>Feature sequence001 664 209 gene locus_tag LOCUS_00010 664 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1176 670 gene locus_tag LOCUS_00020 1176 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2099 1431 gene locus_tag LOCUS_00030 2099 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2819 2166 gene locus_tag LOCUS_00040 2819 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 3151 4005 gene locus_tag LOCUS_00050 3151 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4081 4917 gene locus_tag LOCUS_00060 4081 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5202 6677 gene locus_tag LOCUS_00070 gene purF 5202 6677 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233947.1 protein_id gnl|my_center|LOCUS_00070 6730 7785 gene locus_tag LOCUS_00080 6730 7785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 7818 8507 gene locus_tag LOCUS_00090 7818 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9472 8504 gene locus_tag LOCUS_00100 9472 8504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533422.1 protein_id gnl|my_center|LOCUS_00100 10154 9480 gene locus_tag LOCUS_00110 10154 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10944 10168 gene locus_tag LOCUS_00120 10944 10168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 12634 10937 gene locus_tag LOCUS_00130 12634 10937 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919212.1 protein_id gnl|my_center|LOCUS_00130 13855 13193 gene locus_tag LOCUS_00140 13855 13193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14588 13848 gene locus_tag LOCUS_00150 14588 13848 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_00150 15726 14599 gene locus_tag LOCUS_00160 15726 14599 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392163.1 protein_id gnl|my_center|LOCUS_00160 15824 15752 gene locus_tag LOCUS_t00010 15824 15752 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17697 15946 gene locus_tag LOCUS_00170 gene rpoD 17697 15946 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_00170 19500 17722 gene locus_tag LOCUS_00180 gene dnaG 19500 17722 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_00180 19994 19518 gene locus_tag LOCUS_00190 19994 19518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 20475 20029 gene locus_tag LOCUS_00200 20475 20029 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081070.1 protein_id gnl|my_center|LOCUS_00200 20696 20472 gene locus_tag LOCUS_00210 gene rpsU 20696 20472 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943714.1 protein_id gnl|my_center|LOCUS_00210 21798 20902 gene locus_tag LOCUS_00220 21798 20902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 22349 21891 gene locus_tag LOCUS_00230 22349 21891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 24101 22446 gene locus_tag LOCUS_00240 24101 22446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257117.1 protein_id gnl|my_center|LOCUS_00240 25403 24117 gene locus_tag LOCUS_00250 25403 24117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 26335 25400 gene locus_tag LOCUS_00260 26335 25400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26785 27225 gene locus_tag LOCUS_00270 26785 27225 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110592.1 protein_id gnl|my_center|LOCUS_00270 27245 27796 gene locus_tag LOCUS_00280 27245 27796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 27807 28799 gene locus_tag LOCUS_00290 27807 28799 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_00290 28822 29637 gene locus_tag LOCUS_00300 28822 29637 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729058.1 protein_id gnl|my_center|LOCUS_00300 29677 32049 gene locus_tag LOCUS_00310 29677 32049 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_00310 32081 33016 gene locus_tag LOCUS_00320 32081 33016 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_00320 33052 33852 gene locus_tag LOCUS_00330 33052 33852 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406327.1 protein_id gnl|my_center|LOCUS_00330 33878 35245 gene locus_tag LOCUS_00340 33878 35245 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525150.1 protein_id gnl|my_center|LOCUS_00340 35258 36424 gene locus_tag LOCUS_00350 35258 36424 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_00350 36473 38461 gene locus_tag LOCUS_00360 gene aor 36473 38461 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_00360 38568 39215 gene locus_tag LOCUS_00370 38568 39215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 39264 40814 gene locus_tag LOCUS_00380 39264 40814 CDS product flavocytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775406.1 protein_id gnl|my_center|LOCUS_00380 42798 40849 gene locus_tag LOCUS_00390 42798 40849 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927144.1 protein_id gnl|my_center|LOCUS_00390 43705 43016 gene locus_tag LOCUS_00400 43705 43016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 45067 43892 gene locus_tag LOCUS_00410 45067 43892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 47471 45156 gene locus_tag LOCUS_00420 47471 45156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 48274 47471 gene locus_tag LOCUS_00430 48274 47471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 49524 48274 gene locus_tag LOCUS_00440 49524 48274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 49734 50534 gene locus_tag LOCUS_00450 49734 50534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 50659 51399 gene locus_tag LOCUS_00460 50659 51399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 51718 53361 gene locus_tag LOCUS_00470 51718 53361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53419 54099 gene locus_tag LOCUS_00480 53419 54099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 54107 56143 gene locus_tag LOCUS_00490 54107 56143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 56140 57381 gene locus_tag LOCUS_00500 56140 57381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 57391 58164 gene locus_tag LOCUS_00510 57391 58164 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223496031.1 protein_id gnl|my_center|LOCUS_00510 58803 58189 gene locus_tag LOCUS_00520 58803 58189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61243 58895 gene locus_tag LOCUS_00530 61243 58895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 62605 61271 gene locus_tag LOCUS_00540 62605 61271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 63734 67291 gene locus_tag LOCUS_00550 63734 67291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 67322 70924 gene locus_tag LOCUS_00560 67322 70924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 70957 71292 gene locus_tag LOCUS_00570 70957 71292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 71392 88035 gene locus_tag LOCUS_00580 71392 88035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 88062 90773 gene locus_tag LOCUS_00590 88062 90773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 92888 91182 gene locus_tag LOCUS_00600 92888 91182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 94054 93083 gene locus_tag LOCUS_00610 94054 93083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 94595 97045 gene locus_tag LOCUS_00620 94595 97045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 97155 97667 gene locus_tag LOCUS_00630 97155 97667 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249673.1 protein_id gnl|my_center|LOCUS_00630 99459 97756 gene locus_tag LOCUS_00640 99459 97756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 101734 99464 gene locus_tag LOCUS_00650 101734 99464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 101985 102275 gene locus_tag LOCUS_00660 101985 102275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 103489 102281 gene locus_tag LOCUS_00670 103489 102281 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_00670 104742 103486 gene locus_tag LOCUS_00680 104742 103486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 104923 105846 gene locus_tag LOCUS_00690 104923 105846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 105833 107131 gene locus_tag LOCUS_00700 105833 107131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 107545 107153 gene locus_tag LOCUS_00710 107545 107153 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965490.1 protein_id gnl|my_center|LOCUS_00710 109239 107542 gene locus_tag LOCUS_00720 109239 107542 CDS product HAD-IIIC family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336813.1 protein_id gnl|my_center|LOCUS_00720 109535 109236 gene locus_tag LOCUS_00730 109535 109236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002723515.1 protein_id gnl|my_center|LOCUS_00730 109653 110552 gene locus_tag LOCUS_00740 109653 110552 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073150.1 protein_id gnl|my_center|LOCUS_00740 110571 111893 gene locus_tag LOCUS_00750 110571 111893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 112153 111881 gene locus_tag LOCUS_00760 112153 111881 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_00760 113134 112178 gene locus_tag LOCUS_00770 gene ispB 113134 112178 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038769.1 protein_id gnl|my_center|LOCUS_00770 114063 113134 gene locus_tag LOCUS_00780 114063 113134 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_00780 114699 114163 gene locus_tag LOCUS_00790 114699 114163 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_00790 114832 115845 gene locus_tag LOCUS_00800 114832 115845 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_00800 116819 115854 gene locus_tag LOCUS_00810 gene nagB 116819 115854 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804961.1 protein_id gnl|my_center|LOCUS_00810 118233 116875 gene locus_tag LOCUS_00820 gene glmM 118233 116875 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_00820 119518 118256 gene locus_tag LOCUS_00830 119518 118256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 119705 120910 gene locus_tag LOCUS_00840 119705 120910 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_00840 120958 123162 gene locus_tag LOCUS_00850 120958 123162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 123324 124427 gene locus_tag LOCUS_00860 123324 124427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 125022 124444 gene locus_tag LOCUS_00870 125022 124444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 125473 125039 gene locus_tag LOCUS_00880 125473 125039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 126172 125489 gene locus_tag LOCUS_00890 126172 125489 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_00890 127109 126261 gene locus_tag LOCUS_00900 127109 126261 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_00900 127286 127594 gene locus_tag LOCUS_00910 127286 127594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 129971 127659 gene locus_tag LOCUS_00920 129971 127659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 130294 132189 gene locus_tag LOCUS_00930 gene dnaK 130294 132189 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_00930 132295 133272 gene locus_tag LOCUS_00940 132295 133272 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334279.1 protein_id gnl|my_center|LOCUS_00940 133290 133940 gene locus_tag LOCUS_00950 gene grpE 133290 133940 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021491.1 protein_id gnl|my_center|LOCUS_00950 133937 134410 gene locus_tag LOCUS_00960 133937 134410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 134435 135802 gene locus_tag LOCUS_00970 134435 135802 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_00970 137104 135812 gene locus_tag LOCUS_00980 137104 135812 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_00980 138716 137130 gene locus_tag LOCUS_00990 gene serA 138716 137130 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00990 140830 138857 gene locus_tag LOCUS_01000 140830 138857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 142566 140923 gene locus_tag LOCUS_01010 142566 140923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 142717 143712 gene locus_tag LOCUS_01020 142717 143712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 143737 145122 gene locus_tag LOCUS_01030 143737 145122 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_01030 145230 145769 gene locus_tag LOCUS_01040 gene cobO 145230 145769 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948638.1 protein_id gnl|my_center|LOCUS_01040 145773 146840 gene locus_tag LOCUS_01050 145773 146840 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942826.1 protein_id gnl|my_center|LOCUS_01050 147833 146865 gene locus_tag LOCUS_01060 147833 146865 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942538.1 protein_id gnl|my_center|LOCUS_01060 148622 147843 gene locus_tag LOCUS_01070 gene kdsB 148622 147843 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_01070 148785 149597 gene locus_tag LOCUS_01080 148785 149597 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023864.1 protein_id gnl|my_center|LOCUS_01080 149617 150933 gene locus_tag LOCUS_01090 149617 150933 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01090 150930 151673 gene locus_tag LOCUS_01100 150930 151673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 151651 152706 gene locus_tag LOCUS_01110 151651 152706 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392329.1 protein_id gnl|my_center|LOCUS_01110 154072 152720 gene locus_tag LOCUS_01120 154072 152720 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01120 154195 155667 gene locus_tag LOCUS_01130 154195 155667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 155668 156996 gene locus_tag LOCUS_01140 155668 156996 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01140 158325 157006 gene locus_tag LOCUS_01150 158325 157006 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_01150 159826 158429 gene locus_tag LOCUS_01160 159826 158429 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926801.1 protein_id gnl|my_center|LOCUS_01160 162366 159919 gene locus_tag LOCUS_01170 162366 159919 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392112.1 protein_id gnl|my_center|LOCUS_01170 164197 162359 gene locus_tag LOCUS_01180 gene uvrC 164197 162359 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943890.1 protein_id gnl|my_center|LOCUS_01180 164535 164194 gene locus_tag LOCUS_01190 164535 164194 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_01190 166665 164605 gene locus_tag LOCUS_01200 gene uvrB 166665 164605 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943874.1 protein_id gnl|my_center|LOCUS_01200 167571 166669 gene locus_tag LOCUS_01210 167571 166669 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001681808.1 protein_id gnl|my_center|LOCUS_01210 <170126 167605 gene locus_tag LOCUS_01220 <170126 167605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence002 2759 1212 gene locus_tag LOCUS_01230 gene bchE 2759 1212 CDS product magnesium-protoporphyrin IX monomethyl ester anaerobic oxidative cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259511.1 protein_id gnl|my_center|LOCUS_01230 4194 2761 gene locus_tag LOCUS_01240 4194 2761 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940278.1 protein_id gnl|my_center|LOCUS_01240 5536 4436 gene locus_tag LOCUS_01250 5536 4436 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061731.1 protein_id gnl|my_center|LOCUS_01250 6255 5533 gene locus_tag LOCUS_01260 6255 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 7511 6327 gene locus_tag LOCUS_01270 7511 6327 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061734.1 protein_id gnl|my_center|LOCUS_01270 8535 7504 gene locus_tag LOCUS_01280 8535 7504 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257504.1 protein_id gnl|my_center|LOCUS_01280 8715 9710 gene locus_tag LOCUS_01290 8715 9710 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_01290 11295 9718 gene locus_tag LOCUS_01300 11295 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 13213 11330 gene locus_tag LOCUS_01310 gene ilvG 13213 11330 CDS product acetolactate synthase 2 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038423.1 protein_id gnl|my_center|LOCUS_01310 14719 13259 gene locus_tag LOCUS_01320 14719 13259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 14863 16794 gene locus_tag LOCUS_01330 14863 16794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 16911 18692 gene locus_tag LOCUS_01340 gene phoR 16911 18692 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941762.1 protein_id gnl|my_center|LOCUS_01340 18817 19866 gene locus_tag LOCUS_01350 gene pstS 18817 19866 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930170.1 protein_id gnl|my_center|LOCUS_01350 19947 20885 gene locus_tag LOCUS_01360 gene pstC 19947 20885 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_01360 20882 21727 gene locus_tag LOCUS_01370 gene pstA 20882 21727 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251985.1 protein_id gnl|my_center|LOCUS_01370 21724 22563 gene locus_tag LOCUS_01380 gene pstB 21724 22563 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930167.1 protein_id gnl|my_center|LOCUS_01380 22583 23242 gene locus_tag LOCUS_01390 gene phoU 22583 23242 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_01390 24101 23301 gene locus_tag LOCUS_01400 24101 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 24338 27301 gene locus_tag LOCUS_01410 24338 27301 CDS product formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319769.1 protein_id gnl|my_center|LOCUS_01410 27301 28209 gene locus_tag LOCUS_01420 27301 28209 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942747.1 protein_id gnl|my_center|LOCUS_01420 28370 30985 gene locus_tag LOCUS_01430 28370 30985 CDS product bifunctional aspartate kinase/diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403080.1 protein_id gnl|my_center|LOCUS_01430 31062 31940 gene locus_tag LOCUS_01440 31062 31940 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942150.1 protein_id gnl|my_center|LOCUS_01440 31944 33203 gene locus_tag LOCUS_01450 31944 33203 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257973.1 protein_id gnl|my_center|LOCUS_01450 33205 34746 gene locus_tag LOCUS_01460 33205 34746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 34875 35276 gene locus_tag LOCUS_01470 34875 35276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 35276 36394 gene locus_tag LOCUS_01480 35276 36394 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875973.1 protein_id gnl|my_center|LOCUS_01480 36391 37164 gene locus_tag LOCUS_01490 36391 37164 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229973.1 protein_id gnl|my_center|LOCUS_01490 37204 38307 gene locus_tag LOCUS_01500 37204 38307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 38320 39063 gene locus_tag LOCUS_01510 38320 39063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 39137 40189 gene locus_tag LOCUS_01520 39137 40189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 40195 41223 gene locus_tag LOCUS_01530 40195 41223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 42255 41227 gene locus_tag LOCUS_01540 42255 41227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 44021 42252 gene locus_tag LOCUS_01550 44021 42252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 44134 45066 gene locus_tag LOCUS_01560 44134 45066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 45083 46054 gene locus_tag LOCUS_01570 45083 46054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 46057 47100 gene locus_tag LOCUS_01580 46057 47100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 47097 47954 gene locus_tag LOCUS_01590 47097 47954 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_01590 48013 48429 gene locus_tag LOCUS_01600 48013 48429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 49585 48416 gene locus_tag LOCUS_01610 49585 48416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 50528 49626 gene locus_tag LOCUS_01620 50528 49626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582477.1 protein_id gnl|my_center|LOCUS_01620 52687 50531 gene locus_tag LOCUS_01630 52687 50531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 53427 52774 gene locus_tag LOCUS_01640 53427 52774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_01640 54977 53523 gene locus_tag LOCUS_01650 54977 53523 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072957.1 protein_id gnl|my_center|LOCUS_01650 55300 55956 gene locus_tag LOCUS_01660 55300 55956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 56163 57581 gene locus_tag LOCUS_01670 56163 57581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 57592 58704 gene locus_tag LOCUS_01680 57592 58704 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_01680 58746 61802 gene locus_tag LOCUS_01690 58746 61802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 62097 62420 gene locus_tag LOCUS_01700 62097 62420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 63729 62695 gene locus_tag LOCUS_01710 63729 62695 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902666.1 protein_id gnl|my_center|LOCUS_01710 65873 63732 gene locus_tag LOCUS_01720 65873 63732 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_01720 67775 65877 gene locus_tag LOCUS_01730 67775 65877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 67961 69046 gene locus_tag LOCUS_01740 67961 69046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727033.1 protein_id gnl|my_center|LOCUS_01740 69043 69903 gene locus_tag LOCUS_01750 69043 69903 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803837.1 protein_id gnl|my_center|LOCUS_01750 69900 70703 gene locus_tag LOCUS_01760 69900 70703 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929855.1 protein_id gnl|my_center|LOCUS_01760 70693 71910 gene locus_tag LOCUS_01770 70693 71910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 72651 71947 gene locus_tag LOCUS_01780 72651 71947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 74049 72739 gene locus_tag LOCUS_01790 74049 72739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 75041 74046 gene locus_tag LOCUS_01800 75041 74046 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_01800 77800 75191 gene locus_tag LOCUS_01810 gene alaS 77800 75191 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_01810 79248 78025 gene locus_tag LOCUS_01820 79248 78025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 80908 79649 gene locus_tag LOCUS_01830 80908 79649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 81269 81676 gene locus_tag LOCUS_01840 81269 81676 CDS product enamine/imine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719990.1 protein_id gnl|my_center|LOCUS_01840 81759 83435 gene locus_tag LOCUS_01850 81759 83435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 84210 83371 gene locus_tag LOCUS_01860 gene dapF 84210 83371 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_01860 84506 84207 gene locus_tag LOCUS_01870 84506 84207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 85440 84523 gene locus_tag LOCUS_01880 85440 84523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 86369 85437 gene locus_tag LOCUS_01890 86369 85437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 87068 86451 gene locus_tag LOCUS_01900 87068 86451 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_01900 87826 87074 gene locus_tag LOCUS_01910 87826 87074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 88764 87823 gene locus_tag LOCUS_01920 88764 87823 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_01920 90164 88845 gene locus_tag LOCUS_01930 gene rsxC 90164 88845 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583453.1 protein_id gnl|my_center|LOCUS_01930 91195 90161 gene locus_tag LOCUS_01940 91195 90161 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428486.1 protein_id gnl|my_center|LOCUS_01940 91781 91200 gene locus_tag LOCUS_01950 gene rsxA 91781 91200 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096898.1 protein_id gnl|my_center|LOCUS_01950 92275 92826 gene locus_tag LOCUS_01960 92275 92826 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_01960 92823 93512 gene locus_tag LOCUS_01970 92823 93512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 93677 94201 gene locus_tag LOCUS_01980 93677 94201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 97889 94218 gene locus_tag LOCUS_01990 97889 94218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 98516 98250 gene locus_tag LOCUS_02000 98516 98250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 98968 99717 gene locus_tag LOCUS_02010 98968 99717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 102607 100040 gene locus_tag LOCUS_02020 gene clpB 102607 100040 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941319.1 protein_id gnl|my_center|LOCUS_02020 103386 102712 gene locus_tag LOCUS_02030 103386 102712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 103601 104047 gene locus_tag LOCUS_02040 103601 104047 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_02040 104274 105704 gene locus_tag LOCUS_02050 104274 105704 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_02050 105970 107481 gene locus_tag LOCUS_02060 105970 107481 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_02060 108126 109106 gene locus_tag LOCUS_02070 108126 109106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 109269 111197 gene locus_tag LOCUS_02080 109269 111197 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138655632.1 protein_id gnl|my_center|LOCUS_02080 111856 111347 gene locus_tag LOCUS_02090 111856 111347 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_02090 112515 111856 gene locus_tag LOCUS_02100 112515 111856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 112729 113313 gene locus_tag LOCUS_02110 112729 113313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 113464 113374 gene locus_tag LOCUS_t00020 113464 113374 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 113568 113483 gene locus_tag LOCUS_t00030 113568 113483 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 113860 115182 gene locus_tag LOCUS_02120 113860 115182 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_02120 115182 115733 gene locus_tag LOCUS_02130 115182 115733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 115745 116914 gene locus_tag LOCUS_02140 115745 116914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 116927 117886 gene locus_tag LOCUS_02150 gene arcC 116927 117886 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_02150 118025 120181 gene locus_tag LOCUS_02160 118025 120181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 120178 122145 gene locus_tag LOCUS_02170 120178 122145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 124279 122162 gene locus_tag LOCUS_02180 124279 122162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 126257 124308 gene locus_tag LOCUS_02190 126257 124308 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_02190 127307 126366 gene locus_tag LOCUS_02200 127307 126366 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037429.1 protein_id gnl|my_center|LOCUS_02200 128396 127455 gene locus_tag LOCUS_02210 128396 127455 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037429.1 protein_id gnl|my_center|LOCUS_02210 128656 128393 gene locus_tag LOCUS_02220 128656 128393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 128736 129821 gene locus_tag LOCUS_02230 128736 129821 CDS product MltA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056813.1 protein_id gnl|my_center|LOCUS_02230 129884 131182 gene locus_tag LOCUS_02240 129884 131182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 131257 132153 gene locus_tag LOCUS_02250 131257 132153 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285971.1 protein_id gnl|my_center|LOCUS_02250 132320 133357 gene locus_tag LOCUS_02260 132320 133357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 133507 134970 gene locus_tag LOCUS_02270 133507 134970 CDS product anti-phage dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036788256.1 protein_id gnl|my_center|LOCUS_02270 134967 135149 gene locus_tag LOCUS_02280 134967 135149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 137199 135202 gene locus_tag LOCUS_02290 137199 135202 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_02290 139671 137215 gene locus_tag LOCUS_02300 139671 137215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 140194 139688 gene locus_tag LOCUS_02310 140194 139688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 140486 141337 gene locus_tag LOCUS_02320 140486 141337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 141324 141755 gene locus_tag LOCUS_02330 141324 141755 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_02330 141765 142463 gene locus_tag LOCUS_02340 141765 142463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 144426 142639 gene locus_tag LOCUS_02350 144426 142639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 145383 144505 gene locus_tag LOCUS_02360 145383 144505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 145431 146171 gene locus_tag LOCUS_02370 145431 146171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 146245 147213 gene locus_tag LOCUS_02380 146245 147213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878828.1 protein_id gnl|my_center|LOCUS_02380 148457 147324 gene locus_tag LOCUS_02390 148457 147324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 148641 148438 gene locus_tag LOCUS_02400 148641 148438 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496483.1 protein_id gnl|my_center|LOCUS_02400 148739 150166 gene locus_tag LOCUS_02410 148739 150166 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_02410 150279 151655 gene locus_tag LOCUS_02420 150279 151655 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147298.1 protein_id gnl|my_center|LOCUS_02420 151677 153080 gene locus_tag LOCUS_02430 151677 153080 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_02430 154882 153878 gene locus_tag LOCUS_02440 gene gap 154882 153878 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_02440 155942 154896 gene locus_tag LOCUS_02450 gene gap 155942 154896 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081074.1 protein_id gnl|my_center|LOCUS_02450 156146 156541 gene locus_tag LOCUS_02460 156146 156541 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941050.1 protein_id gnl|my_center|LOCUS_02460 157848 156814 gene locus_tag LOCUS_02470 157848 156814 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_02470 158648 157923 gene locus_tag LOCUS_02480 158648 157923 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_02480 160439 158691 gene locus_tag LOCUS_02490 160439 158691 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226410.1 protein_id gnl|my_center|LOCUS_02490 161001 160612 gene locus_tag LOCUS_02500 161001 160612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 161408 161190 gene locus_tag LOCUS_02510 161408 161190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 >Feature sequence003 377 2362 gene locus_tag LOCUS_02520 377 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 2839 3780 gene locus_tag LOCUS_02530 2839 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 4204 4815 gene locus_tag LOCUS_02540 gene rpoE 4204 4815 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_02540 4812 6056 gene locus_tag LOCUS_02550 4812 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 7215 6046 gene locus_tag LOCUS_02560 7215 6046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 8645 7230 gene locus_tag LOCUS_02570 gene pyk 8645 7230 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728910.1 protein_id gnl|my_center|LOCUS_02570 8769 9425 gene locus_tag LOCUS_02580 8769 9425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 9450 10841 gene locus_tag LOCUS_02590 9450 10841 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_02590 11430 10825 gene locus_tag LOCUS_02600 11430 10825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 12040 11432 gene locus_tag LOCUS_02610 12040 11432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 12639 12085 gene locus_tag LOCUS_02620 12639 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 12777 13823 gene locus_tag LOCUS_02630 12777 13823 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_02630 13827 14528 gene locus_tag LOCUS_02640 13827 14528 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215448.1 protein_id gnl|my_center|LOCUS_02640 14617 15705 gene locus_tag LOCUS_02650 14617 15705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15683 16216 gene locus_tag LOCUS_02660 15683 16216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 16225 16728 gene locus_tag LOCUS_02670 16225 16728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16718 18649 gene locus_tag LOCUS_02680 16718 18649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 18720 19508 gene locus_tag LOCUS_02690 18720 19508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 20513 19716 gene locus_tag LOCUS_02700 20513 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 21103 21828 gene locus_tag LOCUS_02710 21103 21828 CDS product protein tyrosine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929232.1 protein_id gnl|my_center|LOCUS_02710 21825 23453 gene locus_tag LOCUS_02720 gene gspE 21825 23453 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478662.1 protein_id gnl|my_center|LOCUS_02720 23463 24602 gene locus_tag LOCUS_02730 23463 24602 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930876.1 protein_id gnl|my_center|LOCUS_02730 24621 27632 gene locus_tag LOCUS_02740 24621 27632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 27625 30924 gene locus_tag LOCUS_02750 27625 30924 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839229.1 protein_id gnl|my_center|LOCUS_02750 32267 31554 gene locus_tag LOCUS_02760 32267 31554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 32794 32267 gene locus_tag LOCUS_02770 32794 32267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 33500 32763 gene locus_tag LOCUS_02780 33500 32763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 34896 33664 gene locus_tag LOCUS_02790 34896 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 35045 35290 gene locus_tag LOCUS_02800 35045 35290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 35409 35666 gene locus_tag LOCUS_02810 35409 35666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 35730 36320 gene locus_tag LOCUS_02820 35730 36320 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_02820 36663 38207 gene locus_tag LOCUS_02830 36663 38207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 38346 39776 gene locus_tag LOCUS_02840 38346 39776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 40700 39888 gene locus_tag LOCUS_02850 40700 39888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965626.1 protein_id gnl|my_center|LOCUS_02850 40828 44802 gene locus_tag LOCUS_02860 40828 44802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 44804 45919 gene locus_tag LOCUS_02870 gene mraY 44804 45919 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769458.1 protein_id gnl|my_center|LOCUS_02870 46529 46930 gene locus_tag LOCUS_02880 46529 46930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 47031 49337 gene locus_tag LOCUS_02890 47031 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 52002 49285 gene locus_tag LOCUS_02900 52002 49285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 53790 52120 gene locus_tag LOCUS_02910 53790 52120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 54618 55625 gene locus_tag LOCUS_02920 54618 55625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 58423 56327 gene locus_tag LOCUS_02930 58423 56327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 60585 58420 gene locus_tag LOCUS_02940 60585 58420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 62754 60586 gene locus_tag LOCUS_02950 62754 60586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 63659 62751 gene locus_tag LOCUS_02960 63659 62751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_02960 64559 63825 gene locus_tag LOCUS_02970 64559 63825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 65342 65920 gene locus_tag LOCUS_02980 65342 65920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 67972 66026 gene locus_tag LOCUS_02990 67972 66026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 68120 69178 gene locus_tag LOCUS_03000 68120 69178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 69243 69875 gene locus_tag LOCUS_03010 69243 69875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 69902 71068 gene locus_tag LOCUS_03020 69902 71068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 71413 72528 gene locus_tag LOCUS_03030 71413 72528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 72660 74078 gene locus_tag LOCUS_03040 72660 74078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 75060 74029 gene locus_tag LOCUS_03050 75060 74029 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161648749.1 protein_id gnl|my_center|LOCUS_03050 75964 75077 gene locus_tag LOCUS_03060 75964 75077 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948230.1 protein_id gnl|my_center|LOCUS_03060 76290 76114 gene locus_tag LOCUS_03070 76290 76114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 76958 76404 gene locus_tag LOCUS_03080 76958 76404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 79305 76996 gene locus_tag LOCUS_03090 79305 76996 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_03090 79741 79331 gene locus_tag LOCUS_03100 79741 79331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 79916 81271 gene locus_tag LOCUS_03110 79916 81271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 81811 82647 gene locus_tag LOCUS_03120 81811 82647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 82661 84817 gene locus_tag LOCUS_03130 82661 84817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 84837 88331 gene locus_tag LOCUS_03140 84837 88331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 88328 89446 gene locus_tag LOCUS_03150 88328 89446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 89465 89710 gene locus_tag LOCUS_03160 89465 89710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 89830 90480 gene locus_tag LOCUS_03170 89830 90480 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017058.1 protein_id gnl|my_center|LOCUS_03170 90514 91098 gene locus_tag LOCUS_03180 90514 91098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 91121 91633 gene locus_tag LOCUS_03190 91121 91633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 91679 92971 gene locus_tag LOCUS_03200 91679 92971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 92984 93538 gene locus_tag LOCUS_03210 92984 93538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 93604 94830 gene locus_tag LOCUS_03220 93604 94830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 94838 95716 gene locus_tag LOCUS_03230 94838 95716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 95729 97933 gene locus_tag LOCUS_03240 95729 97933 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_03240 97930 98856 gene locus_tag LOCUS_03250 97930 98856 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_03250 98864 100234 gene locus_tag LOCUS_03260 98864 100234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 100231 101595 gene locus_tag LOCUS_03270 100231 101595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 101582 103240 gene locus_tag LOCUS_03280 101582 103240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 103240 107868 gene locus_tag LOCUS_03290 103240 107868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 107865 110201 gene locus_tag LOCUS_03300 107865 110201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 110198 111718 gene locus_tag LOCUS_03310 110198 111718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 111696 112769 gene locus_tag LOCUS_03320 111696 112769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 114241 112766 gene locus_tag LOCUS_03330 114241 112766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 115794 114232 gene locus_tag LOCUS_03340 115794 114232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 116965 115949 gene locus_tag LOCUS_03350 116965 115949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 118203 116962 gene locus_tag LOCUS_03360 118203 116962 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289079.1 protein_id gnl|my_center|LOCUS_03360 119420 118200 gene locus_tag LOCUS_03370 119420 118200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 120578 119523 gene locus_tag LOCUS_03380 120578 119523 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897464.1 protein_id gnl|my_center|LOCUS_03380 121360 120572 gene locus_tag LOCUS_03390 121360 120572 CDS product amonabactin ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705836.1 protein_id gnl|my_center|LOCUS_03390 122220 121357 gene locus_tag LOCUS_03400 122220 121357 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243040.1 protein_id gnl|my_center|LOCUS_03400 122117 122416 gene locus_tag LOCUS_03410 122117 122416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 123489 122338 gene locus_tag LOCUS_03420 123489 122338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 125623 123569 gene locus_tag LOCUS_03430 gene aor 125623 123569 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_03430 125936 125679 gene locus_tag LOCUS_03440 125936 125679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 126583 126017 gene locus_tag LOCUS_03450 gene folK 126583 126017 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173770.1 protein_id gnl|my_center|LOCUS_03450 126582 127223 gene locus_tag LOCUS_03460 gene nadD 126582 127223 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943828.1 protein_id gnl|my_center|LOCUS_03460 127374 128528 gene locus_tag LOCUS_03470 127374 128528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 128877 129032 gene locus_tag LOCUS_03480 128877 129032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 129072 130757 gene locus_tag LOCUS_03490 gene dnaX 129072 130757 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_03490 130769 131086 gene locus_tag LOCUS_03500 130769 131086 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940772.1 protein_id gnl|my_center|LOCUS_03500 131089 131700 gene locus_tag LOCUS_03510 gene recR 131089 131700 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_03510 131763 132347 gene locus_tag LOCUS_03520 131763 132347 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_03520 132962 132495 gene locus_tag LOCUS_03530 132962 132495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 133341 133012 gene locus_tag LOCUS_03540 133341 133012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 134080 133427 gene locus_tag LOCUS_03550 134080 133427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 134911 134111 gene locus_tag LOCUS_03560 134911 134111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 136998 135517 gene locus_tag LOCUS_03570 136998 135517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 138911 137070 gene locus_tag LOCUS_03580 138911 137070 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881164.1 protein_id gnl|my_center|LOCUS_03580 139451 138924 gene locus_tag LOCUS_03590 139451 138924 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390173.1 protein_id gnl|my_center|LOCUS_03590 140334 139621 gene locus_tag LOCUS_03600 140334 139621 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_03600 140464 142200 gene locus_tag LOCUS_03610 140464 142200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 142553 142203 gene locus_tag LOCUS_03620 142553 142203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 142632 143087 gene locus_tag LOCUS_03630 142632 143087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 143206 143874 gene locus_tag LOCUS_03640 143206 143874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 144122 146038 gene locus_tag LOCUS_03650 144122 146038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 146039 147589 gene locus_tag LOCUS_03660 146039 147589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 147600 149183 gene locus_tag LOCUS_03670 147600 149183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 151019 149187 gene locus_tag LOCUS_03680 151019 149187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 153049 151118 gene locus_tag LOCUS_03690 153049 151118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 153264 153668 gene locus_tag LOCUS_03700 153264 153668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 153675 154025 gene locus_tag LOCUS_03710 153675 154025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 154198 154126 gene locus_tag LOCUS_t00040 154198 154126 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 155888 154338 gene locus_tag LOCUS_03720 155888 154338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 155851 156099 gene locus_tag LOCUS_03730 155851 156099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 >Feature sequence004 <1 846 gene locus_tag LOCUS_03740 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545595.1:peptidyl-prolyl cis-trans isomerase 948 1850 gene locus_tag LOCUS_03750 948 1850 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_03750 1860 2855 gene locus_tag LOCUS_03760 1860 2855 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940693.1 protein_id gnl|my_center|LOCUS_03760 4331 2877 gene locus_tag LOCUS_03770 4331 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 4414 5730 gene locus_tag LOCUS_03780 4414 5730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7481 5889 gene locus_tag LOCUS_03790 7481 5889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8890 7502 gene locus_tag LOCUS_03800 8890 7502 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_03800 10324 8930 gene locus_tag LOCUS_03810 10324 8930 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03810 11391 10348 gene locus_tag LOCUS_03820 11391 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 12881 11388 gene locus_tag LOCUS_03830 12881 11388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 13136 14524 gene locus_tag LOCUS_03840 13136 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 14701 16422 gene locus_tag LOCUS_03850 14701 16422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 16544 17878 gene locus_tag LOCUS_03860 16544 17878 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307517.1 protein_id gnl|my_center|LOCUS_03860 18102 19133 gene locus_tag LOCUS_03870 18102 19133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 19866 20300 gene locus_tag LOCUS_03880 19866 20300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 20319 21020 gene locus_tag LOCUS_03890 20319 21020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 21555 21764 gene locus_tag LOCUS_03900 21555 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 23207 21771 gene locus_tag LOCUS_03910 23207 21771 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03910 