene locus_tag LOCUS_12310 2719 1769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118889.1 protein_id gnl|my_center|LOCUS_12310 3553 3332 gene locus_tag LOCUS_12320 3553 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3897 3643 gene locus_tag LOCUS_12330 3897 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 5511 4609 gene locus_tag LOCUS_12340 5511 4609 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence163 2696 543 gene locus_tag LOCUS_12350 gene purL 2696 543 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023948.1 protein_id gnl|my_center|LOCUS_12350 3134 2778 gene locus_tag LOCUS_12360 3134 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 3539 4150 gene locus_tag LOCUS_12370 3539 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4198 5310 gene locus_tag LOCUS_12380 4198 5310 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582516.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence164 1121 267 gene locus_tag LOCUS_12390 1121 267 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_12390 1596 1123 gene locus_tag LOCUS_12400 gene moaC 1596 1123 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066185.1 protein_id gnl|my_center|LOCUS_12400 3087 1624 gene locus_tag LOCUS_12410 3087 1624 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021194.1 protein_id gnl|my_center|LOCUS_12410 <5486 3827 gene locus_tag LOCUS_12420 <5486 3827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020870.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 >Feature sequence165 3974 696 gene locus_tag LOCUS_12430 3974 696 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021188.1 protein_id gnl|my_center|LOCUS_12430 5209 3971 gene locus_tag LOCUS_12440 5209 3971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence166 118 1293 gene locus_tag LOCUS_12450 gene ftsY 118 1293 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024000.1 protein_id gnl|my_center|LOCUS_12450 2168 2665 gene locus_tag LOCUS_12460 2168 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2865 3251 gene locus_tag LOCUS_12470 2865 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 3367 4164 gene locus_tag LOCUS_12480 gene ribB 3367 4164 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020597.1 protein_id gnl|my_center|LOCUS_12480 4219 5082 gene locus_tag LOCUS_12490 4219 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence167 1773 2813 gene locus_tag LOCUS_12500 1773 2813 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 protein_id gnl|my_center|LOCUS_12500 2966 4090 gene locus_tag LOCUS_12510 2966 4090 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392195.1 protein_id gnl|my_center|LOCUS_12510 4090 5250 gene locus_tag LOCUS_12520 4090 5250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence168 3008 3640 gene locus_tag LOCUS_12530 gene hxlB 3008 3640 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065105.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence169 1086 853 gene locus_tag LOCUS_12540 1086 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1702 2478 gene locus_tag LOCUS_12550 1702 2478 CDS product type II CAAX endopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065997.1 protein_id gnl|my_center|LOCUS_12550 2731 2483 gene locus_tag LOCUS_12560 2731 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 3856 3203 gene locus_tag LOCUS_12570 3856 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 4010 4210 gene locus_tag LOCUS_12580 4010 4210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 4511 4696 gene locus_tag LOCUS_12590 4511 4696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 5423 5298 gene locus_tag LOCUS_12600 5423 5298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence170 <1 1559 gene locus_tag LOCUS_12610 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582997.1:TIGR02556 family CRISPR-associated protein 1552 2526 gene locus_tag LOCUS_12620 gene cas7b 1552 2526 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_12620 2537 3289 gene locus_tag LOCUS_12630 gene cas5b 2537 3289 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence171 513 2354 gene locus_tag LOCUS_12640 513 2354 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970307.1 protein_id gnl|my_center|LOCUS_12640 2357 3190 gene locus_tag LOCUS_12650 2357 3190 CDS product BRO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962647.1 protein_id gnl|my_center|LOCUS_12650 3190 5292 gene locus_tag LOCUS_12660 3190 5292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence172 168 317 gene locus_tag LOCUS_12670 168 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 389 649 gene locus_tag LOCUS_12680 389 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 957 706 gene locus_tag LOCUS_12690 957 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 923 1228 gene locus_tag LOCUS_12700 923 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1232 2773 gene locus_tag LOCUS_12710 1232 2773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2770 3417 gene locus_tag LOCUS_12720 2770 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3417 3641 gene locus_tag LOCUS_12730 3417 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3643 4053 gene locus_tag LOCUS_12740 3643 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4053 4418 gene locus_tag LOCUS_12750 4053 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 4523 5101 gene locus_tag LOCUS_12760 4523 5101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence173 <1 540 gene locus_tag LOCUS_12770 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870406.1:flagellin 680 1072 gene locus_tag LOCUS_12780 680 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1084 1524 gene locus_tag LOCUS_12790 1084 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1688 3346 gene locus_tag LOCUS_12800 1688 3346 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496653.1 protein_id gnl|my_center|LOCUS_12800 3602 3916 gene locus_tag LOCUS_12810 3602 3916 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868731.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence174 5 848 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttatgactttattccattaaaacaaggattgaaac 1143 1892 gene locus_tag LOCUS_12820 1143 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 3179 2076 gene locus_tag LOCUS_12830 3179 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 3590 3180 gene locus_tag LOCUS_12840 3590 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 4543 3587 gene locus_tag LOCUS_12850 gene cmr4 4543 3587 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_12850 <5304 4536 gene locus_tag LOCUS_12860 <5304 4536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545976.1:DUF1887 family CARF protein >Feature sequence175 1155 214 gene locus_tag LOCUS_12870 gene rfbB 1155 214 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_12870 2067 1189 gene locus_tag LOCUS_12880 gene rfbA 2067 1189 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965630.1 protein_id gnl|my_center|LOCUS_12880 2289 2071 gene locus_tag LOCUS_12890 2289 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 4052 2949 gene locus_tag LOCUS_12900 gene wecB 4052 2949 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_12900 >Feature sequence176 478 248 gene locus_tag LOCUS_12910 478 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 1168 1863 gene locus_tag LOCUS_12920 1168 1863 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878518.1 protein_id gnl|my_center|LOCUS_12920 1866 3089 gene locus_tag LOCUS_12930 1866 3089 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054370.1 protein_id gnl|my_center|LOCUS_12930 3105 5234 gene locus_tag LOCUS_12940 3105 5234 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948919.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence177 40 198 gene locus_tag LOCUS_12950 40 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 849 1028 gene locus_tag LOCUS_12960 849 1028 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902100.1 protein_id gnl|my_center|LOCUS_12960 1103 2269 gene locus_tag LOCUS_12970 gene ftsZ 1103 2269 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023772.1 protein_id gnl|my_center|LOCUS_12970 4036 2882 gene locus_tag LOCUS_12980 4036 2882 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023766.1 protein_id gnl|my_center|LOCUS_12980 5095 4046 gene locus_tag LOCUS_12990 5095 4046 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023765.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence178 3125 696 gene locus_tag LOCUS_13000 3125 696 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876131.1 protein_id gnl|my_center|LOCUS_13000 3309 3127 gene locus_tag LOCUS_13010 3309 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3650 3306 gene locus_tag LOCUS_13020 3650 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 4740 3655 gene locus_tag LOCUS_13030 4740 3655 CDS product ribonuclease H-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876130.1 protein_id gnl|my_center|LOCUS_13030 4963 4760 gene locus_tag LOCUS_13040 4963 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence179 696 304 gene locus_tag LOCUS_13050 696 304 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_13050 2170 674 gene locus_tag LOCUS_13060 2170 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2526 2335 gene locus_tag LOCUS_13070 2526 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 4490 2472 gene locus_tag LOCUS_13080 4490 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13080 >Feature sequence180 1046 1822 gene locus_tag LOCUS_13090 gene fetB 1046 1822 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496671.1 protein_id gnl|my_center|LOCUS_13090 1849 3093 gene locus_tag LOCUS_13100 gene thiI 1849 3093 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021480.1 protein_id gnl|my_center|LOCUS_13100 3794 4957 gene locus_tag LOCUS_13110 3794 4957 CDS product Nre family DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023953.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence181 1242 2039 gene locus_tag LOCUS_13120 1242 2039 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065883.1 protein_id gnl|my_center|LOCUS_13120 3101 2049 gene locus_tag LOCUS_13130 3101 2049 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020267.1 protein_id gnl|my_center|LOCUS_13130 3386 3108 gene locus_tag LOCUS_13140 3386 3108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 3783 4739 gene locus_tag LOCUS_13150 3783 4739 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064944.1 protein_id gnl|my_center|LOCUS_13150 5030 4851 gene locus_tag LOCUS_13160 5030 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence182 663 866 gene locus_tag LOCUS_13170 663 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 976 1212 gene locus_tag LOCUS_13180 976 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1501 1974 gene locus_tag LOCUS_13190 1501 1974 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065746.1 protein_id gnl|my_center|LOCUS_13190 1982 3166 gene locus_tag LOCUS_13200 gene argJ 1982 3166 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023478.1 protein_id gnl|my_center|LOCUS_13200 3198 4649 gene locus_tag LOCUS_13210 gene pfkC 3198 4649 CDS product ADP-specific phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023477.