23346 24737 gene locus_tag LOCUS_03920 23346 24737 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_03920 24801 26222 gene locus_tag LOCUS_03930 24801 26222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 26778 26230 gene locus_tag LOCUS_03940 26778 26230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 26999 27451 gene locus_tag LOCUS_03950 26999 27451 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087408.1 protein_id gnl|my_center|LOCUS_03950 28651 27893 gene locus_tag LOCUS_03960 28651 27893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 30464 28644 gene locus_tag LOCUS_03970 30464 28644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 30725 30474 gene locus_tag LOCUS_03980 gene yidD 30725 30474 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931699.1 protein_id gnl|my_center|LOCUS_03980 31072 30731 gene locus_tag LOCUS_03990 31072 30731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 32275 31547 gene locus_tag LOCUS_04000 32275 31547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 34023 32425 gene locus_tag LOCUS_04010 34023 32425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 38352 34141 gene locus_tag LOCUS_04020 38352 34141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 40053 38581 gene locus_tag LOCUS_04030 40053 38581 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068650.1 protein_id gnl|my_center|LOCUS_04030 40264 41307 gene locus_tag LOCUS_04040 40264 41307 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728707.1 protein_id gnl|my_center|LOCUS_04040 43406 41304 gene locus_tag LOCUS_04050 gene iha 43406 41304 CDS product bifunctional siderophore receptor/adhesin Iha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223341.1 protein_id gnl|my_center|LOCUS_04050 44458 43601 gene locus_tag LOCUS_04060 44458 43601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 45008 44496 gene locus_tag LOCUS_04070 45008 44496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 45275 46564 gene locus_tag LOCUS_04080 45275 46564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 48001 46643 gene locus_tag LOCUS_04090 gene mnmE 48001 46643 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944074.1 protein_id gnl|my_center|LOCUS_04090 48314 48958 gene locus_tag LOCUS_04100 gene rsmG 48314 48958 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690016.1 protein_id gnl|my_center|LOCUS_04100 49088 49897 gene locus_tag LOCUS_04110 49088 49897 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_04110 49887 50771 gene locus_tag LOCUS_04120 49887 50771 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393992.1 protein_id gnl|my_center|LOCUS_04120 50952 51380 gene locus_tag LOCUS_04130 50952 51380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 51562 52983 gene locus_tag LOCUS_04140 51562 52983 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081360963.1 protein_id gnl|my_center|LOCUS_04140 52994 53563 gene locus_tag LOCUS_04150 52994 53563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 53583 54014 gene locus_tag LOCUS_04160 53583 54014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 54011 54589 gene locus_tag LOCUS_04170 54011 54589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 54586 55131 gene locus_tag LOCUS_04180 54586 55131 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383727.1 protein_id gnl|my_center|LOCUS_04180 55144 56661 gene locus_tag LOCUS_04190 gene atpA 55144 56661 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_04190 56671 57546 gene locus_tag LOCUS_04200 gene atpG 56671 57546 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_04200 57565 58974 gene locus_tag LOCUS_04210 gene atpD 57565 58974 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_04210 58990 59403 gene locus_tag LOCUS_04220 58990 59403 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_04220 60481 59564 gene locus_tag LOCUS_04230 60481 59564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 61707 60643 gene locus_tag LOCUS_04240 61707 60643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 62672 61791 gene locus_tag LOCUS_04250 62672 61791 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251196.1 protein_id gnl|my_center|LOCUS_04250 63532 62690 gene locus_tag LOCUS_04260 63532 62690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 63713 64069 gene locus_tag LOCUS_04270 63713 64069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 64096 66780 gene locus_tag LOCUS_04280 gene polA 64096 66780 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941209.1 protein_id gnl|my_center|LOCUS_04280 66781 67746 gene locus_tag LOCUS_04290 66781 67746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 67756 68385 gene locus_tag LOCUS_04300 67756 68385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 68707 70485 gene locus_tag LOCUS_04310 68707 70485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 70619 72316 gene locus_tag LOCUS_04320 70619 72316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 73028 72234 gene locus_tag LOCUS_04330 73028 72234 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_04330 73222 74961 gene locus_tag LOCUS_04340 gene pilB 73222 74961 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_04340 75106 76170 gene locus_tag LOCUS_04350 75106 76170 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_04350 76216 77421 gene locus_tag LOCUS_04360 76216 77421 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_04360 77414 79060 gene locus_tag LOCUS_04370 77414 79060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942140.1 protein_id gnl|my_center|LOCUS_04370 79294 79806 gene locus_tag LOCUS_04380 79294 79806 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_04380 79803 80123 gene locus_tag LOCUS_04390 79803 80123 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_04390 80123 81316 gene locus_tag LOCUS_04400 gene porA 80123 81316 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_04400 81313 82281 gene locus_tag LOCUS_04410 gene porB 81313 82281 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_04410 82283 82759 gene locus_tag LOCUS_04420 gene nuoE 82283 82759 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081672.1 protein_id gnl|my_center|LOCUS_04420 82764 84617 gene locus_tag LOCUS_04430 gene nuoF 82764 84617 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_04430 84621 85346 gene locus_tag LOCUS_04440 84621 85346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 86757 85735 gene locus_tag LOCUS_04450 86757 85735 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_04450 87651 86788 gene locus_tag LOCUS_04460 87651 86788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 87678 87926 gene locus_tag LOCUS_04470 87678 87926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 88234 87977 gene locus_tag LOCUS_04480 88234 87977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 88625 88242 gene locus_tag LOCUS_04490 88625 88242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 88930 88700 gene locus_tag LOCUS_04500 88930 88700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 89056 89796 gene locus_tag LOCUS_04510 89056 89796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 90866 89901 gene locus_tag LOCUS_04520 90866 89901 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_04520 90917 92356 gene locus_tag LOCUS_04530 90917 92356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 92426 93355 gene locus_tag LOCUS_04540 92426 93355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 95713 93998 gene locus_tag LOCUS_04550 95713 93998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 95855 97501 gene locus_tag LOCUS_04560 95855 97501 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_04560 97547 99001 gene locus_tag LOCUS_04570 97547 99001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 99101 99694 gene locus_tag LOCUS_04580 99101 99694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940945.1 protein_id gnl|my_center|LOCUS_04580 99740 100954 gene locus_tag LOCUS_04590 99740 100954 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927165.1 protein_id gnl|my_center|LOCUS_04590 103302 101176 gene locus_tag LOCUS_04600 103302 101176 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256611.1 protein_id gnl|my_center|LOCUS_04600 103456 104838 gene locus_tag LOCUS_04610 103456 104838 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_04610 105092 106351 gene locus_tag LOCUS_04620 105092 106351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 107849 106482 gene locus_tag LOCUS_04630 107849 106482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 108044 109588 gene locus_tag LOCUS_04640 108044 109588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 109674 109898 gene locus_tag LOCUS_04650 109674 109898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 109886 110269 gene locus_tag LOCUS_04660 109886 110269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 110399 112033 gene locus_tag LOCUS_04670 110399 112033 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_04670 113228 112047 gene locus_tag LOCUS_04680 gene corA 113228 112047 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141025.1 protein_id gnl|my_center|LOCUS_04680 113401 114615 gene locus_tag LOCUS_04690 113401 114615 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036408.1 protein_id gnl|my_center|LOCUS_04690 114677 116251 gene locus_tag LOCUS_04700 114677 116251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 117659 116262 gene locus_tag LOCUS_04710 117659 116262 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_04710 118957 117662 gene locus_tag LOCUS_04720 118957 117662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 119104 120483 gene locus_tag LOCUS_04730 119104 120483 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_04730 120486 121274 gene locus_tag LOCUS_04740 120486 121274 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_04740 121629 122696 gene locus_tag LOCUS_04750 121629 122696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 122708 123013 gene locus_tag LOCUS_04760 122708 123013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 123398 123024 gene locus_tag LOCUS_04770 123398 123024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 123885 124532 gene locus_tag LOCUS_04780 123885 124532 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_04780 124529 124999 gene locus_tag LOCUS_04790 gene nuoE 124529 124999 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_04790 124996 126990 gene locus_tag LOCUS_04800 gene nuoF 124996 126990 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_04800 127003 128724 gene locus_tag LOCUS_04810 127003 128724 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_04810 128730 130832 gene locus_tag LOCUS_04820 128730 130832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 130925 131320 gene locus_tag LOCUS_04830 130925 131320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 131326 132480 gene locus_tag LOCUS_04840 131326 132480 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence005 1405 200 gene locus_tag LOCUS_04850 gene dinB 1405 200 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_04850 1945 1457 gene locus_tag LOCUS_04860 1945 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2802 2029 gene locus_tag LOCUS_04870 2802 2029 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142916.1 protein_id gnl|my_center|LOCUS_04870 3326 2799 gene locus_tag LOCUS_04880 3326 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 5742 3454 gene locus_tag LOCUS_04890 5742 3454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7936 5801 gene locus_tag LOCUS_04900 7936 5801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 8787 8086 gene locus_tag LOCUS_04910 8787 8086 CDS product DUF2461 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224341.1 protein_id gnl|my_center|LOCUS_04910 8959 10095 gene locus_tag LOCUS_04920 8959 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10260 11615 gene locus_tag LOCUS_04930 10260 11615 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257773.1 protein_id gnl|my_center|LOCUS_04930 12764 11670 gene locus_tag LOCUS_04940 12764 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 13312 12809 gene locus_tag LOCUS_04950 gene fldA 13312 12809 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_04950 15658 13442 gene locus_tag LOCUS_04960 15658 13442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 16734 15730 gene locus_tag LOCUS_04970 16734 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 18242 16821 gene locus_tag LOCUS_04980 18242 16821 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_04980 19262 18270 gene locus_tag LOCUS_04990 19262 18270 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263000.1 protein_id gnl|my_center|LOCUS_04990 21202 19916 gene locus_tag LOCUS_05000 21202 19916 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_05000 23146 21491 gene locus_tag LOCUS_05010 23146 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 23329 23691 gene locus_tag LOCUS_05020 23329 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 23731 24774 gene locus_tag LOCUS_05030 gene mltG 23731 24774 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_05030 24771 25283 gene locus_tag LOCUS_05040 24771 25283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 25369 26424 gene locus_tag LOCUS_05050 25369 26424 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001095359.1 protein_id gnl|my_center|LOCUS_05050 26477 26926 gene locus_tag LOCUS_05060 26477 26926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 26943 27836 gene locus_tag LOCUS_05070 26943 27836 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_05070 28077 28856 gene locus_tag LOCUS_05080 28077 28856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 30535 28853 gene locus_tag LOCUS_05090 30535 28853 CDS product GxGYxYP family putative glycoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763974.1 protein_id gnl|my_center|LOCUS_05090 32529 30532 gene locus_tag LOCUS_05100 32529 30532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 32730 33284 gene locus_tag LOCUS_05110 32730 33284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 33281 34846 gene locus_tag LOCUS_05120 33281 34846 CDS product GNVR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176617.1 protein_id gnl|my_center|LOCUS_05120 35158 35835 gene locus_tag LOCUS_05130 35158 35835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 35874 37043 gene locus_tag LOCUS_05140 35874 37043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 37048 37680 gene locus_tag LOCUS_05150 37048 37680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 37703 38350 gene locus_tag LOCUS_05160 37703 38350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 38496 40004 gene locus_tag LOCUS_05170 38496 40004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 40001 41191 gene locus_tag LOCUS_05180 40001 41191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 41188 41772 gene locus_tag LOCUS_05190 41188 41772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 41769 42692 gene locus_tag LOCUS_05200 41769 42692 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_05200 42695 43456 gene locus_tag LOCUS_05210 42695 43456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 43601 44590 gene locus_tag LOCUS_05220 43601 44590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 44744 47545 gene locus_tag LOCUS_05230 gene ileS 44744 47545 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943758.1 protein_id gnl|my_center|LOCUS_05230 47557 48054 gene locus_tag LOCUS_05240 gene lspA 47557 48054 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_05240 48069 48566 gene locus_tag LOCUS_05250 gene lspA 48069 48566 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943757.1 protein_id gnl|my_center|LOCUS_05250 48570 49532 gene locus_tag LOCUS_05260 48570 49532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 49529 50011 gene locus_tag LOCUS_05270 49529 50011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 51292 50021 gene locus_tag LOCUS_05280 51292 50021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 52170 51289 gene locus_tag LOCUS_05290 52170 51289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 52632 52979 gene locus_tag LOCUS_05300 gene rplS 52632 52979 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_05300 53099 54103 gene locus_tag LOCUS_05310 53099 54103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 54206 55522 gene locus_tag LOCUS_05320 54206 55522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 55689 57170 gene locus_tag LOCUS_05330 55689 57170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 57248 59107 gene locus_tag LOCUS_05340 57248 59107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 59104 60048 gene locus_tag LOCUS_05350 59104 60048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 60140 61441 gene locus_tag LOCUS_05360 60140 61441 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762689.1 protein_id gnl|my_center|LOCUS_05360 62998 61577 gene locus_tag LOCUS_05370 62998 61577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 63633 63067 gene locus_tag LOCUS_05380 63633 63067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 64922 63705 gene locus_tag LOCUS_05390 64922 63705 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259130.1 protein_id gnl|my_center|LOCUS_05390 66154 64919 gene locus_tag LOCUS_05400 gene glpB 66154 64919 CDS product glycerol-3-phosphate dehydrogenase subunit GlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259131.1 protein_id gnl|my_center|LOCUS_05400 67710 66151 gene locus_tag LOCUS_05410 gene glpA 67710 66151 CDS product anaerobic glycerol-3-phosphate dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706147.1 protein_id gnl|my_center|LOCUS_05410 67882 69594 gene locus_tag LOCUS_05420 67882 69594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 70127 69612 gene locus_tag LOCUS_05430 70127 69612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 70852 70124 gene locus_tag LOCUS_05440 70852 70124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 71062 71433 gene locus_tag LOCUS_05450 71062 71433 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_05450 71424 71906 gene locus_tag LOCUS_05460 71424 71906 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_05460 71910 72380 gene locus_tag LOCUS_05470 71910 72380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 72377 73561 gene locus_tag LOCUS_05480 gene nuoD 72377 73561 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_05480 73601 74149 gene locus_tag LOCUS_05490 73601 74149 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_05490 74220 75260 gene locus_tag LOCUS_05500 gene nuoH 74220 75260 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_05500 75274 75705 gene locus_tag LOCUS_05510 gene nuoI 75274 75705 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_05510 75713 76294 gene locus_tag LOCUS_05520 75713 76294 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967808.1 protein_id gnl|my_center|LOCUS_05520 76291 76593 gene locus_tag LOCUS_05530 gene nuoK 76291 76593 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_05530 76603 78543 gene locus_tag LOCUS_05540 gene nuoL 76603 78543 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_05540 78565 80112 gene locus_tag LOCUS_05550 78565 80112 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_05550 80125 81606 gene locus_tag LOCUS_05560 80125 81606 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_05560 81721 82833 gene locus_tag LOCUS_05570 81721 82833 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926062.1 protein_id gnl|my_center|LOCUS_05570 82875 84449 gene locus_tag LOCUS_05580 82875 84449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 84694 86841 gene locus_tag LOCUS_05590 84694 86841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 86857 89235 gene locus_tag LOCUS_05600 86857 89235 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_05600 89460 90170 gene locus_tag LOCUS_05610 89460 90170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 90181 90417 gene locus_tag LOCUS_05620 90181 90417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 90659 91435 gene locus_tag LOCUS_05630 90659 91435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 92266 91922 gene locus_tag LOCUS_05640 92266 91922 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142672.1 protein_id gnl|my_center|LOCUS_05640 94636 92282 gene locus_tag LOCUS_05650 94636 92282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 95292 94702 gene locus_tag LOCUS_05660 95292 94702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420565.1 protein_id gnl|my_center|LOCUS_05660 95430 97697 gene locus_tag LOCUS_05670 95430 97697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 97733 98761 gene locus_tag LOCUS_05680 97733 98761 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532940.1 protein_id gnl|my_center|LOCUS_05680 101274 98668 gene locus_tag LOCUS_05690 101274 98668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 103100 101337 gene locus_tag LOCUS_05700 103100 101337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 103352 103282 gene locus_tag LOCUS_t00050 103352 103282 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 103435 103362 gene locus_tag LOCUS_t00060 103435 103362 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 105102 103561 gene locus_tag LOCUS_05710 105102 103561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 106376 105099 gene locus_tag LOCUS_05720 106376 105099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 107224 106373 gene locus_tag LOCUS_05730 107224 106373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 108051 108953 gene locus_tag LOCUS_05740 108051 108953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 110036 109275 gene locus_tag LOCUS_05750 110036 109275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence006 397 948 gene locus_tag LOCUS_05760 397 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 985 2139 gene locus_tag LOCUS_05770 985 2139 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_05770 2139 3305 gene locus_tag LOCUS_05780 2139 3305 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245114.1 protein_id gnl|my_center|LOCUS_05780 3345 5138 gene locus_tag LOCUS_05790 3345 5138 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485037.1 protein_id gnl|my_center|LOCUS_05790 5156 6301 gene locus_tag LOCUS_05800 5156 6301 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979868.1 protein_id gnl|my_center|LOCUS_05800 6314 7516 gene locus_tag LOCUS_05810 6314 7516 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224426.1 protein_id gnl|my_center|LOCUS_05810 7513 7983 gene locus_tag LOCUS_05820 7513 7983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05820 7997 8452 gene locus_tag LOCUS_05830 7997 8452 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878466.1 protein_id gnl|my_center|LOCUS_05830 8548 10140 gene locus_tag LOCUS_05840 8548 10140 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222688.1 protein_id gnl|my_center|LOCUS_05840 10215 10637 gene locus_tag LOCUS_05850 10215 10637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 10662 11177 gene locus_tag LOCUS_05860 10662 11177 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391096.1 protein_id gnl|my_center|LOCUS_05860 12451 11189 gene locus_tag LOCUS_05870 12451 11189 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938271.1 protein_id gnl|my_center|LOCUS_05870 13356 12535 gene locus_tag LOCUS_05880 13356 12535 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262778.1 protein_id gnl|my_center|LOCUS_05880 15750 13390 gene locus_tag LOCUS_05890 15750 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 15867 16721 gene locus_tag LOCUS_05900 15867 16721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 16732 17457 gene locus_tag LOCUS_05910 16732 17457 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972581.1 protein_id gnl|my_center|LOCUS_05910 18221 17484 gene locus_tag LOCUS_05920 gene ygiD 18221 17484 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174107.1 protein_id gnl|my_center|LOCUS_05920 18508 20289 gene locus_tag LOCUS_05930 18508 20289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 22385 20376 gene locus_tag LOCUS_05940 22385 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 22661 24385 gene locus_tag LOCUS_05950 22661 24385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 24382 25941 gene locus_tag LOCUS_05960 24382 25941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 28171 25949 gene locus_tag LOCUS_05970 28171 25949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 29737 28172 gene locus_tag LOCUS_05980 29737 28172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 30094 31182 gene locus_tag LOCUS_05990 30094 31182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 31240 31791 gene locus_tag LOCUS_06000 31240 31791 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719850.1 protein_id gnl|my_center|LOCUS_06000 31947 32726 gene locus_tag LOCUS_06010 31947 32726 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202330.1 protein_id gnl|my_center|LOCUS_06010 33175 32696 gene locus_tag LOCUS_06020 33175 32696 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037970.1 protein_id gnl|my_center|LOCUS_06020 34517 33267 gene locus_tag LOCUS_06030 34517 33267 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393135.1 protein_id gnl|my_center|LOCUS_06030 35236 34520 gene locus_tag LOCUS_06040 35236 34520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 35493 35254 gene locus_tag LOCUS_06050 35493 35254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 36053 35508 gene locus_tag LOCUS_06060 36053 35508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 37184 36258 gene locus_tag LOCUS_06070 37184 36258 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948625.1 protein_id gnl|my_center|LOCUS_06070 37419 38915 gene locus_tag LOCUS_06080 37419 38915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 40610 38940 gene locus_tag LOCUS_06090 40610 38940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 40769 41746 gene locus_tag LOCUS_06100 40769 41746 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360255.1 protein_id gnl|my_center|LOCUS_06100 41743 42429 gene locus_tag LOCUS_06110 41743 42429 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942524.1 protein_id gnl|my_center|LOCUS_06110 42548 43840 gene locus_tag LOCUS_06120 42548 43840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 43874 44860 gene locus_tag LOCUS_06130 43874 44860 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_06130 44887 46431 gene locus_tag LOCUS_06140 44887 46431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 46515 47489 gene locus_tag LOCUS_06150 46515 47489 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_06150 47497 48516 gene locus_tag LOCUS_06160 gene guaA 47497 48516 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_06160 48613 49002 gene locus_tag LOCUS_06170 48613 49002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 50029 49004 gene locus_tag LOCUS_06180 50029 49004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 52390 50072 gene locus_tag LOCUS_06190 52390 50072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 54741 52606 gene locus_tag LOCUS_06200 54741 52606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 56108 54882 gene locus_tag LOCUS_06210 56108 54882 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000552081.1 protein_id gnl|my_center|LOCUS_06210 56908 56258 gene locus_tag LOCUS_06220 56908 56258 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583839.1 protein_id gnl|my_center|LOCUS_06220 57563 56922 gene locus_tag LOCUS_06230 57563 56922 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869350.1 protein_id gnl|my_center|LOCUS_06230 57645 58205 gene locus_tag LOCUS_06240 57645 58205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 59533 58202 gene locus_tag LOCUS_06250 59533 58202 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_06250 59657 61186 gene locus_tag LOCUS_06260 59657 61186 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_06260 62473 61190 gene locus_tag LOCUS_06270 62473 61190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 63234 62455 gene locus_tag LOCUS_06280 63234 62455 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_06280 64504 63296 gene locus_tag LOCUS_06290 64504 63296 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_06290 65606 64515 gene locus_tag LOCUS_06300 gene fldC 65606 64515 CDS product phenyllactyl-CoA dehydratase subunit FldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048236.1 protein_id gnl|my_center|LOCUS_06300 65792 66580 gene locus_tag LOCUS_06310 65792 66580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 67419 66571 gene locus_tag LOCUS_06320 67419 66571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 68144 67416 gene locus_tag LOCUS_06330 68144 67416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 69272 68145 gene locus_tag LOCUS_06340 69272 68145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 69398 69682 gene locus_tag LOCUS_06350 69398 69682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 70091 70510 gene locus_tag LOCUS_06360 gene flgB 70091 70510 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_06360 71644 70511 gene locus_tag LOCUS_06370 71644 70511 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_06370 72253 71765 gene locus_tag LOCUS_06380 72253 71765 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_06380 72318 73826 gene locus_tag LOCUS_06390 72318 73826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 75135 73792 gene locus_tag LOCUS_06400 gene der 75135 73792 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_06400 76040 75132 gene locus_tag LOCUS_06410 gene era 76040 75132 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_06410 76756 76037 gene locus_tag LOCUS_06420 gene rnc 76756 76037 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973423.1 protein_id gnl|my_center|LOCUS_06420 76873 77307 gene locus_tag LOCUS_06430 76873 77307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 79612 77333 gene locus_tag LOCUS_06440 79612 77333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 80974 79664 gene locus_tag LOCUS_06450 gene mtaB 80974 79664 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_06450 81868 80978 gene locus_tag LOCUS_06460 81868 80978 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941353.1 protein_id gnl|my_center|LOCUS_06460 82746 81910 gene locus_tag LOCUS_06470 82746 81910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 84102 82753 gene locus_tag LOCUS_06480 84102 82753 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_06480 86289 84154 gene locus_tag LOCUS_06490 86289 84154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 86580 86290 gene locus_tag LOCUS_06500 86580 86290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 86818 88857 gene locus_tag LOCUS_06510 gene ligA 86818 88857 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941554.1 protein_id gnl|my_center|LOCUS_06510 88854 89123 gene locus_tag LOCUS_06520 88854 89123 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_06520 90298 89195 gene locus_tag LOCUS_06530 gene ald 90298 89195 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459459.1 protein_id gnl|my_center|LOCUS_06530 92352 90415 gene locus_tag LOCUS_06540 gene speA 92352 90415 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480160.1 protein_id gnl|my_center|LOCUS_06540 93548 92433 gene locus_tag LOCUS_06550 93548 92433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 93736 93809 gene locus_tag LOCUS_t00070 93736 93809 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 94832 93843 gene locus_tag LOCUS_06560 94832 93843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 94991 97099 gene locus_tag LOCUS_06570 94991 97099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 97221 98835 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcggtttgatctctgattcggaacggttacact 99215 98886 gene locus_tag LOCUS_06580 gene cas2 99215 98886 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475522.1 protein_id gnl|my_center|LOCUS_06580 100093 99212 gene locus_tag LOCUS_06590 gene cas1 100093 99212 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06590 103043 100086 gene locus_tag LOCUS_06600 103043 100086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 104195 103608 gene locus_tag LOCUS_06610 104195 103608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 105020 104307 gene locus_tag LOCUS_06620 105020 104307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 106134 105025 gene locus_tag LOCUS_06630 106134 105025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 107855 106248 gene locus_tag LOCUS_06640 107855 106248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence007 315 704 gene locus_tag LOCUS_06650 gene gcvH 315 704 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393442.1 protein_id gnl|my_center|LOCUS_06650 733 2061 gene locus_tag LOCUS_06660 gene gcvPA 733 2061 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_06660 2036 3514 gene locus_tag LOCUS_06670 gene gcvPB 2036 3514 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393440.1 protein_id gnl|my_center|LOCUS_06670 3687 3565 gene locus_tag LOCUS_06680 3687 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3891 5783 gene locus_tag LOCUS_06690 3891 5783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 7039 5852 gene locus_tag LOCUS_06700 gene kbl 7039 5852 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_06700 8148 7111 gene locus_tag LOCUS_06710 gene tdh 8148 7111 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244880.1 protein_id gnl|my_center|LOCUS_06710 8985 8233 gene locus_tag LOCUS_06720 8985 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 9960 9094 gene locus_tag LOCUS_06730 9960 9094 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706778.1 protein_id gnl|my_center|LOCUS_06730 10593 10069 gene locus_tag LOCUS_06740 10593 10069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 13856 10590 gene locus_tag LOCUS_06750 13856 10590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 14141 13920 gene locus_tag LOCUS_06760 14141 13920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 15604 14192 gene locus_tag LOCUS_06770 15604 14192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 17217 15604 gene locus_tag LOCUS_06780 17217 15604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 18762 17275 gene locus_tag LOCUS_06790 18762 17275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 19378 18806 gene locus_tag LOCUS_06800 19378 18806 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_06800 21378 19456 gene locus_tag LOCUS_06810 21378 19456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 22768 21506 gene locus_tag LOCUS_06820 22768 21506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 22956 25661 gene locus_tag LOCUS_06830 22956 25661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 25707 26615 gene locus_tag LOCUS_06840 25707 26615 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_06840 27992 26589 gene locus_tag LOCUS_06850 27992 26589 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876537.1 protein_id gnl|my_center|LOCUS_06850 29300 28017 gene locus_tag LOCUS_06860 29300 28017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 29504 30580 gene locus_tag LOCUS_06870 29504 30580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 30558 31046 gene locus_tag LOCUS_06880 30558 31046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 34480 31076 gene locus_tag LOCUS_06890 34480 31076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 34879 35760 gene locus_tag LOCUS_06900 34879 35760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 36845 36303 gene locus_tag LOCUS_06910 36845 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 37195 39102 gene locus_tag LOCUS_06920 37195 39102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 39621 39112 gene locus_tag LOCUS_06930 39621 39112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 39789 41075 gene locus_tag LOCUS_06940 39789 41075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 41808 41077 gene locus_tag LOCUS_06950 41808 41077 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_06950 44039 41805 gene locus_tag LOCUS_06960 44039 41805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 49495 44204 gene locus_tag LOCUS_06970 49495 44204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 50694 49579 gene locus_tag LOCUS_06980 50694 49579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001231564.1 protein_id gnl|my_center|LOCUS_06980 52026 50695 gene locus_tag LOCUS_06990 52026 50695 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355764.1 protein_id gnl|my_center|LOCUS_06990 53978 52032 gene locus_tag LOCUS_07000 53978 52032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 54942 54085 gene locus_tag LOCUS_07010 54942 54085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 55142 54939 gene locus_tag LOCUS_07020 55142 54939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 55354 56454 gene locus_tag LOCUS_07030 gene wecB 55354 56454 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393864.1 protein_id gnl|my_center|LOCUS_07030 58386 56461 gene locus_tag LOCUS_07040 58386 56461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 60260 58383 gene locus_tag LOCUS_07050 60260 58383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 60413 61189 gene locus_tag LOCUS_07060 60413 61189 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_07060 62326 61214 gene locus_tag LOCUS_07070 62326 61214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 62716 62426 gene locus_tag LOCUS_07080 gene rpmA 62716 62426 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_07080 63043 62732 gene locus_tag LOCUS_07090 gene rplU 63043 62732 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392094.1 protein_id gnl|my_center|LOCUS_07090 63235 64161 gene locus_tag LOCUS_07100 63235 64161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 66224 64200 gene locus_tag LOCUS_07110 66224 64200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 68095 66221 gene locus_tag LOCUS_07120 68095 66221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 68437 71760 gene locus_tag LOCUS_07130 68437 71760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 72568 71819 gene locus_tag LOCUS_07140 72568 71819 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943078.1 protein_id gnl|my_center|LOCUS_07140 73616 72747 gene locus_tag LOCUS_07150 73616 72747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 73807 74811 gene locus_tag LOCUS_07160 73807 74811 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225688.1 protein_id gnl|my_center|LOCUS_07160 75010 75975 gene locus_tag LOCUS_07170 75010 75975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 77699 75996 gene locus_tag LOCUS_07180 77699 75996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 77973 79409 gene locus_tag LOCUS_07190 77973 79409 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_07190 79406 80638 gene locus_tag LOCUS_07200 79406 80638 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_07200 80643 81845 gene locus_tag LOCUS_07210 80643 81845 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583067.1 protein_id gnl|my_center|LOCUS_07210 82112 83371 gene locus_tag LOCUS_07220 82112 83371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 83997 83368 gene locus_tag LOCUS_07230 83997 83368 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966328.1 protein_id gnl|my_center|LOCUS_07230 84222 85679 gene locus_tag LOCUS_07240 84222 85679 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257950.1 protein_id gnl|my_center|LOCUS_07240 85708 86847 gene locus_tag LOCUS_07250 85708 86847 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058124.1 protein_id gnl|my_center|LOCUS_07250 86897 88798 gene locus_tag LOCUS_07260 86897 88798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 88795 90012 gene locus_tag LOCUS_07270 88795 90012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 91299 90076 gene locus_tag LOCUS_07280 91299 90076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 92748 91969 gene locus_tag LOCUS_07290 92748 91969 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039072.1 protein_id gnl|my_center|LOCUS_07290 93487 92717 gene locus_tag LOCUS_07300 gene cysZ 93487 92717 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693426.1 protein_id gnl|my_center|LOCUS_07300 94840 93497 gene locus_tag LOCUS_07310 94840 93497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 95182 94880 gene locus_tag LOCUS_07320 95182 94880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 95075 97051 gene locus_tag LOCUS_07330 95075 97051 CDS product cache domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706864.1 protein_id gnl|my_center|LOCUS_07330 97155 99065 gene locus_tag LOCUS_07340 gene pepF 97155 99065 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_07340 99823 99167 gene locus_tag LOCUS_07350 99823 99167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 100004 100357 gene locus_tag LOCUS_07360 100004 100357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 100406 100648 gene locus_tag LOCUS_07370 100406 100648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 101107 101874 gene locus_tag LOCUS_07380 101107 101874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 103243 101933 gene locus_tag LOCUS_07390 103243 101933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 104258 103302 gene locus_tag LOCUS_07400 104258 103302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 104396 105040 gene locus_tag LOCUS_07410 104396 105040 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545227.1 protein_id gnl|my_center|LOCUS_07410 105299 105096 gene locus_tag LOCUS_07420 105299 105096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 105616 105314 gene locus_tag LOCUS_07430 105616 105314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 106503 105748 gene locus_tag LOCUS_07440 106503 105748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 107649 106750 gene locus_tag LOCUS_07450 107649 106750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence008 630 133 gene locus_tag LOCUS_07460 630 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1388 924 gene locus_tag LOCUS_07470 1388 924 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866321.1 protein_id gnl|my_center|LOCUS_07470 3139 1385 gene locus_tag LOCUS_07480 3139 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 4155 3136 gene locus_tag LOCUS_07490 4155 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 7616 4158 gene locus_tag LOCUS_07500 7616 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 9297 7618 gene locus_tag LOCUS_07510 9297 7618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 9665 9907 gene locus_tag LOCUS_07520 9665 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 10344 11618 gene locus_tag LOCUS_07530 10344 11618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 11736 11662 gene locus_tag LOCUS_t00080 11736 11662 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 13314 11776 gene locus_tag LOCUS_07540 13314 11776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 14317 13655 gene locus_tag LOCUS_07550 gene rpe 14317 13655 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_07550 15650 14319 gene locus_tag LOCUS_07560 gene rsmB 15650 14319 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_07560 16574 15651 gene locus_tag LOCUS_07570 gene fmt 16574 15651 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_07570 17102 16578 gene locus_tag LOCUS_07580 gene def 17102 16578 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694639.1 protein_id gnl|my_center|LOCUS_07580 18736 17102 gene locus_tag LOCUS_07590 18736 17102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 19918 18749 gene locus_tag LOCUS_07600 19918 18749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 21132 20359 gene locus_tag LOCUS_07610 21132 20359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 21267 21893 gene locus_tag LOCUS_07620 21267 21893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 21897 22295 gene locus_tag LOCUS_07630 21897 22295 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243483.1 protein_id gnl|my_center|LOCUS_07630 24040 22307 gene locus_tag LOCUS_07640 24040 22307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 25761 24037 gene locus_tag LOCUS_07650 25761 24037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 27289 25784 gene locus_tag LOCUS_07660 27289 25784 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_07660 28222 27320 gene locus_tag LOCUS_07670 28222 27320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702854.1 protein_id gnl|my_center|LOCUS_07670 28377 29375 gene locus_tag LOCUS_07680 28377 29375 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_07680 29368 29982 gene locus_tag LOCUS_07690 29368 29982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 30072 30446 gene locus_tag LOCUS_07700 30072 30446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 30440 32044 gene locus_tag LOCUS_07710 30440 32044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 32088 33479 gene locus_tag LOCUS_07720 32088 33479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 35214 33481 gene locus_tag LOCUS_07730 35214 33481 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226611.1 protein_id gnl|my_center|LOCUS_07730 35373 36989 gene locus_tag LOCUS_07740 35373 36989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 37090 38439 gene locus_tag LOCUS_07750 37090 38439 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763445.1 protein_id gnl|my_center|LOCUS_07750 38501 38806 gene locus_tag LOCUS_07760 38501 38806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 39691 40167 gene locus_tag LOCUS_07770 39691 40167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 42094 40622 gene locus_tag LOCUS_07780 42094 40622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 43587 42091 gene locus_tag LOCUS_07790 43587 42091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 44364 43618 gene locus_tag LOCUS_07800 44364 43618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 47070 44386 gene locus_tag LOCUS_07810 47070 44386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 47389 48588 gene locus_tag LOCUS_07820 gene pgsB 47389 48588 CDS product poly-gamma-glutamate synthase PgsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118210.1 protein_id gnl|my_center|LOCUS_07820 48585 49031 gene locus_tag LOCUS_07830 gene pgsC 48585 49031 CDS product poly-gamma-glutamate biosynthesis protein PgsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003016687.1 protein_id gnl|my_center|LOCUS_07830 49028 50173 gene locus_tag LOCUS_07840 gene pgsW 49028 50173 CDS product poly-gamma-glutamate system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118209.1 protein_id gnl|my_center|LOCUS_07840 50266 51165 gene locus_tag LOCUS_07850 50266 51165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000510896.1 protein_id gnl|my_center|LOCUS_07850 51171 52040 gene locus_tag LOCUS_07860 51171 52040 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459741.1 protein_id gnl|my_center|LOCUS_07860 52791 52066 gene locus_tag LOCUS_07870 52791 52066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 53427 52843 gene locus_tag LOCUS_07880 53427 52843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 54619 53429 gene locus_tag LOCUS_07890 gene pseC 54619 53429 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869432.1 protein_id gnl|my_center|LOCUS_07890 55433 54696 gene locus_tag LOCUS_07900 55433 54696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 56934 55405 gene locus_tag LOCUS_07910 56934 55405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 57937 56990 gene locus_tag LOCUS_07920 57937 56990 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771489.1 protein_id gnl|my_center|LOCUS_07920 58914 57934 gene locus_tag LOCUS_07930 gene gmd 58914 57934 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_07930 59750 58938 gene locus_tag LOCUS_07940 59750 58938 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104295.1 protein_id gnl|my_center|LOCUS_07940 60173 59751 gene locus_tag LOCUS_07950 60173 59751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 60343 61566 gene locus_tag LOCUS_07960 60343 61566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 61651 61917 gene locus_tag LOCUS_07970 61651 61917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 61917 62258 gene locus_tag LOCUS_07980 61917 62258 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938183.1 protein_id gnl|my_center|LOCUS_07980 62788 62255 gene locus_tag LOCUS_07990 62788 62255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 63458 62901 gene locus_tag LOCUS_08000 63458 62901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 64410 63484 gene locus_tag LOCUS_08010 64410 63484 CDS product phosphatidylglycerol lysyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939824.1 protein_id gnl|my_center|LOCUS_08010 64616 64434 gene locus_tag LOCUS_08020 64616 64434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 65894 64620 gene locus_tag LOCUS_08030 65894 64620 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_08030 66543 65956 gene locus_tag LOCUS_08040 66543 65956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 67064 66672 gene locus_tag LOCUS_08050 gene rpsI 67064 66672 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829818.1 protein_id gnl|my_center|LOCUS_08050 67503 67075 gene locus_tag LOCUS_08060 gene rplM 67503 67075 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_08060 67991 67743 gene locus_tag LOCUS_08070 67991 67743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 69384 68092 gene locus_tag LOCUS_08080 69384 68092 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_08080 69293 69565 gene locus_tag LOCUS_08090 69293 69565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 69852 69454 gene locus_tag LOCUS_08100 69852 69454 CDS product TIGR02530 family flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392299.1 protein_id gnl|my_center|LOCUS_08100 70552 69857 gene locus_tag LOCUS_08110 70552 69857 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_08110 72396 70576 gene locus_tag LOCUS_08120 72396 70576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 73268 72642 gene locus_tag LOCUS_08130 73268 72642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 73729 73265 gene locus_tag LOCUS_08140 73729 73265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 75153 73756 gene locus_tag LOCUS_08150 75153 73756 CDS product FliI/YscN family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941081.1 protein_id gnl|my_center|LOCUS_08150 75762 75154 gene locus_tag LOCUS_08160 75762 75154 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392294.1 protein_id gnl|my_center|LOCUS_08160 76785 75787 gene locus_tag LOCUS_08170 gene fliG 76785 75787 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932791.1 protein_id gnl|my_center|LOCUS_08170 78451 76778 gene locus_tag LOCUS_08180 gene fliF 78451 76778 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941078.1 protein_id gnl|my_center|LOCUS_08180 78813 78496 gene locus_tag LOCUS_08190 78813 78496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 79260 78829 gene locus_tag LOCUS_08200 gene flgC 79260 78829 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_08200 80754 79432 gene locus_tag LOCUS_08210 80754 79432 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_08210 82050 80809 gene locus_tag LOCUS_08220 82050 80809 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545659.1 protein_id gnl|my_center|LOCUS_08220 84164 82047 gene locus_tag LOCUS_08230 84164 82047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 85862 84462 gene locus_tag LOCUS_08240 85862 84462 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_08240 86440 85862 gene locus_tag LOCUS_08250 86440 85862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 87227 88600 gene locus_tag LOCUS_08260 87227 88600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 88597 89937 gene locus_tag LOCUS_08270 88597 89937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 89966 91222 gene locus_tag LOCUS_08280 89966 91222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 91230 92969 gene locus_tag LOCUS_08290 91230 92969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 93140 93958 gene locus_tag LOCUS_08300 93140 93958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 94124 94894 gene locus_tag LOCUS_08310 94124 94894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 95130 96944 gene locus_tag LOCUS_08320 95130 96944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 97057 98550 gene locus_tag LOCUS_08330 97057 98550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 99238 98690 gene locus_tag LOCUS_08340 99238 98690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 101373 99265 gene locus_tag LOCUS_08350 101373 99265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 103141 101468 gene locus_tag LOCUS_08360 103141 101468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 103581 103138 gene locus_tag LOCUS_08370 103581 103138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 104322 103582 gene locus_tag LOCUS_08380 104322 103582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 105634 104354 gene locus_tag LOCUS_08390 gene eno 105634 104354 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_08390 106079 105654 gene locus_tag LOCUS_08400 106079 105654 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_08400 107301 106072 gene locus_tag LOCUS_08410 107301 106072 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence009 2327 591 gene locus_tag LOCUS_08420 2327 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 4132 2408 gene locus_tag LOCUS_08430 4132 2408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 5920 4196 gene locus_tag LOCUS_08440 5920 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 6199 8037 gene locus_tag LOCUS_08450 6199 8037 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962257.1 protein_id gnl|my_center|LOCUS_08450 8607 8062 gene locus_tag LOCUS_08460 8607 8062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 8768 9400 gene locus_tag LOCUS_08470 8768 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 10679 9462 gene locus_tag LOCUS_08480 10679 9462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223273.1 protein_id gnl|my_center|LOCUS_08480 10820 12916 gene locus_tag LOCUS_08490 10820 12916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 12909 14000 gene locus_tag LOCUS_08500 12909 14000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 14089 14667 gene locus_tag LOCUS_08510 14089 14667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 15767 14643 gene locus_tag LOCUS_08520 15767 14643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 17458 15764 gene locus_tag LOCUS_08530 17458 15764 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_08530 19792 17462 gene locus_tag LOCUS_08540 19792 17462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 20768 19932 gene locus_tag LOCUS_08550 20768 19932 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942919.1 protein_id gnl|my_center|LOCUS_08550 21145 20765 gene locus_tag LOCUS_08560 21145 20765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 23552 21159 gene locus_tag LOCUS_08570 23552 21159 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_08570 24547 23549 gene locus_tag LOCUS_08580 24547 23549 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_08580 24975 24553 gene locus_tag LOCUS_08590 24975 24553 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_08590 25459 25130 gene locus_tag LOCUS_08600 25459 25130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 28201 25637 gene locus_tag LOCUS_08610 28201 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 28402 30030 gene locus_tag LOCUS_08620 28402 30030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 30023 31831 gene locus_tag LOCUS_08630 30023 31831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 32029 32772 gene locus_tag LOCUS_08640 32029 32772 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_08640 32807 33328 gene locus_tag LOCUS_08650 gene ruvC 32807 33328 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_08650 33325 33933 gene locus_tag LOCUS_08660 gene ruvA 33325 33933 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_08660 33937 34974 gene locus_tag LOCUS_08670 gene ruvB 33937 34974 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_08670 34971 35477 gene locus_tag LOCUS_08680 34971 35477 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072772321.1 protein_id gnl|my_center|LOCUS_08680 35470 35886 gene locus_tag LOCUS_08690 35470 35886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 36051 37445 gene locus_tag LOCUS_08700 36051 37445 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_08700 37421 38347 gene locus_tag LOCUS_08710 37421 38347 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941035.1 protein_id gnl|my_center|LOCUS_08710 40121 38394 gene locus_tag LOCUS_08720 40121 38394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 42830 40302 gene locus_tag LOCUS_08730 42830 40302 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104717.1 protein_id gnl|my_center|LOCUS_08730 43867 42845 gene locus_tag LOCUS_08740 43867 42845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 45273 43996 gene locus_tag LOCUS_08750 45273 43996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 47127 45301 gene locus_tag LOCUS_08760 47127 45301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 48182 47253 gene locus_tag LOCUS_08770 48182 47253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 49025 48258 gene locus_tag LOCUS_08780 49025 48258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 49769 49347 gene locus_tag LOCUS_08790 49769 49347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 50996 49809 gene locus_tag LOCUS_08800 50996 49809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 51292 53919 gene locus_tag LOCUS_08810 51292 53919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 53968 54522 gene locus_tag LOCUS_08820 53968 54522 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_08820 54536 57481 gene locus_tag LOCUS_08830 54536 57481 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941949.1 protein_id gnl|my_center|LOCUS_08830 57696 58520 gene locus_tag LOCUS_08840 gene cheR 57696 58520 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019080859.1 protein_id gnl|my_center|LOCUS_08840 58517 59026 gene locus_tag LOCUS_08850 58517 59026 CDS product chemotaxis protein CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425085.1 protein_id gnl|my_center|LOCUS_08850 59023 59868 gene locus_tag LOCUS_08860 59023 59868 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_08860 59885 60286 gene locus_tag LOCUS_08870 59885 60286 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_08870 60279 60728 gene locus_tag LOCUS_08880 60279 60728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 60772 61803 gene locus_tag LOCUS_08890 60772 61803 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389160.1 protein_id gnl|my_center|LOCUS_08890 62610 61819 gene locus_tag LOCUS_08900 62610 61819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 64045 62789 gene locus_tag LOCUS_08910 64045 62789 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228926.1 protein_id gnl|my_center|LOCUS_08910 64002 64286 gene locus_tag LOCUS_08920 64002 64286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 65209 64412 gene locus_tag LOCUS_08930 65209 64412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 66674 65298 gene locus_tag LOCUS_08940 66674 65298 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_08940 69190 66809 gene locus_tag LOCUS_08950 69190 66809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 71548 69257 gene locus_tag LOCUS_08960 71548 69257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 73947 71575 gene locus_tag LOCUS_08970 73947 71575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 76358 73986 gene locus_tag LOCUS_08980 76358 73986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 78377 76662 gene locus_tag LOCUS_08990 78377 76662 CDS product propionate CoA-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392773.1 protein_id gnl|my_center|LOCUS_08990 78765 79919 gene locus_tag LOCUS_09000 78765 79919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 80849 79935 gene locus_tag LOCUS_09010 80849 79935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 81170 81823 gene locus_tag LOCUS_09020 81170 81823 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084765.1 protein_id gnl|my_center|LOCUS_09020 81842 82693 gene locus_tag LOCUS_09030 81842 82693 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086149.1 protein_id gnl|my_center|LOCUS_09030 82726 83739 gene locus_tag LOCUS_09040 82726 83739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069660.1 protein_id gnl|my_center|LOCUS_09040 85084 83753 gene locus_tag LOCUS_09050 85084 83753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 86699 85197 gene locus_tag LOCUS_09060 86699 85197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 87460 86738 gene locus_tag LOCUS_09070 87460 86738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 87807 87577 gene locus_tag LOCUS_09080 87807 87577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 88559 87948 gene locus_tag LOCUS_09090 88559 87948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 89748 88663 gene locus_tag LOCUS_09100 89748 88663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 90765 89785 gene locus_tag LOCUS_09110 90765 89785 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987015.1 protein_id gnl|my_center|LOCUS_09110 91799 90762 gene locus_tag LOCUS_09120 91799 90762 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870574.1 protein_id gnl|my_center|LOCUS_09120 92313 91870 gene locus_tag LOCUS_09130 92313 91870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 92798 92313 gene locus_tag LOCUS_09140 92798 92313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 94390 92831 gene locus_tag LOCUS_09150 94390 92831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 94889 94452 gene locus_tag LOCUS_09160 94889 94452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 95780 94959 gene locus_tag LOCUS_09170 95780 94959 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943665.1 protein_id gnl|my_center|LOCUS_09170 96485 95988 gene locus_tag LOCUS_09180 gene fliW 96485 95988 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460794.1 protein_id gnl|my_center|LOCUS_09180 96755 96504 gene locus_tag LOCUS_09190 gene csrA 96755 96504 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943667.1 protein_id gnl|my_center|LOCUS_09190 97766 96885 gene locus_tag LOCUS_09200 gene flgL 97766 96885 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_09200 99225 97819 gene locus_tag LOCUS_09210 gene flgK 99225 97819 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_09210 99727 99227 gene locus_tag LOCUS_09220 99727 99227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 100097 99795 gene locus_tag LOCUS_09230 100097 99795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 100773 100300 gene locus_tag LOCUS_09240 100773 100300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 101886 100783 gene locus_tag LOCUS_09250 101886 100783 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_09250 102789 101899 gene locus_tag LOCUS_09260 102789 101899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 103743 102802 gene locus_tag LOCUS_09270 103743 102802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 104555 103767 gene locus_tag LOCUS_09280 gene flgG 104555 103767 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_09280 105321 104575 gene locus_tag LOCUS_09290 gene flgF 105321 104575 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_09290 105633 106292 gene locus_tag LOCUS_09300 105633 106292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 106289 106954 gene locus_tag LOCUS_09310 106289 106954 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_09310 107437 107036 gene locus_tag LOCUS_09320 107437 107036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence010 624 1367 gene locus_tag LOCUS_09330 gene ubiE 624 1367 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328112.1 protein_id gnl|my_center|LOCUS_09330 2893 1325 gene locus_tag LOCUS_09340 2893 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 5316 2899 gene locus_tag LOCUS_09350 5316 2899 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_09350 7037 5325 gene locus_tag LOCUS_09360 7037 5325 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943734.1 protein_id gnl|my_center|LOCUS_09360 7749 7030 gene locus_tag LOCUS_09370 7749 7030 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039081.1 protein_id gnl|my_center|LOCUS_09370 8824 7799 gene locus_tag LOCUS_09380 8824 7799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 9126 10097 gene locus_tag LOCUS_09390 9126 10097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 10104 13376 gene locus_tag LOCUS_09400 10104 13376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 13373 14524 gene locus_tag LOCUS_09410 13373 14524 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_09410 14525 15646 gene locus_tag LOCUS_09420 14525 15646 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221227.1 protein_id gnl|my_center|LOCUS_09420 15643 16824 gene locus_tag LOCUS_09430 15643 16824 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256778.1 protein_id gnl|my_center|LOCUS_09430 17358 16834 gene locus_tag LOCUS_09440 17358 16834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 19720 17387 gene locus_tag LOCUS_09450 19720 17387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 21362 19713 gene locus_tag LOCUS_09460 21362 19713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 24211 21359 gene locus_tag LOCUS_09470 gene uvrA 24211 21359 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943938.1 protein_id gnl|my_center|LOCUS_09470 25215 24208 gene locus_tag LOCUS_09480 gene pdxA 25215 24208 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314586.1 protein_id gnl|my_center|LOCUS_09480 26275 25358 gene locus_tag LOCUS_09490 gene motB 26275 25358 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097767.1 protein_id gnl|my_center|LOCUS_09490 27143 26307 gene locus_tag LOCUS_09500 gene motA 27143 26307 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_09500 28989 27304 gene locus_tag LOCUS_09510 28989 27304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 29718 29107 gene locus_tag LOCUS_09520 29718 29107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 31513 29768 gene locus_tag LOCUS_09530 31513 29768 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392815.1 protein_id gnl|my_center|LOCUS_09530 31946 31530 gene locus_tag LOCUS_09540 31946 31530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 33351 32014 gene locus_tag LOCUS_09550 33351 32014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 33513 35681 gene locus_tag LOCUS_09560 33513 35681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 35779 37185 gene locus_tag LOCUS_09570 35779 37185 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112884.1 protein_id gnl|my_center|LOCUS_09570 37201 38379 gene locus_tag LOCUS_09580 37201 38379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 38465 39952 gene locus_tag LOCUS_09590 38465 39952 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948684.1 protein_id gnl|my_center|LOCUS_09590 40896 39949 gene locus_tag LOCUS_09600 40896 39949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 40981 42510 gene locus_tag LOCUS_09610 40981 42510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 42580 43605 gene locus_tag LOCUS_09620 42580 43605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 43703 44905 gene locus_tag LOCUS_09630 gene purC 43703 44905 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878767.1 protein_id gnl|my_center|LOCUS_09630 44905 45363 gene locus_tag LOCUS_09640 44905 45363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 46593 45397 gene locus_tag LOCUS_09650 46593 45397 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141484866.1 protein_id gnl|my_center|LOCUS_09650 47744 46665 gene locus_tag LOCUS_09660 gene lptG 47744 46665 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942568.1 protein_id gnl|my_center|LOCUS_09660 48952 47741 gene locus_tag LOCUS_09670 gene lptF 48952 47741 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942567.1 protein_id gnl|my_center|LOCUS_09670 50411 49014 gene locus_tag LOCUS_09680 gene dnaB 50411 49014 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_09680 50905 50441 gene locus_tag LOCUS_09690 gene rplI 50905 50441 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_09690 51920 50925 gene locus_tag LOCUS_09700 51920 50925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 52179 51940 gene locus_tag LOCUS_09710 gene rpsR 52179 51940 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420527.1 protein_id gnl|my_center|LOCUS_09710 52652 52224 gene locus_tag LOCUS_09720 52652 52224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 53195 52686 gene locus_tag LOCUS_09730 53195 52686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 54010 53441 gene locus_tag LOCUS_09740 gene pth 54010 53441 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405251.1 protein_id gnl|my_center|LOCUS_09740 54699 54010 gene locus_tag LOCUS_09750 54699 54010 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869821.1 protein_id gnl|my_center|LOCUS_09750 55972 54941 gene locus_tag LOCUS_09760 55972 54941 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_09760 56162 56090 gene locus_tag LOCUS_t00090 56162 56090 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56543 56256 gene locus_tag LOCUS_09770 gene spoVG 56543 56256 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722726.1 protein_id gnl|my_center|LOCUS_09770 57312 56566 gene locus_tag LOCUS_09780 gene ispE 57312 56566 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_09780 57969 59300 gene locus_tag LOCUS_09790 57969 59300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 59936 59439 gene locus_tag LOCUS_09800 59936 59439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 61091 60132 gene locus_tag LOCUS_09810 61091 60132 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223243.1 protein_id gnl|my_center|LOCUS_09810 62443 61088 gene locus_tag LOCUS_09820 62443 61088 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010976108.1 protein_id gnl|my_center|LOCUS_09820 63691 62528 gene locus_tag LOCUS_09830 63691 62528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 63924 63996 gene locus_tag LOCUS_t00100 63924 63996 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 64268 68773 gene locus_tag LOCUS_09840 64268 68773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 68783 71716 gene locus_tag LOCUS_09850 68783 71716 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_09850 71877 72968 gene locus_tag LOCUS_09860 71877 72968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 73815 73027 gene locus_tag LOCUS_09870 73815 73027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 74327 73959 gene locus_tag LOCUS_09880 74327 73959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 74716 74324 gene locus_tag LOCUS_09890 74716 74324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 74956 76905 gene locus_tag LOCUS_09900 74956 76905 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000457972.1 protein_id gnl|my_center|LOCUS_09900 77040 77885 gene locus_tag LOCUS_09910 77040 77885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 78851 78183 gene locus_tag LOCUS_09920 78851 78183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 80130 79159 gene locus_tag LOCUS_09930 80130 79159 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_09930 80277 81032 gene locus_tag LOCUS_09940 80277 81032 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193427759.1 protein_id gnl|my_center|LOCUS_09940 81046 83037 gene locus_tag LOCUS_09950 81046 83037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 83155 84726 gene locus_tag LOCUS_09960 83155 84726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 84920 86845 gene locus_tag LOCUS_09970 84920 86845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 86877 87359 gene locus_tag LOCUS_09980 86877 87359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 88461 87388 gene locus_tag LOCUS_09990 88461 87388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 90089 88632 gene locus_tag LOCUS_10000 90089 88632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 91255 90239 gene locus_tag LOCUS_10010 91255 90239 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_10010 92183 91416 gene locus_tag LOCUS_10020 92183 91416 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_10020 93175 92198 gene locus_tag LOCUS_10030 93175 92198 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_10030 94115 93234 gene locus_tag LOCUS_10040 gene speB 94115 93234 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_10040 94385 96658 gene locus_tag LOCUS_10050 94385 96658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 97096 96782 gene locus_tag LOCUS_10060 97096 96782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 99295 97124 gene locus_tag LOCUS_10070 99295 97124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 99838 99401 gene locus_tag LOCUS_10080 gene nikR 99838 99401 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_10080 100202 101161 gene locus_tag LOCUS_10090 100202 101161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 103909 101225 gene locus_tag LOCUS_10100 103909 101225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 104027 104572 gene locus_tag LOCUS_10110 104027 104572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 104823 105992 gene locus_tag LOCUS_10120 104823 105992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 106528 106704 gene locus_tag LOCUS_10130 106528 106704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence011 279 1898 gene locus_tag LOCUS_10140 279 1898 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948914.1 protein_id gnl|my_center|LOCUS_10140 5168 1920 gene locus_tag LOCUS_10150 gene carB 5168 1920 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_10150 6354 5209 gene locus_tag LOCUS_10160 gene carA 6354 5209 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_10160 8259 6364 gene locus_tag LOCUS_10170 gene pyrG 8259 6364 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657046.1 protein_id gnl|my_center|LOCUS_10170 9681 8416 gene locus_tag LOCUS_10180 gene murA 9681 8416 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_10180 10542 9682 gene locus_tag LOCUS_10190 gene prmC 10542 9682 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943724.1 protein_id gnl|my_center|LOCUS_10190 10646 10572 gene locus_tag LOCUS_t00110 10646 10572 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 12613 10832 gene locus_tag LOCUS_10200 12613 10832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 12968 14869 gene locus_tag LOCUS_10210 gene asnB 12968 14869 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940273.1 protein_id gnl|my_center|LOCUS_10210 15221 16498 gene locus_tag LOCUS_10220 15221 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 17195 18220 gene locus_tag LOCUS_10230 17195 18220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 19123 18239 gene locus_tag LOCUS_10240 19123 18239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 20513 19182 gene locus_tag LOCUS_10250 20513 19182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 21452 20586 gene locus_tag LOCUS_10260 21452 20586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 22766 21729 gene locus_tag LOCUS_10270 gene ltaE 22766 21729 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_10270 22887 23435 gene locus_tag LOCUS_10280 22887 23435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 25801 23459 gene locus_tag LOCUS_10290 25801 23459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 27590 26022 gene locus_tag LOCUS_10300 27590 26022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 28421 27669 gene locus_tag LOCUS_10310 28421 27669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 29703 28408 gene locus_tag LOCUS_10320 29703 28408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 29659 29589 gene locus_tag LOCUS_t00120 29659 29589 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 30376 29960 gene locus_tag LOCUS_10330 30376 29960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 33032 30570 gene locus_tag LOCUS_10340 33032 30570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 33967 33296 gene locus_tag LOCUS_10350 33967 33296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 35147 33960 gene locus_tag LOCUS_10360 35147 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 35515 36000 gene locus_tag LOCUS_10370 35515 36000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 35997 36188 gene locus_tag LOCUS_10380 gene rpmF 35997 36188 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638547.1 protein_id gnl|my_center|LOCUS_10380 36252 37139 gene locus_tag LOCUS_10390 gene fabD 36252 37139 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869845.1 protein_id gnl|my_center|LOCUS_10390 37136 37876 gene locus_tag LOCUS_10400 gene fabG 37136 37876 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938502.1 protein_id gnl|my_center|LOCUS_10400 37911 38156 gene locus_tag LOCUS_10410 gene acpP 37911 38156 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_10410 38166 38405 gene locus_tag LOCUS_10420 38166 38405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 38398 40032 gene locus_tag LOCUS_10430 38398 40032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 40075 41556 gene locus_tag LOCUS_10440 40075 41556 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941285.1 protein_id gnl|my_center|LOCUS_10440 44082 41683 gene locus_tag LOCUS_10450 44082 41683 CDS product VIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122418.1 protein_id gnl|my_center|LOCUS_10450 44363 45544 gene locus_tag LOCUS_10460 44363 45544 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933793.1 protein_id gnl|my_center|LOCUS_10460 45704 47329 gene locus_tag LOCUS_10470 45704 47329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 48010 47393 gene locus_tag LOCUS_10480 48010 47393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 49008 48007 gene locus_tag LOCUS_10490 49008 48007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 49291 50565 gene locus_tag LOCUS_10500 49291 50565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 50913 51587 gene locus_tag LOCUS_10510 50913 51587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 51623 52825 gene locus_tag LOCUS_10520 51623 52825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 52853 53488 gene locus_tag LOCUS_10530 52853 53488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 53524 54138 gene locus_tag LOCUS_10540 53524 54138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 54161 54781 gene locus_tag LOCUS_10550 54161 54781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 56581 54815 gene locus_tag LOCUS_10560 56581 54815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 56772 57902 gene locus_tag LOCUS_10570 gene asnA 56772 57902 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108145.1 protein_id gnl|my_center|LOCUS_10570 57983 59578 gene locus_tag LOCUS_10580 57983 59578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 59604 60656 gene locus_tag LOCUS_10590 59604 60656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 62436 60658 gene locus_tag LOCUS_10600 62436 60658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 63218 62529 gene locus_tag LOCUS_10610 63218 62529 CDS product MT-A70 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384784.1 protein_id gnl|my_center|LOCUS_10610 63967 63236 gene locus_tag LOCUS_10620 63967 63236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 65836 64079 gene locus_tag LOCUS_10630 65836 64079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 66920 65862 gene locus_tag LOCUS_10640 66920 65862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 67350 66961 gene locus_tag LOCUS_10650 67350 66961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 67447 69204 gene locus_tag LOCUS_10660 67447 69204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 69933 69238 gene locus_tag LOCUS_10670 69933 69238 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_10670 70082 71653 gene locus_tag LOCUS_10680 gene pckA 70082 71653 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_10680 72616 71765 gene locus_tag LOCUS_10690 72616 71765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 72756 73847 gene locus_tag LOCUS_10700 72756 73847 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803849.1 protein_id gnl|my_center|LOCUS_10700 73840 75138 gene locus_tag LOCUS_10710 73840 75138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 75307 75717 gene locus_tag LOCUS_10720 75307 75717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 75805 77625 gene locus_tag LOCUS_10730 75805 77625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 79747 77684 gene locus_tag LOCUS_10740 gene fusA 79747 77684 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_10740 79974 80504 gene locus_tag LOCUS_10750 79974 80504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 80552 81394 gene locus_tag LOCUS_10760 80552 81394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 81391 82455 gene locus_tag LOCUS_10770 81391 82455 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933710.1 protein_id gnl|my_center|LOCUS_10770 82452 83417 gene locus_tag LOCUS_10780 82452 83417 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140474.1 protein_id gnl|my_center|LOCUS_10780 83526 84089 gene locus_tag LOCUS_10790 83526 84089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 84093 84878 gene locus_tag LOCUS_10800 84093 84878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941592.1 protein_id gnl|my_center|LOCUS_10800 84887 85639 gene locus_tag LOCUS_10810 84887 85639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405214.1 protein_id gnl|my_center|LOCUS_10810 85649 86782 gene locus_tag LOCUS_10820 85649 86782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 86784 88499 gene locus_tag LOCUS_10830 86784 88499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 88546 89724 gene locus_tag LOCUS_10840 88546 89724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 89876 90415 gene locus_tag LOCUS_10850 89876 90415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 90412 91188 gene locus_tag LOCUS_10860 90412 91188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 91188 91643 gene locus_tag LOCUS_10870 91188 91643 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391711.1 protein_id gnl|my_center|LOCUS_10870 91683 92723 gene locus_tag LOCUS_10880 91683 92723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10880 92724 94889 gene locus_tag LOCUS_10890 92724 94889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10890 94892 96511 gene locus_tag LOCUS_10900 94892 96511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 96931 96524 gene locus_tag LOCUS_10910 96931 96524 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035740.1 protein_id gnl|my_center|LOCUS_10910 97256 96942 gene locus_tag LOCUS_10920 97256 96942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 97558 98205 gene locus_tag LOCUS_10930 97558 98205 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810125.1 protein_id gnl|my_center|LOCUS_10930 98768 100261 gene locus_tag LOCUS_10940 98768 100261 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_10940 101234 100275 gene locus_tag LOCUS_10950 101234 100275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 102816 101335 gene locus_tag LOCUS_10960 102816 101335 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545143.1 protein_id gnl|my_center|LOCUS_10960 103115 103939 gene locus_tag LOCUS_10970 103115 103939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence012 1171 326 gene locus_tag LOCUS_10980 1171 326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2639 1179 gene locus_tag LOCUS_10990 2639 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3463 2648 gene locus_tag LOCUS_11000 3463 2648 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028154.1 protein_id gnl|my_center|LOCUS_11000 4851 3469 gene locus_tag LOCUS_11010 4851 3469 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_11010 5399 4854 gene locus_tag LOCUS_11020 5399 4854 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940892.1 protein_id gnl|my_center|LOCUS_11020 6207 5446 gene locus_tag LOCUS_11030 gene cobB1 6207 5446 CDS product NAD-dependent protein deacylase Cob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879172.1 protein_id gnl|my_center|LOCUS_11030 6893 6204 gene locus_tag LOCUS_11040 6893 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 7673 6984 gene locus_tag LOCUS_11050 gene cmk 7673 6984 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201786468.1 protein_id gnl|my_center|LOCUS_11050 7791 8219 gene locus_tag LOCUS_11060 7791 8219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 8248 9045 gene locus_tag LOCUS_11070 8248 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 9098 10189 gene locus_tag LOCUS_11080 9098 10189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 10968 10207 gene locus_tag LOCUS_11090 10968 10207 CDS product Rv2407 family type 3 sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412350.1 protein_id gnl|my_center|LOCUS_11090 11119 13161 gene locus_tag LOCUS_11100 11119 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 13158 13961 gene locus_tag LOCUS_11110 13158 13961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 14109 15035 gene locus_tag LOCUS_11120 14109 15035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 15035 15358 gene locus_tag LOCUS_11130 15035 15358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 15403 17034 gene locus_tag LOCUS_11140 15403 17034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 17049 17201 gene locus_tag LOCUS_11150 17049 17201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 17208 17768 gene locus_tag LOCUS_11160 17208 17768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 17801 18799 gene locus_tag LOCUS_11170 17801 18799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 18792 19394 gene locus_tag LOCUS_11180 18792 19394 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_11180 19396 20307 gene locus_tag LOCUS_11190 gene nrfD 19396 20307 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462220.1 protein_id gnl|my_center|LOCUS_11190 20316 22406 gene locus_tag LOCUS_11200 20316 22406 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937997.1 protein_id gnl|my_center|LOCUS_11200 22408 23352 gene locus_tag LOCUS_11210 22408 23352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 23361 23843 gene locus_tag LOCUS_11220 23361 23843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 23858 24589 gene locus_tag LOCUS_11230 23858 24589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 24599 26260 gene locus_tag LOCUS_11240 24599 26260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 27824 26262 gene locus_tag LOCUS_11250 27824 26262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 28077 28406 gene locus_tag LOCUS_11260 28077 28406 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529756.1 protein_id gnl|my_center|LOCUS_11260 28575 28988 gene locus_tag LOCUS_11270 28575 28988 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870191.1 protein_id gnl|my_center|LOCUS_11270 29056 30003 gene locus_tag LOCUS_11280 29056 30003 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_11280 30534 30052 gene locus_tag LOCUS_11290 30534 30052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 31577 30531 gene locus_tag LOCUS_11300 31577 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 31873 31574 gene locus_tag LOCUS_11310 31873 31574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 32939 31962 gene locus_tag LOCUS_11320 32939 31962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 33130 34680 gene locus_tag LOCUS_11330 33130 34680 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_11330 34697 35698 gene locus_tag LOCUS_11340 34697 35698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 35714 37543 gene locus_tag LOCUS_11350 gene glmS 35714 37543 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940943.1 protein_id gnl|my_center|LOCUS_11350 39119 37578 gene locus_tag LOCUS_11360 39119 37578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 39542 39138 gene locus_tag LOCUS_11370 39542 39138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 40987 39626 gene locus_tag LOCUS_11380 40987 39626 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943126.1 protein_id gnl|my_center|LOCUS_11380 41107 42522 gene locus_tag LOCUS_11390 41107 42522 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_11390 42742 43095 gene locus_tag LOCUS_11400 42742 43095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 43289 44386 gene locus_tag LOCUS_11410 gene lpxK 43289 44386 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_11410 44421 44999 gene locus_tag LOCUS_11420 44421 44999 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057968.1 protein_id gnl|my_center|LOCUS_11420 44996 46003 gene locus_tag LOCUS_11430 gene rfaE1 44996 46003 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_11430 45991 46473 gene locus_tag LOCUS_11440 45991 46473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11440 46470 47411 gene locus_tag LOCUS_11450 46470 47411 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229036.1 protein_id gnl|my_center|LOCUS_11450 47416 47595 gene locus_tag LOCUS_11460 47416 47595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 47592 48428 gene locus_tag LOCUS_11470 gene kdsA 47592 48428 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942539.1 protein_id gnl|my_center|LOCUS_11470 48446 49084 gene locus_tag LOCUS_11480 gene fsa 48446 49084 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000667661.1 protein_id gnl|my_center|LOCUS_11480 49090 49845 gene locus_tag LOCUS_11490 49090 49845 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001239224.1 protein_id gnl|my_center|LOCUS_11490 49842 50876 gene locus_tag LOCUS_11500 49842 50876 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938354.1 protein_id gnl|my_center|LOCUS_11500 51906 50935 gene locus_tag LOCUS_11510 51906 50935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 52444 53505 gene locus_tag LOCUS_11520 52444 53505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 53746 56055 gene locus_tag LOCUS_11530 53746 56055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 56067 58742 gene locus_tag LOCUS_11540 56067 58742 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_11540 58763 60079 gene locus_tag LOCUS_11550 58763 60079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 60118 63600 gene locus_tag LOCUS_11560 60118 63600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 63743 64774 gene locus_tag LOCUS_11570 gene waaF 63743 64774 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_11570 64774 65892 gene locus_tag LOCUS_11580 64774 65892 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_11580 65909 67165 gene locus_tag LOCUS_11590 65909 67165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 67162 68169 gene locus_tag LOCUS_11600 67162 68169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 68166 68717 gene locus_tag LOCUS_11610 68166 68717 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121758.1 protein_id gnl|my_center|LOCUS_11610 68714 69592 gene locus_tag LOCUS_11620 68714 69592 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392409.1 protein_id gnl|my_center|LOCUS_11620 69582 70211 gene locus_tag LOCUS_11630 gene gmk 69582 70211 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_11630 70174 72351 gene locus_tag LOCUS_11640 70174 72351 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_11640 75638 72369 gene locus_tag LOCUS_11650 75638 72369 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_11650 77162 75642 gene locus_tag LOCUS_11660 77162 75642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 78457 77159 gene locus_tag LOCUS_11670 78457 77159 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_11670 78682 80370 gene locus_tag LOCUS_11680 78682 80370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 82463 80367 gene locus_tag LOCUS_11690 82463 80367 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000466031.1 protein_id gnl|my_center|LOCUS_11690 84762 82519 gene locus_tag LOCUS_11700 84762 82519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 86288 84900 gene locus_tag LOCUS_11710 86288 84900 CDS product flotillin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764424.1 protein_id gnl|my_center|LOCUS_11710 86934 86320 gene locus_tag LOCUS_11720 86934 86320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 90411 87049 gene locus_tag LOCUS_11730 90411 87049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 90911 92017 gene locus_tag LOCUS_11740 90911 92017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 92002 93444 gene locus_tag LOCUS_11750 92002 93444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 94098 93466 gene locus_tag LOCUS_11760 94098 93466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 96184 94997 gene