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence183 <1 922 gene locus_tag LOCUS_13220 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868347.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 1974 3428 gene locus_tag LOCUS_13230 gene cobD 1974 3428 CDS product threonine-phosphate decarboxylase CobD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020980.1 protein_id gnl|my_center|LOCUS_13230 3561 4796 gene locus_tag LOCUS_13240 gene xseA 3561 4796 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_13240 4789 5148 gene locus_tag LOCUS_13250 4789 5148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence184 439 2379 gene locus_tag LOCUS_13260 gene gyrB 439 2379 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021594.1 protein_id gnl|my_center|LOCUS_13260 2376 4796 gene locus_tag LOCUS_13270 gene gyrA 2376 4796 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021593.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence185 589 1221 gene locus_tag LOCUS_13280 gene psmB 589 1221 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023769.1 protein_id gnl|my_center|LOCUS_13280 3497 2598 gene locus_tag LOCUS_13290 3497 2598 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_13290 5130 3835 gene locus_tag LOCUS_13300 gene gatD 5130 3835 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021336.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence186 2 160 gene locus_tag LOCUS_13310 2 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 162 311 gene locus_tag LOCUS_13320 162 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 326 1174 gene locus_tag LOCUS_13330 326 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1430 2116 gene locus_tag LOCUS_13340 1430 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2136 3071 gene locus_tag LOCUS_13350 2136 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3106 4368 gene locus_tag LOCUS_13360 3106 4368 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597559.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence187 1909 899 gene locus_tag LOCUS_13370 gene mvaD 1909 899 CDS product phosphomevalonate decarboxylase MvaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289187.1 protein_id gnl|my_center|LOCUS_13370 2725 2060 gene locus_tag LOCUS_13380 2725 2060 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_13380 2981 2736 gene locus_tag LOCUS_13390 2981 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 3634 3720 gene locus_tag LOCUS_t00230 3634 3720 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4323 4811 gene locus_tag LOCUS_13400 gene hacB 4323 4811 CDS product homoaconitase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065791.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence188 30 887 gene locus_tag LOCUS_13410 30 887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 862 1353 gene locus_tag LOCUS_13420 862 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1343 2314 gene locus_tag LOCUS_13430 1343 2314 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_13430 2329 3069 gene locus_tag LOCUS_13440 2329 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 3082 3819 gene locus_tag LOCUS_13450 3082 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 3820 4584 gene locus_tag LOCUS_13460 3820 4584 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013221994.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence189 290 1186 gene locus_tag LOCUS_13470 290 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023654.1 protein_id gnl|my_center|LOCUS_13470 1167 2165 gene locus_tag LOCUS_13480 1167 2165 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023652.1 protein_id gnl|my_center|LOCUS_13480 2404 3330 gene locus_tag LOCUS_13490 2404 3330 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_13490 4855 3470 gene locus_tag LOCUS_13500 4855 3470 CDS product Sau3AI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068548.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence190 <1 934 gene locus_tag LOCUS_13510 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880437.1:hydroxyacid dehydrogenase 952 1140 gene locus_tag LOCUS_13520 952 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 1610 3109 gene locus_tag LOCUS_13530 1610 3109 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053651.1 protein_id gnl|my_center|LOCUS_13530 3460 4902 gene locus_tag LOCUS_13540 3460 4902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence191 2121 4151 gene locus_tag LOCUS_13550 2121 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 >Feature sequence192 1678 443 gene locus_tag LOCUS_13560 1678 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2381 1695 gene locus_tag LOCUS_13570 2381 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 3060 2371 gene locus_tag LOCUS_13580 3060 2371 CDS product BsaWI family type II restriction enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545684.1 protein_id gnl|my_center|LOCUS_13580 4426 3074 gene locus_tag LOCUS_13590 4426 3074 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence193 940 518 gene locus_tag LOCUS_13600 940 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020121.1 protein_id gnl|my_center|LOCUS_13600 1820 948 gene locus_tag LOCUS_13610 1820 948 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_13610 3044 2037 gene locus_tag LOCUS_13620 3044 2037 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021397.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence194 688 2598 gene locus_tag LOCUS_13630 688 2598 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023770.1 protein_id gnl|my_center|LOCUS_13630 3510 2842 gene locus_tag LOCUS_13640 gene tpiA 3510 2842 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024480.1 protein_id gnl|my_center|LOCUS_13640 4776 3589 gene locus_tag LOCUS_13650 4776 3589 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024481.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence195 1629 397 gene locus_tag LOCUS_13660 1629 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2557 2108 gene locus_tag LOCUS_13670 2557 2108 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878644.1 protein_id gnl|my_center|LOCUS_13670 3215 2676 gene locus_tag LOCUS_13680 3215 2676 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_13680 3449 4774 gene locus_tag LOCUS_13690 3449 4774 CDS product DNA methyltransferase C1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545124.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence196 397 799 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttatgactttattccattaaaacaaggattgaaac 1904 804 gene locus_tag LOCUS_13700 1904 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3375 1981 gene locus_tag LOCUS_13710 3375 1981 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066384.1 protein_id gnl|my_center|LOCUS_13710 4661 3615 gene locus_tag LOCUS_13720 4661 3615 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064840.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence197 2518 761 gene locus_tag LOCUS_13730 2518 761 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986746.1 protein_id gnl|my_center|LOCUS_13730 4046 2673 gene locus_tag LOCUS_13740 4046 2673 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987110.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence198 1186 59 gene locus_tag LOCUS_13750 1186 59 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_13750 1874 1656 gene locus_tag LOCUS_13760 1874 1656 CDS product addiction module protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940734.1 protein_id gnl|my_center|LOCUS_13760 2168 2040 gene locus_tag LOCUS_13770 2168 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2584 2165 gene locus_tag LOCUS_13780 2584 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 2827 2597 gene locus_tag LOCUS_13790 2827 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3882 2833 gene locus_tag LOCUS_13800 3882 2833 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044860.1 protein_id gnl|my_center|LOCUS_13800 4753 3875 gene locus_tag LOCUS_13810 4753 3875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence199 878 168 gene locus_tag LOCUS_13820 878 168 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_13820 1966 875 gene locus_tag LOCUS_13830 gene aroB 1966 875 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_13830 2646 2134 gene locus_tag LOCUS_13840 2646 2134 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_13840 4059 2728 gene locus_tag LOCUS_13850 4059 2728 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_13850 4464 4081 gene locus_tag LOCUS_13860 4464 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4706 4464 gene locus_tag LOCUS_13870 4706 4464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence200 1107 742 gene locus_tag LOCUS_13880 1107 742 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_13880 2905 1265 gene locus_tag LOCUS_13890 2905 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 3074 2931 gene locus_tag LOCUS_13900 3074 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 3490 3137 gene locus_tag LOCUS_13910 3490 3137 CDS product cobalamin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990686.1 protein_id gnl|my_center|LOCUS_13910 4488 4147 gene locus_tag LOCUS_13920 4488 4147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 4775 4596 gene locus_tag LOCUS_13930 4775 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence201 1163 1420 gene locus_tag LOCUS_13940 1163 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1530 3230 gene locus_tag LOCUS_13950 1530 3230 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_13950 4175 3384 gene locus_tag LOCUS_13960 gene larE 4175 3384 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020298.1 protein_id gnl|my_center|LOCUS_13960 <4833 4156 gene locus_tag LOCUS_13970 <4833 4156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020065.1:tyrosine decarboxylase MfnA >Feature sequence202 <1 546 gene locus_tag LOCUS_13980 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392279.1:acylneuraminate cytidylyltransferase family protein 543 1085 gene locus_tag LOCUS_13990 543 1085 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925129.1 protein_id gnl|my_center|LOCUS_13990 1075 2394 gene locus_tag LOCUS_14000 1075 2394 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869430.1 protein_id gnl|my_center|LOCUS_14000 2400 3191 gene locus_tag LOCUS_14010 gene ptmA 2400 3191 CDS product flagellin modification protein PtmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857935.1 protein_id gnl|my_center|LOCUS_14010 3188 3889 gene locus_tag LOCUS_14020 3188 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 3886 4599 gene locus_tag LOCUS_14030 3886 4599 CDS product glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869429.1 protein_id gnl|my_center|LOCUS_14030 4617 4778 gene locus_tag LOCUS_14040 4617 4778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 >Feature sequence203 110 289 gene locus_tag LOCUS_14050 110 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 598 1065 gene locus_tag LOCUS_14060 598 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1065 1352 gene locus_tag LOCUS_14070 1065 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1941 1732 gene locus_tag LOCUS_14080 1941 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14080 2386 2093 gene locus_tag LOCUS_14090 2386 2093 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_14090 2879 3397 gene locus_tag LOCUS_14100 gene cobO 2879 3397 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666509.1 protein_id gnl|my_center|LOCUS_14100 4589 3477 gene locus_tag LOCUS_14110 4589 3477 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545208.