locus_tag LOCUS_11770 96184 94997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 96321 97601 gene locus_tag LOCUS_11780 96321 97601 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392822.1 protein_id gnl|my_center|LOCUS_11780 97689 98990 gene locus_tag LOCUS_11790 97689 98990 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392821.1 protein_id gnl|my_center|LOCUS_11790 99009 101543 gene locus_tag LOCUS_11800 gene thrA 99009 101543 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_11800 101813 103198 gene locus_tag LOCUS_11810 101813 103198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence013 532 1665 gene locus_tag LOCUS_11820 gene proB 532 1665 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943830.1 protein_id gnl|my_center|LOCUS_11820 1715 2974 gene locus_tag LOCUS_11830 1715 2974 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_11830 2974 5319 gene locus_tag LOCUS_11840 2974 5319 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_11840 6356 5316 gene locus_tag LOCUS_11850 gene rlmN 6356 5316 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_11850 7582 6353 gene locus_tag LOCUS_11860 7582 6353 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460214.1 protein_id gnl|my_center|LOCUS_11860 7681 8460 gene locus_tag LOCUS_11870 7681 8460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 11652 8482 gene locus_tag LOCUS_11880 11652 8482 CDS product PAS domain S-box protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942202.1 protein_id gnl|my_center|LOCUS_11880 13887 11791 gene locus_tag LOCUS_11890 13887 11791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 14063 15031 gene locus_tag LOCUS_11900 14063 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 15091 16854 gene locus_tag LOCUS_11910 15091 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 18936 16870 gene locus_tag LOCUS_11920 18936 16870 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_11920 19151 21304 gene locus_tag LOCUS_11930 19151 21304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 21383 23056 gene locus_tag LOCUS_11940 21383 23056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 23056 24762 gene locus_tag LOCUS_11950 23056 24762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 24847 27141 gene locus_tag LOCUS_11960 24847 27141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 27251 29956 gene locus_tag LOCUS_11970 27251 29956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 30743 31144 gene locus_tag LOCUS_11980 30743 31144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 31255 31764 gene locus_tag LOCUS_11990 31255 31764 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258997.1 protein_id gnl|my_center|LOCUS_11990 31786 32742 gene locus_tag LOCUS_12000 31786 32742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 33019 32759 gene locus_tag LOCUS_12010 33019 32759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986424.1 protein_id gnl|my_center|LOCUS_12010 33145 33933 gene locus_tag LOCUS_12020 gene lgt 33145 33933 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897834.1 protein_id gnl|my_center|LOCUS_12020 35103 33961 gene locus_tag LOCUS_12030 35103 33961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943375.1 protein_id gnl|my_center|LOCUS_12030 35930 35250 gene locus_tag LOCUS_12040 35930 35250 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173524.1 protein_id gnl|my_center|LOCUS_12040 36513 35944 gene locus_tag LOCUS_12050 36513 35944 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_12050 36757 38280 gene locus_tag LOCUS_12060 36757 38280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 38487 40607 gene locus_tag LOCUS_12070 38487 40607 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797084.1 protein_id gnl|my_center|LOCUS_12070 41195 40620 gene locus_tag LOCUS_12080 41195 40620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 41329 43197 gene locus_tag LOCUS_12090 41329 43197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 43330 45042 gene locus_tag LOCUS_12100 43330 45042 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230221.1 protein_id gnl|my_center|LOCUS_12100 47676 45118 gene locus_tag LOCUS_12110 47676 45118 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_12110 47879 49753 gene locus_tag LOCUS_12120 gene gor 47879 49753 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_12120 51165 49750 gene locus_tag LOCUS_12130 51165 49750 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_12130 51366 52826 gene locus_tag LOCUS_12140 51366 52826 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_12140 52843 53166 gene locus_tag LOCUS_12150 52843 53166 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258148.1 protein_id gnl|my_center|LOCUS_12150 54443 53178 gene locus_tag LOCUS_12160 54443 53178 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118020.1 protein_id gnl|my_center|LOCUS_12160 55944 54454 gene locus_tag LOCUS_12170 55944 54454 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_12170 56783 55950 gene locus_tag LOCUS_12180 gene rhaD 56783 55950 CDS product rhamnulose-1-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766960.1 protein_id gnl|my_center|LOCUS_12180 56972 59146 gene locus_tag LOCUS_12190 56972 59146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 59923 59153 gene locus_tag LOCUS_12200 59923 59153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 62089 60065 gene locus_tag LOCUS_12210 62089 60065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 62276 62968 gene locus_tag LOCUS_12220 62276 62968 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325942.1 protein_id gnl|my_center|LOCUS_12220 63970 62981 gene locus_tag LOCUS_12230 63970 62981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 69401 64146 gene locus_tag LOCUS_12240 69401 64146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 69673 71484 gene locus_tag LOCUS_12250 69673 71484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 71128 71219 gene locus_tag LOCUS_t00130 71128 71219 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 71565 72983 gene locus_tag LOCUS_12260 71565 72983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 74141 73245 gene locus_tag LOCUS_12270 74141 73245 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022700.1 protein_id gnl|my_center|LOCUS_12270 74327 74944 gene locus_tag LOCUS_12280 74327 74944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 74937 77528 gene locus_tag LOCUS_12290 74937 77528 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459062.1 protein_id gnl|my_center|LOCUS_12290 77548 78543 gene locus_tag LOCUS_12300 77548 78543 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_12300 78540 79349 gene locus_tag LOCUS_12310 78540 79349 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_12310 79378 80142 gene locus_tag LOCUS_12320 79378 80142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 80157 81359 gene locus_tag LOCUS_12330 80157 81359 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_12330 81391 82257 gene locus_tag LOCUS_12340 81391 82257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 82994 82254 gene locus_tag LOCUS_12350 82994 82254 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817053.1 protein_id gnl|my_center|LOCUS_12350 83213 84307 gene locus_tag LOCUS_12360 gene ahbD 83213 84307 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_12360 84361 87159 gene locus_tag LOCUS_12370 84361 87159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 87662 89260 gene locus_tag LOCUS_12380 87662 89260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 89548 89742 gene locus_tag LOCUS_12390 89548 89742 CDS product FeoA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546008.1 protein_id gnl|my_center|LOCUS_12390 89742 91667 gene locus_tag LOCUS_12400 gene feoB 89742 91667 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_12400 92132 92473 gene locus_tag LOCUS_12410 92132 92473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 92550 93101 gene locus_tag LOCUS_12420 92550 93101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 94380 93463 gene locus_tag LOCUS_12430 94380 93463 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_12430 94925 94377 gene locus_tag LOCUS_12440 94925 94377 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_12440 95358 95984 gene locus_tag LOCUS_12450 95358 95984 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_12450 96362 96649 gene locus_tag LOCUS_12460 96362 96649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 99114 96706 gene locus_tag LOCUS_12470 99114 96706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 99359 99180 gene locus_tag LOCUS_12480 99359 99180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 99906 99505 gene locus_tag LOCUS_12490 99906 99505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence014 209 646 gene locus_tag LOCUS_12500 209 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 822 1472 gene locus_tag LOCUS_12510 822 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3007 2228 gene locus_tag LOCUS_12520 3007 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 4234 3173 gene locus_tag LOCUS_12530 4234 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 5322 4267 gene locus_tag LOCUS_12540 5322 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6708 5329 gene locus_tag LOCUS_12550 gene atoC 6708 5329 CDS product acetoacetate metabolism transcriptional regulator AtoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000125281.1 protein_id gnl|my_center|LOCUS_12550 8150 6705 gene locus_tag LOCUS_12560 8150 6705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 8568 8152 gene locus_tag LOCUS_12570 8568 8152 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110149.1 protein_id gnl|my_center|LOCUS_12570 9209 8565 gene locus_tag LOCUS_12580 9209 8565 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_12580 9962 9375 gene locus_tag LOCUS_12590 9962 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 10453 10121 gene locus_tag LOCUS_12600 10453 10121 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941274.1 protein_id gnl|my_center|LOCUS_12600 12562 10526 gene locus_tag LOCUS_12610 12562 10526 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940947.1 protein_id gnl|my_center|LOCUS_12610 13850 12660 gene locus_tag LOCUS_12620 13850 12660 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941898.1 protein_id gnl|my_center|LOCUS_12620 14367 13867 gene locus_tag LOCUS_12630 gene coaD 14367 13867 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080981.1 protein_id gnl|my_center|LOCUS_12630 14924 14355 gene locus_tag LOCUS_12640 gene rsmD 14924 14355 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_12640 16084 15098 gene locus_tag LOCUS_12650 16084 15098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 16791 16615 gene locus_tag LOCUS_12660 16791 16615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 17100 17372 gene locus_tag LOCUS_12670 17100 17372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 17489 19705 gene locus_tag LOCUS_12680 17489 19705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 19761 22352 gene locus_tag LOCUS_12690 19761 22352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 23629 22367 gene locus_tag LOCUS_12700 gene waaA 23629 22367 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_12700 25175 23640 gene locus_tag LOCUS_12710 25175 23640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 26960 25182 gene locus_tag LOCUS_12720 gene msbA 26960 25182 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_12720 28809 26950 gene locus_tag LOCUS_12730 28809 26950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 30472 28811 gene locus_tag LOCUS_12740 30472 28811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 31307 30486 gene locus_tag LOCUS_12750 gene lpxI 31307 30486 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_12750 32274 31309 gene locus_tag LOCUS_12760 32274 31309 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140212.1 protein_id gnl|my_center|LOCUS_12760 33056 32271 gene locus_tag LOCUS_12770 gene lpxA 33056 32271 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942904.1 protein_id gnl|my_center|LOCUS_12770 34079 33060 gene locus_tag LOCUS_12780 gene lpxD 34079 33060 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141862.1 protein_id gnl|my_center|LOCUS_12780 34691 34170 gene locus_tag LOCUS_12790 34691 34170 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942907.1 protein_id gnl|my_center|LOCUS_12790 37004 34707 gene locus_tag LOCUS_12800 gene bamA 37004 34707 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_12800 37684 37001 gene locus_tag LOCUS_12810 37684 37001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_12810 38954 37689 gene locus_tag LOCUS_12820 38954 37689 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_12820 40449 38959 gene locus_tag LOCUS_12830 gene lysS 40449 38959 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_12830 41599 40514 gene locus_tag LOCUS_12840 gene prfB 41599 40514 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886623.1 protein_id gnl|my_center|LOCUS_12840 43327 41618 gene locus_tag LOCUS_12850 gene lnt 43327 41618 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_12850 45538 43421 gene locus_tag LOCUS_12860 45538 43421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 45623 47341 gene locus_tag LOCUS_12870 45623 47341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 47338 49071 gene locus_tag LOCUS_12880 47338 49071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 49068 51008 gene locus_tag LOCUS_12890 49068 51008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 53304 50989 gene locus_tag LOCUS_12900 53304 50989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 53572 56487 gene locus_tag LOCUS_12910 53572 56487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 56506 57267 gene locus_tag LOCUS_12920 56506 57267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 57271 58770 gene locus_tag LOCUS_12930 57271 58770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 60139 58895 gene locus_tag LOCUS_12940 60139 58895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 61419 60226 gene locus_tag LOCUS_12950 61419 60226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 62386 62036 gene locus_tag LOCUS_12960 62386 62036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 63099 62602 gene locus_tag LOCUS_12970 63099 62602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 64210 63110 gene locus_tag LOCUS_12980 64210 63110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 64414 65709 gene locus_tag LOCUS_12990 64414 65709 CDS product condensation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966819.1 protein_id gnl|my_center|LOCUS_12990 66039 67325 gene locus_tag LOCUS_13000 66039 67325 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016570.1 protein_id gnl|my_center|LOCUS_13000 67462 68904 gene locus_tag LOCUS_13010 67462 68904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 69855 69055 gene locus_tag LOCUS_13020 69855 69055 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049892481.1 protein_id gnl|my_center|LOCUS_13020 70827 70009 gene locus_tag LOCUS_13030 70827 70009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 71007 75035 gene locus_tag LOCUS_13040 71007 75035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 75557 75168 gene locus_tag LOCUS_13050 75557 75168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 75696 75493 gene locus_tag LOCUS_13060 75696 75493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 75777 77615 gene locus_tag LOCUS_13070 gene iorA 75777 77615 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_13070 77612 78196 gene locus_tag LOCUS_13080 77612 78196 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_13080 78418 79065 gene locus_tag LOCUS_13090 78418 79065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 79080 79280 gene locus_tag LOCUS_13100 79080 79280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 80231 79410 gene locus_tag LOCUS_13110 80231 79410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 80465 80653 gene locus_tag LOCUS_13120 80465 80653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 81369 80683 gene locus_tag LOCUS_13130 81369 80683 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_13130 81532 82266 gene locus_tag LOCUS_13140 81532 82266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 82423 83160 gene locus_tag LOCUS_13150 82423 83160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 84269 83157 gene locus_tag LOCUS_13160 84269 83157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 85333 84257 gene locus_tag LOCUS_13170 85333 84257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 86866 85337 gene locus_tag LOCUS_13180 86866 85337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 87542 87060 gene locus_tag LOCUS_13190 gene ybaK 87542 87060 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_13190 87962 87549 gene locus_tag LOCUS_13200 87962 87549 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529139.1 protein_id gnl|my_center|LOCUS_13200 88192 87959 gene locus_tag LOCUS_13210 88192 87959 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244189.1 protein_id gnl|my_center|LOCUS_13210 89472 88300 gene locus_tag LOCUS_13220 89472 88300 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224388.1 protein_id gnl|my_center|LOCUS_13220 91015 89474 gene locus_tag LOCUS_13230 91015 89474 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964371.1 protein_id gnl|my_center|LOCUS_13230 92215 91103 gene locus_tag LOCUS_13240 92215 91103 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_13240 94715 92220 gene locus_tag LOCUS_13250 94715 92220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 95874 94801 gene locus_tag LOCUS_13260 95874 94801 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_13260 96896 95874 gene locus_tag LOCUS_13270 gene obgE 96896 95874 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_13270 97157 98338 gene locus_tag LOCUS_13280 97157 98338 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207591.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence015 1730 165 gene locus_tag LOCUS_13290 gene rny 1730 165 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941798.1 protein_id gnl|my_center|LOCUS_13290 2666 2382 gene locus_tag LOCUS_13300 2666 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 2894 2812 gene locus_tag LOCUS_t00140 2894 2812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3442 2966 gene locus_tag LOCUS_13310 3442 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8532 3697 gene locus_tag LOCUS_13320 8532 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 13450 8624 gene locus_tag LOCUS_13330 13450 8624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 13783 13580 gene locus_tag LOCUS_13340 13783 13580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 14209 14826 gene locus_tag LOCUS_13350 14209 14826 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_13350 15021 15932 gene locus_tag LOCUS_13360 gene lpxC 15021 15932 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073895.1 protein_id gnl|my_center|LOCUS_13360 16142 17191 gene locus_tag LOCUS_13370 16142 17191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 17323 19248 gene locus_tag LOCUS_13380 17323 19248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 19259 20011 gene locus_tag LOCUS_13390 19259 20011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 20008 21282 gene locus_tag LOCUS_13400 20008 21282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21421 23058 gene locus_tag LOCUS_13410 21421 23058 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230761.1 protein_id gnl|my_center|LOCUS_13410 23755 23114 gene locus_tag LOCUS_13420 23755 23114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 23903 24886 gene locus_tag LOCUS_13430 23903 24886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 24883 25974 gene locus_tag LOCUS_13440 24883 25974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 26121 26429 gene locus_tag LOCUS_13450 gene lsrG 26121 26429 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175221.1 protein_id gnl|my_center|LOCUS_13450 26469 27593 gene locus_tag LOCUS_13460 26469 27593 CDS product FIST N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392213.1 protein_id gnl|my_center|LOCUS_13460 27593 29683 gene locus_tag LOCUS_13470 27593 29683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 31068 29686 gene locus_tag LOCUS_13480 31068 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 31915 31220 gene locus_tag LOCUS_13490 31915 31220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 32133 32603 gene locus_tag LOCUS_13500 32133 32603 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_13500 35229 32611 gene locus_tag LOCUS_13510 35229 32611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 35465 36502 gene locus_tag LOCUS_13520 35465 36502 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073579.1 protein_id gnl|my_center|LOCUS_13520 36659 36919 gene locus_tag LOCUS_13530 36659 36919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 37148 38065 gene locus_tag LOCUS_13540 37148 38065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 38149 39318 gene locus_tag LOCUS_13550 38149 39318 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021066.1 protein_id gnl|my_center|LOCUS_13550 39503 39994 gene locus_tag LOCUS_13560 gene rimP 39503 39994 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958225.1 protein_id gnl|my_center|LOCUS_13560 40007 41647 gene locus_tag LOCUS_13570 40007 41647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 41936 44662 gene locus_tag LOCUS_13580 gene infB 41936 44662 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942233.1 protein_id gnl|my_center|LOCUS_13580 44686 44973 gene locus_tag LOCUS_13590 44686 44973 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_13590 44978 45376 gene locus_tag LOCUS_13600 gene rbfA 44978 45376 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144020.1 protein_id gnl|my_center|LOCUS_13600 45369 46340 gene locus_tag LOCUS_13610 45369 46340 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_13610 46337 47275 gene locus_tag LOCUS_13620 gene truB 46337 47275 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942236.1 protein_id gnl|my_center|LOCUS_13620 47375 47644 gene locus_tag LOCUS_13630 gene rpsO 47375 47644 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808855.1 protein_id gnl|my_center|LOCUS_13630 47763 49886 gene locus_tag LOCUS_13640 gene pnp 47763 49886 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_13640 49943 50392 gene locus_tag LOCUS_13650 gene dut 49943 50392 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083581.1 protein_id gnl|my_center|LOCUS_13650 50394 51089 gene locus_tag LOCUS_13660 gene nfi 50394 51089 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172477.1 protein_id gnl|my_center|LOCUS_13660 51154 52101 gene locus_tag LOCUS_13670 51154 52101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 52163 53929 gene locus_tag LOCUS_13680 52163 53929 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_13680 54498 53926 gene locus_tag LOCUS_13690 54498 53926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 55794 54571 gene locus_tag LOCUS_13700 55794 54571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 58788 55840 gene locus_tag LOCUS_13710 58788 55840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 61196 58785 gene locus_tag LOCUS_13720 61196 58785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 61563 61366 gene locus_tag LOCUS_13730 61563 61366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 62221 61655 gene locus_tag LOCUS_13740 62221 61655 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_13740 62382 62218 gene locus_tag LOCUS_13750 62382 62218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 63540 62536 gene locus_tag LOCUS_13760 63540 62536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 63745 64923 gene locus_tag LOCUS_13770 63745 64923 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877552.1 protein_id gnl|my_center|LOCUS_13770 64927 66522 gene locus_tag LOCUS_13780 64927 66522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 68127 66529 gene locus_tag LOCUS_13790 68127 66529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 69832 68300 gene locus_tag LOCUS_13800 69832 68300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 71836 69884 gene locus_tag LOCUS_13810 71836 69884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 72126 72467 gene locus_tag LOCUS_13820 72126 72467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 78613 72527 gene locus_tag LOCUS_13830 78613 72527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 78773 83269 gene locus_tag LOCUS_13840 78773 83269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 83313 83975 gene locus_tag LOCUS_13850 83313 83975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 85009 83972 gene locus_tag LOCUS_13860 85009 83972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 86454 85006 gene locus_tag LOCUS_13870 gene hpnJ 86454 85006 CDS product hopanoid biosynthesis associated radical SAM protein HpnJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941811.1 protein_id gnl|my_center|LOCUS_13870 87679 86459 gene locus_tag LOCUS_13880 87679 86459 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259610.1 protein_id gnl|my_center|LOCUS_13880 90318 87997 gene locus_tag LOCUS_13890 90318 87997 CDS product tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107358.1 protein_id gnl|my_center|LOCUS_13890 91356 90322 gene locus_tag LOCUS_13900 91356 90322 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000978074.1 protein_id gnl|my_center|LOCUS_13900 92213 91425 gene locus_tag LOCUS_13910 gene tatC 92213 91425 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383013.1 protein_id gnl|my_center|LOCUS_13910 92638 92210 gene locus_tag LOCUS_13920 92638 92210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 93710 92709 gene locus_tag LOCUS_13930 93710 92709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 94649 93858 gene locus_tag LOCUS_13940 94649 93858 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403918.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence016 469 1176 gene locus_tag LOCUS_13950 469 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1287 2006 gene locus_tag LOCUS_13960 1287 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 2588 2010 gene locus_tag LOCUS_13970 2588 2010 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_13970 2793 4397 gene locus_tag LOCUS_13980 2793 4397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4450 5646 gene locus_tag LOCUS_13990 4450 5646 CDS product TRC40/GET3/ArsA family transport-energizing ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256035.1 protein_id gnl|my_center|LOCUS_13990 5643 6107 gene locus_tag LOCUS_14000 5643 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 6735 6112 gene locus_tag LOCUS_14010 6735 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 7484 6732 gene locus_tag LOCUS_14020 7484 6732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 9380 7797 gene locus_tag LOCUS_14030 9380 7797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 9703 10710 gene locus_tag LOCUS_14040 gene tsaD 9703 10710 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942510.1 protein_id gnl|my_center|LOCUS_14040 10707 11177 gene locus_tag LOCUS_14050 10707 11177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 11174 11965 gene locus_tag LOCUS_14060 gene rsmA 11174 11965 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956993.1 protein_id gnl|my_center|LOCUS_14060 12728 12201 gene locus_tag LOCUS_14070 12728 12201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 12969 13868 gene locus_tag LOCUS_14080 12969 13868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 15552 13873 gene locus_tag LOCUS_14090 15552 13873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 15678 16367 gene locus_tag LOCUS_14100 15678 16367 CDS product SprT-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491603.1 protein_id gnl|my_center|LOCUS_14100 16446 16949 gene locus_tag LOCUS_14110 16446 16949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 16954 17490 gene locus_tag LOCUS_14120 16954 17490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 19252 17501 gene locus_tag LOCUS_14130 19252 17501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 19398 20537 gene locus_tag LOCUS_14140 19398 20537 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_14140 20552 21274 gene locus_tag LOCUS_14150 20552 21274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 21274 22983 gene locus_tag LOCUS_14160 gene asnB 21274 22983 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_14160 22976 23824 gene locus_tag LOCUS_14170 22976 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 25887 23821 gene locus_tag LOCUS_14180 25887 23821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 28634 25998 gene locus_tag LOCUS_14190 28634 25998 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_14190 29451 28840 gene locus_tag LOCUS_14200 29451 28840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 29585 29737 gene locus_tag LOCUS_14210 29585 29737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 30650 29721 gene locus_tag LOCUS_14220 gene miaA 30650 29721 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_14220 31330 30656 gene locus_tag LOCUS_14230 31330 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 32236 31331 gene locus_tag LOCUS_14240 32236 31331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 33407 32436 gene locus_tag LOCUS_14250 gene meaB 33407 32436 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_14250 35201 33411 gene locus_tag LOCUS_14260 gene mutL 35201 33411 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942644.1 protein_id gnl|my_center|LOCUS_14260 35736 35317 gene locus_tag LOCUS_14270 35736 35317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 36548 35979 gene locus_tag LOCUS_14280 gene thpR 36548 35979 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_14280 37777 36545 gene locus_tag LOCUS_14290 37777 36545 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541328.1 protein_id gnl|my_center|LOCUS_14290 38232 37762 gene locus_tag LOCUS_14300 38232 37762 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940818.1 protein_id gnl|my_center|LOCUS_14300 40216 38285 gene locus_tag LOCUS_14310 40216 38285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 41889 40213 gene locus_tag LOCUS_14320 41889 40213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 41944 42360 gene locus_tag LOCUS_14330 41944 42360 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003307318.1 protein_id gnl|my_center|LOCUS_14330 43476 42361 gene locus_tag LOCUS_14340 43476 42361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 44410 43493 gene locus_tag LOCUS_14350 44410 43493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 44611 45237 gene locus_tag LOCUS_14360 44611 45237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 45465 47180 gene locus_tag LOCUS_14370 45465 47180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 47323 48459 gene locus_tag LOCUS_14380 47323 48459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 48478 50661 gene locus_tag LOCUS_14390 48478 50661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 52074 50668 gene locus_tag LOCUS_14400 52074 50668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 52228 52155 gene locus_tag LOCUS_t00150 52228 52155 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 54618 52309 gene locus_tag LOCUS_14410 54618 52309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 57262 54707 gene locus_tag LOCUS_14420 57262 54707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 60676 57302 gene locus_tag LOCUS_14430 60676 57302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 61859 60693 gene locus_tag LOCUS_14440 61859 60693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 63012 61996 gene locus_tag LOCUS_14450 gene fbp 63012 61996 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939127.1 protein_id gnl|my_center|LOCUS_14450 63195 63629 gene locus_tag LOCUS_14460 63195 63629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 63630 64037 gene locus_tag LOCUS_14470 63630 64037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 64034 65866 gene locus_tag LOCUS_14480 64034 65866 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_14480 65868 66992 gene locus_tag LOCUS_14490 65868 66992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258901.1 protein_id gnl|my_center|LOCUS_14490 67015 67875 gene locus_tag LOCUS_14500 gene mtnP 67015 67875 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_14500 67887 68795 gene locus_tag LOCUS_14510 67887 68795 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941774.1 protein_id gnl|my_center|LOCUS_14510 68910 69671 gene locus_tag LOCUS_14520 68910 69671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 69676 70566 gene locus_tag LOCUS_14530 69676 70566 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289198.1 protein_id gnl|my_center|LOCUS_14530 71198 70743 gene locus_tag LOCUS_14540 71198 70743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 71948 71274 gene locus_tag LOCUS_14550 71948 71274 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_14550 72544 71945 gene locus_tag LOCUS_14560 72544 71945 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943181.1 protein_id gnl|my_center|LOCUS_14560 73464 72541 gene locus_tag LOCUS_14570 gene argF 73464 72541 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_14570 74920 73478 gene locus_tag LOCUS_14580 gene hslU 74920 73478 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_14580 75470 74922 gene locus_tag LOCUS_14590 gene hslV 75470 74922 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172636479.1 protein_id gnl|my_center|LOCUS_14590 76420 75467 gene locus_tag LOCUS_14600 gene xerC 76420 75467 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_14600 77809 76481 gene locus_tag LOCUS_14610 gene trmFO 77809 76481 CDS product methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392541.1 protein_id gnl|my_center|LOCUS_14610 80161 77813 gene locus_tag LOCUS_14620 gene topA 80161 77813 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_14620 81276 80161 gene locus_tag LOCUS_14630 gene dprA 81276 80161 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_14630 82506 81445 gene locus_tag LOCUS_14640 82506 81445 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914065.1 protein_id gnl|my_center|LOCUS_14640 83273 82521 gene locus_tag LOCUS_14650 83273 82521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 84734 83379 gene locus_tag LOCUS_14660 84734 83379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 84874 86988 gene locus_tag LOCUS_14670 84874 86988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 87000 87989 gene locus_tag LOCUS_14680 87000 87989 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389971.1 protein_id gnl|my_center|LOCUS_14680 88045 88722 gene locus_tag LOCUS_14690 88045 88722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 90367 92679 gene locus_tag LOCUS_14700 90367 92679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 92904 93530 gene locus_tag LOCUS_14710 92904 93530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 93710 94297 gene locus_tag LOCUS_14720 93710 94297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence017 2252 240 gene locus_tag LOCUS_14730 2252 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 4468 2354 gene locus_tag LOCUS_14740 4468 2354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 4603 5193 gene locus_tag LOCUS_14750 4603 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963138.1 protein_id gnl|my_center|LOCUS_14750 6733 5216 gene locus_tag LOCUS_14760 6733 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 9492 6832 gene locus_tag LOCUS_14770 9492 6832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 11417 9609 gene locus_tag LOCUS_14780 11417 9609 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_14780 11380 11556 gene locus_tag LOCUS_14790 11380 11556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 14670 11578 gene locus_tag LOCUS_14800 14670 11578 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974031.1 protein_id gnl|my_center|LOCUS_14800 15725 14667 gene locus_tag LOCUS_14810 15725 14667 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_14810 16219 15794 gene locus_tag LOCUS_14820 16219 15794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 16548 17627 gene locus_tag LOCUS_14830 16548 17627 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030873148.1 protein_id gnl|my_center|LOCUS_14830 17617 18102 gene locus_tag LOCUS_14840 17617 18102 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086743.1 protein_id gnl|my_center|LOCUS_14840 18190 19203 gene locus_tag LOCUS_14850 18190 19203 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974270.1 protein_id gnl|my_center|LOCUS_14850 21340 19214 gene locus_tag LOCUS_14860 21340 19214 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878706.1 protein_id gnl|my_center|LOCUS_14860 21837 21412 gene locus_tag LOCUS_14870 21837 21412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 22013 23068 gene locus_tag LOCUS_14880 22013 23068 CDS product DUF2804 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986244.1 protein_id gnl|my_center|LOCUS_14880 23396 27943 gene locus_tag LOCUS_14890 23396 27943 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064803.1 protein_id gnl|my_center|LOCUS_14890 27936 29357 gene locus_tag LOCUS_14900 27936 29357 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005062753.1 protein_id gnl|my_center|LOCUS_14900 29812 29420 gene locus_tag LOCUS_14910 29812 29420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 30019 30486 gene locus_tag LOCUS_14920 30019 30486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 30483 31541 gene locus_tag LOCUS_14930 30483 31541 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392522.1 protein_id gnl|my_center|LOCUS_14930 31546 32823 gene locus_tag LOCUS_14940 31546 32823 CDS product 2-hydroxyacyl-CoA dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392521.1 protein_id gnl|my_center|LOCUS_14940 32900 34939 gene locus_tag LOCUS_14950 32900 34939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 34969 36948 gene locus_tag LOCUS_14960 34969 36948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 37620 36964 gene locus_tag LOCUS_14970 37620 36964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 38890 37673 gene locus_tag LOCUS_14980 38890 37673 CDS product amino acid deaminase/aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003904700.1 protein_id gnl|my_center|LOCUS_14980 39381 38914 gene locus_tag LOCUS_14990 39381 38914 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766229.1 protein_id gnl|my_center|LOCUS_14990 43599 39535 gene locus_tag LOCUS_15000 43599 39535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 45522 43717 gene locus_tag LOCUS_15010 45522 43717 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_15010 47303 45621 gene locus_tag LOCUS_15020 47303 45621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 47655 47350 gene locus_tag LOCUS_15030 47655 47350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15030 48048 47719 gene locus_tag LOCUS_15040 48048 47719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15040 48232 49296 gene locus_tag LOCUS_15050 48232 49296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404941.1 protein_id gnl|my_center|LOCUS_15050 49293 50330 gene locus_tag LOCUS_15060 gene argC 49293 50330 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065747.1 protein_id gnl|my_center|LOCUS_15060 50324 51487 gene locus_tag LOCUS_15070 50324 51487 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404943.1 protein_id gnl|my_center|LOCUS_15070 51484 52410 gene locus_tag LOCUS_15080 gene argB 51484 52410 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_15080 52403 53497 gene locus_tag LOCUS_15090 52403 53497 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404946.1 protein_id gnl|my_center|LOCUS_15090 53484 53957 gene locus_tag LOCUS_15100 gene argR 53484 53957 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935393.1 protein_id gnl|my_center|LOCUS_15100 53954 55222 gene locus_tag LOCUS_15110 53954 55222 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_15110 55223 56620 gene locus_tag LOCUS_15120 gene argH 55223 56620 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259187.1 protein_id gnl|my_center|LOCUS_15120 56972 58414 gene locus_tag LOCUS_15130 56972 58414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 58420 59811 gene locus_tag LOCUS_15140 58420 59811 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_15140 61265 59835 gene locus_tag LOCUS_15150 61265 59835 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_15150 61525 62979 gene locus_tag LOCUS_15160 61525 62979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 62976 65048 gene locus_tag LOCUS_15170 62976 65048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 65124 65987 gene locus_tag LOCUS_15180 65124 65987 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941492.1 protein_id gnl|my_center|LOCUS_15180 67324 66005 gene locus_tag LOCUS_15190 67324 66005 CDS product carboxylic ester hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012297.1 protein_id gnl|my_center|LOCUS_15190 67492 68820 gene locus_tag LOCUS_15200 67492 68820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 70379 68817 gene locus_tag LOCUS_15210 70379 68817 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_15210 71752 70391 gene locus_tag LOCUS_15220 71752 70391 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861196.1 protein_id gnl|my_center|LOCUS_15220 74021 71793 gene locus_tag LOCUS_15230 74021 71793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 74217 75053 gene locus_tag LOCUS_15240 74217 75053 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824948.1 protein_id gnl|my_center|LOCUS_15240 75067 76743 gene locus_tag LOCUS_15250 75067 76743 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972394.1 protein_id gnl|my_center|LOCUS_15250 76776 78050 gene locus_tag LOCUS_15260 76776 78050 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_15260 78108 78746 gene locus_tag LOCUS_15270 78108 78746 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840010.1 protein_id gnl|my_center|LOCUS_15270 79070 81058 gene locus_tag LOCUS_15280 79070 81058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 81130 82722 gene locus_tag LOCUS_15290 81130 82722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 82893 84752 gene locus_tag LOCUS_15300 gene typA 82893 84752 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_15300 85175 84792 gene locus_tag LOCUS_15310 85175 84792 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969399.1 protein_id gnl|my_center|LOCUS_15310 88345 85205 gene locus_tag LOCUS_15320 88345 85205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 89650 88529 gene locus_tag LOCUS_15330 89650 88529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 91027 89792 gene locus_tag LOCUS_15340 91027 89792 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948368.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence018 2833 185 gene locus_tag LOCUS_15350 2833 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 4385 2928 gene locus_tag LOCUS_15360 4385 2928 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633351.1 protein_id gnl|my_center|LOCUS_15360 5345 4401 gene locus_tag LOCUS_15370 5345 4401 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_15370 6170 5349 gene locus_tag LOCUS_15380 6170 5349 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_15380 6326 7936 gene locus_tag LOCUS_15390 6326 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 9296 8001 gene locus_tag LOCUS_15400 9296 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9498 10466 gene locus_tag LOCUS_15410 9498 10466 CDS product DUF523 and DUF1722 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001248640.1 protein_id gnl|my_center|LOCUS_15410 11403 10669 gene locus_tag LOCUS_15420 11403 10669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 12533 11688 gene locus_tag LOCUS_15430 12533 11688 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122726.1 protein_id gnl|my_center|LOCUS_15430 12714 16568 gene locus_tag LOCUS_15440 12714 16568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 16693 17766 gene locus_tag LOCUS_15450 gene recA 16693 17766 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_15450 17771 19009 gene locus_tag LOCUS_15460 17771 19009 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_15460 19016 19921 gene locus_tag LOCUS_15470 19016 19921 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_15470 20572 19949 gene locus_tag LOCUS_15480 20572 19949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 21414 20572 gene locus_tag LOCUS_15490 21414 20572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 22043 21411 gene locus_tag LOCUS_15500 22043 21411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 23085 22054 gene locus_tag LOCUS_15510 23085 22054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 24453 23176 gene locus_tag LOCUS_15520 24453 23176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 24962 24450 gene locus_tag LOCUS_15530 24962 24450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 26341 24962 gene locus_tag LOCUS_15540 26341 24962 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_15540 26852 26355 gene locus_tag LOCUS_15550 26852 26355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15550 27796 26849 gene locus_tag LOCUS_15560 27796 26849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15560 28129 29154 gene locus_tag LOCUS_15570 28129 29154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 29159 30277 gene locus_tag LOCUS_15580 29159 30277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 30274 31131 gene locus_tag LOCUS_15590 30274 31131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 31311 32858 gene locus_tag LOCUS_15600 31311 32858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 33168 33968 gene locus_tag LOCUS_15610 33168 33968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 35393 34038 gene locus_tag LOCUS_15620 35393 34038 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706126.1 protein_id gnl|my_center|LOCUS_15620 35803 37599 gene locus_tag LOCUS_15630 35803 37599 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_15630 38275 39042 gene locus_tag LOCUS_15640 38275 39042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 39381 40727 gene locus_tag LOCUS_15650 39381 40727 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071020.1 protein_id gnl|my_center|LOCUS_15650 41357 40734 gene locus_tag LOCUS_15660 41357 40734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 42453 41482 gene locus_tag LOCUS_15670 42453 41482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 43869 42460 gene locus_tag LOCUS_15680 43869 42460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 44098 45153 gene locus_tag LOCUS_15690 44098 45153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 45193 45266 gene locus_tag LOCUS_t00160 45193 45266 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 45631 49101 gene locus_tag LOCUS_15700 45631 49101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 50788 49220 gene locus_tag LOCUS_15710 50788 49220 CDS product family 1 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143220.1 protein_id gnl|my_center|LOCUS_15710 50978 52495 gene locus_tag LOCUS_15720 50978 52495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 52528 53547 gene locus_tag LOCUS_15730 52528 53547 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966538.1 protein_id gnl|my_center|LOCUS_15730 55169 53553 gene locus_tag LOCUS_15740 55169 53553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 55662 57776 gene locus_tag LOCUS_15750 55662 57776 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933078.1 protein_id gnl|my_center|LOCUS_15750 58537 57839 gene locus_tag LOCUS_15760 58537 57839 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583790.1 protein_id gnl|my_center|LOCUS_15760 59242 59937 gene locus_tag LOCUS_15770 59242 59937 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021473.1 protein_id gnl|my_center|LOCUS_15770 59959 61317 gene locus_tag LOCUS_15780 59959 61317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 62775 61324 gene locus_tag LOCUS_15790 62775 61324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 62875 63318 gene locus_tag LOCUS_15800 62875 63318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 63983 63330 gene locus_tag LOCUS_15810 63983 63330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 64355 67261 gene locus_tag LOCUS_15820 64355 67261 CDS product ligand-binding sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076055427.1 protein_id gnl|my_center|LOCUS_15820 69289 67286 gene locus_tag LOCUS_15830 69289 67286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 69620 70519 gene locus_tag LOCUS_15840 69620 70519 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028181.1 protein_id gnl|my_center|LOCUS_15840 70532 71830 gene locus_tag LOCUS_15850 70532 71830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 71928 75431 gene locus_tag LOCUS_15860 71928 75431 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_15860 75444 76412 gene locus_tag LOCUS_15870 75444 76412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 77678 76452 gene locus_tag LOCUS_15880 77678 76452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 77817 79082 gene locus_tag LOCUS_15890 77817 79082 CDS product acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139014079.1 protein_id gnl|my_center|LOCUS_15890 79211 79879 gene locus_tag LOCUS_15900 79211 79879 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000404330.1 protein_id gnl|my_center|LOCUS_15900 80040 81620 gene locus_tag LOCUS_15910 80040 81620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 82252 81716 gene locus_tag LOCUS_15920 82252 81716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence019 494 1531 gene locus_tag LOCUS_15930 494 1531 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_15930 1578 2417 gene locus_tag LOCUS_15940 gene mreC 1578 2417 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_15940 2414 2938 gene locus_tag LOCUS_15950 2414 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 2939 4789 gene locus_tag LOCUS_15960 gene mrdA 2939 4789 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_15960 4800 5963 gene locus_tag LOCUS_15970 gene rodA 4800 5963 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_15970 6975 5977 gene locus_tag LOCUS_15980 gene amrS 6975 5977 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393777.1 protein_id gnl|my_center|LOCUS_15980 10445 6984 gene locus_tag LOCUS_15990 10445 6984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 10619 11614 gene locus_tag LOCUS_16000 10619 11614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 11622 13295 gene locus_tag LOCUS_16010 11622 13295 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392228.1 protein_id gnl|my_center|LOCUS_16010 13292 14065 gene locus_tag LOCUS_16020 13292 14065 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392229.1 protein_id gnl|my_center|LOCUS_16020 14093 15436 gene locus_tag LOCUS_16030 14093 15436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 15445 16758 gene locus_tag LOCUS_16040 15445 16758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 16762 17919 gene locus_tag LOCUS_16050 16762 17919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 17916 18800 gene locus_tag LOCUS_16060 17916 18800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 18822 19865 gene locus_tag LOCUS_16070 18822 19865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 20569 19862 gene locus_tag LOCUS_16080 20569 19862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 20848 21840 gene locus_tag LOCUS_16090 20848 21840 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037390645.1 protein_id gnl|my_center|LOCUS_16090 21950 23137 gene locus_tag LOCUS_16100 gene metK 21950 23137 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173679.1 protein_id gnl|my_center|LOCUS_16100 23134 24345 gene locus_tag LOCUS_16110 gene megL 23134 24345 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_16110 24411 25220 gene locus_tag LOCUS_16120 gene mutM 24411 25220 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_16120 26499 25231 gene locus_tag LOCUS_16130 26499 25231 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817337.1 protein_id gnl|my_center|LOCUS_16130 26798 27979 gene locus_tag LOCUS_16140 26798 27979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 27996 28439 gene locus_tag LOCUS_16150 27996 28439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 28476 29135 gene locus_tag LOCUS_16160 28476 29135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 29319 30242 gene locus_tag LOCUS_16170 29319 30242 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_16170 30250 32586 gene locus_tag LOCUS_16180 30250 32586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 32590 34092 gene locus_tag LOCUS_16190 32590 34092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 35590 34142 gene locus_tag LOCUS_16200 35590 34142 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_16200 36014 35616 gene locus_tag LOCUS_16210 36014 35616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 36165 37697 gene locus_tag LOCUS_16220 36165 37697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 39095 37710 gene locus_tag LOCUS_16230 39095 37710 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839227.1 protein_id gnl|my_center|LOCUS_16230 40178 39144 gene locus_tag LOCUS_16240 40178 39144 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089653.1 protein_id gnl|my_center|LOCUS_16240 40462 40190 gene locus_tag LOCUS_16250 40462 40190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 41522 40467 gene locus_tag LOCUS_16260 41522 40467 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803778.1 protein_id gnl|my_center|LOCUS_16260 41700 42827 gene locus_tag LOCUS_16270 41700 42827 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965886.1 protein_id gnl|my_center|LOCUS_16270 43565 42849 gene locus_tag LOCUS_16280 43565 42849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 43720 45117 gene locus_tag LOCUS_16290 43720 45117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 45165 46787 gene locus_tag LOCUS_16300 45165 46787 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114139.1 protein_id gnl|my_center|LOCUS_16300 46788 47141 gene locus_tag LOCUS_16310 46788 47141 CDS product peptide chain release factor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144028.1 protein_id gnl|my_center|LOCUS_16310 47400 48875 gene locus_tag LOCUS_16320 47400 48875 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933883.1 protein_id gnl|my_center|LOCUS_16320 49965 48952 gene locus_tag LOCUS_16330 49965 48952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 54649 50114 gene locus_tag LOCUS_16340 54649 50114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 55668 54847 gene locus_tag LOCUS_16350 55668 54847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 56526 55804 gene locus_tag LOCUS_16360 gene tpiA 56526 55804 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_16360 57791 56610 gene locus_tag LOCUS_16370 57791 56610 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964029.1 protein_id gnl|my_center|LOCUS_16370 58833 57772 gene locus_tag LOCUS_16380 gene gap 58833 57772 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_16380 60075 58960 gene locus_tag LOCUS_16390 60075 58960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 64985 60216 gene locus_tag LOCUS_16400 64985 60216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 66602 65301 gene locus_tag LOCUS_16410 66602 65301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 69134 66645 gene locus_tag LOCUS_16420 69134 66645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 71294 69174 gene locus_tag LOCUS_16430 71294 69174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 71717 72409 gene locus_tag LOCUS_16440 71717 72409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 72716 72417 gene locus_tag LOCUS_16450 72716 72417 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870093.1 protein_id gnl|my_center|LOCUS_16450 73759 72713 gene locus_tag LOCUS_16460 73759 72713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 74179 73859 gene locus_tag LOCUS_16470 74179 73859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 75104 74448 gene locus_tag LOCUS_16480 75104 74448 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894969.1 protein_id gnl|my_center|LOCUS_16480 76554 75148 gene locus_tag LOCUS_16490 gene betC 76554 75148 CDS product choline-sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776263.1 protein_id gnl|my_center|LOCUS_16490 77391 76600 gene locus_tag LOCUS_16500 gene whiG 77391 76600 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_16500 77567 77379 gene locus_tag LOCUS_16510 77567 77379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 78476 77589 gene locus_tag LOCUS_16520 78476 77589 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943679.1 protein_id gnl|my_center|LOCUS_16520 79735 78497 gene locus_tag LOCUS_16530 gene flhF 79735 78497 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943680.1 protein_id gnl|my_center|LOCUS_16530 <81067 79739 gene locus_tag LOCUS_16540 <81067 79739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943681.1:flagellar biosynthesis protein FlhA >Feature sequence020 220 2166 gene locus_tag LOCUS_16550 220 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2163 3035 gene locus_tag LOCUS_16560 2163 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 3049 4158 gene locus_tag LOCUS_16570 3049 4158 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061129.1 protein_id gnl|my_center|LOCUS_16570 5073 4174 gene locus_tag LOCUS_16580 5073 4174 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027450.1 protein_id gnl|my_center|LOCUS_16580 6070 5165 gene locus_tag LOCUS_16590 6070 5165 CDS product RNA polymerase factor sigma-32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938875.1 protein_id gnl|my_center|LOCUS_16590 6956 6429 gene locus_tag LOCUS_16600 6956 6429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 9715 6959 gene locus_tag LOCUS_16610 9715 6959 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047729.1 protein_id gnl|my_center|LOCUS_16610 12235 10196 gene locus_tag LOCUS_16620 12235 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 14239 12257 gene locus_tag LOCUS_16630 14239 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 14575 15090 gene locus_tag LOCUS_16640 14575 15090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 15141 15752 gene locus_tag LOCUS_16650 15141 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 15864 16355 gene locus_tag LOCUS_16660 15864 16355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 17181 16489 gene locus_tag LOCUS_16670 17181 16489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 17849 17295 gene locus_tag LOCUS_16680 17849 17295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 18505 17873 gene locus_tag LOCUS_16690 18505 17873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 19082 18507 gene locus_tag LOCUS_16700 19082 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 19770 19135 gene locus_tag LOCUS_16710 19770 19135 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_16710 20375 21916 gene locus_tag LOCUS_16720 20375 21916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 22042 24303 gene locus_tag LOCUS_16730 22042 24303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 25085 24375 gene locus_tag LOCUS_16740 25085 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 25320 27917 gene locus_tag LOCUS_16750 25320 27917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 27997 30270 gene locus_tag LOCUS_16760 27997 30270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 31956 30292 gene locus_tag LOCUS_16770 31956 30292 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598537.1 protein_id gnl|my_center|LOCUS_16770 32106 32300 gene locus_tag LOCUS_16780 32106 32300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 33889 32354 gene locus_tag LOCUS_16790 33889 32354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 34497 33886 gene locus_tag LOCUS_16800 34497 33886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 35334 34513 gene locus_tag LOCUS_16810 35334 34513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 36028 35564 gene locus_tag LOCUS_16820 gene bcp 36028 35564 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_16820 36635 36030 gene locus_tag LOCUS_16830 36635 36030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 36777 38315 gene locus_tag LOCUS_16840 36777 38315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 38426 38941 gene locus_tag LOCUS_16850 gene tpx 38426 38941 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938524.1 protein_id gnl|my_center|LOCUS_16850 39422 39982 gene locus_tag LOCUS_16860 39422 39982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 42989 40053 gene locus_tag LOCUS_16870 42989 40053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 44090 43119 gene locus_tag LOCUS_16880 44090 43119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 45307 44201 gene locus_tag LOCUS_16890 45307 44201 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545648.1 protein_id gnl|my_center|LOCUS_16890 48130 45491 gene locus_tag LOCUS_16900 48130 45491 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947857.1 protein_id gnl|my_center|LOCUS_16900 51225 48124 gene locus_tag LOCUS_16910 51225 48124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 51855 53099 gene locus_tag LOCUS_16920 51855 53099 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_16920 53169 54053 gene locus_tag LOCUS_16930 53169 54053 CDS product hydroxypyruvate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081620.1 protein_id gnl|my_center|LOCUS_16930 54067 55146 gene locus_tag LOCUS_16940 gene serC 54067 55146 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_16940 55315 56613 gene locus_tag LOCUS_16950 55315 56613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 58557 56653 gene locus_tag LOCUS_16960 58557 56653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 59753 58554 gene locus_tag LOCUS_16970 59753 58554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 61490 59778 gene locus_tag LOCUS_16980 61490 59778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 61673 62155 gene locus_tag LOCUS_16990 61673 62155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 62215 63315 gene locus_tag LOCUS_17000 62215 63315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468938.1 protein_id gnl|my_center|LOCUS_17000 65107 63326 gene locus_tag LOCUS_17010 65107 63326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 66771 65197 gene locus_tag LOCUS_17020 66771 65197 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_17020 67667 66768 gene locus_tag LOCUS_17030 67667 66768 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_17030 68650 67775 gene locus_tag LOCUS_17040 68650 67775 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_17040 69477 68647 gene locus_tag LOCUS_17050 69477 68647 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249998.1 protein_id gnl|my_center|LOCUS_17050 69533 70336 gene locus_tag LOCUS_17060 69533 70336 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868711.1 protein_id gnl|my_center|LOCUS_17060 72990 70345 gene locus_tag LOCUS_17070 72990 70345 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929460.1 protein_id gnl|my_center|LOCUS_17070 74486 72936 gene locus_tag LOCUS_17080 74486 72936 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence021 375 1295 gene locus_tag LOCUS_17090 gene trxB 375 1295 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_17090 3183 1318 gene locus_tag LOCUS_17100 3183 1318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 3771 3202 gene locus_tag LOCUS_17110 3771 3202 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_17110 4590 3775 gene locus_tag LOCUS_17120 4590 3775 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942115.1 protein_id gnl|my_center|LOCUS_17120 5743 4580 gene locus_tag LOCUS_17130 5743 4580 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942114.1 protein_id gnl|my_center|LOCUS_17130 5994 5746 gene locus_tag LOCUS_17140 5994 5746 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942113.1 protein_id gnl|my_center|LOCUS_17140 6388 6861 gene locus_tag LOCUS_17150 6388 6861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 6932 8602 gene locus_tag LOCUS_17160 6932 8602 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941285.1 protein_id gnl|my_center|LOCUS_17160 9411 8812 gene locus_tag LOCUS_17170 9411 8812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 12073 9707 gene locus_tag LOCUS_17180 12073 9707 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_17180 12218 12880 gene locus_tag LOCUS_17190 12218 12880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 12914 13657 gene locus_tag LOCUS_17200 12914 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 13682 16066 gene locus_tag LOCUS_17210 13682 16066 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229541.1 protein_id gnl|my_center|LOCUS_17210 17953 16067 gene locus_tag LOCUS_17220 17953 16067 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392283.1 protein_id gnl|my_center|LOCUS_17220 19227 17950 gene locus_tag LOCUS_17230 19227 17950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 19350 20483 gene locus_tag LOCUS_17240 19350 20483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 21232 20474 gene locus_tag LOCUS_17250 21232 20474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 22329 21280 gene locus_tag LOCUS_17260 22329 21280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 23099 22506 gene locus_tag LOCUS_17270 23099 22506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 24300 23137 gene locus_tag LOCUS_17280 gene rdgC 24300 23137 CDS product recombination-associated protein RdgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940809.1 protein_id gnl|my_center|LOCUS_17280 24418 24723 gene locus_tag LOCUS_17290 24418 24723 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_17290 24720 25100 gene locus_tag LOCUS_17300 24720 25100 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430159.1 protein_id gnl|my_center|LOCUS_17300 25374 25637 gene locus_tag LOCUS_17310 25374 25637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 26640 25651 gene locus_tag LOCUS_17320 26640 25651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 27087 28397 gene locus_tag LOCUS_17330 27087 28397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 28739 30172 gene locus_tag LOCUS_17340 gene glnA 28739 30172 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_17340 31744 30179 gene locus_tag LOCUS_17350 31744 30179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 33602 31776 gene locus_tag LOCUS_17360 33602 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 33779 34276 gene locus_tag LOCUS_17370 33779 34276 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387043.1 protein_id gnl|my_center|LOCUS_17370 34691 36295 gene locus_tag LOCUS_17380 34691 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 36307 37767 gene locus_tag LOCUS_17390 36307 37767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 37893 39527 gene locus_tag LOCUS_17400 37893 39527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 41254 39683 gene locus_tag LOCUS_17410 41254 39683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 41811 43364 gene locus_tag LOCUS_17420 gene aceB 41811 43364 CDS product malate synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889536.1 protein_id gnl|my_center|LOCUS_17420 43413 44552 gene locus_tag LOCUS_17430 gene aceA 43413 44552 CDS product isocitrate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930728.1 protein_id gnl|my_center|LOCUS_17430 44619 45569 gene locus_tag LOCUS_17440 44619 45569 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000877935.1 protein_id gnl|my_center|LOCUS_17440 45873 47246 gene locus_tag LOCUS_17450 45873 47246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 47243 47746 gene locus_tag LOCUS_17460 47243 47746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 48462 49415 gene locus_tag LOCUS_17470 48462 49415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 49439 51205 gene locus_tag LOCUS_17480 49439 51205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 51202 52014 gene locus_tag LOCUS_17490 51202 52014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 52141 53451 gene locus_tag LOCUS_17500 52141 53451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 54603 53599 gene locus_tag LOCUS_17510 54603 53599 CDS product LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038437.1 protein_id gnl|my_center|LOCUS_17510 54723 56078 gene locus_tag LOCUS_17520 54723 56078 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080708.1 protein_id gnl|my_center|LOCUS_17520 56187 57446 gene locus_tag LOCUS_17530 56187 57446 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038851.1 protein_id gnl|my_center|LOCUS_17530 57616 59736 gene locus_tag LOCUS_17540 57616 59736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 59733 61088 gene locus_tag LOCUS_17550 59733 61088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 61236 63068 gene locus_tag LOCUS_17560 61236 63068 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_17560 63087 63296 gene locus_tag LOCUS_17570 63087 63296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 64713 63367 gene locus_tag LOCUS_17580 64713 63367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 66833 64710 gene locus_tag LOCUS_17590 66833 64710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 66969 68783 gene locus_tag LOCUS_17600 66969 68783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 68959 70287 gene locus_tag LOCUS_17610 68959 70287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 71339 70485 gene locus_tag LOCUS_17620 gene tsf 71339 70485 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938172.1 protein_id gnl|my_center|LOCUS_17620 72350 71412 gene locus_tag LOCUS_17630 72350 71412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence022 <1 4179 gene locus_tag LOCUS_17640 <1 4179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121646688.1:RHS repeat-associated core domain-containing protein 4754 5389 gene locus_tag LOCUS_17650 4754 5389 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943032.1 protein_id gnl|my_center|LOCUS_17650 6147 7607 gene locus_tag LOCUS_17660 6147 7607 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17660 7756 8406 gene locus_tag LOCUS_17670 7756 8406 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530095.1 protein_id gnl|my_center|LOCUS_17670 8403 8726 gene locus_tag LOCUS_17680 8403 8726 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140295.1 protein_id gnl|my_center|LOCUS_17680 8723 9496 gene locus_tag LOCUS_17690 gene cbiQ 8723 9496 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975656.1 protein_id gnl|my_center|LOCUS_17690 9499 10251 gene locus_tag LOCUS_17700 9499 10251 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028802.1 protein_id gnl|my_center|LOCUS_17700 10442 12559 gene locus_tag LOCUS_17710 10442 12559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 12576 13982 gene locus_tag LOCUS_17720 12576 13982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 15845 13986 gene locus_tag LOCUS_17730 15845 13986 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943502.1 protein_id gnl|my_center|LOCUS_17730 16819 15842 gene locus_tag LOCUS_17740 16819 15842 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390553.1 protein_id gnl|my_center|LOCUS_17740 18407 16824 gene locus_tag LOCUS_17750 18407 16824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 19837 18401 gene locus_tag LOCUS_17760 19837 18401 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17760 21256 19841 gene locus_tag LOCUS_17770 21256 19841 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_17770 21467 22669 gene locus_tag LOCUS_17780 21467 22669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 22949 23566 gene locus_tag LOCUS_17790 gene fadR 22949 23566 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_17790 23628 24413 gene locus_tag LOCUS_17800 23628 24413 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_17800 24460 25428 gene locus_tag LOCUS_17810 24460 25428 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817156.1 protein_id gnl|my_center|LOCUS_17810 25511 27724 gene locus_tag LOCUS_17820 25511 27724 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459849.1 protein_id gnl|my_center|LOCUS_17820 28658 27837 gene locus_tag LOCUS_17830 28658 27837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 28777 30852 gene locus_tag LOCUS_17840 28777 30852 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927211.1 protein_id gnl|my_center|LOCUS_17840 30849 31775 gene locus_tag LOCUS_17850 30849 31775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_17850 31772 32581 gene locus_tag LOCUS_17860 31772 32581 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939732.1 protein_id gnl|my_center|LOCUS_17860 32591 34114 gene locus_tag LOCUS_17870 32591 34114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 34211 35137 gene locus_tag LOCUS_17880 34211 35137 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_17880 35153 36910 gene locus_tag LOCUS_17890 35153 36910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 36914 37606 gene locus_tag LOCUS_17900 36914 37606 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085667.1 protein_id gnl|my_center|LOCUS_17900 38661 37603 gene locus_tag LOCUS_17910 38661 37603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 40514 38658 gene locus_tag LOCUS_17920 40514 38658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 42128 40569 gene locus_tag LOCUS_17930 42128 40569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17930 44759 42132 gene locus_tag LOCUS_17940 44759 42132 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943755.1 protein_id gnl|my_center|LOCUS_17940 45163 44930 gene locus_tag LOCUS_17950 45163 44930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 48078 45301 gene locus_tag LOCUS_17960 48078 45301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 48989 48207 gene locus_tag LOCUS_17970 48989 48207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 50116 49082 gene locus_tag LOCUS_17980 50116 49082 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_17980 50350 53709 gene locus_tag LOCUS_17990 50350 53709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 54218 53925 gene locus_tag LOCUS_18000 54218 53925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 54340 55062 gene locus_tag LOCUS_18010 54340 55062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 55087 55989 gene locus_tag LOCUS_18020 55087 55989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 56156 57841 gene locus_tag LOCUS_18030 56156 57841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 57897 58682 gene locus_tag LOCUS_18040 57897 58682 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_18040 58679 59395 gene locus_tag LOCUS_18050 58679 59395 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_18050 59512 61029 gene locus_tag LOCUS_18060 59512 61029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 63161 61302 gene locus_tag LOCUS_18070 63161 61302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 63586 65652 gene locus_tag LOCUS_18080 63586 65652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 66173 68677 gene locus_tag LOCUS_18090 66173 68677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 69344 68922 gene locus_tag LOCUS_18100 69344 68922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 69803 69390 gene locus_tag LOCUS_18110 69803 69390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 70267 69848 gene locus_tag LOCUS_18120 70267 69848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 70801 70304 gene locus_tag LOCUS_18130 70801 70304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 70988 72052 gene locus_tag LOCUS_18140 70988 72052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence023 657 79 gene locus_tag LOCUS_18150 657 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 2154 883 gene locus_tag LOCUS_18160 2154 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 2823 2284 gene locus_tag LOCUS_18170 2823 2284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 3075 3821 gene locus_tag LOCUS_18180 3075 3821 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051073304.1 protein_id gnl|my_center|LOCUS_18180 3938 4399 gene locus_tag LOCUS_18190 3938 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 4554 5834 gene locus_tag LOCUS_18200 4554 5834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 5961 6479 gene locus_tag LOCUS_18210 5961 6479 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391304.1 protein_id gnl|my_center|LOCUS_18210 7149 8669 gene locus_tag LOCUS_18220 7149 8669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 8781 9425 gene locus_tag LOCUS_18230 gene tmk 8781 9425 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391590.1 protein_id gnl|my_center|LOCUS_18230 9422 10444 gene locus_tag LOCUS_18240 gene holB 9422 10444 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942870.1 protein_id gnl|my_center|LOCUS_18240 10441 11310 gene locus_tag LOCUS_18250 10441 11310 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_18250 11303 12199 gene locus_tag LOCUS_18260 11303 12199 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393491.1 protein_id gnl|my_center|LOCUS_18260 12192 13844 gene locus_tag LOCUS_18270 12192 13844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 15090 13816 gene locus_tag LOCUS_18280 15090 13816 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_18280 15263 15350 gene locus_tag LOCUS_t00170 15263 15350 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 15731 18067 gene locus_tag LOCUS_18290 gene lon 15731 18067 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_18290 19296 18133 gene locus_tag LOCUS_18300 gene larC 19296 18133 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393989.1 protein_id gnl|my_center|LOCUS_18300 20063 19302 gene locus_tag LOCUS_18310 gene larB 20063 19302 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_18310 21047 20085 gene locus_tag LOCUS_18320 gene thiL 21047 20085 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_18320 23024 21096 gene locus_tag LOCUS_18330 23024 21096 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_18330 24940 23030 gene locus_tag LOCUS_18340 24940 23030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 26034 24946 gene locus_tag LOCUS_18350 gene dnaJ 26034 24946 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880419.1 protein_id gnl|my_center|LOCUS_18350 27994 26111 gene locus_tag LOCUS_18360 gene dnaK 27994 26111 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_18360 29017 28046 gene locus_tag LOCUS_18370 29017 28046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 30487 29408 gene locus_tag LOCUS_18380 30487 29408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 31205 31471 gene locus_tag LOCUS_18390 31205 31471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18390 31905 31537 gene locus_tag LOCUS_18400 31905 31537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18400 32198 31812 gene locus_tag LOCUS_18410 32198 31812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18410 32415 33824 gene locus_tag LOCUS_18420 32415 33824 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_18420 33905 35464 gene locus_tag LOCUS_18430 33905 35464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 35502 36929 gene locus_tag LOCUS_18440 35502 36929 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_18440 36933 37916 gene locus_tag LOCUS_18450 36933 37916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 37909 38586 gene locus_tag LOCUS_18460 37909 38586 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867690.1 protein_id gnl|my_center|LOCUS_18460 38590 39993 gene locus_tag LOCUS_18470 38590 39993 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259612.1 protein_id gnl|my_center|LOCUS_18470 40833 39997 gene locus_tag LOCUS_18480 40833 39997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 41720 40926 gene locus_tag LOCUS_18490 41720 40926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 43462 41732 gene locus_tag LOCUS_18500 43462 41732 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_18500 44231 43446 gene locus_tag LOCUS_18510 44231 43446 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_18510 44339 45103 gene locus_tag LOCUS_18520 44339 45103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 45118 45315 gene locus_tag LOCUS_18530 45118 45315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 46781 45309 gene locus_tag LOCUS_18540 46781 45309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 48448 46778 gene locus_tag LOCUS_18550 48448 46778 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_18550 48714 48448 gene locus_tag LOCUS_18560 48714 48448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 50467 48914 gene locus_tag LOCUS_18570 50467 48914 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_18570 51038 53176 gene locus_tag LOCUS_18580 51038 53176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 53180 54517 gene locus_tag LOCUS_18590 53180 54517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 54816 56759 gene locus_tag LOCUS_18600 54816 56759 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943203.1 protein_id gnl|my_center|LOCUS_18600 56771 57211 gene locus_tag LOCUS_18610 56771 57211 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_18610 57227 60739 gene locus_tag LOCUS_18620 57227 60739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 62406 60808 gene locus_tag LOCUS_18630 62406 60808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 62621 64354 gene locus_tag LOCUS_18640 62621 64354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 64461 65042 gene locus_tag LOCUS_18650 64461 65042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 65528 67966 gene locus_tag LOCUS_18660 65528 67966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 68235 68552 gene locus_tag LOCUS_18670 68235 68552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 68553 68954 gene locus_tag LOCUS_18680 68553 68954 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_18680 68951 69940 gene locus_tag LOCUS_18690 gene znuA 68951 69940 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261504.1 protein_id gnl|my_center|LOCUS_18690 <71760 69993 gene locus_tag LOCUS_18700 <71760 69993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence024 218 1024 gene locus_tag LOCUS_18710 218 1024 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_18710 1021 2298 gene locus_tag LOCUS_18720 1021 2298 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_18720 2295 4574 gene locus_tag LOCUS_18730 gene lptD 2295 4574 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_18730 6330 4585 gene locus_tag LOCUS_18740 6330 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 6718 6524 gene locus_tag LOCUS_18750 gene rpmB 6718 6524 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_18750 8299 6827 gene locus_tag LOCUS_18760 8299 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 9358 8303 gene locus_tag LOCUS_18770 gene purM 9358 8303 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_18770 9532 11832 gene locus_tag LOCUS_18780 9532 11832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 11861 14998 gene locus_tag LOCUS_18790 11861 14998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 15532 15008 gene locus_tag LOCUS_18800 15532 15008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 16783 15536 gene locus_tag LOCUS_18810 16783 15536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 18978 16882 gene locus_tag LOCUS_18820 gene fusA 18978 16882 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_18820 19881 19111 gene locus_tag LOCUS_18830 19881 19111 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_18830 20673 19885 gene locus_tag LOCUS_18840 20673 19885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 21521 20670 gene locus_tag LOCUS_18850 gene nadC 21521 20670 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942581.1 protein_id gnl|my_center|LOCUS_18850 22373 21522 gene locus_tag LOCUS_18860 22373 21522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 23498 22389 gene locus_tag LOCUS_18870 23498 22389 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941750.1 protein_id gnl|my_center|LOCUS_18870 23637 24941 gene locus_tag LOCUS_18880 23637 24941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 26006 24951 gene locus_tag LOCUS_18890 26006 24951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 26221 28224 gene locus_tag LOCUS_18900 26221 28224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 28277 29374 gene locus_tag LOCUS_18910 28277 29374 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_18910 29497 30063 gene locus_tag LOCUS_18920 gene pyrR 29497 30063 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_18920 30060 30983 gene locus_tag LOCUS_18930 30060 30983 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_18930 30980 32251 gene locus_tag LOCUS_18940 30980 32251 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_18940 32255 32875 gene locus_tag LOCUS_18950 32255 32875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 32875 33777 gene locus_tag LOCUS_18960 32875 33777 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360266.1 protein_id gnl|my_center|LOCUS_18960 33770 34507 gene locus_tag LOCUS_18970 33770 34507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 34539 36644 gene locus_tag LOCUS_18980 gene recG 34539 36644 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941980.1 protein_id gnl|my_center|LOCUS_18980 36641 37540 gene locus_tag LOCUS_18990 gene lipA 36641 37540 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 protein_id gnl|my_center|LOCUS_18990 37564 37776 gene locus_tag LOCUS_19000 37564 37776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 37825 38712 gene locus_tag LOCUS_19010 37825 38712 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032710620.1 protein_id gnl|my_center|LOCUS_19010 38706 39791 gene locus_tag LOCUS_19020 38706 39791 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_19020 39778 41211 gene locus_tag LOCUS_19030 39778 41211 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403684.1 protein_id gnl|my_center|LOCUS_19030 41208 42188 gene locus_tag LOCUS_19040 41208 42188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 43679 42201 gene locus_tag LOCUS_19050 43679 42201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 43793 44857 gene locus_tag LOCUS_19060 43793 44857 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817208.1 protein_id gnl|my_center|LOCUS_19060 44931 45698 gene locus_tag LOCUS_19070 44931 45698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 47016 45805 gene locus_tag LOCUS_19080 gene bamB 47016 45805 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001177072.1 protein_id gnl|my_center|LOCUS_19080 47826 47020 gene locus_tag LOCUS_19090 47826 47020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 48422 47922 gene locus_tag LOCUS_19100 48422 47922 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545067.1 protein_id gnl|my_center|LOCUS_19100 49799 48432 gene locus_tag LOCUS_19110 gene miaB 49799 48432 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942838.1 protein_id gnl|my_center|LOCUS_19110 51364 49796 gene locus_tag LOCUS_19120 gene amrB 51364 49796 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_19120 52438 51446 gene locus_tag LOCUS_19130 52438 51446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 52784 52440 gene locus_tag LOCUS_19140 52784 52440 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392126.1 protein_id gnl|my_center|LOCUS_19140 53209 54315 gene locus_tag LOCUS_19150 53209 54315 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868529.1 protein_id gnl|my_center|LOCUS_19150 54312 56513 gene locus_tag LOCUS_19160 54312 56513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 56981 56574 gene locus_tag LOCUS_19170 56981 56574 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_19170 58701 57067 gene locus_tag LOCUS_19180 58701 57067 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_19180 59969 58695 gene locus_tag LOCUS_19190 59969 58695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 60275 61486 gene locus_tag LOCUS_19200 60275 61486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 62364 61510 gene locus_tag LOCUS_19210 62364 61510 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328162.1 protein_id gnl|my_center|LOCUS_19210 62702 63481 gene locus_tag LOCUS_19220 62702 63481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 63727 64185 gene locus_tag LOCUS_19230 63727 64185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 64210 64518 gene locus_tag LOCUS_19240 64210 64518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 64729 65184 gene locus_tag LOCUS_19250 64729 65184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 65260 65514 gene locus_tag LOCUS_19260 65260 65514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 67403 65568 gene locus_tag LOCUS_19270 67403 65568 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171583159.1 protein_id gnl|my_center|LOCUS_19270 67775 67416 gene locus_tag LOCUS_19280 67775 67416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 68462 67788 gene locus_tag LOCUS_19290 gene lipB 68462 67788 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583130.1 protein_id gnl|my_center|LOCUS_19290 69208 68471 gene locus_tag LOCUS_19300 69208 68471 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_19300 70224 69223 gene locus_tag LOCUS_19310 70224 69223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 70772 70236 gene locus_tag LOCUS_19320 70772 70236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence025 1198 467 gene locus_tag LOCUS_19330 1198 467 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_19330 1328 1936 gene locus_tag LOCUS_19340 1328 1936 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444179.1 protein_id gnl|my_center|LOCUS_19340 2116 4845 gene locus_tag LOCUS_19350 2116 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 5723 4932 gene locus_tag LOCUS_19360 5723 4932 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254517.1 protein_id gnl|my_center|LOCUS_19360 5874 6974 gene locus_tag LOCUS_19370 gene mutY 5874 6974 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_19370 6980 7717 gene locus_tag LOCUS_19380 6980 7717 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657519.1 protein_id gnl|my_center|LOCUS_19380 7863 9866 gene locus_tag LOCUS_19390 gene tkt 7863 9866 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_19390 10006 11172 gene locus_tag LOCUS_19400 10006 11172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 13129 11252 gene locus_tag LOCUS_19410 13129 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724010.1 protein_id gnl|my_center|LOCUS_19410 13531 13208 gene locus_tag LOCUS_19420 13531 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 13620 15053 gene locus_tag LOCUS_19430 13620 15053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 15299 16555 gene locus_tag LOCUS_19440 15299 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 16571 19342 gene locus_tag LOCUS_19450 16571 19342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 20793 19390 gene locus_tag LOCUS_19460 gene lpdA 20793 19390 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260104.1 protein_id gnl|my_center|LOCUS_19460 21895 20786 gene locus_tag LOCUS_19470 21895 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 23088 21892 gene locus_tag LOCUS_19480 23088 21892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 25110 23251 gene locus_tag LOCUS_19490 25110 23251 CDS product acyl-CoA dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888987.1 protein_id gnl|my_center|LOCUS_19490 25387 25662 gene locus_tag LOCUS_19500 gene rpsT 25387 25662 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_19500 26640 25645 gene locus_tag LOCUS_19510 gene holA 26640 25645 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836680.1 protein_id gnl|my_center|LOCUS_19510 27131 26637 gene locus_tag LOCUS_19520 27131 26637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 27715 27206 gene locus_tag LOCUS_19530 27715 27206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 28761 27787 gene locus_tag LOCUS_19540 28761 27787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 29462 28791 gene locus_tag LOCUS_19550 29462 28791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 30081 29470 gene locus_tag LOCUS_19560 30081 29470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19560 30822 30223 gene locus_tag LOCUS_19570 30822 30223 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_19570 34247 30819 gene locus_tag LOCUS_19580 34247 30819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 34434 36245 gene locus_tag LOCUS_19590 34434 36245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 