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence204 553 1764 gene locus_tag LOCUS_14120 553 1764 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022961.1 protein_id gnl|my_center|LOCUS_14120 1776 3620 gene locus_tag LOCUS_14130 gene glmS 1776 3620 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022962.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence205 560 1510 gene locus_tag LOCUS_14140 560 1510 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065056.1 protein_id gnl|my_center|LOCUS_14140 1831 1529 gene locus_tag LOCUS_14150 1831 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2659 2868 gene locus_tag LOCUS_14160 2659 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 2984 4285 gene locus_tag LOCUS_14170 2984 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence206 421 44 gene locus_tag LOCUS_14180 421 44 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021138.1 protein_id gnl|my_center|LOCUS_14180 981 457 gene locus_tag LOCUS_14190 981 457 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021137.1 protein_id gnl|my_center|LOCUS_14190 1448 1002 gene locus_tag LOCUS_14200 1448 1002 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066175.1 protein_id gnl|my_center|LOCUS_14200 2079 1858 gene locus_tag LOCUS_14210 2079 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 2375 2290 gene locus_tag LOCUS_t00240 2375 2290 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3436 2387 gene locus_tag LOCUS_14220 3436 2387 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021133.1 protein_id gnl|my_center|LOCUS_14220 4007 3456 gene locus_tag LOCUS_14230 4007 3456 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021132.1 protein_id gnl|my_center|LOCUS_14230 4622 4008 gene locus_tag LOCUS_14240 4622 4008 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021131.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence207 <1 1493 gene locus_tag LOCUS_14250 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963162.1:PAS domain S-box protein 2242 3729 gene locus_tag LOCUS_14260 2242 3729 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020229.1 protein_id gnl|my_center|LOCUS_14260 4202 4759 gene locus_tag LOCUS_14270 4202 4759 CDS product deoxyuridine 5'-triphosphate nucleotidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020492.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence208 1055 270 gene locus_tag LOCUS_14280 1055 270 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020633.1 protein_id gnl|my_center|LOCUS_14280 1965 1057 gene locus_tag LOCUS_14290 1965 1057 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066118.1 protein_id gnl|my_center|LOCUS_14290 2916 2632 gene locus_tag LOCUS_14300 2916 2632 CDS product non-histone chromosomal MC1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024392.1 protein_id gnl|my_center|LOCUS_14300 3217 4050 gene locus_tag LOCUS_14310 3217 4050 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870548.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence209 228 2660 gene locus_tag LOCUS_14320 gene ppk1 228 2660 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870306.1 protein_id gnl|my_center|LOCUS_14320 2632 4404 gene locus_tag LOCUS_14330 2632 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence210 434 1570 gene locus_tag LOCUS_14340 434 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 1630 3186 gene locus_tag LOCUS_14350 1630 3186 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968694.1 protein_id gnl|my_center|LOCUS_14350 3189 3944 gene locus_tag LOCUS_14360 3189 3944 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104614758.1 protein_id gnl|my_center|LOCUS_14360 4016 4483 gene locus_tag LOCUS_14370 4016 4483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence211 512 1270 gene locus_tag LOCUS_14380 gene psmA 512 1270 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065214.1 protein_id gnl|my_center|LOCUS_14380 1309 2001 gene locus_tag LOCUS_14390 1309 2001 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021781.1 protein_id gnl|my_center|LOCUS_14390 2017 2658 gene locus_tag LOCUS_14400 gene rrp4 2017 2658 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021780.1 protein_id gnl|my_center|LOCUS_14400 2757 3569 gene locus_tag LOCUS_14410 2757 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 3559 4341 gene locus_tag LOCUS_14420 gene rrp42 3559 4341 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021779.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence212 979 1596 gene locus_tag LOCUS_14430 979 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence213 351 479 gene locus_tag LOCUS_14440 351 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 492 776 gene locus_tag LOCUS_14450 492 776 CDS product DUF1894 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020185.1 protein_id gnl|my_center|LOCUS_14450 2102 813 gene locus_tag LOCUS_14460 gene proB 2102 813 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023993.1 protein_id gnl|my_center|LOCUS_14460 2517 2269 gene locus_tag LOCUS_14470 2517 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 2812 2678 gene locus_tag LOCUS_14480 2812 2678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 4004 2883 gene locus_tag LOCUS_14490 4004 2883 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_14490 4252 4016 gene locus_tag LOCUS_14500 4252 4016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14500 >Feature sequence214 2083 119 gene locus_tag LOCUS_14510 2083 119 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_14510 3845 2508 gene locus_tag LOCUS_14520 3845 2508 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_14520 4002 4133 gene locus_tag LOCUS_14530 4002 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence215 734 946 gene locus_tag LOCUS_14540 734 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1096 1317 gene locus_tag LOCUS_14550 1096 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 1323 3299 gene locus_tag LOCUS_14560 1323 3299 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000367546.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence216 >Feature sequence217 8 1552 gene locus_tag LOCUS_14570 8 1552 CDS product methanogenesis marker 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023892.1 protein_id gnl|my_center|LOCUS_14570 1549 2037 gene locus_tag LOCUS_14580 1549 2037 CDS product methanogenesis marker 6 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065869.1 protein_id gnl|my_center|LOCUS_14580 2052 2468 gene locus_tag LOCUS_14590 2052 2468 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546772.1 protein_id gnl|my_center|LOCUS_14590 2455 4227 gene locus_tag LOCUS_14600 2455 4227 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545652.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence218 628 1125 gene locus_tag LOCUS_14610 gene hdrC 628 1125 CDS product CoB--CoM heterodisulfide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261191.1 protein_id gnl|my_center|LOCUS_14610 1118 2032 gene locus_tag LOCUS_14620 gene hdrB 1118 2032 CDS product CoB--CoM heterodisulfide reductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024119.1 protein_id gnl|my_center|LOCUS_14620 2034 4001 gene locus_tag LOCUS_14630 gene hdrA 2034 4001 CDS product H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061038.1 protein_id gnl|my_center|LOCUS_14630 4004 4429 gene locus_tag LOCUS_14640 4004 4429 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876760.1 protein_id gnl|my_center|LOCUS_14640 >Feature sequence219 412 1314 gene locus_tag LOCUS_14650 412 1314 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020197.1 protein_id gnl|my_center|LOCUS_14650 1315 2913 gene locus_tag LOCUS_14660 1315 2913 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020198.1 protein_id gnl|my_center|LOCUS_14660 3030 4061 gene locus_tag LOCUS_14670 3030 4061 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064821.1 protein_id gnl|my_center|LOCUS_14670 >Feature sequence220 318 1172 gene locus_tag LOCUS_14680 gene speB 318 1172 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023880.1 protein_id gnl|my_center|LOCUS_14680 1191 2393 gene locus_tag LOCUS_14690 1191 2393 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022842.1 protein_id gnl|my_center|LOCUS_14690 2541 2960 gene locus_tag LOCUS_14700 gene nikR 2541 2960 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023967.1 protein_id gnl|my_center|LOCUS_14700 3823 4029 gene locus_tag LOCUS_14710 3823 4029 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_14710 >Feature sequence221 1431 1219 gene locus_tag LOCUS_14720 1431 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 2461 1502 gene locus_tag LOCUS_14730 2461 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 3322 2585 gene locus_tag LOCUS_14740 3322 2585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 >Feature sequence222 52 936 gene locus_tag LOCUS_14750 52 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 957 1187 gene locus_tag LOCUS_14760 957 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2365 3504 gene locus_tag LOCUS_14770 2365 3504 CDS product N-acetyl sugar amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869425.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence223 <1 882 gene locus_tag LOCUS_14780 <1 882 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:TAT-variant-translocated molybdopterin oxidoreductase 909 2381 gene locus_tag LOCUS_14790 gene nrfD 909 2381 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962545.1 protein_id gnl|my_center|LOCUS_14790 2399 3382 gene locus_tag LOCUS_14800 2399 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 >Feature sequence224 >Feature sequence225 549 1349 gene locus_tag LOCUS_14810 549 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 1352 4003 gene locus_tag LOCUS_14820 1352 4003 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence226 1558 1145 gene locus_tag LOCUS_14830 gene ribH 1558 1145 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021820.1 protein_id gnl|my_center|LOCUS_14830 2056 1592 gene locus_tag LOCUS_14840 gene ribC 2056 1592 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021819.1 protein_id gnl|my_center|LOCUS_14840 3146 2049 gene locus_tag LOCUS_14850 3146 2049 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065228.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence227 647 871 gene locus_tag LOCUS_14860 647 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 876 1628 gene locus_tag LOCUS_14870 876 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1630 1911 gene locus_tag LOCUS_14880 1630 1911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1912 2508 gene locus_tag LOCUS_14890 1912 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2765 3697 gene locus_tag LOCUS_14900 2765 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 3721 3858 gene locus_tag LOCUS_14910 3721 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 3871 3999 gene locus_tag LOCUS_14920 3871 3999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence228 1550 774 gene locus_tag LOCUS_14930 1550 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 2797 2045 gene locus_tag LOCUS_14940 gene fdhD 2797 2045 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_14940 4001 2799 gene locus_tag LOCUS_14950 4001 2799 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172824500.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence229 530 366 gene locus_tag LOCUS_14960 530 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1336 494 gene locus_tag LOCUS_14970 gene galU 1336 494 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_14970 2211 1333 gene locus_tag LOCUS_14980 2211 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3557 2397 gene locus_tag LOCUS_14990 3557 2397 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392042.1 protein_id gnl|my_center|LOCUS_14990 4050 3661 gene locus_tag LOCUS_15000 4050 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence230 527 1009 gene locus_tag LOCUS_15010 527 1009 CDS product NOB1 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066159.1 protein_id gnl|my_center|LOCUS_15010 1138 1749 gene locus_tag LOCUS_15020 1138 1749 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022488.1 protein_id gnl|my_center|LOCUS_15020 1860 2345 gene locus_tag LOCUS_15030 1860 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020868.1 protein_id gnl|my_center|LOCUS_15030 2734 2522 gene locus_tag LOCUS_15040 2734 2522 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878240.1 protein_id gnl|my_center|LOCUS_15040 4143 3754 gene locus_tag LOCUS_15050 4143 3754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence231 1067 1789 gene locus_tag LOCUS_15060 1067 1789 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_15060 2871 1795 gene locus_tag LOCUS_15070 2871 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence232 1629 1375 gene locus_tag LOCUS_15080 1629 1375 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_15080 1820 1626 gene locus_tag LOCUS_15090 1820 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 2075 1827 gene locus_tag LOCUS_15100 2075 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2698 2360 gene locus_tag LOCUS_15110 2698 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 3210 2983 gene locus_tag LOCUS_15120 3210 2983 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_15120 3415 3203 gene locus_tag LOCUS_15130 3415 3203 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391793.1 protein_id gnl|my_center|LOCUS_15130 3848 3495 gene locus_tag LOCUS_15140 3848 3495 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_15140 >Feature sequence233 501 1388 gene locus_tag LOCUS_15150 gene map 501 1388 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020270.1 protein_id gnl|my_center|LOCUS_15150 2165 3088 gene locus_tag LOCUS_15160 gene pyrB 2165 3088 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024378.1 protein_id gnl|my_center|LOCUS_15160 3085 3573 gene locus_tag LOCUS_15170 gene pyrI 3085 3573 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024377.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence234 2059 428 gene locus_tag LOCUS_15180 2059 428 CDS product methylamine methyltransferase corrinoid protein reductive activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065863.1 protein_id gnl|my_center|LOCUS_15180 3379 2387 gene locus_tag LOCUS_15190 gene mtaA 3379 2387 CDS product methylcobamide:CoM methyltransferase MtaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589539.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence235 328 861 gene locus_tag LOCUS_15200 328 861 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939708.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence236 576 719 gene locus_tag LOCUS_15210 576 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 770 916 gene locus_tag LOCUS_15220 770 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 984 2387 gene locus_tag LOCUS_15230 gene cfbB 984 2387 CDS product Ni-sirohydrochlorin a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023534.1 protein_id gnl|my_center|LOCUS_15230 2552 3607 gene locus_tag LOCUS_15240 gene endA 2552 3607 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023532.1 protein_id gnl|my_center|LOCUS_15240 3613 4017 gene locus_tag LOCUS_15250 3613 4017 CDS product DUF2209 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023531.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence237 609 1115 gene locus_tag LOCUS_15260 609 1115 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021787.1 protein_id gnl|my_center|LOCUS_15260 1112 1717 gene locus_tag LOCUS_15270 1112 1717 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755897.1 protein_id gnl|my_center|LOCUS_15270 1698 2423 gene locus_tag LOCUS_15280 1698 2423 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021785.1 protein_id gnl|my_center|LOCUS_15280 2734 3141 gene locus_tag LOCUS_15290 2734 3141 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021784.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence238 2957 204 gene locus_tag LOCUS_15300 2957 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 3875 2961 gene locus_tag LOCUS_15310 3875 2961 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310179.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence239 441 193 gene locus_tag LOCUS_15320 441 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 563 820 gene locus_tag LOCUS_15330 563 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 830 1387 gene locus_tag LOCUS_15340 830 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1643 2305 gene locus_tag LOCUS_15350 1643 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 2699 3895 gene locus_tag LOCUS_15360 2699 3895 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121450865.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence240 1051 2721 gene locus_tag LOCUS_15370 1051 2721 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020142.1 protein_id gnl|my_center|LOCUS_15370 3976 3002 gene locus_tag LOCUS_15380 3976 3002 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015945.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence241 <1 1402 gene locus_tag LOCUS_15390 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211204934.1:site-specific DNA-methyltransferase 1411 2070 gene locus_tag LOCUS_15400 1411 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence242 506 1360 gene locus_tag LOCUS_15410 506 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1428 2294 gene locus_tag LOCUS_15420 1428 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence243 1195 1022 gene locus_tag LOCUS_15430 1195 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1867 1250 gene locus_tag LOCUS_15440 1867 1250 CDS product amino acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021487.1 protein_id gnl|my_center|LOCUS_15440 3322 1880 gene locus_tag LOCUS_15450 3322 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 <4100 3327 gene locus_tag LOCUS_15460 <4100 3327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878633.1:ABC transporter permease >Feature sequence244 1039 2187 gene locus_tag LOCUS_15470 1039 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 3666 2449 gene locus_tag LOCUS_15480 3666 2449 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870253.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence245 128 2776 gene locus_tag LOCUS_15490 128 2776 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_15490 2820 2892 gene locus_tag LOCUS_t00250 2820 2892 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3267 3683 gene locus_tag LOCUS_15500 3267 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence246 206 6 gene locus_tag LOCUS_15510 206 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2056 536 gene locus_tag LOCUS_15520 2056 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 2907 2062 gene locus_tag LOCUS_15530 2907 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 3456 2923 gene locus_tag LOCUS_15540 3456 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence247 874 482 gene locus_tag LOCUS_15550 gene csx20 874 482 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_15550 1961 867 gene locus_tag LOCUS_15560 gene cmr3 1961 867 CDS product type III-B CRISPR module-associated protein Cmr3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880205.1 protein_id gnl|my_center|LOCUS_15560 3700 1958 gene locus_tag LOCUS_15570 gene cas10 3700 1958 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880206.