38435 36255 gene locus_tag LOCUS_19600 38435 36255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 40416 38602 gene locus_tag LOCUS_19610 40416 38602 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836987.1 protein_id gnl|my_center|LOCUS_19610 41107 40367 gene locus_tag LOCUS_19620 41107 40367 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545169.1 protein_id gnl|my_center|LOCUS_19620 41641 41117 gene locus_tag LOCUS_19630 41641 41117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 42066 41638 gene locus_tag LOCUS_19640 gene nusB 42066 41638 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001276210.1 protein_id gnl|my_center|LOCUS_19640 42537 42073 gene locus_tag LOCUS_19650 gene ribE 42537 42073 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869754.1 protein_id gnl|my_center|LOCUS_19650 43771 42524 gene locus_tag LOCUS_19660 43771 42524 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_19660 44449 43778 gene locus_tag LOCUS_19670 44449 43778 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_19670 45549 44434 gene locus_tag LOCUS_19680 gene ribD 45549 44434 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_19680 46042 45572 gene locus_tag LOCUS_19690 gene nrdR 46042 45572 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_19690 46537 46100 gene locus_tag LOCUS_19700 gene rpiB 46537 46100 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_19700 47426 46455 gene locus_tag LOCUS_19710 47426 46455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 47934 47413 gene locus_tag LOCUS_19720 47934 47413 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942173.1 protein_id gnl|my_center|LOCUS_19720 48524 48607 gene locus_tag LOCUS_t00180 48524 48607 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 49247 48744 gene locus_tag LOCUS_19730 49247 48744 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_19730 49920 49255 gene locus_tag LOCUS_19740 49920 49255 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942171.1 protein_id gnl|my_center|LOCUS_19740 50657 49914 gene locus_tag LOCUS_19750 gene surE 50657 49914 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_19750 51522 50746 gene locus_tag LOCUS_19760 gene fetB 51522 50746 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392685.1 protein_id gnl|my_center|LOCUS_19760 52270 51530 gene locus_tag LOCUS_19770 52270 51530 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392686.1 protein_id gnl|my_center|LOCUS_19770 53906 52284 gene locus_tag LOCUS_19780 53906 52284 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_19780 54950 54018 gene locus_tag LOCUS_19790 54950 54018 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057901.1 protein_id gnl|my_center|LOCUS_19790 55852 54947 gene locus_tag LOCUS_19800 55852 54947 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_19800 56364 55849 gene locus_tag LOCUS_19810 56364 55849 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583273.1 protein_id gnl|my_center|LOCUS_19810 56930 56361 gene locus_tag LOCUS_19820 56930 56361 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048408.1 protein_id gnl|my_center|LOCUS_19820 57089 58990 gene locus_tag LOCUS_19830 gene prpE 57089 58990 CDS product propionate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255916.1 protein_id gnl|my_center|LOCUS_19830 61872 59059 gene locus_tag LOCUS_19840 61872 59059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 64281 61909 gene locus_tag LOCUS_19850 64281 61909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19850 65101 64382 gene locus_tag LOCUS_19860 65101 64382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19860 65626 65165 gene locus_tag LOCUS_19870 65626 65165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 65720 66046 gene locus_tag LOCUS_19880 65720 66046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 >Feature sequence026 185 664 gene locus_tag LOCUS_19890 185 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 716 1999 gene locus_tag LOCUS_19900 716 1999 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840043.1 protein_id gnl|my_center|LOCUS_19900 2021 2713 gene locus_tag LOCUS_19910 2021 2713 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_19910 2710 3927 gene locus_tag LOCUS_19920 2710 3927 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_19920 4107 6227 gene locus_tag LOCUS_19930 4107 6227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 6231 7589 gene locus_tag LOCUS_19940 6231 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 7586 8896 gene locus_tag LOCUS_19950 7586 8896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 10884 9109 gene locus_tag LOCUS_19960 10884 9109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 11134 12477 gene locus_tag LOCUS_19970 11134 12477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 13345 12671 gene locus_tag LOCUS_19980 13345 12671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 13567 14397 gene locus_tag LOCUS_19990 13567 14397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 14841 14527 gene locus_tag LOCUS_20000 14841 14527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 15102 15029 gene locus_tag LOCUS_t00190 15102 15029 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15524 15138 gene locus_tag LOCUS_20010 15524 15138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 15832 15554 gene locus_tag LOCUS_20020 15832 15554 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_20020 18330 15937 gene locus_tag LOCUS_20030 gene pheT 18330 15937 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942167.1 protein_id gnl|my_center|LOCUS_20030 19373 18330 gene locus_tag LOCUS_20040 gene pheS 19373 18330 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942166.1 protein_id gnl|my_center|LOCUS_20040 19729 19379 gene locus_tag LOCUS_20050 gene rplT 19729 19379 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770935.1 protein_id gnl|my_center|LOCUS_20050 19977 19783 gene locus_tag LOCUS_20060 gene rpmI 19977 19783 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_20060 20540 20079 gene locus_tag LOCUS_20070 gene infC 20540 20079 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939807.1 protein_id gnl|my_center|LOCUS_20070 20972 20900 gene locus_tag LOCUS_t00200 20972 20900 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 21898 21047 gene locus_tag LOCUS_20080 21898 21047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 23024 21912 gene locus_tag LOCUS_20090 23024 21912 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_20090 23378 23043 gene locus_tag LOCUS_20100 23378 23043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 24493 23375 gene locus_tag LOCUS_20110 24493 23375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 25770 24469 gene locus_tag LOCUS_20120 gene hflX 25770 24469 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_20120 26038 25787 gene locus_tag LOCUS_20130 gene hfq 26038 25787 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428780.1 protein_id gnl|my_center|LOCUS_20130 29551 26069 gene locus_tag LOCUS_20140 gene dnaE 29551 26069 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942050.1 protein_id gnl|my_center|LOCUS_20140 31106 29556 gene locus_tag LOCUS_20150 gene guaA 31106 29556 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_20150 32612 31152 gene locus_tag LOCUS_20160 gene guaB 32612 31152 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_20160 33024 32626 gene locus_tag LOCUS_20170 33024 32626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 34038 33109 gene locus_tag LOCUS_20180 34038 33109 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_20180 34198 34833 gene locus_tag LOCUS_20190 34198 34833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 36504 35215 gene locus_tag LOCUS_20200 36504 35215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 37433 36516 gene locus_tag LOCUS_20210 37433 36516 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393349.1 protein_id gnl|my_center|LOCUS_20210 37608 39989 gene locus_tag LOCUS_20220 37608 39989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 40217 40858 gene locus_tag LOCUS_20230 40217 40858 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000177702.1 protein_id gnl|my_center|LOCUS_20230 40845 41270 gene locus_tag LOCUS_20240 40845 41270 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919048.1 protein_id gnl|my_center|LOCUS_20240 41267 42115 gene locus_tag LOCUS_20250 41267 42115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 43222 42179 gene locus_tag LOCUS_20260 43222 42179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 44695 43247 gene locus_tag LOCUS_20270 44695 43247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 45585 44728 gene locus_tag LOCUS_20280 45585 44728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 46492 45572 gene locus_tag LOCUS_20290 46492 45572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 49483 46559 gene locus_tag LOCUS_20300 49483 46559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 49670 49491 gene locus_tag LOCUS_20310 49670 49491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 49913 51157 gene locus_tag LOCUS_20320 49913 51157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 51193 52392 gene locus_tag LOCUS_20330 51193 52392 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294622.1 protein_id gnl|my_center|LOCUS_20330 52925 52389 gene locus_tag LOCUS_20340 52925 52389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 53672 53094 gene locus_tag LOCUS_20350 53672 53094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 55510 53786 gene locus_tag LOCUS_20360 55510 53786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 55666 57174 gene locus_tag LOCUS_20370 55666 57174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 58513 57191 gene locus_tag LOCUS_20380 58513 57191 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_20380 58618 58536 gene locus_tag LOCUS_t00210 58618 58536 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 59439 58678 gene locus_tag LOCUS_20390 59439 58678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 60179 59478 gene locus_tag LOCUS_20400 60179 59478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 61852 60554 gene locus_tag LOCUS_20410 61852 60554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 63161 61911 gene locus_tag LOCUS_20420 63161 61911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 64773 63205 gene locus_tag LOCUS_20430 64773 63205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 65013 65354 gene locus_tag LOCUS_20440 65013 65354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence027 426 241 gene locus_tag LOCUS_20450 426 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 1111 500 gene locus_tag LOCUS_20460 1111 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 1789 1145 gene locus_tag LOCUS_20470 1789 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 2456 1830 gene locus_tag LOCUS_20480 2456 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 4300 2453 gene locus_tag LOCUS_20490 4300 2453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 4676 4275 gene locus_tag LOCUS_20500 4676 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 8003 4698 gene locus_tag LOCUS_20510 8003 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 9470 8034 gene locus_tag LOCUS_20520 9470 8034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 10197 9511 gene locus_tag LOCUS_20530 10197 9511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 11565 10243 gene locus_tag LOCUS_20540 11565 10243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 12282 11797 gene locus_tag LOCUS_20550 12282 11797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 13206 12325 gene locus_tag LOCUS_20560 13206 12325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 15101 13203 gene locus_tag LOCUS_20570 15101 13203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 16021 15167 gene locus_tag LOCUS_20580 16021 15167 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110305.1 protein_id gnl|my_center|LOCUS_20580 16747 16025 gene locus_tag LOCUS_20590 16747 16025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 18035 16809 gene locus_tag LOCUS_20600 18035 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 18283 18092 gene locus_tag LOCUS_20610 18283 18092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 18825 18421 gene locus_tag LOCUS_20620 18825 18421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 19034 18837 gene locus_tag LOCUS_20630 19034 18837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19296 19063 gene locus_tag LOCUS_20640 19296 19063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 19807 19454 gene locus_tag LOCUS_20650 19807 19454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 20015 19830 gene locus_tag LOCUS_20660 20015 19830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 20533 21132 gene locus_tag LOCUS_20670 20533 21132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 21255 22031 gene locus_tag LOCUS_20680 21255 22031 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942025.1 protein_id gnl|my_center|LOCUS_20680 22056 23306 gene locus_tag LOCUS_20690 22056 23306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 23382 24530 gene locus_tag LOCUS_20700 23382 24530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 24692 27916 gene locus_tag LOCUS_20710 24692 27916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 27939 28310 gene locus_tag LOCUS_20720 27939 28310 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626534.1 protein_id gnl|my_center|LOCUS_20720 28363 29034 gene locus_tag LOCUS_20730 28363 29034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 29606 29037 gene locus_tag LOCUS_20740 29606 29037 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880554.1 protein_id gnl|my_center|LOCUS_20740 31423 29636 gene locus_tag LOCUS_20750 gene thrS 31423 29636 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989741.1 protein_id gnl|my_center|LOCUS_20750 32565 31492 gene locus_tag LOCUS_20760 gene prfA 32565 31492 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393874.1 protein_id gnl|my_center|LOCUS_20760 33733 32603 gene locus_tag LOCUS_20770 33733 32603 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_20770 34032 33811 gene locus_tag LOCUS_20780 gene rpmE 34032 33811 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_20780 35571 34186 gene locus_tag LOCUS_20790 gene rho 35571 34186 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_20790 36605 35841 gene locus_tag LOCUS_20800 gene pgeF 36605 35841 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227882.1 protein_id gnl|my_center|LOCUS_20800 37554 36598 gene locus_tag LOCUS_20810 37554 36598 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_20810 38737 37628 gene locus_tag LOCUS_20820 38737 37628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_20820 40671 38749 gene locus_tag LOCUS_20830 40671 38749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 40831 40755 gene locus_tag LOCUS_t00220 40831 40755 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42350 40920 gene locus_tag LOCUS_20840 42350 40920 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941440.1 protein_id gnl|my_center|LOCUS_20840 42639 43028 gene locus_tag LOCUS_20850 42639 43028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 43060 44550 gene locus_tag LOCUS_20860 43060 44550 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940275.1 protein_id gnl|my_center|LOCUS_20860 44547 46415 gene locus_tag LOCUS_20870 44547 46415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 46412 48232 gene locus_tag LOCUS_20880 46412 48232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 48840 48229 gene locus_tag LOCUS_20890 48840 48229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 49524 48925 gene locus_tag LOCUS_20900 49524 48925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 50544 49546 gene locus_tag LOCUS_20910 50544 49546 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943459.1 protein_id gnl|my_center|LOCUS_20910 51210 50581 gene locus_tag LOCUS_20920 gene rpsD 51210 50581 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_20920 51611 51222 gene locus_tag LOCUS_20930 gene rpsK 51611 51222 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_20930 51994 51629 gene locus_tag LOCUS_20940 gene rpsM 51994 51629 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390416.1 protein_id gnl|my_center|LOCUS_20940 52395 52177 gene locus_tag LOCUS_20950 gene infA 52395 52177 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_20950 53171 52404 gene locus_tag LOCUS_20960 gene map 53171 52404 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_20960 53808 53164 gene locus_tag LOCUS_20970 53808 53164 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_20970 55121 53814 gene locus_tag LOCUS_20980 gene secY 55121 53814 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_20980 55595 55140 gene locus_tag LOCUS_20990 gene rplO 55595 55140 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810128.1 protein_id gnl|my_center|LOCUS_20990 55780 55592 gene locus_tag LOCUS_21000 gene rpmD 55780 55592 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000201159.1 protein_id gnl|my_center|LOCUS_21000 56312 55794 gene locus_tag LOCUS_21010 gene rpsE 56312 55794 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_21010 56692 56324 gene locus_tag LOCUS_21020 gene rplR 56692 56324 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_21020 57248 56712 gene locus_tag LOCUS_21030 gene rplF 57248 56712 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943471.1 protein_id gnl|my_center|LOCUS_21030 57673 57275 gene locus_tag LOCUS_21040 gene rpsH 57673 57275 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_21040 57874 57689 gene locus_tag LOCUS_21050 57874 57689 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_21050 58430 57885 gene locus_tag LOCUS_21060 gene rplE 58430 57885 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_21060 58807 58445 gene locus_tag LOCUS_21070 gene rplX 58807 58445 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187422288.1 protein_id gnl|my_center|LOCUS_21070 59185 58817 gene locus_tag LOCUS_21080 gene rplN 59185 58817 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943476.1 protein_id gnl|my_center|LOCUS_21080 59468 59202 gene locus_tag LOCUS_21090 gene rpsQ 59468 59202 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254114.1 protein_id gnl|my_center|LOCUS_21090 59667 59461 gene locus_tag LOCUS_21100 gene rpmC 59667 59461 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002383858.1 protein_id gnl|my_center|LOCUS_21100 60079 59657 gene locus_tag LOCUS_21110 gene rplP 60079 59657 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_21110 60730 60098 gene locus_tag LOCUS_21120 gene rpsC 60730 60098 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_21120 61087 60743 gene locus_tag LOCUS_21130 gene rplV 61087 60743 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_21130 61378 61106 gene locus_tag LOCUS_21140 gene rpsS 61378 61106 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_21140 62212 61394 gene locus_tag LOCUS_21150 gene rplB 62212 61394 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_21150 62514 62224 gene locus_tag LOCUS_21160 62514 62224 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_21160 63134 62511 gene locus_tag LOCUS_21170 gene rplD 63134 62511 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_21170 63789 63148 gene locus_tag LOCUS_21180 gene rplC 63789 63148 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055936.1 protein_id gnl|my_center|LOCUS_21180 64114 63803 gene locus_tag LOCUS_21190 gene rpsJ 64114 63803 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_21190 >Feature sequence028 2115 316 gene locus_tag LOCUS_21200 2115 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 5051 2340 gene locus_tag LOCUS_21210 5051 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063800.1 protein_id gnl|my_center|LOCUS_21210 6480 5197 gene locus_tag LOCUS_21220 6480 5197 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615882.1 protein_id gnl|my_center|LOCUS_21220 6994 6641 gene locus_tag LOCUS_21230 6994 6641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9601 7115 gene locus_tag LOCUS_21240 9601 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 9780 10601 gene locus_tag LOCUS_21250 9780 10601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11259 10621 gene locus_tag LOCUS_21260 11259 10621 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229005.1 protein_id gnl|my_center|LOCUS_21260 12755 11523 gene locus_tag LOCUS_21270 12755 11523 CDS product mandelate racemase/muconate lactonizing enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227995.1 protein_id gnl|my_center|LOCUS_21270 12916 14466 gene locus_tag LOCUS_21280 12916 14466 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_21280 15249 14485 gene locus_tag LOCUS_21290 15249 14485 CDS product acetoacetate decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206888.1 protein_id gnl|my_center|LOCUS_21290 16366 15266 gene locus_tag LOCUS_21300 16366 15266 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_21300 17804 16356 gene locus_tag LOCUS_21310 17804 16356 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_21310 18778 17843 gene locus_tag LOCUS_21320 18778 17843 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229229.1 protein_id gnl|my_center|LOCUS_21320 19101 20114 gene locus_tag LOCUS_21330 19101 20114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 20102 21031 gene locus_tag LOCUS_21340 20102 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 21198 22421 gene locus_tag LOCUS_21350 21198 22421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 22425 23393 gene locus_tag LOCUS_21360 22425 23393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 24893 23403 gene locus_tag LOCUS_21370 24893 23403 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_21370 26606 25038 gene locus_tag LOCUS_21380 26606 25038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 27887 26670 gene locus_tag LOCUS_21390 27887 26670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21390 30038 28113 gene locus_tag LOCUS_21400 gene asnB 30038 28113 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_21400 31517 30054 gene locus_tag LOCUS_21410 31517 30054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 32813 31563 gene locus_tag LOCUS_21420 32813 31563 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_21420 33924 32806 gene locus_tag LOCUS_21430 33924 32806 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240521.1 protein_id gnl|my_center|LOCUS_21430 34544 34077 gene locus_tag LOCUS_21440 34544 34077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 34766 36955 gene locus_tag LOCUS_21450 34766 36955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 37050 38318 gene locus_tag LOCUS_21460 37050 38318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 38336 41071 gene locus_tag LOCUS_21470 38336 41071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 42413 41157 gene locus_tag LOCUS_21480 42413 41157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 42844 43170 gene locus_tag LOCUS_21490 42844 43170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 43234 44235 gene locus_tag LOCUS_21500 43234 44235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 44571 46148 gene locus_tag LOCUS_21510 44571 46148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 46262 49003 gene locus_tag LOCUS_21520 46262 49003 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941349.1 protein_id gnl|my_center|LOCUS_21520 49228 49854 gene locus_tag LOCUS_21530 49228 49854 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803694.1 protein_id gnl|my_center|LOCUS_21530 49905 51449 gene locus_tag LOCUS_21540 49905 51449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 52325 51462 gene locus_tag LOCUS_21550 52325 51462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21550 52514 54037 gene locus_tag LOCUS_21560 52514 54037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191912.1 protein_id gnl|my_center|LOCUS_21560 56365 54056 gene locus_tag LOCUS_21570 56365 54056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 56605 56862 gene locus_tag LOCUS_21580 56605 56862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 56881 57180 gene locus_tag LOCUS_21590 56881 57180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 58359 57202 gene locus_tag LOCUS_21600 58359 57202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 61461 58378 gene locus_tag LOCUS_21610 61461 58378 CDS product multidrug efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144016.1 protein_id gnl|my_center|LOCUS_21610 62597 61458 gene locus_tag LOCUS_21620 62597 61458 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942255.1 protein_id gnl|my_center|LOCUS_21620 63539 62700 gene locus_tag LOCUS_21630 63539 62700 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073205.1 protein_id gnl|my_center|LOCUS_21630 >Feature sequence029 417 3128 gene locus_tag LOCUS_21640 gene acnA 417 3128 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888355.1 protein_id gnl|my_center|LOCUS_21640 3167 4876 gene locus_tag LOCUS_21650 3167 4876 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938860.1 protein_id gnl|my_center|LOCUS_21650 5029 5889 gene locus_tag LOCUS_21660 5029 5889 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_21660 5931 7622 gene locus_tag LOCUS_21670 5931 7622 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933697.1 protein_id gnl|my_center|LOCUS_21670 7637 8350 gene locus_tag LOCUS_21680 7637 8350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 8357 9778 gene locus_tag LOCUS_21690 8357 9778 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941147.1 protein_id gnl|my_center|LOCUS_21690 9871 11109 gene locus_tag LOCUS_21700 9871 11109 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_21700 11247 12263 gene locus_tag LOCUS_21710 11247 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 12384 13538 gene locus_tag LOCUS_21720 gene amrS 12384 13538 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023371.1 protein_id gnl|my_center|LOCUS_21720 13620 14789 gene locus_tag LOCUS_21730 13620 14789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 15862 14786 gene locus_tag LOCUS_21740 15862 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 16806 15865 gene locus_tag LOCUS_21750 16806 15865 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_21750 17114 16806 gene locus_tag LOCUS_21760 17114 16806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 17703 17128 gene locus_tag LOCUS_21770 17703 17128 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768286.1 protein_id gnl|my_center|LOCUS_21770 17829 18413 gene locus_tag LOCUS_21780 17829 18413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21780 18518 19711 gene locus_tag LOCUS_21790 18518 19711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 19708 20307 gene locus_tag LOCUS_21800 gene coaE 19708 20307 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941181.1 protein_id gnl|my_center|LOCUS_21800 20452 21816 gene locus_tag LOCUS_21810 20452 21816 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887834.1 protein_id gnl|my_center|LOCUS_21810 21825 22553 gene locus_tag LOCUS_21820 gene rph 21825 22553 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460930.1 protein_id gnl|my_center|LOCUS_21820 22553 23149 gene locus_tag LOCUS_21830 gene rdgB 22553 23149 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926068.1 protein_id gnl|my_center|LOCUS_21830 24422 23079 gene locus_tag LOCUS_21840 24422 23079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 24527 25474 gene locus_tag LOCUS_21850 24527 25474 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389973.1 protein_id gnl|my_center|LOCUS_21850 25471 26646 gene locus_tag LOCUS_21860 25471 26646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 26698 27594 gene locus_tag LOCUS_21870 26698 27594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 27676 28374 gene locus_tag LOCUS_21880 27676 28374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 28455 30023 gene locus_tag LOCUS_21890 28455 30023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 30025 30498 gene locus_tag LOCUS_21900 gene rimI 30025 30498 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938967.1 protein_id gnl|my_center|LOCUS_21900 30495 31316 gene locus_tag LOCUS_21910 30495 31316 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_21910 31313 32245 gene locus_tag LOCUS_21920 31313 32245 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942399.1 protein_id gnl|my_center|LOCUS_21920 32785 32246 gene locus_tag LOCUS_21930 gene aroL 32785 32246 CDS product shikimate kinase AroL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983569.1 protein_id gnl|my_center|LOCUS_21930 34319 32823 gene locus_tag LOCUS_21940 gene dacB 34319 32823 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_21940 34452 35021 gene locus_tag LOCUS_21950 gene efp 34452 35021 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775323.1 protein_id gnl|my_center|LOCUS_21950 36008 35031 gene locus_tag LOCUS_21960 gene galE 36008 35031 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404514.1 protein_id gnl|my_center|LOCUS_21960 36950 36012 gene locus_tag LOCUS_21970 36950 36012 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_21970 38301 36970 gene locus_tag LOCUS_21980 38301 36970 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_21980 39693 38323 gene locus_tag LOCUS_21990 39693 38323 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461019.1 protein_id gnl|my_center|LOCUS_21990 40823 39714 gene locus_tag LOCUS_22000 40823 39714 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_22000 42205 40826 gene locus_tag LOCUS_22010 42205 40826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 43577 42186 gene locus_tag LOCUS_22020 43577 42186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 44689 43574 gene locus_tag LOCUS_22030 44689 43574 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_22030 45915 44686 gene locus_tag LOCUS_22040 45915 44686 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124212.1 protein_id gnl|my_center|LOCUS_22040 47147 45975 gene locus_tag LOCUS_22050 47147 45975 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030386.1 protein_id gnl|my_center|LOCUS_22050 48259 47144 gene locus_tag LOCUS_22060 48259 47144 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_22060 49209 48298 gene locus_tag LOCUS_22070 49209 48298 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_22070 50846 49314 gene locus_tag LOCUS_22080 50846 49314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 52152 50914 gene locus_tag LOCUS_22090 52152 50914 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_22090 52629 52153 gene locus_tag LOCUS_22100 gene tsaE 52629 52153 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044854.1 protein_id gnl|my_center|LOCUS_22100 54209 52626 gene locus_tag LOCUS_22110 54209 52626 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_22110 54577 54206 gene locus_tag LOCUS_22120 54577 54206 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974229.1 protein_id gnl|my_center|LOCUS_22120 55315 54581 gene locus_tag LOCUS_22130 55315 54581 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_22130 56353 55391 gene locus_tag LOCUS_22140 56353 55391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 57123 56356 gene locus_tag LOCUS_22150 gene cdaA 57123 56356 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_22150 57956 57120 gene locus_tag LOCUS_22160 gene folP 57956 57120 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_22160 59911 57953 gene locus_tag LOCUS_22170 gene ftsH 59911 57953 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_22170 61288 59966 gene locus_tag LOCUS_22180 gene tilS 61288 59966 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044390753.1 protein_id gnl|my_center|LOCUS_22180 61716 61285 gene locus_tag LOCUS_22190 61716 61285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 62356 61727 gene locus_tag LOCUS_22200 62356 61727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 63148 62456 gene locus_tag LOCUS_22210 63148 62456 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228242.1 protein_id gnl|my_center|LOCUS_22210 63313 63386 gene locus_tag LOCUS_t00230 63313 63386 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 47 2623 gene locus_tag LOCUS_22220 47 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 3114 2650 gene locus_tag LOCUS_22230 3114 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 3923 3210 gene locus_tag LOCUS_22240 3923 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 4082 5059 gene locus_tag LOCUS_22250 4082 5059 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407646.1 protein_id gnl|my_center|LOCUS_22250 6248 5820 gene locus_tag LOCUS_22260 6248 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 7369 6764 gene locus_tag LOCUS_22270 7369 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 7869 7378 gene locus_tag LOCUS_22280 7869 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 9339 8152 gene locus_tag LOCUS_22290 9339 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 11017 9554 gene locus_tag LOCUS_22300 11017 9554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 11311 12609 gene locus_tag LOCUS_22310 11311 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 13958 12678 gene locus_tag LOCUS_22320 13958 12678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 14305 15936 gene locus_tag LOCUS_22330 14305 15936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 16567 15986 gene locus_tag LOCUS_22340 16567 15986 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927006.1 protein_id gnl|my_center|LOCUS_22340 16669 18792 gene locus_tag LOCUS_22350 16669 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 18850 20973 gene locus_tag LOCUS_22360 18850 20973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 20996 21445 gene locus_tag LOCUS_22370 20996 21445 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_22370 21690 21472 gene locus_tag LOCUS_22380 21690 21472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 21972 24503 gene locus_tag LOCUS_22390 21972 24503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 24595 25956 gene locus_tag LOCUS_22400 24595 25956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 26092 26340 gene locus_tag LOCUS_22410 26092 26340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 26803 26399 gene locus_tag LOCUS_22420 26803 26399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 27516 26950 gene locus_tag LOCUS_22430 gene pyrE 27516 26950 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868222.1 protein_id gnl|my_center|LOCUS_22430 27949 27575 gene locus_tag LOCUS_22440 27949 27575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 28828 27962 gene locus_tag LOCUS_22450 gene panC 28828 27962 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942350.1 protein_id gnl|my_center|LOCUS_22450 29683 28955 gene locus_tag LOCUS_22460 29683 28955 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_22460 29793 31058 gene locus_tag LOCUS_22470 29793 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 32788 31133 gene locus_tag LOCUS_22480 gene hcp 32788 31133 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390569.1 protein_id gnl|my_center|LOCUS_22480 33118 32816 gene locus_tag LOCUS_22490 33118 32816 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943861.1 protein_id gnl|my_center|LOCUS_22490 34049 33282 gene locus_tag LOCUS_22500 34049 33282 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_22500 34471 34046 gene locus_tag LOCUS_22510 34471 34046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 34852 36345 gene locus_tag LOCUS_22520 34852 36345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 39782 36591 gene locus_tag LOCUS_22530 39782 36591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 41524 39779 gene locus_tag LOCUS_22540 41524 39779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 41956 42522 gene locus_tag LOCUS_22550 41956 42522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 42534 44300 gene locus_tag LOCUS_22560 42534 44300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 44312 44809 gene locus_tag LOCUS_22570 44312 44809 CDS product Rab family GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257121.1 protein_id gnl|my_center|LOCUS_22570 44859 46565 gene locus_tag LOCUS_22580 44859 46565 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404200.1 protein_id gnl|my_center|LOCUS_22580 46799 47977 gene locus_tag LOCUS_22590 46799 47977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 48020 48718 gene locus_tag LOCUS_22600 gene aqpZ 48020 48718 CDS product aquaporin Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140371.1 protein_id gnl|my_center|LOCUS_22600 48795 50588 gene locus_tag LOCUS_22610 48795 50588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 50735 51577 gene locus_tag LOCUS_22620 50735 51577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 51675 52256 gene locus_tag LOCUS_22630 51675 52256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 52347 54581 gene locus_tag LOCUS_22640 52347 54581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680025.1 protein_id gnl|my_center|LOCUS_22640 55601 54630 gene locus_tag LOCUS_22650 55601 54630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 56114 55680 gene locus_tag LOCUS_22660 gene mscL 56114 55680 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_22660 57070 56141 gene locus_tag LOCUS_22670 57070 56141 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256178.1 protein_id gnl|my_center|LOCUS_22670 57310 59025 gene locus_tag LOCUS_22680 57310 59025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 59062 60456 gene locus_tag LOCUS_22690 59062 60456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 61374 62009 gene locus_tag LOCUS_22700 61374 62009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 62085 62279 gene locus_tag LOCUS_22710 62085 62279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence031 1954 872 gene locus_tag LOCUS_22720 gene flhB 1954 872 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870058.1 protein_id gnl|my_center|LOCUS_22720 2749 1967 gene locus_tag LOCUS_22730 gene fliR 2749 1967 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_22730 3018 2749 gene locus_tag LOCUS_22740 gene fliQ 3018 2749 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816214.1 protein_id gnl|my_center|LOCUS_22740 3796 3029 gene locus_tag LOCUS_22750 gene fliP 3796 3029 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_22750 4963 3821 gene locus_tag LOCUS_22760 4963 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 5502 4975 gene locus_tag LOCUS_22770 5502 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 6512 5517 gene locus_tag LOCUS_22780 gene fliM 6512 5517 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545847.1 protein_id gnl|my_center|LOCUS_22780 7052 6525 gene locus_tag LOCUS_22790 7052 6525 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_22790 8602 7604 gene locus_tag LOCUS_22800 8602 7604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 9603 8614 gene locus_tag LOCUS_22810 9603 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 10677 9616 gene locus_tag LOCUS_22820 10677 9616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 11026 13911 gene locus_tag LOCUS_22830 11026 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 13908 15788 gene locus_tag LOCUS_22840 13908 15788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 15831 16613 gene locus_tag LOCUS_22850 15831 16613 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104155.1 protein_id gnl|my_center|LOCUS_22850 18724 16982 gene locus_tag LOCUS_22860 18724 16982 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_22860 20176 18890 gene locus_tag LOCUS_22870 20176 18890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 21095 20196 gene locus_tag LOCUS_22880 21095 20196 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_22880 21487 21119 gene locus_tag LOCUS_22890 21487 21119 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141683.1 protein_id gnl|my_center|LOCUS_22890 23514 21487 gene locus_tag LOCUS_22900 23514 21487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 23723 24607 gene locus_tag LOCUS_22910 23723 24607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 24604 26511 gene locus_tag LOCUS_22920 24604 26511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 27575 26508 gene locus_tag LOCUS_22930 27575 26508 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258565.1 protein_id gnl|my_center|LOCUS_22930 28887 27598 gene locus_tag LOCUS_22940 gene serS 28887 27598 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680220.1 protein_id gnl|my_center|LOCUS_22940 29324 28968 gene locus_tag LOCUS_22950 29324 28968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 30708 29392 gene locus_tag LOCUS_22960 30708 29392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 33056 30705 gene locus_tag LOCUS_22970 33056 30705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161963454.1 protein_id gnl|my_center|LOCUS_22970 34504 33062 gene locus_tag LOCUS_22980 34504 33062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 35181 34540 gene locus_tag LOCUS_22990 35181 34540 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836510.1 protein_id gnl|my_center|LOCUS_22990 36191 35196 gene locus_tag LOCUS_23000 gene ftcD 36191 35196 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_23000 37246 36221 gene locus_tag LOCUS_23010 37246 36221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23010 37674 37312 gene locus_tag LOCUS_23020 37674 37312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 38181 37684 gene locus_tag LOCUS_23030 38181 37684 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146469.1 protein_id gnl|my_center|LOCUS_23030 38719 38186 gene locus_tag LOCUS_23040 38719 38186 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_23040 39003 38716 gene locus_tag LOCUS_23050 39003 38716 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943239.1 protein_id gnl|my_center|LOCUS_23050 39927 39019 gene locus_tag LOCUS_23060 gene sppA 39927 39019 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_23060 41934 40021 gene locus_tag LOCUS_23070 41934 40021 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_23070 43043 42189 gene locus_tag LOCUS_23080 43043 42189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 43871 43053 gene locus_tag LOCUS_23090 43871 43053 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942280.1 protein_id gnl|my_center|LOCUS_23090 46868 43887 gene locus_tag LOCUS_23100 46868 43887 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942279.1 protein_id gnl|my_center|LOCUS_23100 47741 47244 gene locus_tag LOCUS_23110 47741 47244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 48157 47795 gene locus_tag LOCUS_23120 48157 47795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 48587 48228 gene locus_tag LOCUS_23130 48587 48228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 49518 48784 gene locus_tag LOCUS_23140 49518 48784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23140 50132 49515 gene locus_tag LOCUS_23150 50132 49515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 51837 50299 gene locus_tag LOCUS_23160 gene tldD 51837 50299 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039540.1 protein_id gnl|my_center|LOCUS_23160 52463 51873 gene locus_tag LOCUS_23170 52463 51873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 52666 53652 gene locus_tag LOCUS_23180 52666 53652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 53649 55157 gene locus_tag LOCUS_23190 53649 55157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 55551 55159 gene locus_tag LOCUS_23200 55551 55159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 56027 55548 gene locus_tag LOCUS_23210 56027 55548 CDS product DoxX family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941174.1 protein_id gnl|my_center|LOCUS_23210 56551 56024 gene locus_tag LOCUS_23220 56551 56024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 56711 56935 gene locus_tag LOCUS_23230 56711 56935 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888660.1 protein_id gnl|my_center|LOCUS_23230 57000 57167 gene locus_tag LOCUS_23240 57000 57167 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784522.1 protein_id gnl|my_center|LOCUS_23240 57522 57247 gene locus_tag LOCUS_23250 57522 57247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 57658 58092 gene locus_tag LOCUS_23260 57658 58092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 59273 58143 gene locus_tag LOCUS_23270 59273 58143 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402607.1 protein_id gnl|my_center|LOCUS_23270 60164 59277 gene locus_tag LOCUS_23280 60164 59277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 61710 60436 gene locus_tag LOCUS_23290 61710 60436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 >Feature sequence032 842 1276 gene locus_tag LOCUS_23300 842 1276 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_23300 1320 1895 gene locus_tag LOCUS_23310 1320 1895 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940353.1 protein_id gnl|my_center|LOCUS_23310 1912 2400 gene locus_tag LOCUS_23320 1912 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 2445 2603 gene locus_tag LOCUS_23330 2445 2603 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_23330 2659 3030 gene locus_tag LOCUS_23340 2659 3030 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_23340 3037 3546 gene locus_tag LOCUS_23350 3037 3546 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259748.1 protein_id gnl|my_center|LOCUS_23350 3666 5006 gene locus_tag LOCUS_23360 3666 5006 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942285.1 protein_id gnl|my_center|LOCUS_23360 5003 6019 gene locus_tag LOCUS_23370 gene cydB 5003 6019 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_23370 6381 6097 gene locus_tag LOCUS_23380 6381 6097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 6563 9046 gene locus_tag LOCUS_23390 6563 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 9050 10024 gene locus_tag LOCUS_23400 9050 10024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 10024 11166 gene locus_tag LOCUS_23410 10024 11166 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230566.1 protein_id gnl|my_center|LOCUS_23410 12158 11154 gene locus_tag LOCUS_23420 12158 11154 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398688.1 protein_id gnl|my_center|LOCUS_23420 12367 14166 gene locus_tag LOCUS_23430 12367 14166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 14198 18124 gene locus_tag LOCUS_23440 14198 18124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 