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence248 1756 1322 gene locus_tag LOCUS_15580 1756 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2292 1759 gene locus_tag LOCUS_15590 2292 1759 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063706.1 protein_id gnl|my_center|LOCUS_15590 3519 2332 gene locus_tag LOCUS_15600 3519 2332 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020758.1 protein_id gnl|my_center|LOCUS_15600 4022 3720 gene locus_tag LOCUS_15610 4022 3720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 >Feature sequence249 >Feature sequence250 1079 138 gene locus_tag LOCUS_15620 1079 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3958 1079 gene locus_tag LOCUS_15630 3958 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence251 481 92 gene locus_tag LOCUS_15640 481 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 855 733 gene locus_tag LOCUS_15650 855 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 1488 2564 gene locus_tag LOCUS_15660 gene cobT 1488 2564 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_15660 2554 3189 gene locus_tag LOCUS_15670 2554 3189 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024487.1 protein_id gnl|my_center|LOCUS_15670 3683 3549 gene locus_tag LOCUS_15680 3683 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 3870 3676 gene locus_tag LOCUS_15690 3870 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence252 <1 873 gene locus_tag LOCUS_15700 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240438.1:glycosyltransferase family 1 protein 1228 1356 gene locus_tag LOCUS_15710 1228 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1880 1755 gene locus_tag LOCUS_15720 1880 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2116 1940 gene locus_tag LOCUS_15730 2116 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2548 2721 gene locus_tag LOCUS_15740 2548 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 >Feature sequence253 577 1716 gene locus_tag LOCUS_15750 gene priS 577 1716 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020695.1 protein_id gnl|my_center|LOCUS_15750 1703 2380 gene locus_tag LOCUS_15760 1703 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064936.1 protein_id gnl|my_center|LOCUS_15760 2646 2924 gene locus_tag LOCUS_15770 2646 2924 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020693.1 protein_id gnl|my_center|LOCUS_15770 2941 3120 gene locus_tag LOCUS_15780 2941 3120 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020692.1 protein_id gnl|my_center|LOCUS_15780 3127 3912 gene locus_tag LOCUS_15790 3127 3912 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064935.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence254 266 550 gene locus_tag LOCUS_15800 gene eif1A 266 550 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064992.1 protein_id gnl|my_center|LOCUS_15800 675 1481 gene locus_tag LOCUS_15810 675 1481 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_15810 1833 2369 gene locus_tag LOCUS_15820 1833 2369 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020937.1 protein_id gnl|my_center|LOCUS_15820 2406 3101 gene locus_tag LOCUS_15830 2406 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence255 187 381 gene locus_tag LOCUS_15840 187 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 378 2411 gene locus_tag LOCUS_15850 378 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 2416 3813 gene locus_tag LOCUS_15860 2416 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence256 751 1572 gene locus_tag LOCUS_15870 751 1572 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964203.1 protein_id gnl|my_center|LOCUS_15870 1624 3306 gene locus_tag LOCUS_15880 gene hcp 1624 3306 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047923.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence257 <1 3699 gene locus_tag LOCUS_15890 <1 3699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989462.1:class 1 internalin InlA >Feature sequence258 1171 86 gene locus_tag LOCUS_15900 gene prfB 1171 86 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_15900 2949 1273 gene locus_tag LOCUS_15910 2949 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 3168 3722 gene locus_tag LOCUS_15920 gene msrA 3168 3722 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421586.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence259 279 3365 gene locus_tag LOCUS_15930 279 3365 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257687.1 protein_id gnl|my_center|LOCUS_15930 3709 3407 gene locus_tag LOCUS_15940 3709 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence260 252 1499 gene locus_tag LOCUS_15950 252 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1628 2554 gene locus_tag LOCUS_15960 1628 2554 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_15960 2724 3665 gene locus_tag LOCUS_15970 2724 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence261 22 1083 gene locus_tag LOCUS_15980 22 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1380 1700 gene locus_tag LOCUS_15990 1380 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1651 2013 gene locus_tag LOCUS_16000 1651 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 2074 2598 gene locus_tag LOCUS_16010 2074 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 3080 3580 gene locus_tag LOCUS_16020 3080 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence262 >Feature sequence263 1643 1149 gene locus_tag LOCUS_16030 gene grpE 1643 1149 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_16030 1840 3219 gene locus_tag LOCUS_16040 gene dnaB 1840 3219 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583712.1 protein_id gnl|my_center|LOCUS_16040 3216 3854 gene locus_tag LOCUS_16050 gene recR 3216 3854 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359478.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence264 <1 1880 gene locus_tag LOCUS_16060 <1 1880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein 2895 2113 gene locus_tag LOCUS_16070 2895 2113 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768886.1 protein_id gnl|my_center|LOCUS_16070 3482 2895 gene locus_tag LOCUS_16080 3482 2895 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787813.1 protein_id gnl|my_center|LOCUS_16080 3849 3502 gene locus_tag LOCUS_16090 3849 3502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence265 <1 788 gene locus_tag LOCUS_16100 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022960.1:calcium/sodium antiporter 1700 777 gene locus_tag LOCUS_16110 1700 777 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_16110 1927 3648 gene locus_tag LOCUS_16120 1927 3648 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022420.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence266 251 1471 gene locus_tag LOCUS_16130 251 1471 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064787.1 protein_id gnl|my_center|LOCUS_16130 2431 1889 gene locus_tag LOCUS_16140 2431 1889 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020095.1 protein_id gnl|my_center|LOCUS_16140 2768 3577 gene locus_tag LOCUS_16150 2768 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16150 >Feature sequence267 607 371 gene locus_tag LOCUS_16160 607 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 873 1340 gene locus_tag LOCUS_16170 gene greA 873 1340 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_16170 1409 1849 gene locus_tag LOCUS_16180 1409 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 2482 1997 gene locus_tag LOCUS_16190 2482 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 2860 2666 gene locus_tag LOCUS_16200 2860 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 3869 2853 gene locus_tag LOCUS_16210 3869 2853 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015931.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence268 1749 799 gene locus_tag LOCUS_16220 1749 799 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258544.1 protein_id gnl|my_center|LOCUS_16220 2892 1771 gene locus_tag LOCUS_16230 2892 1771 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_16230 3677 2889 gene locus_tag LOCUS_16240 3677 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence269 1014 2363 gene locus_tag LOCUS_16250 gene cca 1014 2363 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023473.1 protein_id gnl|my_center|LOCUS_16250 3666 2347 gene locus_tag LOCUS_16260 3666 2347 CDS product ADP-dependent glucokinase/phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023476.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence270 289 80 gene locus_tag LOCUS_16270 289 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1990 830 gene locus_tag LOCUS_16280 1990 830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964158.1 protein_id gnl|my_center|LOCUS_16280 3258 2458 gene locus_tag LOCUS_16290 3258 2458 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393323.1 protein_id gnl|my_center|LOCUS_16290 3863 3444 gene locus_tag LOCUS_16300 gene tsaA 3863 3444 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868101.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence271 763 1512 gene locus_tag LOCUS_16310 gene cobA 763 1512 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022972.1 protein_id gnl|my_center|LOCUS_16310 1543 2334 gene locus_tag LOCUS_16320 1543 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16320 2545 3462 gene locus_tag LOCUS_16330 2545 3462 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870112.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence272 394 750 gene locus_tag LOCUS_16340 394 750 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023749.1 protein_id gnl|my_center|LOCUS_16340 852 1832 gene locus_tag LOCUS_16350 852 1832 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_16350 1843 2880 gene locus_tag LOCUS_16360 1843 2880 CDS product methanogenesis marker 12 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023754.1 protein_id gnl|my_center|LOCUS_16360 3500 3571 gene locus_tag LOCUS_t00260 3500 3571 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence273 1004 27 gene locus_tag LOCUS_16370 1004 27 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023440.1 protein_id gnl|my_center|LOCUS_16370 1761 2549 gene locus_tag LOCUS_16380 1761 2549 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020123.1 protein_id gnl|my_center|LOCUS_16380 2550 3302 gene locus_tag LOCUS_16390 2550 3302 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064800.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence274 1380 952 gene locus_tag LOCUS_16400 gene rplK 1380 952 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_16400 2493 1408 gene locus_tag LOCUS_16410 gene rseP 2493 1408 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392556.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence275 1489 272 gene locus_tag LOCUS_16420 gene purT 1489 272 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_16420 2233 1493 gene locus_tag LOCUS_16430 2233 1493 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_221202124.1 protein_id gnl|my_center|LOCUS_16430 2644 2720 gene locus_tag LOCUS_t00270 2644 2720 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2873 3094 gene locus_tag LOCUS_16440 2873 3094 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021287.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence276 186 1148 gene locus_tag LOCUS_16450 186 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 2219 1143 gene locus_tag LOCUS_16460 gene gcvT 2219 1143 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence277 233 158 gene locus_tag LOCUS_t00280 233 158 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 397 990 gene locus_tag LOCUS_16470 gene dcd 397 990 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_16470 992 1735 gene locus_tag LOCUS_16480 gene pyrF 992 1735 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545803.1 protein_id gnl|my_center|LOCUS_16480 1692 3263 gene locus_tag LOCUS_16490 gene pabB 1692 3263 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189680.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence278 1772 3055 gene locus_tag LOCUS_16500 1772 3055 CDS product methanogenesis marker 16 metalloprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023232.