18580 18176 gene locus_tag LOCUS_23450 18580 18176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 20303 18621 gene locus_tag LOCUS_23460 20303 18621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 21539 21015 gene locus_tag LOCUS_23470 21539 21015 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939219.1 protein_id gnl|my_center|LOCUS_23470 23061 21637 gene locus_tag LOCUS_23480 23061 21637 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_23480 23712 23071 gene locus_tag LOCUS_23490 gene pncA 23712 23071 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404207.1 protein_id gnl|my_center|LOCUS_23490 23853 24482 gene locus_tag LOCUS_23500 23853 24482 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902491.1 protein_id gnl|my_center|LOCUS_23500 24525 25592 gene locus_tag LOCUS_23510 24525 25592 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941210.1 protein_id gnl|my_center|LOCUS_23510 26050 27798 gene locus_tag LOCUS_23520 gene nuoF 26050 27798 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868905.1 protein_id gnl|my_center|LOCUS_23520 27810 28535 gene locus_tag LOCUS_23530 gene hoxU 27810 28535 CDS product bidirectional hydrogenase complex protein HoxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257072.1 protein_id gnl|my_center|LOCUS_23530 28545 29090 gene locus_tag LOCUS_23540 28545 29090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 29114 30556 gene locus_tag LOCUS_23550 29114 30556 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_23550 30553 31050 gene locus_tag LOCUS_23560 30553 31050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 31076 31453 gene locus_tag LOCUS_23570 31076 31453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 31521 32630 gene locus_tag LOCUS_23580 31521 32630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 32655 32918 gene locus_tag LOCUS_23590 32655 32918 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_23590 32908 34005 gene locus_tag LOCUS_23600 gene hypD 32908 34005 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250950.1 protein_id gnl|my_center|LOCUS_23600 33998 35011 gene locus_tag LOCUS_23610 gene hypE 33998 35011 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810719.1 protein_id gnl|my_center|LOCUS_23610 35011 35355 gene locus_tag LOCUS_23620 35011 35355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 35352 36017 gene locus_tag LOCUS_23630 35352 36017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 36100 36366 gene locus_tag LOCUS_23640 36100 36366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 36389 37027 gene locus_tag LOCUS_23650 36389 37027 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393069.1 protein_id gnl|my_center|LOCUS_23650 37085 38539 gene locus_tag LOCUS_23660 37085 38539 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_23660 38813 38547 gene locus_tag LOCUS_23670 38813 38547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 38948 40597 gene locus_tag LOCUS_23680 38948 40597 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044972.1 protein_id gnl|my_center|LOCUS_23680 41228 40602 gene locus_tag LOCUS_23690 41228 40602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 41473 41228 gene locus_tag LOCUS_23700 41473 41228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 42835 41537 gene locus_tag LOCUS_23710 42835 41537 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036621.1 protein_id gnl|my_center|LOCUS_23710 43153 43827 gene locus_tag LOCUS_23720 43153 43827 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105364.1 protein_id gnl|my_center|LOCUS_23720 43843 44529 gene locus_tag LOCUS_23730 43843 44529 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019283.1 protein_id gnl|my_center|LOCUS_23730 44539 45216 gene locus_tag LOCUS_23740 44539 45216 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_23740 45884 45285 gene locus_tag LOCUS_23750 45884 45285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 46696 45905 gene locus_tag LOCUS_23760 46696 45905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 47526 46714 gene locus_tag LOCUS_23770 47526 46714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 48262 47549 gene locus_tag LOCUS_23780 48262 47549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 49337 48351 gene locus_tag LOCUS_23790 49337 48351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 50285 49437 gene locus_tag LOCUS_23800 gene pstB 50285 49437 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_23800 51143 50295 gene locus_tag LOCUS_23810 gene pstA 51143 50295 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_23810 52031 51147 gene locus_tag LOCUS_23820 gene pstC 52031 51147 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877335.1 protein_id gnl|my_center|LOCUS_23820 53043 52051 gene locus_tag LOCUS_23830 53043 52051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 53226 54314 gene locus_tag LOCUS_23840 53226 54314 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065027.1 protein_id gnl|my_center|LOCUS_23840 <55545 54325 gene locus_tag LOCUS_23850 <55545 54325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012803772.1:sulfatase >Feature sequence033 2477 69 gene locus_tag LOCUS_23860 2477 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 5297 2730 gene locus_tag LOCUS_23870 5297 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 5441 8065 gene locus_tag LOCUS_23880 5441 8065 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938942.1 protein_id gnl|my_center|LOCUS_23880 8210 8920 gene locus_tag LOCUS_23890 8210 8920 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_23890 8917 11499 gene locus_tag LOCUS_23900 8917 11499 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003915882.1 protein_id gnl|my_center|LOCUS_23900 11640 12338 gene locus_tag LOCUS_23910 11640 12338 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389529.1 protein_id gnl|my_center|LOCUS_23910 12342 13322 gene locus_tag LOCUS_23920 gene trpS 12342 13322 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937453.1 protein_id gnl|my_center|LOCUS_23920 13326 14072 gene locus_tag LOCUS_23930 13326 14072 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_23930 14062 15024 gene locus_tag LOCUS_23940 14062 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 15021 15761 gene locus_tag LOCUS_23950 15021 15761 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965156.1 protein_id gnl|my_center|LOCUS_23950 15758 17725 gene locus_tag LOCUS_23960 15758 17725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 17783 17859 gene locus_tag LOCUS_t00240 17783 17859 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17992 19206 gene locus_tag LOCUS_23970 17992 19206 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393297.1 protein_id gnl|my_center|LOCUS_23970 19349 20413 gene locus_tag LOCUS_23980 19349 20413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 20424 20699 gene locus_tag LOCUS_23990 20424 20699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 20987 20694 gene locus_tag LOCUS_24000 20987 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 21475 21011 gene locus_tag LOCUS_24010 21475 21011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 23246 21489 gene locus_tag LOCUS_24020 23246 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 24026 23571 gene locus_tag LOCUS_24030 24026 23571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 24806 24123 gene locus_tag LOCUS_24040 24806 24123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 25079 24855 gene locus_tag LOCUS_24050 25079 24855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 26191 25451 gene locus_tag LOCUS_24060 26191 25451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 28006 26633 gene locus_tag LOCUS_24070 28006 26633 CDS product PD40 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202208.1 protein_id gnl|my_center|LOCUS_24070 29409 28111 gene locus_tag LOCUS_24080 29409 28111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 30947 30183 gene locus_tag LOCUS_24090 30947 30183 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_24090 31684 30944 gene locus_tag LOCUS_24100 31684 30944 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_24100 32649 31681 gene locus_tag LOCUS_24110 32649 31681 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_24110 33508 32651 gene locus_tag LOCUS_24120 33508 32651 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819072.1 protein_id gnl|my_center|LOCUS_24120 34819 33527 gene locus_tag LOCUS_24130 34819 33527 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_24130 35104 37614 gene locus_tag LOCUS_24140 35104 37614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 39570 37579 gene locus_tag LOCUS_24150 39570 37579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 40043 40396 gene locus_tag LOCUS_24160 40043 40396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 40480 41469 gene locus_tag LOCUS_24170 40480 41469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 41555 42919 gene locus_tag LOCUS_24180 41555 42919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 45398 42942 gene locus_tag LOCUS_24190 45398 42942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 48780 45652 gene locus_tag LOCUS_24200 48780 45652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 49013 50050 gene locus_tag LOCUS_24210 49013 50050 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113167.1 protein_id gnl|my_center|LOCUS_24210 50833 50117 gene locus_tag LOCUS_24220 50833 50117 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223909.1 protein_id gnl|my_center|LOCUS_24220 51581 50976 gene locus_tag LOCUS_24230 51581 50976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 54663 51589 gene locus_tag LOCUS_24240 54663 51589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 <55329 54663 gene locus_tag LOCUS_24250 <55329 54663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615854.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence034 222 818 gene locus_tag LOCUS_24260 222 818 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942123.1 protein_id gnl|my_center|LOCUS_24260 827 1555 gene locus_tag LOCUS_24270 827 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24270 1568 2197 gene locus_tag LOCUS_24280 1568 2197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942125.1 protein_id gnl|my_center|LOCUS_24280 2613 2311 gene locus_tag LOCUS_24290 2613 2311 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721993.1 protein_id gnl|my_center|LOCUS_24290 3627 2938 gene locus_tag LOCUS_24300 3627 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 4355 3687 gene locus_tag LOCUS_24310 4355 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 6727 4436 gene locus_tag LOCUS_24320 6727 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 6851 7846 gene locus_tag LOCUS_24330 6851 7846 CDS product quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257832.1 protein_id gnl|my_center|LOCUS_24330 8076 8843 gene locus_tag LOCUS_24340 8076 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 8857 10134 gene locus_tag LOCUS_24350 8857 10134 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086334.1 protein_id gnl|my_center|LOCUS_24350 10303 11445 gene locus_tag LOCUS_24360 10303 11445 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419507.1 protein_id gnl|my_center|LOCUS_24360 12004 12663 gene locus_tag LOCUS_24370 12004 12663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 12683 13384 gene locus_tag LOCUS_24380 12683 13384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 13529 13981 gene locus_tag LOCUS_24390 13529 13981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 14024 14938 gene locus_tag LOCUS_24400 14024 14938 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937841.1 protein_id gnl|my_center|LOCUS_24400 14935 16167 gene locus_tag LOCUS_24410 gene nrfD 14935 16167 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937840.1 protein_id gnl|my_center|LOCUS_24410 16279 17463 gene locus_tag LOCUS_24420 16279 17463 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963666.1 protein_id gnl|my_center|LOCUS_24420 17463 18473 gene locus_tag LOCUS_24430 17463 18473 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528694.1 protein_id gnl|my_center|LOCUS_24430 19031 18474 gene locus_tag LOCUS_24440 19031 18474 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584147.1 protein_id gnl|my_center|LOCUS_24440 20408 19038 gene locus_tag LOCUS_24450 20408 19038 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941261.1 protein_id gnl|my_center|LOCUS_24450 22105 20408 gene locus_tag LOCUS_24460 22105 20408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 22713 22318 gene locus_tag LOCUS_24470 22713 22318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 23582 22815 gene locus_tag LOCUS_24480 23582 22815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 24610 23585 gene locus_tag LOCUS_24490 24610 23585 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_24490 25449 24607 gene locus_tag LOCUS_24500 25449 24607 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080608.1 protein_id gnl|my_center|LOCUS_24500 26840 25686 gene locus_tag LOCUS_24510 26840 25686 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108945.1 protein_id gnl|my_center|LOCUS_24510 26979 27335 gene locus_tag LOCUS_24520 26979 27335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 28316 27402 gene locus_tag LOCUS_24530 28316 27402 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258713.1 protein_id gnl|my_center|LOCUS_24530 28909 28484 gene locus_tag LOCUS_24540 28909 28484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 30102 29236 gene locus_tag LOCUS_24550 30102 29236 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113772.1 protein_id gnl|my_center|LOCUS_24550 31053 30127 gene locus_tag LOCUS_24560 31053 30127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969952.1 protein_id gnl|my_center|LOCUS_24560 31453 31046 gene locus_tag LOCUS_24570 31453 31046 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986849.1 protein_id gnl|my_center|LOCUS_24570 32502 31450 gene locus_tag LOCUS_24580 32502 31450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 34504 32558 gene locus_tag LOCUS_24590 34504 32558 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_24590 34821 36392 gene locus_tag LOCUS_24600 34821 36392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 36461 37339 gene locus_tag LOCUS_24610 36461 37339 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121418.1 protein_id gnl|my_center|LOCUS_24610 37336 39195 gene locus_tag LOCUS_24620 37336 39195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 39179 41776 gene locus_tag LOCUS_24630 39179 41776 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922073.1 protein_id gnl|my_center|LOCUS_24630 41780 42763 gene locus_tag LOCUS_24640 41780 42763 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326093.1 protein_id gnl|my_center|LOCUS_24640 43274 42831 gene locus_tag LOCUS_24650 43274 42831 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022893.1 protein_id gnl|my_center|LOCUS_24650 44143 43361 gene locus_tag LOCUS_24660 44143 43361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 44251 45159 gene locus_tag LOCUS_24670 44251 45159 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942049.1 protein_id gnl|my_center|LOCUS_24670 45829 45359 gene locus_tag LOCUS_24680 45829 45359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 46496 46164 gene locus_tag LOCUS_24690 46496 46164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 47290 46523 gene locus_tag LOCUS_24700 47290 46523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 48384 47287 gene locus_tag LOCUS_24710 48384 47287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 50527 48461 gene locus_tag LOCUS_24720 50527 48461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 52442 50697 gene locus_tag LOCUS_24730 52442 50697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 53243 53947 gene locus_tag LOCUS_24740 53243 53947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 54166 54501 gene locus_tag LOCUS_24750 54166 54501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence035 <1 1457 gene locus_tag LOCUS_24760 <1 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143059.1:histidine ammonia-lyase 1454 3040 gene locus_tag LOCUS_24770 gene hutH 1454 3040 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_24770 3027 4403 gene locus_tag LOCUS_24780 gene hisS 3027 4403 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_24780 4424 5239 gene locus_tag LOCUS_24790 4424 5239 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_24790 7445 5328 gene locus_tag LOCUS_24800 7445 5328 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895660.1 protein_id gnl|my_center|LOCUS_24800 7823 7449 gene locus_tag LOCUS_24810 7823 7449 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_24810 9387 7936 gene locus_tag LOCUS_24820 9387 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 9929 9531 gene locus_tag LOCUS_24830 9929 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 10188 10856 gene locus_tag LOCUS_24840 10188 10856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 10917 12047 gene locus_tag LOCUS_24850 10917 12047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 14864 12066 gene locus_tag LOCUS_24860 14864 12066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 16465 15062 gene locus_tag LOCUS_24870 16465 15062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 16712 16639 gene locus_tag LOCUS_t00250 16712 16639 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 18086 16809 gene locus_tag LOCUS_24880 18086 16809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 19007 18198 gene locus_tag LOCUS_24890 19007 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 19306 19378 gene locus_tag LOCUS_t00260 19306 19378 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 19476 21863 gene locus_tag LOCUS_24900 gene mrcB 19476 21863 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707274.1 protein_id gnl|my_center|LOCUS_24900 21866 22690 gene locus_tag LOCUS_24910 21866 22690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 23434 22694 gene locus_tag LOCUS_24920 23434 22694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 23980 23537 gene locus_tag LOCUS_24930 23980 23537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 24313 25557 gene locus_tag LOCUS_24940 24313 25557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 28096 25544 gene locus_tag LOCUS_24950 28096 25544 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_24950 29198 28206 gene locus_tag LOCUS_24960 29198 28206 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550079.1 protein_id gnl|my_center|LOCUS_24960 30037 29195 gene locus_tag LOCUS_24970 30037 29195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24970 30151 30852 gene locus_tag LOCUS_24980 gene ispD 30151 30852 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943979.1 protein_id gnl|my_center|LOCUS_24980 30849 31331 gene locus_tag LOCUS_24990 gene ispF 30849 31331 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943978.1 protein_id gnl|my_center|LOCUS_24990 31328 32752 gene locus_tag LOCUS_25000 gene gltX 31328 32752 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958261.1 protein_id gnl|my_center|LOCUS_25000 34760 32754 gene locus_tag LOCUS_25010 34760 32754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 35026 37053 gene locus_tag LOCUS_25020 35026 37053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 39103 36986 gene locus_tag LOCUS_25030 39103 36986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 39285 41039 gene locus_tag LOCUS_25040 39285 41039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 42636 41047 gene locus_tag LOCUS_25050 42636 41047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 42760 43449 gene locus_tag LOCUS_25060 42760 43449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 43450 45438 gene locus_tag LOCUS_25070 43450 45438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 45441 47540 gene locus_tag LOCUS_25080 45441 47540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 47533 49440 gene locus_tag LOCUS_25090 47533 49440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 49440 51401 gene locus_tag LOCUS_25100 49440 51401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 51398 53287 gene locus_tag LOCUS_25110 51398 53287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 53384 53620 gene locus_tag LOCUS_25120 53384 53620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 54067 53627 gene locus_tag LOCUS_25130 54067 53627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 >Feature sequence036 195 995 gene locus_tag LOCUS_25140 195 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 1420 1010 gene locus_tag LOCUS_25150 1420 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 3068 1728 gene locus_tag LOCUS_25160 3068 1728 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_25160 3759 3190 gene locus_tag LOCUS_25170 3759 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 4385 3756 gene locus_tag LOCUS_25180 4385 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 4618 7155 gene locus_tag LOCUS_25190 gene gyrA 4618 7155 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940682.1 protein_id gnl|my_center|LOCUS_25190 7155 8771 gene locus_tag LOCUS_25200 7155 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 9469 8768 gene locus_tag LOCUS_25210 9469 8768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 10951 9470 gene locus_tag LOCUS_25220 10951 9470 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875981.1 protein_id gnl|my_center|LOCUS_25220 13249 10982 gene locus_tag LOCUS_25230 13249 10982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 14435 13260 gene locus_tag LOCUS_25240 14435 13260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 15964 14435 gene locus_tag LOCUS_25250 15964 14435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 16614 16060 gene locus_tag LOCUS_25260 16614 16060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 18040 16727 gene locus_tag LOCUS_25270 18040 16727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 18841 18083 gene locus_tag LOCUS_25280 18841 18083 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816573.1 protein_id gnl|my_center|LOCUS_25280 20325 18838 gene locus_tag LOCUS_25290 20325 18838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 21248 20373 gene locus_tag LOCUS_25300 gene dprA 21248 20373 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085786324.1 protein_id gnl|my_center|LOCUS_25300 22883 21336 gene locus_tag LOCUS_25310 22883 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 23524 22997 gene locus_tag LOCUS_25320 23524 22997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 25284 23521 gene locus_tag LOCUS_25330 25284 23521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 25694 25993 gene locus_tag LOCUS_25340 25694 25993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 25996 26820 gene locus_tag LOCUS_25350 25996 26820 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939346.1 protein_id gnl|my_center|LOCUS_25350 26864 27805 gene locus_tag LOCUS_25360 26864 27805 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939345.1 protein_id gnl|my_center|LOCUS_25360 29511 28198 gene locus_tag LOCUS_25370 29511 28198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 30193 29504 gene locus_tag LOCUS_25380 30193 29504 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_25380 31426 30206 gene locus_tag LOCUS_25390 31426 30206 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_25390 32669 31437 gene locus_tag LOCUS_25400 32669 31437 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_25400 33435 32671 gene locus_tag LOCUS_25410 33435 32671 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_25410 34537 33512 gene locus_tag LOCUS_25420 gene rfbB 34537 33512 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_25420 35006 34617 gene locus_tag LOCUS_25430 35006 34617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25430 36680 35031 gene locus_tag LOCUS_25440 36680 35031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25440 37420 36677 gene locus_tag LOCUS_25450 37420 36677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 39465 37417 gene locus_tag LOCUS_25460 39465 37417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 41111 39588 gene locus_tag LOCUS_25470 41111 39588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 41527 41108 gene locus_tag LOCUS_25480 41527 41108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 41809 42687 gene locus_tag LOCUS_25490 41809 42687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25490 42776 44002 gene locus_tag LOCUS_25500 42776 44002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 44780 44019 gene locus_tag LOCUS_25510 gene soj 44780 44019 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_25510 45126 44806 gene locus_tag LOCUS_25520 45126 44806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 45306 46817 gene locus_tag LOCUS_25530 45306 46817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 47946 47050 gene locus_tag LOCUS_25540 47946 47050 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867557.1 protein_id gnl|my_center|LOCUS_25540 49602 48094 gene locus_tag LOCUS_25550 49602 48094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 50155 52881 gene locus_tag LOCUS_25560 50155 52881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 53276 53040 gene locus_tag LOCUS_25570 53276 53040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 >Feature sequence037 295 753 gene locus_tag LOCUS_25580 295 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 2057 771 gene locus_tag LOCUS_25590 2057 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 4196 2211 gene locus_tag LOCUS_25600 4196 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 4371 4703 gene locus_tag LOCUS_25610 4371 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25610 4799 6151 gene locus_tag LOCUS_25620 4799 6151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 6148 7188 gene locus_tag LOCUS_25630 6148 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 7185 8162 gene locus_tag LOCUS_25640 7185 8162 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940277.1 protein_id gnl|my_center|LOCUS_25640 8959 8216 gene locus_tag LOCUS_25650 8959 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 10303 8966 gene locus_tag LOCUS_25660 10303 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 12154 10397 gene locus_tag LOCUS_25670 12154 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 12397 13263 gene locus_tag LOCUS_25680 gene dapA 12397 13263 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_25680 13276 14094 gene locus_tag LOCUS_25690 gene dapB 13276 14094 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_25690 14091 14870 gene locus_tag LOCUS_25700 14091 14870 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056890.1 protein_id gnl|my_center|LOCUS_25700 16044 14995 gene locus_tag LOCUS_25710 16044 14995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 16389 16126 gene locus_tag LOCUS_25720 16389 16126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 16974 16399 gene locus_tag LOCUS_25730 16974 16399 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220007.1 protein_id gnl|my_center|LOCUS_25730 17315 18163 gene locus_tag LOCUS_25740 gene cheR 17315 18163 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091728.1 protein_id gnl|my_center|LOCUS_25740 18212 18592 gene locus_tag LOCUS_25750 18212 18592 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772151.1 protein_id gnl|my_center|LOCUS_25750 19170 20051 gene locus_tag LOCUS_25760 19170 20051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 20083 20898 gene locus_tag LOCUS_25770 20083 20898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 20917 21495 gene locus_tag LOCUS_25780 20917 21495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 23095 21602 gene locus_tag LOCUS_25790 23095 21602 CDS product IS1182-like element ISPa22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112390.1 protein_id gnl|my_center|LOCUS_25790 24867 23365 gene locus_tag LOCUS_25800 24867 23365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 25810 24941 gene locus_tag LOCUS_25810 25810 24941 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193057.1 protein_id gnl|my_center|LOCUS_25810 26048 26863 gene locus_tag LOCUS_25820 26048 26863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 26868 28190 gene locus_tag LOCUS_25830 26868 28190 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943068.1 protein_id gnl|my_center|LOCUS_25830 28209 28970 gene locus_tag LOCUS_25840 28209 28970 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_25840 28986 30185 gene locus_tag LOCUS_25850 28986 30185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 30189 31262 gene locus_tag LOCUS_25860 gene queA 30189 31262 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943258.1 protein_id gnl|my_center|LOCUS_25860 31259 32407 gene locus_tag LOCUS_25870 gene tgt 31259 32407 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_25870 32397 32738 gene locus_tag LOCUS_25880 32397 32738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 32777 34360 gene locus_tag LOCUS_25890 gene secD 32777 34360 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939106.1 protein_id gnl|my_center|LOCUS_25890 34370 35362 gene locus_tag LOCUS_25900 gene secF 34370 35362 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_25900 35384 37102 gene locus_tag LOCUS_25910 gene recJ 35384 37102 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_25910 38209 37163 gene locus_tag LOCUS_25920 38209 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 39617 38517 gene locus_tag LOCUS_25930 39617 38517 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680154.1 protein_id gnl|my_center|LOCUS_25930 39954 39610 gene locus_tag LOCUS_25940 39954 39610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 41841 39958 gene locus_tag LOCUS_25950 41841 39958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 43006 41972 gene locus_tag LOCUS_25960 gene mtnA 43006 41972 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943990.1 protein_id gnl|my_center|LOCUS_25960 43135 45321 gene locus_tag LOCUS_25970 43135 45321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 45358 47106 gene locus_tag LOCUS_25980 gene ispH 45358 47106 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011417689.1 protein_id gnl|my_center|LOCUS_25980 48297 47116 gene locus_tag LOCUS_25990 48297 47116 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_25990 48863 48327 gene locus_tag LOCUS_26000 48863 48327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 50325 49069 gene locus_tag LOCUS_26010 50325 49069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 50849 50322 gene locus_tag LOCUS_26020 50849 50322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 51872 50856 gene locus_tag LOCUS_26030 51872 50856 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099147.1 protein_id gnl|my_center|LOCUS_26030 52740 51877 gene locus_tag LOCUS_26040 52740 51877 CDS product TRAP transporter TatT component family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682338.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence038 1834 752 gene locus_tag LOCUS_26050 1834 752 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211683.1 protein_id gnl|my_center|LOCUS_26050 2026 3747 gene locus_tag LOCUS_26060 2026 3747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26060 4741 3806 gene locus_tag LOCUS_26070 4741 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26070 4930 6237 gene locus_tag LOCUS_26080 4930 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26080 7579 6245 gene locus_tag LOCUS_26090 7579 6245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26090 7910 9475 gene locus_tag LOCUS_26100 7910 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 9552 10379 gene locus_tag LOCUS_26110 9552 10379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 10501 11037 gene locus_tag LOCUS_26120 10501 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 11050 12117 gene locus_tag LOCUS_26130 11050 12117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26130 13092 12157 gene locus_tag LOCUS_26140 13092 12157 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_26140 13838 13290 gene locus_tag LOCUS_26150 13838 13290 CDS product lipocalin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942963.1 protein_id gnl|my_center|LOCUS_26150 14570 14436 gene locus_tag LOCUS_26160 14570 14436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 16213 14669 gene locus_tag LOCUS_26170 16213 14669 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_26170 16454 17779 gene locus_tag LOCUS_26180 16454 17779 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_26180 17798 18193 gene locus_tag LOCUS_26190 17798 18193 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060873.1 protein_id gnl|my_center|LOCUS_26190 18343 18684 gene locus_tag LOCUS_26200 18343 18684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 18806 18709 gene locus_tag LOCUS_t00270 18806 18709 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 19007 20239 gene locus_tag LOCUS_26210 19007 20239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 21159 20335 gene locus_tag LOCUS_26220 21159 20335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26220 23274 21187 gene locus_tag LOCUS_26230 23274 21187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26230 25274 23301 gene locus_tag LOCUS_26240 25274 23301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 25443 26114 gene locus_tag LOCUS_26250 25443 26114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 26166 27440 gene locus_tag LOCUS_26260 gene purD 26166 27440 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_26260 27441 27938 gene locus_tag LOCUS_26270 gene purE 27441 27938 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941273.1 protein_id gnl|my_center|LOCUS_26270 27993 28631 gene locus_tag LOCUS_26280 27993 28631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26280 28634 29977 gene locus_tag LOCUS_26290 28634 29977 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921547.1 protein_id gnl|my_center|LOCUS_26290 29961 30758 gene locus_tag LOCUS_26300 29961 30758 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435875.1 protein_id gnl|my_center|LOCUS_26300 30769 31620 gene locus_tag LOCUS_26310 gene rfbD 30769 31620 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929228.1 protein_id gnl|my_center|LOCUS_26310 31699 33009 gene locus_tag LOCUS_26320 31699 33009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 33116 34405 gene locus_tag LOCUS_26330 33116 34405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 34436 35866 gene locus_tag LOCUS_26340 34436 35866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 35876 36628 gene locus_tag LOCUS_26350 35876 36628 CDS product tRNA 2-thiocytidine biosynthesis TtcA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940499.1 protein_id gnl|my_center|LOCUS_26350 36720 38720 gene locus_tag LOCUS_26360 36720 38720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 38717 38977 gene locus_tag LOCUS_26370 38717 38977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 39078 39569 gene locus_tag LOCUS_26380 39078 39569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 39622 40458 gene locus_tag LOCUS_26390 39622 40458 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941197.1 protein_id gnl|my_center|LOCUS_26390 42141 40429 gene locus_tag LOCUS_26400 gene recN 42141 40429 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942706.1 protein_id gnl|my_center|LOCUS_26400 42993 42145 gene locus_tag LOCUS_26410 42993 42145 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_26410 44705 42993 gene locus_tag LOCUS_26420 44705 42993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26420 45356 44841 gene locus_tag LOCUS_26430 45356 44841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 46086 45406 gene locus_tag LOCUS_26440 46086 45406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 46395 47741 gene locus_tag LOCUS_26450 46395 47741 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_26450 47813 50140 gene locus_tag LOCUS_26460 47813 50140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 >Feature sequence039 1365 127 gene locus_tag LOCUS_26470 1365 127 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_26470 1557 2903 gene locus_tag LOCUS_26480 1557 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 3672 2968 gene locus_tag LOCUS_26490 3672 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 5892 3802 gene locus_tag LOCUS_26500 5892 3802 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035498.1 protein_id gnl|my_center|LOCUS_26500 6537 6013 gene locus_tag LOCUS_26510 6537 6013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 6661 7842 gene locus_tag LOCUS_26520 gene dinB 6661 7842 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_26520 8715 8212 gene locus_tag LOCUS_26530 gene fldA 8715 8212 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140318.1 protein_id gnl|my_center|LOCUS_26530 9081 9725 gene locus_tag LOCUS_26540 9081 9725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 9885 11129 gene locus_tag LOCUS_26550 gene nifS 9885 11129 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393154.1 protein_id gnl|my_center|LOCUS_26550 11140 11589 gene locus_tag LOCUS_26560 11140 11589 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460328.1 protein_id gnl|my_center|LOCUS_26560 11629 12285 gene locus_tag LOCUS_26570 11629 12285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 12431 12898 gene locus_tag LOCUS_26580 12431 12898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 12941 15472 gene locus_tag LOCUS_26590 12941 15472 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_26590 15532 17109 gene locus_tag LOCUS_26600 gene rng 15532 17109 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_26600 18933 17146 gene locus_tag LOCUS_26610 gene ptsP 18933 17146 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942526.1 protein_id gnl|my_center|LOCUS_26610 19208 18939 gene locus_tag LOCUS_26620 19208 18939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 19617 19213 gene locus_tag LOCUS_26630 19617 19213 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_26630 20498 19632 gene locus_tag LOCUS_26640 gene rapZ 20498 19632 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942529.1 protein_id gnl|my_center|LOCUS_26640 21454 20495 gene locus_tag LOCUS_26650 gene hprK 21454 20495 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_26650 21913 21578 gene locus_tag LOCUS_26660 21913 21578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_26660 22476 21919 gene locus_tag LOCUS_26670 gene raiA 22476 21919 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_26670 23928 22498 gene locus_tag LOCUS_26680 gene rpoN 23928 22498 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_26680 24677 23946 gene locus_tag LOCUS_26690 gene lptB 24677 23946 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_26690 25283 24681 gene locus_tag LOCUS_26700 25283 24681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 25837 25280 gene locus_tag LOCUS_26710 25837 25280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 25988 28054 gene locus_tag LOCUS_26720 25988 28054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 28065 29558 gene locus_tag LOCUS_26730 28065 29558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26730 29606 31012 gene locus_tag LOCUS_26740 29606 31012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26740 31009 32010 gene locus_tag LOCUS_26750 31009 32010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26750 32123 33283 gene locus_tag LOCUS_26760 gene metK 32123 33283 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_26760 33361 34620 gene locus_tag LOCUS_26770 gene ahcY 33361 34620 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_26770 34653 35573 gene locus_tag LOCUS_26780 34653 35573 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_26780 35570 36679 gene locus_tag LOCUS_26790 35570 36679 CDS product geranylgeranyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388387.1 protein_id gnl|my_center|LOCUS_26790 36679 37746 gene locus_tag LOCUS_26800 36679 37746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 38752 37757 gene locus_tag LOCUS_26810 38752 37757 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963619.1 protein_id gnl|my_center|LOCUS_26810 39756 38764 gene locus_tag LOCUS_26820 gene galT 39756 38764 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_26820 41985 39865 gene locus_tag LOCUS_26830 41985 39865 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867300.1 protein_id gnl|my_center|LOCUS_26830 44155 41987 gene locus_tag LOCUS_26840 44155 41987 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943867.1 protein_id gnl|my_center|LOCUS_26840 45402 44152 gene locus_tag LOCUS_26850 gene glgC 45402 44152 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227648.1 protein_id gnl|my_center|LOCUS_26850 46379 45408 gene locus_tag LOCUS_26860 46379 45408 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403550.1 protein_id gnl|my_center|LOCUS_26860 46903 46376 gene locus_tag LOCUS_26870 46903 46376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 47209 48552 gene locus_tag LOCUS_26880 47209 48552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 48604 50181 gene locus_tag LOCUS_26890 48604 50181 CDS product glycosyl hydrolase family 79 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526730.1 protein_id gnl|my_center|LOCUS_26890 50318 50245 gene locus_tag LOCUS_t00280 50318 50245 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence040 103 1656 gene locus_tag LOCUS_26900 103 1656 CDS product D-lysine 5,6-aminomutase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015881.1 protein_id gnl|my_center|LOCUS_26900 1643 2404 gene locus_tag LOCUS_26910 1643 2404 CDS product B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902977.1 protein_id gnl|my_center|LOCUS_26910 2401 2793 gene locus_tag LOCUS_26920 2401 2793 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372681.1 protein_id gnl|my_center|LOCUS_26920 2943 4259 gene locus_tag LOCUS_26930 2943 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26930 4476 5681 gene locus_tag LOCUS_26940 4476 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26940 5682 6716 gene locus_tag LOCUS_26950 5682 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 6730 7497 gene locus_tag LOCUS_26960 6730 7497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 9140 7512 gene locus_tag LOCUS_26970 9140 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 10494 9250 gene locus_tag LOCUS_26980 10494 9250 CDS product aminotransferase class III-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528130.1 protein_id gnl|my_center|LOCUS_26980 11445 10513 gene locus_tag LOCUS_26990 11445 10513 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_26990 12230 11454 gene locus_tag LOCUS_27000 12230 11454 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_27000 13359 12217 gene locus_tag LOCUS_27010 gene alr 13359 12217 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_27010 14469 13408 gene locus_tag LOCUS_27020 14469 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 14587 15846 gene locus_tag LOCUS_27030 14587 15846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 16444 15851 gene locus_tag LOCUS_27040 16444 15851 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072078.1 protein_id gnl|my_center|LOCUS_27040 18558 16453 gene locus_tag LOCUS_27050 18558 16453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27050 19060 21723 gene locus_tag LOCUS_27060 19060 21723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 21735 24323 gene locus_tag LOCUS_27070 21735 24323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 24526 26403 gene locus_tag LOCUS_27080 24526 26403 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_27080 26409 28472 gene locus_tag LOCUS_27090 26409 28472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 29545 28466 gene locus_tag LOCUS_27100 29545 28466 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767146.1 protein_id gnl|my_center|LOCUS_27100 30921 29656 gene locus_tag LOCUS_27110 gene hisD 30921 29656 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228145.1 protein_id gnl|my_center|LOCUS_27110 32180 30918 gene locus_tag LOCUS_27120 32180 30918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 32932 32177 gene locus_tag LOCUS_27130 gene hisF 32932 32177 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393527.1 protein_id gnl|my_center|LOCUS_27130 33540 32926 gene locus_tag LOCUS_27140 gene hisH 33540 32926 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877134.1 protein_id gnl|my_center|LOCUS_27140 34127 33537 gene locus_tag LOCUS_27150 gene hisB 34127 33537 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009566359.1 protein_id gnl|my_center|LOCUS_27150 35854 34124 gene locus_tag LOCUS_27160 35854 34124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 36741 35866 gene locus_tag LOCUS_27170 gene hisG 36741 35866 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942177.1 protein_id gnl|my_center|LOCUS_27170 37228 38448 gene locus_tag LOCUS_27180 37228 38448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 39416 38556 gene locus_tag LOCUS_27190 39416 38556 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420407.1 protein_id gnl|my_center|LOCUS_27190 40557 39421 gene locus_tag LOCUS_27200 40557 39421 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420308.1 protein_id gnl|my_center|LOCUS_27200 42943 40652 gene locus_tag LOCUS_27210 42943 40652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 44815 43037 gene locus_tag LOCUS_27220 44815 43037 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941068.1 protein_id gnl|my_center|LOCUS_27220 45342 44872 gene locus_tag LOCUS_27230 45342 44872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 48476 45339 gene locus_tag LOCUS_27240 48476 45339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 49637 49218 gene locus_tag LOCUS_27250 49637 49218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 49888 49634 gene locus_tag LOCUS_27260 49888 49634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27260 >Feature sequence041 212 1675 gene locus_tag LOCUS_27270 212 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27270 1776 4679 gene locus_tag LOCUS_27280 1776 4679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 6601 4838 gene locus_tag LOCUS_27290 6601 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 8100 6598 gene locus_tag LOCUS_27300 8100 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 8205 9089 gene locus_tag LOCUS_27310 8205 