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence279 203 1423 gene locus_tag LOCUS_16510 203 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 1458 2219 gene locus_tag LOCUS_16520 1458 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16520 2622 2834 gene locus_tag LOCUS_16530 2622 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence280 766 359 gene locus_tag LOCUS_16540 766 359 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870272.1 protein_id gnl|my_center|LOCUS_16540 1538 1876 gene locus_tag LOCUS_16550 gene glnK1 1538 1876 CDS product P-II family nitrogen regulator GlnK1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869551.1 protein_id gnl|my_center|LOCUS_16550 1925 3136 gene locus_tag LOCUS_16560 1925 3136 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496964.1 protein_id gnl|my_center|LOCUS_16560 3763 3251 gene locus_tag LOCUS_16570 3763 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 >Feature sequence281 1400 750 gene locus_tag LOCUS_16580 1400 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 2812 2090 gene locus_tag LOCUS_16590 2812 2090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence282 1027 14 gene locus_tag LOCUS_16600 1027 14 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_16600 2069 1410 gene locus_tag LOCUS_16610 2069 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3206 2406 gene locus_tag LOCUS_16620 3206 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence283 <1 1381 gene locus_tag LOCUS_16630 <1 1381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034260979.1:DEAD/DEAH box helicase family protein note possible pseudo, frameshifted 1353 2345 gene locus_tag LOCUS_16640 1353 2345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16640 2512 3480 gene locus_tag LOCUS_16650 2512 3480 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875712.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence284 606 1292 gene locus_tag LOCUS_16660 gene phoU 606 1292 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_16660 2170 1427 gene locus_tag LOCUS_16670 gene rpiA 2170 1427 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021687.1 protein_id gnl|my_center|LOCUS_16670 3526 2195 gene locus_tag LOCUS_16680 gene aspS 3526 2195 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021688.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence285 1576 200 gene locus_tag LOCUS_16690 1576 200 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948760.1 protein_id gnl|my_center|LOCUS_16690 1916 1569 gene locus_tag LOCUS_16700 1916 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 2791 1913 gene locus_tag LOCUS_16710 2791 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 3660 2782 gene locus_tag LOCUS_16720 3660 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence286 986 2752 gene locus_tag LOCUS_16730 986 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 2924 3424 gene locus_tag LOCUS_16740 2924 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence287 457 1797 gene locus_tag LOCUS_16750 457 1797 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020654.1 protein_id gnl|my_center|LOCUS_16750 1984 2949 gene locus_tag LOCUS_16760 1984 2949 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066119.1 protein_id gnl|my_center|LOCUS_16760 2983 3059 gene locus_tag LOCUS_t00290 2983 3059 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 2585 189 gene locus_tag LOCUS_16770 2585 189 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951098.1 protein_id gnl|my_center|LOCUS_16770 2921 2661 gene locus_tag LOCUS_16780 2921 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16780 <3683 2924 gene locus_tag LOCUS_16790 <3683 2924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869119.1:site-specific DNA-methyltransferase >Feature sequence289 2655 781 gene locus_tag LOCUS_16800 2655 781 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_16800 <3665 2645 gene locus_tag LOCUS_16810 <3665 2645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148183415.1:type II/IV secretion system ATPase subunit >Feature sequence290 <1 1258 gene locus_tag LOCUS_16820 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103419.1:restriction endonuclease subunit S 1695 2294 gene locus_tag LOCUS_16830 1695 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132283202.1 protein_id gnl|my_center|LOCUS_16830 2291 3235 gene locus_tag LOCUS_16840 2291 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence291 <1 2631 gene locus_tag LOCUS_16850 <1 2631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846723.1:DNA double-strand break repair ATPase Rad50 3010 2573 gene locus_tag LOCUS_16860 3010 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 3341 3093 gene locus_tag LOCUS_16870 3341 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 3571 3359 gene locus_tag LOCUS_16880 3571 3359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 >Feature sequence292 887 2959 gene locus_tag LOCUS_16890 887 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 >Feature sequence293 483 220 gene locus_tag LOCUS_16900 483 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1797 3254 gene locus_tag LOCUS_16910 1797 3254 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence294 136 1008 gene locus_tag LOCUS_16920 136 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 1015 1377 gene locus_tag LOCUS_16930 1015 1377 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_16930 1436 2536 gene locus_tag LOCUS_16940 1436 2536 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249584.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence295 1021 791 gene locus_tag LOCUS_16950 1021 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1242 1018 gene locus_tag LOCUS_16960 1242 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 2231 1371 gene locus_tag LOCUS_16970 2231 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 2654 2451 gene locus_tag LOCUS_16980 2654 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 >Feature sequence296 1148 642 gene locus_tag LOCUS_16990 1148 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2107 1154 gene locus_tag LOCUS_17000 2107 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 3524 2406 gene locus_tag LOCUS_17010 3524 2406 CDS product ISNCY-like element ISMac19 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020207.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence297 1233 70 gene locus_tag LOCUS_17020 1233 70 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020271.1 protein_id gnl|my_center|LOCUS_17020 <3556 1548 gene locus_tag LOCUS_17030 <3556 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436266.1:excinuclease ABC subunit UvrA >Feature sequence298 269 1713 gene locus_tag LOCUS_r00040 269 1713 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1839 3260 gene locus_tag LOCUS_17040 gene secY 1839 3260 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875668.1 protein_id gnl|my_center|LOCUS_17040 3315 3485 gene locus_tag LOCUS_17050 3315 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence299 1121 702 gene locus_tag LOCUS_17060 1121 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 2666 1134 gene locus_tag LOCUS_17070 2666 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 3168 2656 gene locus_tag LOCUS_17080 3168 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 3331 3152 gene locus_tag LOCUS_17090 3331 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence300 168 641 gene locus_tag LOCUS_17100 168 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 790 1320 gene locus_tag LOCUS_17110 790 1320 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_17110 2760 1501 gene locus_tag LOCUS_17120 2760 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 2975 2766 gene locus_tag LOCUS_17130 2975 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence301 844 2016 gene locus_tag LOCUS_17140 844 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 2041 2406 gene locus_tag LOCUS_17150 2041 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 2449 3033 gene locus_tag LOCUS_17160 2449 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 >Feature sequence302 429 1133 gene locus_tag LOCUS_17170 429 1133 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_17170 1193 2044 gene locus_tag LOCUS_17180 gene dph5 1193 2044 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021388.1 protein_id gnl|my_center|LOCUS_17180 2041 3012 gene locus_tag LOCUS_17190 2041 3012 CDS product methanogenesis marker 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024078.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence303 1951 2145 gene locus_tag LOCUS_17200 1951 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 2208 2372 gene locus_tag LOCUS_17210 2208 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence304 1015 1764 gene locus_tag LOCUS_17220 1015 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2144 1860 gene locus_tag LOCUS_17230 2144 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 >Feature sequence305 511 170 gene locus_tag LOCUS_17240 511 170 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146633.1 protein_id gnl|my_center|LOCUS_17240 1173 511 gene locus_tag LOCUS_17250 1173 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1466 1170 gene locus_tag LOCUS_17260 1466 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867849.1 protein_id gnl|my_center|LOCUS_17260 1736 1470 gene locus_tag LOCUS_17270 1736 1470 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146635.1 protein_id gnl|my_center|LOCUS_17270 2091 1729 gene locus_tag LOCUS_17280 gene mnhG 2091 1729 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_17280 2354 2088 gene locus_tag LOCUS_17290 2354 2088 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_17290 2752 2351 gene locus_tag LOCUS_17300 2752 2351 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251030.1 protein_id gnl|my_center|LOCUS_17300 >Feature sequence306 81 767 gene locus_tag LOCUS_17310 81 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 944 1822 gene locus_tag LOCUS_17320 944 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 1900 2913 gene locus_tag LOCUS_17330 1900 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 2913 3356 gene locus_tag LOCUS_17340 2913 3356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 >Feature sequence307 1356 481 gene locus_tag LOCUS_17350 gene ilvE 1356 481 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_17350 1801 1445 gene locus_tag LOCUS_17360 gene queD 1801 1445 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065925.1 protein_id gnl|my_center|LOCUS_17360 2523 1798 gene locus_tag LOCUS_17370 2523 1798 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024082.1 protein_id gnl|my_center|LOCUS_17370 3088 2525 gene locus_tag LOCUS_17380 3088 2525 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024083.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence308 163 468 gene locus_tag LOCUS_17390 163 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 2038 1445 gene locus_tag LOCUS_17400 2038 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 2881 2531 gene locus_tag LOCUS_17410 2881 2531 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_17410 3038 2874 gene locus_tag LOCUS_17420 3038 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 3227 3051 gene locus_tag LOCUS_17430 3227 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence309 <1 776 gene locus_tag LOCUS_17440 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022803.1:sulfide-dependent adenosine diphosphate thiazole synthase 2887 1505 gene locus_tag LOCUS_17450 2887 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 >Feature sequence310 144 560 gene locus_tag LOCUS_17460 144 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 563 3154 gene locus_tag LOCUS_17470 563 3154 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545345.1 protein_id gnl|my_center|LOCUS_17470 >Feature sequence311 >Feature sequence312 344 2041 gene locus_tag LOCUS_17480 344 2041 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023035.1 protein_id gnl|my_center|LOCUS_17480 2038 2931 gene locus_tag LOCUS_17490 2038 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 >Feature sequence313 <1 1094 gene locus_tag LOCUS_17500 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011082555.1:ABC transporter permease 1151 1444 gene locus_tag LOCUS_17510 1151 1444 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066074.1 protein_id gnl|my_center|LOCUS_17510 1907 1599 gene locus_tag LOCUS_17520 gene yciH 1907 1599 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023951.1 protein_id gnl|my_center|LOCUS_17520 3174 2269 gene locus_tag LOCUS_17530 3174 2269 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048168954.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence314 42 1208 gene locus_tag LOCUS_17540 42 1208 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023975.1 protein_id gnl|my_center|LOCUS_17540 1239 2264 gene locus_tag LOCUS_17550 gene argC 1239 2264 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_17550 2566 2832 gene locus_tag LOCUS_17560 2566 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence315 <1 1262 gene locus_tag LOCUS_17570 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920215.1:cellulase family glycosylhydrolase 1276 2019 gene locus_tag LOCUS_17580 1276 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 2142 3074 gene locus_tag LOCUS_17590 gene uxuA 2142 3074 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000426045.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence316 2040 1018 gene locus_tag LOCUS_17600 2040 1018 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020659.1 protein_id gnl|my_center|LOCUS_17600 2550 2290 gene locus_tag LOCUS_17610 2550 2290 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020658.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence317 595 290 gene locus_tag LOCUS_17620 gene rpl12p 595 290 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024158.1 protein_id gnl|my_center|LOCUS_17620 1775 756 gene locus_tag LOCUS_17630 1775 756 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024157.1 protein_id gnl|my_center|LOCUS_17630 2416 1775 gene locus_tag LOCUS_17640 2416 1775 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024156.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence318 >Feature sequence319 >Feature sequence320 1456 344 gene locus_tag LOCUS_17650 gene hisC 1456 344 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_17650 2093 1644 gene locus_tag LOCUS_17660 2093 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 <3344 2799 gene locus_tag LOCUS_17670 <3344 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005616461.1:prephenate dehydratase >Feature sequence321 1992 1195 gene locus_tag LOCUS_17680 gene cfbC 1992 1195 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase ATP-dependent reductase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023535.1 protein_id gnl|my_center|LOCUS_17680 3191 1989 gene locus_tag LOCUS_17690 gene cfbD 3191 1989 CDS product Ni-sirohydrochlorin a,c-diamide reductive cyclase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023536.1 protein_id gnl|my_center|LOCUS_17690 >Feature sequence322 85 342 gene locus_tag LOCUS_17700 85 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 326 544 gene locus_tag LOCUS_17710 326 544 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546452.1 protein_id gnl|my_center|LOCUS_17710 860 696 gene locus_tag LOCUS_17720 860 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 1124 906 gene locus_tag LOCUS_17730 1124 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2500 1154 gene locus_tag LOCUS_17740 2500 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 3110 2511 gene locus_tag LOCUS_17750 3110 2511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence323 995 831 gene locus_tag LOCUS_17760 995 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17760 1323 1057 gene locus_tag LOCUS_17770 1323 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020351.1 protein_id gnl|my_center|LOCUS_17770 1453 2406 gene locus_tag LOCUS_17780 1453 2406 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_17780 >Feature sequence324 380 1237 gene locus_tag LOCUS_17790 380 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000386427.1 protein_id gnl|my_center|LOCUS_17790 1246 2037 gene locus_tag LOCUS_17800 1246 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence325 <1 801 gene locus_tag LOCUS_17810 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964594.1:molecular chaperone DnaK 926 2011 gene locus_tag LOCUS_17820 gene dnaJ 926 2011 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002468806.1 protein_id gnl|my_center|LOCUS_17820 2165 2818 gene locus_tag LOCUS_17830 2165 2818 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763353.1 protein_id gnl|my_center|LOCUS_17830 2882 2954 gene locus_tag LOCUS_t00300 2882 2954 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence326 1254 367 gene locus_tag LOCUS_17840 1254 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 2182 1229 gene locus_tag LOCUS_17850 2182 1229 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402846.1 protein_id gnl|my_center|LOCUS_17850 <3309 2379 gene locus_tag LOCUS_17860 <3309 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190897490.1:glycosyltransferase family 61 protein >Feature sequence327 <3288 1890 gene locus_tag LOCUS_17870 <3288 1890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545530.1:site-specific DNA-methyltransferase >Feature sequence328 2107 620 gene locus_tag LOCUS_17880 2107 620 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938997.1 protein_id gnl|my_center|LOCUS_17880 2686 2108 gene locus_tag LOCUS_17890 2686 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence329 248 811 gene locus_tag LOCUS_17900 248 811 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_17900 1944 1060 gene locus_tag LOCUS_17910 gene miaA 1944 1060 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000504940.1 protein_id gnl|my_center|LOCUS_17910 3285 2023 gene locus_tag LOCUS_17920 gene miaB 3285 2023 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986381.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence330 359 664 gene locus_tag LOCUS_17930 359 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227996.1 protein_id gnl|my_center|LOCUS_17930 863 1060 gene locus_tag LOCUS_17940 863 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1066 1191 gene locus_tag LOCUS_17950 1066 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 1638 3200 gene locus_tag LOCUS_17960 1638 3200 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065935.1 protein_id gnl|my_center|LOCUS_17960 >Feature sequence331 563 1639 gene locus_tag LOCUS_17970 563 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250304.1 protein_id gnl|my_center|LOCUS_17970 1667 1906 gene locus_tag LOCUS_17980 1667 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 1927 2187 gene locus_tag LOCUS_17990 1927 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence332 2967 646 gene locus_tag LOCUS_18000 2967 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence333 2593 1205 gene locus_tag LOCUS_18010 2593 1205 CDS product Y4yA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921741.1 protein_id gnl|my_center|LOCUS_18010 3264 2602 gene locus_tag LOCUS_18020 3264 2602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence334 1199 78 gene locus_tag LOCUS_18030 1199 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 2508 1375 gene locus_tag LOCUS_18040 2508 1375 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868579.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence335 301 453 gene locus_tag LOCUS_18050 301 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 513 698 gene locus_tag LOCUS_18060 513 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 761 1255 gene locus_tag LOCUS_18070 761 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1324 1527 gene locus_tag LOCUS_18080 1324 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 1882 1607 gene locus_tag LOCUS_18090 1882 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 2246 1953 gene locus_tag LOCUS_18100 2246 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3062 2265 gene locus_tag LOCUS_18110 3062 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence336 2287 809 gene locus_tag LOCUS_18120 gene tgtA 2287 809 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024298.1 protein_id gnl|my_center|LOCUS_18120 2561 2313 gene locus_tag LOCUS_18130 2561 2313 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021744.1 protein_id gnl|my_center|LOCUS_18130 3133 2933 gene locus_tag LOCUS_18140 3133 2933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence337 517 1047 gene locus_tag LOCUS_18150 517 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1044 1526 gene locus_tag LOCUS_18160 1044 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence338 486 800 gene locus_tag LOCUS_18170 486 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 800 1066 gene locus_tag LOCUS_18180 800 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1041 2522 gene locus_tag LOCUS_18190 1041 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 2523 2870 gene locus_tag LOCUS_18200 2523 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 >Feature sequence339 1954 536 gene locus_tag LOCUS_18210 1954 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence340 <1 551 gene locus_tag LOCUS_18220 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962698.1:transcription antitermination factor NusB 580 1122 gene locus_tag LOCUS_18230 580 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 1129 1443 gene locus_tag LOCUS_18240 1129 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 2140 1541 gene locus_tag LOCUS_18250 2140 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 3151 2360 gene locus_tag LOCUS_18260 3151 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence341 2498 1935 gene locus_tag LOCUS_18270 2498 1935 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021279.1 protein_id gnl|my_center|LOCUS_18270 2933 2505 gene locus_tag LOCUS_18280 2933 2505 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021280.1 protein_id gnl|my_center|LOCUS_18280 >Feature sequence342 967 203 gene locus_tag LOCUS_18290 967 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 1108 971 gene locus_tag LOCUS_18300 1108 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 1484 1182 gene locus_tag LOCUS_18310 1484 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 2075 1491 gene locus_tag LOCUS_18320 2075 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2913 2080 gene locus_tag LOCUS_18330 2913 2080 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806072.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence343 255 172 gene locus_tag LOCUS_t00310 255 172 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1486 275 gene locus_tag LOCUS_18340 gene tsaD 1486 275 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731954.1 protein_id gnl|my_center|LOCUS_18340 1589 1674 gene locus_tag LOCUS_t00320 1589 1674 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence344 491 324 gene locus_tag LOCUS_18350 491 324 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_18350 1142 636 gene locus_tag LOCUS_18360 1142 636 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065785.1 protein_id gnl|my_center|LOCUS_18360 2130 1144 gene locus_tag LOCUS_18370 gene mer 2130 1144 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023637.1 protein_id gnl|my_center|LOCUS_18370 3150 2596 gene locus_tag LOCUS_18380 3150 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence345 485 1501 gene locus_tag LOCUS_18390 485 1501 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879606.1 protein_id gnl|my_center|LOCUS_18390 1494 2498 gene locus_tag LOCUS_18400 1494 2498 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023080.1 protein_id gnl|my_center|LOCUS_18400 2783 2917 gene locus_tag LOCUS_18410 2783 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 >Feature sequence346 1631 141 gene locus_tag LOCUS_18420 gene pap 1631 141 CDS product polyphosphate:AMP phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941390.1 protein_id gnl|my_center|LOCUS_18420 1910 2101 gene locus_tag LOCUS_18430 1910 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 2303 2662 gene locus_tag LOCUS_18440 2303 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072091.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence347 112 678 gene locus_tag LOCUS_18450 112 678 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254908.1 protein_id gnl|my_center|LOCUS_18450 752 1063 gene locus_tag LOCUS_18460 752 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 1072 1332 gene locus_tag LOCUS_18470 1072 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 1364 3010 gene locus_tag LOCUS_18480 1364 3010 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073697.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence348 579 13 gene locus_tag LOCUS_18490 579 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 1724 666 gene locus_tag LOCUS_18500 1724 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 <3122 1781 gene locus_tag LOCUS_18510 <3122 1781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence349 39 1373 gene locus_tag LOCUS_18520 39 1373 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_18520 1482 2261 gene locus_tag LOCUS_18530 1482 2261 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_18530 2279 2890 gene locus_tag LOCUS_18540 2279 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 >Feature sequence350 <1 2248 gene locus_tag LOCUS_18550 <1 2248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein 2287 2922 gene locus_tag LOCUS_18560 2287 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 >Feature sequence351 2887 1448 gene locus_tag LOCUS_18570 2887 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 >Feature sequence352 417 959 gene locus_tag LOCUS_18580 417 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 965 2149 gene locus_tag LOCUS_18590 965 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 2216 2974 gene locus_tag LOCUS_18600 2216 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 >Feature sequence353 1143 1433 gene locus_tag LOCUS_18610 1143 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18610 1434 1985 gene locus_tag LOCUS_18620 1434 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 2000 >3104 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccttgttttaatggaataaagtcataaac >Feature sequence354 2971 341 gene locus_tag LOCUS_18630 2971 341 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108228.1 protein_id gnl|my_center|LOCUS_18630 >Feature sequence355 1899 382 gene locus_tag LOCUS_18640 1899 382 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023184.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence356 2233 47 gene locus_tag LOCUS_18650 gene recG 2233 47 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence357 1 234 gene locus_tag LOCUS_18660 1 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 1916 412 gene locus_tag LOCUS_r00050 1916 412 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2246 2173 gene locus_tag LOCUS_t00330 2246 2173 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2613 2278 gene locus_tag LOCUS_18670 2613 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 >Feature sequence358 259 636 gene locus_tag LOCUS_18680 259 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 646 1110 gene locus_tag LOCUS_18690 646 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 1355 2167 gene locus_tag LOCUS_18700 1355 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 2154 3002 gene locus_tag LOCUS_18710 2154 3002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 >Feature sequence359 962 336 gene locus_tag LOCUS_18720 gene trmY 962 336 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066221.1 protein_id gnl|my_center|LOCUS_18720 2506 1016 gene locus_tag LOCUS_18730 2506 1016 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589535.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence360 1223 1501 gene locus_tag LOCUS_18740 1223 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 1505 1807 gene locus_tag LOCUS_18750 1505 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 2068 2565 gene locus_tag LOCUS_18760 2068 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 >Feature sequence361 418 2139 gene locus_tag LOCUS_18770 418 2139 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence362 148 1281 gene locus_tag LOCUS_18780 148 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 1278 2423 gene locus_tag LOCUS_18790 1278 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 2726 2568 gene locus_tag LOCUS_18800 2726 2568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence363 2567 150 gene locus_tag LOCUS_18810 2567 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 >Feature sequence364 2017 926 gene locus_tag LOCUS_18820 gene murG 2017 926 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_18820 <3059 2180 gene locus_tag LOCUS_18830 <3059 2180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964157.1:FtsW/RodA/SpoVE family cell cycle protein >Feature sequence365 >Feature sequence366 465 241 gene locus_tag LOCUS_18840 465 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 840 475 gene locus_tag LOCUS_18850 840 475 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072235.1 protein_id gnl|my_center|LOCUS_18850 1398 844 gene locus_tag LOCUS_18860 1398 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 <3053 1419 gene locus_tag LOCUS_18870 <3053 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000370329.1:penicillin-binding protein 2 >Feature sequence367 1301 93 gene locus_tag LOCUS_18880 1301 93 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_18880 2754 1732 gene locus_tag LOCUS_18890 gene gmd 2754 1732 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066186.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence368 <1 942 gene locus_tag LOCUS_18900 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein 1203 1325 gene locus_tag LOCUS_18910 1203 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 2031 1579 gene locus_tag LOCUS_18920 2031 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 2260 2021 gene locus_tag LOCUS_18930 2260 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 >Feature sequence369 513 1772 gene locus_tag LOCUS_18940 gene ftsA 513 1772 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957399.1 protein_id gnl|my_center|LOCUS_18940 1774 2142 gene locus_tag LOCUS_18950 1774 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2487 2278 gene locus_tag LOCUS_18960 2487 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence370 2712 1675 gene locus_tag LOCUS_18970 2712 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence371 2424 2104 gene locus_tag LOCUS_18980 2424 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence372 1732 242 gene locus_tag LOCUS_18990 1732 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 2883 1729 gene locus_tag LOCUS_19000 2883 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence373 <1 1020 gene locus_tag LOCUS_19010 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000039472.1:DNA polymerase 1109 1387 gene locus_tag LOCUS_19020 1109 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 1457 1777 gene locus_tag LOCUS_19030 1457 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 1836 2177 gene locus_tag LOCUS_19040 1836 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 2252 2371 gene locus_tag LOCUS_19050 2252 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence374 <3003 847 gene locus_tag LOCUS_19060 <3003 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205278.1:AAA family ATPase >Feature sequence375 1466 1242 gene locus_tag LOCUS_19070 1466 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1675 1460 gene locus_tag LOCUS_19080 1675 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2676 1924 gene locus_tag LOCUS_19090 gene mobB 2676 1924 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence376 1050 1235 gene locus_tag LOCUS_19100 1050 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 >Feature sequence377 2223 759 gene locus_tag LOCUS_r00060 2223 759 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence378 1511 85 gene locus_tag LOCUS_r00070 1511 85 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence379 33 106 gene locus_tag LOCUS_t00340 33 106 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence380 >Feature sequence381 295 107 gene locus_tag LOCUS_19110 295 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 >Feature sequence382 >Feature sequence383 >Feature sequence384 >Feature sequence385