9089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 9094 9933 gene locus_tag LOCUS_27320 gene rsmI 9094 9933 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_27320 9930 10106 gene locus_tag LOCUS_27330 9930 10106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 10297 10160 gene locus_tag LOCUS_27340 10297 10160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 10538 10822 gene locus_tag LOCUS_27350 10538 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 10819 12708 gene locus_tag LOCUS_27360 gene dxs 10819 12708 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_27360 12705 13451 gene locus_tag LOCUS_27370 12705 13451 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_27370 13448 14581 gene locus_tag LOCUS_27380 13448 14581 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942069.1 protein_id gnl|my_center|LOCUS_27380 14578 16710 gene locus_tag LOCUS_27390 14578 16710 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942070.1 protein_id gnl|my_center|LOCUS_27390 16732 17748 gene locus_tag LOCUS_27400 16732 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_27400 17915 18940 gene locus_tag LOCUS_27410 17915 18940 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_27410 19643 18960 gene locus_tag LOCUS_27420 19643 18960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27420 20761 19664 gene locus_tag LOCUS_27430 20761 19664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 23430 20758 gene locus_tag LOCUS_27440 23430 20758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 24049 23423 gene locus_tag LOCUS_27450 24049 23423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 26559 24046 gene locus_tag LOCUS_27460 26559 24046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 27354 26560 gene locus_tag LOCUS_27470 27354 26560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 28737 27499 gene locus_tag LOCUS_27480 28737 27499 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_27480 31121 28758 gene locus_tag LOCUS_27490 31121 28758 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486377.1 protein_id gnl|my_center|LOCUS_27490 33976 31601 gene locus_tag LOCUS_27500 33976 31601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 34404 34054 gene locus_tag LOCUS_27510 34404 34054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 34885 35922 gene locus_tag LOCUS_27520 34885 35922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 35933 36553 gene locus_tag LOCUS_27530 35933 36553 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_27530 37263 36550 gene locus_tag LOCUS_27540 37263 36550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 38548 37268 gene locus_tag LOCUS_27550 gene rlmD 38548 37268 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103674.1 protein_id gnl|my_center|LOCUS_27550 38641 39942 gene locus_tag LOCUS_27560 38641 39942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 40723 39950 gene locus_tag LOCUS_27570 40723 39950 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_27570 40829 41605 gene locus_tag LOCUS_27580 40829 41605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 42403 41588 gene locus_tag LOCUS_27590 gene deoC 42403 41588 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389958.1 protein_id gnl|my_center|LOCUS_27590 43028 42432 gene locus_tag LOCUS_27600 43028 42432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27600 45329 43212 gene locus_tag LOCUS_27610 45329 43212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence042 340 266 gene locus_tag LOCUS_t00290 340 266 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 504 420 gene locus_tag LOCUS_t00300 504 420 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 613 541 gene locus_tag LOCUS_t00310 613 541 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1226 849 gene locus_tag LOCUS_27620 1226 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 1956 1228 gene locus_tag LOCUS_27630 1956 1228 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_27630 2423 1953 gene locus_tag LOCUS_27640 2423 1953 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310198.1 protein_id gnl|my_center|LOCUS_27640 3442 2420 gene locus_tag LOCUS_27650 gene clpX 3442 2420 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521258.1 protein_id gnl|my_center|LOCUS_27650 3868 3446 gene locus_tag LOCUS_27660 3868 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27660 4490 3849 gene locus_tag LOCUS_27670 4490 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27670 4611 5606 gene locus_tag LOCUS_27680 gene sppA 4611 5606 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682856.1 protein_id gnl|my_center|LOCUS_27680 6228 5611 gene locus_tag LOCUS_27690 6228 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27690 7324 6326 gene locus_tag LOCUS_27700 7324 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 8462 7407 gene locus_tag LOCUS_27710 8462 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 8676 12545 gene locus_tag LOCUS_27720 8676 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27720 12812 15283 gene locus_tag LOCUS_27730 12812 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27730 15311 18247 gene locus_tag LOCUS_27740 15311 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 18352 19839 gene locus_tag LOCUS_27750 18352 19839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 19969 20928 gene locus_tag LOCUS_27760 19969 20928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 20980 22461 gene locus_tag LOCUS_27770 20980 22461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 24196 22469 gene locus_tag LOCUS_27780 24196 22469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 24618 24280 gene locus_tag LOCUS_27790 24618 24280 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393515.1 protein_id gnl|my_center|LOCUS_27790 24717 25934 gene locus_tag LOCUS_27800 24717 25934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27800 26216 27013 gene locus_tag LOCUS_27810 26216 27013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 27507 27091 gene locus_tag LOCUS_27820 27507 27091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27820 27779 27522 gene locus_tag LOCUS_27830 27779 27522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 27971 28552 gene locus_tag LOCUS_27840 27971 28552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142945.1 protein_id gnl|my_center|LOCUS_27840 28539 29462 gene locus_tag LOCUS_27850 28539 29462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142944.1 protein_id gnl|my_center|LOCUS_27850 29586 29511 gene locus_tag LOCUS_t00320 29586 29511 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 29692 29620 gene locus_tag LOCUS_t00330 29692 29620 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 29888 30355 gene locus_tag LOCUS_27860 29888 30355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 30379 30876 gene locus_tag LOCUS_27870 30379 30876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 30949 31434 gene locus_tag LOCUS_27880 30949 31434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27880 31455 31952 gene locus_tag LOCUS_27890 31455 31952 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939592.1 protein_id gnl|my_center|LOCUS_27890 31954 32445 gene locus_tag LOCUS_27900 31954 32445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 32642 32869 gene locus_tag LOCUS_27910 32642 32869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 32940 34103 gene locus_tag LOCUS_27920 gene sat 32940 34103 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141086.1 protein_id gnl|my_center|LOCUS_27920 34117 35499 gene locus_tag LOCUS_27930 34117 35499 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257227.1 protein_id gnl|my_center|LOCUS_27930 35514 36116 gene locus_tag LOCUS_27940 gene cysC 35514 36116 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140515.1 protein_id gnl|my_center|LOCUS_27940 36681 36196 gene locus_tag LOCUS_27950 36681 36196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 36869 38092 gene locus_tag LOCUS_27960 36869 38092 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_27960 38694 38134 gene locus_tag LOCUS_27970 38694 38134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27970 40500 38704 gene locus_tag LOCUS_27980 40500 38704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27980 41332 40586 gene locus_tag LOCUS_27990 41332 40586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 42126 41329 gene locus_tag LOCUS_28000 42126 41329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 43660 42155 gene locus_tag LOCUS_28010 43660 42155 CDS product fatty acid--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055172.1 protein_id gnl|my_center|LOCUS_28010 44517 43672 gene locus_tag LOCUS_28020 44517 43672 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195982.1 protein_id gnl|my_center|LOCUS_28020 44723 45403 gene locus_tag LOCUS_28030 44723 45403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 45881 46072 gene locus_tag LOCUS_28040 45881 46072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence043 910 125 gene locus_tag LOCUS_28050 gene soj 910 125 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_28050 1114 1039 gene locus_tag LOCUS_t00340 1114 1039 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1273 1926 gene locus_tag LOCUS_28060 1273 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2048 3265 gene locus_tag LOCUS_28070 2048 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 3278 3613 gene locus_tag LOCUS_28080 3278 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 4260 3619 gene locus_tag LOCUS_28090 gene nth 4260 3619 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230550.1 protein_id gnl|my_center|LOCUS_28090 5978 4257 gene locus_tag LOCUS_28100 gene polX 5978 4257 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_28100 7047 6049 gene locus_tag LOCUS_28110 7047 6049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28110 9590 7044 gene locus_tag LOCUS_28120 9590 7044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28120 9781 9855 gene locus_tag LOCUS_t00350 9781 9855 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 9864 9938 gene locus_tag LOCUS_t00360 9864 9938 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10691 10008 gene locus_tag LOCUS_28130 10691 10008 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356907.1 protein_id gnl|my_center|LOCUS_28130 10774 12252 gene locus_tag LOCUS_28140 gene hemL 10774 12252 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704436.1 protein_id gnl|my_center|LOCUS_28140 12266 12937 gene locus_tag LOCUS_28150 12266 12937 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460450.1 protein_id gnl|my_center|LOCUS_28150 12961 14568 gene locus_tag LOCUS_28160 12961 14568 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878821.1 protein_id gnl|my_center|LOCUS_28160 15408 14653 gene locus_tag LOCUS_28170 15408 14653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28170 15693 15499 gene locus_tag LOCUS_28180 15693 15499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 17407 16121 gene locus_tag LOCUS_28190 17407 16121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 17695 20319 gene locus_tag LOCUS_28200 17695 20319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 21357 23399 gene locus_tag LOCUS_28210 21357 23399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 25171 23501 gene locus_tag LOCUS_28220 25171 23501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 25698 25201 gene locus_tag LOCUS_28230 25698 25201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28230 25874 27652 gene locus_tag LOCUS_28240 25874 27652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 27689 29713 gene locus_tag LOCUS_28250 27689 29713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 31366 30020 gene locus_tag LOCUS_28260 31366 30020 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454549.1 protein_id gnl|my_center|LOCUS_28260 31709 34123 gene locus_tag LOCUS_28270 31709 34123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 34171 34674 gene locus_tag LOCUS_28280 34171 34674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 34681 35100 gene locus_tag LOCUS_28290 34681 35100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28290 35515 35078 gene locus_tag LOCUS_28300 35515 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 36141 35515 gene locus_tag LOCUS_28310 36141 35515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 37917 36202 gene locus_tag LOCUS_28320 37917 36202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 38739 37927 gene locus_tag LOCUS_28330 38739 37927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 39574 38702 gene locus_tag LOCUS_28340 39574 38702 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_28340 40296 39571 gene locus_tag LOCUS_28350 gene pyrF 40296 39571 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435818.1 protein_id gnl|my_center|LOCUS_28350 42004 40283 gene locus_tag LOCUS_28360 42004 40283 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_28360 43092 42010 gene locus_tag LOCUS_28370 gene ispG 43092 42010 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541503.1 protein_id gnl|my_center|LOCUS_28370 44468 43089 gene locus_tag LOCUS_28380 44468 43089 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_28380 45333 44767 gene locus_tag LOCUS_28390 45333 44767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28390 >Feature sequence044 1142 168 gene locus_tag LOCUS_28400 1142 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 2584 1148 gene locus_tag LOCUS_28410 2584 1148 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_28410 3649 2588 gene locus_tag LOCUS_28420 3649 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 4088 3651 gene locus_tag LOCUS_28430 4088 3651 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811622.1 protein_id gnl|my_center|LOCUS_28430 4295 4798 gene locus_tag LOCUS_28440 4295 4798 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941529.1 protein_id gnl|my_center|LOCUS_28440 4795 5085 gene locus_tag LOCUS_28450 4795 5085 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_28450 5082 6062 gene locus_tag LOCUS_28460 5082 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 7543 6356 gene locus_tag LOCUS_28470 7543 6356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 7671 8567 gene locus_tag LOCUS_28480 7671 8567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 8564 10009 gene locus_tag LOCUS_28490 8564 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 10006 10584 gene locus_tag LOCUS_28500 10006 10584 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167942160.1 protein_id gnl|my_center|LOCUS_28500 10587 11621 gene locus_tag LOCUS_28510 10587 11621 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940262.1 protein_id gnl|my_center|LOCUS_28510 11618 12820 gene locus_tag LOCUS_28520 11618 12820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 12820 13932 gene locus_tag LOCUS_28530 12820 13932 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_28530 13913 15427 gene locus_tag LOCUS_28540 13913 15427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 15424 16512 gene locus_tag LOCUS_28550 15424 16512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 16509 17660 gene locus_tag LOCUS_28560 16509 17660 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_28560 17653 18696 gene locus_tag LOCUS_28570 gene waaF 17653 18696 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530068.1 protein_id gnl|my_center|LOCUS_28570 18693 20555 gene locus_tag LOCUS_28580 18693 20555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 20527 21564 gene locus_tag LOCUS_28590 20527 21564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 21561 22298 gene locus_tag LOCUS_28600 21561 22298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 22303 23424 gene locus_tag LOCUS_28610 22303 23424 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202936.1 protein_id gnl|my_center|LOCUS_28610 23489 23962 gene locus_tag LOCUS_28620 gene ptsN 23489 23962 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387770.1 protein_id gnl|my_center|LOCUS_28620 23991 24314 gene locus_tag LOCUS_28630 23991 24314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 24349 25572 gene locus_tag LOCUS_28640 24349 25572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 25569 26870 gene locus_tag LOCUS_28650 25569 26870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 26938 27693 gene locus_tag LOCUS_28660 26938 27693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 27729 28943 gene locus_tag LOCUS_28670 27729 28943 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259590.1 protein_id gnl|my_center|LOCUS_28670 28940 29779 gene locus_tag LOCUS_28680 28940 29779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28680 29834 30661 gene locus_tag LOCUS_28690 gene proC 29834 30661 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943177.1 protein_id gnl|my_center|LOCUS_28690 30699 31202 gene locus_tag LOCUS_28700 30699 31202 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_28700 32537 31221 gene locus_tag LOCUS_28710 32537 31221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 33465 32638 gene locus_tag LOCUS_28720 33465 32638 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_28720 34116 33670 gene locus_tag LOCUS_28730 gene ruvX 34116 33670 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393142.1 protein_id gnl|my_center|LOCUS_28730 35206 34133 gene locus_tag LOCUS_28740 35206 34133 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_28740 35888 35226 gene locus_tag LOCUS_28750 35888 35226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 36772 35885 gene locus_tag LOCUS_28760 36772 35885 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_28760 37539 36769 gene locus_tag LOCUS_28770 37539 36769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 40426 37706 gene locus_tag LOCUS_28780 gene ppdK 40426 37706 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_28780 43563 40558 gene locus_tag LOCUS_28790 43563 40558 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_28790 44984 43641 gene locus_tag LOCUS_28800 gene gdhA 44984 43641 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_28800 >Feature sequence045 385 104 gene locus_tag LOCUS_28810 385 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 1313 270 gene locus_tag LOCUS_28820 gene cas1e 1313 270 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_28820 2156 1380 gene locus_tag LOCUS_28830 2156 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28830 3148 2153 gene locus_tag LOCUS_28840 3148 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 4377 3262 gene locus_tag LOCUS_28850 gene cas7e 4377 3262 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_28850 4871 4380 gene locus_tag LOCUS_28860 4871 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 6328 4868 gene locus_tag LOCUS_28870 6328 4868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 8066 6738 gene locus_tag LOCUS_28880 8066 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 8293 9054 gene locus_tag LOCUS_28890 gene tolQ 8293 9054 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_28890 9058 9480 gene locus_tag LOCUS_28900 gene tolR 9058 9480 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940705.1 protein_id gnl|my_center|LOCUS_28900 9487 10239 gene locus_tag LOCUS_28910 9487 10239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28910 10261 11658 gene locus_tag LOCUS_28920 gene tolB 10261 11658 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940703.1 protein_id gnl|my_center|LOCUS_28920 11744 12439 gene locus_tag LOCUS_28930 11744 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28930 12728 13570 gene locus_tag LOCUS_28940 12728 13570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28940 13676 14419 gene locus_tag LOCUS_28950 13676 14419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28950 18079 14486 gene locus_tag LOCUS_28960 gene smc 18079 14486 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941791.1 protein_id gnl|my_center|LOCUS_28960 20596 19406 gene locus_tag LOCUS_28970 20596 19406 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943373.1 protein_id gnl|my_center|LOCUS_28970 20757 21722 gene locus_tag LOCUS_28980 20757 21722 CDS product bifunctional methionine sulfoxide reductase B/A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932947.1 protein_id gnl|my_center|LOCUS_28980 23516 21729 gene locus_tag LOCUS_28990 23516 21729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 23920 23639 gene locus_tag LOCUS_29000 23920 23639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29000 24887 24054 gene locus_tag LOCUS_29010 24887 24054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29010 25001 25714 gene locus_tag LOCUS_29020 25001 25714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 25815 27962 gene locus_tag LOCUS_29030 25815 27962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 28102 29082 gene locus_tag LOCUS_29040 28102 29082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 29543 29079 gene locus_tag LOCUS_29050 29543 29079 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229257.1 protein_id gnl|my_center|LOCUS_29050 30809 29595 gene locus_tag LOCUS_29060 30809 29595 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020586886.1 protein_id gnl|my_center|LOCUS_29060 32170 30806 gene locus_tag LOCUS_29070 32170 30806 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_29070 32943 32167 gene locus_tag LOCUS_29080 32943 32167 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_29080 33066 34157 gene locus_tag LOCUS_29090 33066 34157 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459676.1 protein_id gnl|my_center|LOCUS_29090 34337 36703 gene locus_tag LOCUS_29100 34337 36703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29100 36784 39849 gene locus_tag LOCUS_29110 36784 39849 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943139.1 protein_id gnl|my_center|LOCUS_29110 41004 39898 gene locus_tag LOCUS_29120 41004 39898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29120 41138 41542 gene locus_tag LOCUS_29130 41138 41542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29130 41539 43152 gene locus_tag LOCUS_29140 41539 43152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29140 44412 43162 gene locus_tag LOCUS_29150 gene pepT 44412 43162 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401270.1 protein_id gnl|my_center|LOCUS_29150 >Feature sequence046 1549 665 gene locus_tag LOCUS_29160 1549 665 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_29160 2316 1546 gene locus_tag LOCUS_29170 2316 1546 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920702.1 protein_id gnl|my_center|LOCUS_29170 2949 2329 gene locus_tag LOCUS_29180 2949 2329 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_29180 3715 3092 gene locus_tag LOCUS_29190 3715 3092 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933381.1 protein_id gnl|my_center|LOCUS_29190 4659 3868 gene locus_tag LOCUS_29200 4659 3868 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_29200 5733 4675 gene locus_tag LOCUS_29210 gene arsB 5733 4675 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000826560.1 protein_id gnl|my_center|LOCUS_29210 6158 5745 gene locus_tag LOCUS_29220 6158 5745 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_29220 6487 6164 gene locus_tag LOCUS_29230 6487 6164 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061032.1 protein_id gnl|my_center|LOCUS_29230 7398 6919 gene locus_tag LOCUS_29240 7398 6919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 8093 7395 gene locus_tag LOCUS_29250 8093 7395 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943589.1 protein_id gnl|my_center|LOCUS_29250 8495 8094 gene locus_tag LOCUS_29260 8495 8094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 8731 8492 gene locus_tag LOCUS_29270 8731 8492 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545531.1 protein_id gnl|my_center|LOCUS_29270 8977 8747 gene locus_tag LOCUS_29280 8977 8747 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_29280 10159 8990 gene locus_tag LOCUS_29290 10159 8990 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870216.1 protein_id gnl|my_center|LOCUS_29290 10538 10227 gene locus_tag LOCUS_29300 10538 10227 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938934.1 protein_id gnl|my_center|LOCUS_29300 10870 10721 gene locus_tag LOCUS_29310 10870 10721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29310 11015 12364 gene locus_tag LOCUS_29320 gene orpR 11015 12364 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_29320 12951 13310 gene locus_tag LOCUS_29330 12951 13310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29330 13588 14142 gene locus_tag LOCUS_29340 gene tsaA 13588 14142 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_29340 14139 14993 gene locus_tag LOCUS_29350 14139 14993 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_29350 14993 15553 gene locus_tag LOCUS_29360 14993 15553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29360 15550 16416 gene locus_tag LOCUS_29370 15550 16416 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_29370 16406 17407 gene locus_tag LOCUS_29380 16406 17407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 17612 17971 gene locus_tag LOCUS_29390 17612 17971 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_29390 18064 19236 gene locus_tag LOCUS_29400 18064 19236 CDS product iron-sulfur cluster carrier protein MrpORP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294665.1 protein_id gnl|my_center|LOCUS_29400 19258 19716 gene locus_tag LOCUS_29410 19258 19716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29410 19832 20530 gene locus_tag LOCUS_29420 19832 20530 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_29420 20523 21182 gene locus_tag LOCUS_29430 20523 21182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29430 21184 22056 gene locus_tag LOCUS_29440 21184 22056 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925959.1 protein_id gnl|my_center|LOCUS_29440 22082 22252 gene locus_tag LOCUS_29450 22082 22252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29450 22173 23342 gene locus_tag LOCUS_29460 22173 23342 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022500.1 protein_id gnl|my_center|LOCUS_29460 23917 23690 gene locus_tag LOCUS_29470 23917 23690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 24255 23914 gene locus_tag LOCUS_29480 24255 23914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29480 24196 24609 gene locus_tag LOCUS_29490 24196 24609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 25359 24643 gene locus_tag LOCUS_29500 25359 24643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 25893 26081 gene locus_tag LOCUS_29510 25893 26081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29510 26078 28105 gene locus_tag LOCUS_29520 26078 28105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29520 29947 28280 gene locus_tag LOCUS_29530 29947 28280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29530 31567 30590 gene locus_tag LOCUS_29540 31567 30590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 32110 33960 gene locus_tag LOCUS_29550 32110 33960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 34518 33973 gene locus_tag LOCUS_29560 34518 33973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 35070 34711 gene locus_tag LOCUS_29570 35070 34711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29570 35251 36246 gene locus_tag LOCUS_29580 35251 36246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29580 36455 37612 gene locus_tag LOCUS_29590 gene hemW 36455 37612 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940708.1 protein_id gnl|my_center|LOCUS_29590 39405 37609 gene locus_tag LOCUS_29600 gene lepA 39405 37609 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957093.1 protein_id gnl|my_center|LOCUS_29600 40056 39421 gene locus_tag LOCUS_29610 40056 39421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29610 41073 40150 gene locus_tag LOCUS_29620 41073 40150 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_29620 42751 41159 gene locus_tag LOCUS_29630 42751 41159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29630 44173 42758 gene locus_tag LOCUS_29640 44173 42758 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence047 1250 360 gene locus_tag LOCUS_29650 1250 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29650 2248 1247 gene locus_tag LOCUS_29660 2248 1247 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962309.1 protein_id gnl|my_center|LOCUS_29660 3232 2249 gene locus_tag LOCUS_29670 3232 2249 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_29670 4251 3229 gene locus_tag LOCUS_29680 4251 3229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29680 5126 4248 gene locus_tag LOCUS_29690 5126 4248 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_29690 6141 5146 gene locus_tag LOCUS_29700 6141 5146 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931757.1 protein_id gnl|my_center|LOCUS_29700 8231 6354 gene locus_tag LOCUS_29710 8231 6354 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024488.1 protein_id gnl|my_center|LOCUS_29710 8738 8274 gene locus_tag LOCUS_29720 8738 8274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29720 9540 9289 gene locus_tag LOCUS_29730 9540 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29730 10535 9537 gene locus_tag LOCUS_29740 gene dusB 10535 9537 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391694.1 protein_id gnl|my_center|LOCUS_29740 11503 10538 gene locus_tag LOCUS_29750 gene selD 11503 10538 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768338.1 protein_id gnl|my_center|LOCUS_29750 11724 12656 gene locus_tag LOCUS_29760 gene mdh 11724 12656 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_29760 13328 12828 gene locus_tag LOCUS_29770 gene rimM 13328 12828 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081983.1 protein_id gnl|my_center|LOCUS_29770 13595 13365 gene locus_tag LOCUS_29780 13595 13365 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_29780 13904 13650 gene locus_tag LOCUS_29790 gene rpsP 13904 13650 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002940682.1 protein_id gnl|my_center|LOCUS_29790 15382 13964 gene locus_tag LOCUS_29800 gene ffh 15382 13964 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_29800 15651 16331 gene locus_tag LOCUS_29810 15651 16331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29810 17080 16451 gene locus_tag LOCUS_29820 17080 16451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29820 17910 17026 gene locus_tag LOCUS_29830 17910 17026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29830 20841 17932 gene locus_tag LOCUS_29840 20841 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29840 21042 21236 gene locus_tag LOCUS_29850 21042 21236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29850 21359 22120 gene locus_tag LOCUS_29860 21359 22120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29860 22199 22492 gene locus_tag LOCUS_29870 22199 22492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29870 23823 22594 gene locus_tag LOCUS_29880 23823 22594 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944609.1 protein_id gnl|my_center|LOCUS_29880 24278 23829 gene locus_tag LOCUS_29890 24278 23829 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546500.1 protein_id gnl|my_center|LOCUS_29890 24812 24288 gene locus_tag LOCUS_29900 24812 24288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 24717 24935 gene locus_tag LOCUS_29910 24717 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 25203 26036 gene locus_tag LOCUS_29920 25203 26036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 26320 26087 gene locus_tag LOCUS_29930 26320 26087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29930 26492 27451 gene locus_tag LOCUS_29940 26492 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 28237 27467 gene locus_tag LOCUS_29950 28237 27467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29950 28845 28507 gene locus_tag LOCUS_29960 28845 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29960 29367 30887 gene locus_tag LOCUS_29970 29367 30887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29970 30901 33240 gene locus_tag LOCUS_29980 30901 33240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29980 33237 40508 gene locus_tag LOCUS_29990 33237 40508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29990 40518 42029 gene locus_tag LOCUS_30000 40518 42029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30000 42026 42865 gene locus_tag LOCUS_30010 42026 42865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30010 >Feature sequence048 259 1791 gene locus_tag LOCUS_30020 259 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30020 3636 1798 gene locus_tag LOCUS_30030 3636 1798 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409258.1 protein_id gnl|my_center|LOCUS_30030 6463 3719 gene locus_tag LOCUS_30040 6463 3719 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259718.1 protein_id gnl|my_center|LOCUS_30040 7138 6680 gene locus_tag LOCUS_30050 7138 6680 CDS product deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002988493.1 protein_id gnl|my_center|LOCUS_30050 10604 7170 gene locus_tag LOCUS_30060 10604 7170 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_30060 11668 10829 gene locus_tag LOCUS_30070 gene thyX 11668 10829 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681263.1 protein_id gnl|my_center|LOCUS_30070 12141 11815 gene locus_tag LOCUS_30080 12141 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30080 13415 12153 gene locus_tag LOCUS_30090 13415 12153 CDS product [FeFe] hydrogenase, group A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939057.1 protein_id gnl|my_center|LOCUS_30090 14322 13408 gene locus_tag LOCUS_30100 14322 13408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 16294 14369 gene locus_tag LOCUS_30110 16294 14369 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_30110 17525 16329 gene locus_tag LOCUS_30120 17525 16329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30120 18040 17522 gene locus_tag LOCUS_30130 gene nuoE 18040 17522 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380120.1 protein_id gnl|my_center|LOCUS_30130 18421 18044 gene locus_tag LOCUS_30140 18421 18044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 18654 19376 gene locus_tag LOCUS_30150 18654 19376 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005063534.1 protein_id gnl|my_center|LOCUS_30150 19518 19637 gene locus_tag LOCUS_30160 19518 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30160 20081 19650 gene locus_tag LOCUS_30170 20081 19650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30170 20218 21321 gene locus_tag LOCUS_30180 20218 21321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 21439 24657 gene locus_tag LOCUS_30190 21439 24657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 28065 25621 gene locus_tag LOCUS_30200 28065 25621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 30147 28822 gene locus_tag LOCUS_30210 30147 28822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 30274 30897 gene locus_tag LOCUS_30220 30274 30897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30220 31046 31750 gene locus_tag LOCUS_30230 31046 31750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30230 31840 35181 gene locus_tag LOCUS_30240 31840 35181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30240 36044 35265 gene locus_tag LOCUS_30250 36044 35265 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921905.1 protein_id gnl|my_center|LOCUS_30250 36262 37176 gene locus_tag LOCUS_30260 36262 37176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 37992 37222 gene locus_tag LOCUS_30270 37992 37222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30270 39032 38004 gene locus_tag LOCUS_30280 39032 38004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 39792 39175 gene locus_tag LOCUS_30290 39792 39175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30290 40605 39835 gene locus_tag LOCUS_30300 40605 39835 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088485.1 protein_id gnl|my_center|LOCUS_30300 40932 41201 gene locus_tag LOCUS_30310 40932 41201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30310 41222 41803 gene locus_tag LOCUS_30320 41222 41803 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133795409.1 protein_id gnl|my_center|LOCUS_30320 41797 42972 gene locus_tag LOCUS_30330 41797 42972 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_30330 >Feature sequence049 1325 423 gene locus_tag LOCUS_30340 1325 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 3004 1556 gene locus_tag LOCUS_30350 3004 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 3262 4683 gene locus_tag LOCUS_30360 3262 4683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 4721 6430 gene locus_tag LOCUS_30370 4721 6430 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480032.1 protein_id gnl|my_center|LOCUS_30370 6523 9162 gene locus_tag LOCUS_30380 6523 9162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30380 9684 9175 gene locus_tag LOCUS_30390 9684 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30390 10355 9837 gene locus_tag LOCUS_30400 10355 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30400 10805 11545 gene locus_tag LOCUS_30410 gene bfmR 10805 11545 CDS product response regulator transcription factor BfmR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076440.1 protein_id gnl|my_center|LOCUS_30410 11542 12837 gene locus_tag LOCUS_30420 11542 12837 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082362.1 protein_id gnl|my_center|LOCUS_30420 12971 14326 gene locus_tag LOCUS_30430 12971 14326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30430 14373 15596 gene locus_tag LOCUS_30440 14373 15596 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_30440 15606 16352 gene locus_tag LOCUS_30450 15606 16352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_30450 16349 17578 gene locus_tag LOCUS_30460 16349 17578 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941165.1 protein_id gnl|my_center|LOCUS_30460 17759 20101 gene locus_tag LOCUS_30470 gene secA2 17759 20101 CDS product accessory Sec system translocase SecA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223120.1 protein_id gnl|my_center|LOCUS_30470 20299 20225 gene locus_tag LOCUS_t00370 20299 20225 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20426 20353 gene locus_tag LOCUS_t00380 20426 20353 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 20792 22756 gene locus_tag LOCUS_30480 gene acs 20792 22756 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113911.1 protein_id gnl|my_center|LOCUS_30480 25188 23083 gene locus_tag LOCUS_30490 25188 23083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30490 26080 25589 gene locus_tag LOCUS_30500 26080 25589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 26742 26077 gene locus_tag LOCUS_30510 26742 26077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 26781 28091 gene locus_tag LOCUS_30520 26781 28091 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140466.1 protein_id gnl|my_center|LOCUS_30520 28088 29686 gene locus_tag LOCUS_30530 28088 29686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 29841 31157 gene locus_tag LOCUS_30540 29841 31157 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958607.1 protein_id gnl|my_center|LOCUS_30540 32388 31177 gene locus_tag LOCUS_30550 gene icd 32388 31177 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_30550 32630 33943 gene locus_tag LOCUS_30560 32630 33943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 34009 36303 gene locus_tag LOCUS_30570 34009 36303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 36563 37105 gene locus_tag LOCUS_30580 36563 37105 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948224.1 protein_id gnl|my_center|LOCUS_30580 37102 37719 gene locus_tag LOCUS_30590 37102 37719 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392954.1 protein_id gnl|my_center|LOCUS_30590 37727 38503 gene locus_tag LOCUS_30600 37727 38503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30600 38569 39228 gene locus_tag LOCUS_30610 38569 39228 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728469.1 protein_id gnl|my_center|LOCUS_30610 40629 39244 gene locus_tag LOCUS_30620 40629 39244 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_30620 42459 40642 gene locus_tag LOCUS_30630 42459 40642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30630 >Feature sequence050 29 265 gene locus_tag LOCUS_30640 29 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 1346 456 gene locus_tag LOCUS_30650 1346 456 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228665.1 protein_id gnl|my_center|LOCUS_30650 2337 1402 gene locus_tag LOCUS_30660 2337 1402 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942861.1 protein_id gnl|my_center|LOCUS_30660 10445 2337 gene locus_tag LOCUS_30670 10445 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30670 11707 10631 gene locus_tag LOCUS_30680 11707 10631 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942664.1 protein_id gnl|my_center|LOCUS_30680 12143 11697 gene locus_tag LOCUS_30690 gene aroQ 12143 11697 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707111.1 protein_id gnl|my_center|LOCUS_30690 13141 12143 gene locus_tag LOCUS_30700 13141 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30700 14770 13382 gene locus_tag LOCUS_30710 14770 13382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 14835 16304 gene locus_tag LOCUS_30720 14835 16304 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_30720 16815 16279 gene locus_tag LOCUS_30730 16815 16279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30730 17480 16812 gene locus_tag LOCUS_30740 17480 16812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 18523 17477 gene locus_tag LOCUS_30750 18523 17477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30750 19439 18609 gene locus_tag LOCUS_30760 19439 18609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30760 20975 19500 gene locus_tag LOCUS_30770 20975 19500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30770 21596 21015 gene locus_tag LOCUS_30780 21596 21015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 22272 21619 gene locus_tag LOCUS_30790 22272 21619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30790 22924 22331 gene locus_tag LOCUS_30800 22924 22331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 23946 22921 gene locus_tag LOCUS_30810 gene pilM 23946 22921 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_30810 28026 24316 gene locus_tag LOCUS_30820 28026 24316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30820 30579 28036 gene locus_tag LOCUS_30830 30579 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30830 31206 30589 gene locus_tag LOCUS_30840 31206 30589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 31914 31288 gene locus_tag LOCUS_30850 31914 31288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30850 33472 32087 gene locus_tag LOCUS_30860 33472 32087 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942684.1 protein_id gnl|my_center|LOCUS_30860 35138 33465 gene locus_tag LOCUS_30870 35138 33465 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942685.1 protein_id gnl|my_center|LOCUS_30870 35907 35128 gene locus_tag LOCUS_30880 35907 35128 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_30880 37561 35945 gene locus_tag LOCUS_30890 37561 35945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30890 37618 39375 gene locus_tag LOCUS_30900 37618 39375 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_30900 39490 40689 gene locus_tag LOCUS_30910 39490 40689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 41116 40712 gene locus_tag LOCUS_30920 41116 40712 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029785.1 protein_id gnl|my_center|LOCUS_30920 41553 41113 gene locus_tag LOCUS_30930 41553 41113 CDS product MaoC family dehydratase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034285884.1 protein_id gnl|my_center|LOCUS_30930 41750 42232 gene locus_tag LOCUS_30940 41750 42232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 >Feature sequence051 3 272 gene locus_tag LOCUS_30950 3 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30950 418 909 gene locus_tag LOCUS_30960 418 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30960 910 2490 gene locus_tag LOCUS_30970 910 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 2838 4535 gene locus_tag LOCUS_30980 2838 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 4549 6447 gene locus_tag LOCUS_30990 4549 6447 CDS product DUF3604 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883150.1 protein_id gnl|my_center|LOCUS_30990 8926 6482 gene locus_tag LOCUS_31000 gene gyrB 8926 6482 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_31000 10171 9317 gene locus_tag LOCUS_31010 10171 9317 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_31010 12565 10184 gene locus_tag LOCUS_31020 12565 10184 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202125.1 protein_id gnl|my_center|LOCUS_31020 14015 12645 gene locus_tag LOCUS_31030 14015 12645 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_31030 14202 17252 gene locus_tag LOCUS_31040 14202 17252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 17284 17511 gene locus_tag LOCUS_31050 17284 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 17617 19038 gene locus_tag LOCUS_31060 17617 19038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31060 19172 21151 gene locus_tag LOCUS_31070 19172 21151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31070 21144 21728 gene locus_tag LOCUS_31080 21144 21728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 22907 21813 gene locus_tag LOCUS_31090 22907 21813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 24699 23227 gene locus_tag LOCUS_31100 gene cysS 24699 23227 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943976.1 protein_id gnl|my_center|LOCUS_31100 25675 24785 gene locus_tag LOCUS_31110 25675 24785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31110 26679 25747 gene locus_tag LOCUS_31120 26679 25747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31120 28172 26859 gene locus_tag LOCUS_31130 28172 26859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 29024 28188 gene locus_tag LOCUS_31140 gene hpnK 29024 28188 CDS product hopanoid biosynthesis-associated protein HpnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192157.1 protein_id gnl|my_center|LOCUS_31140 29775 29017 gene locus_tag LOCUS_31150 29775 29017 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257033.1 protein_id gnl|my_center|LOCUS_31150 33171 29794 gene locus_tag LOCUS_31160 33171 29794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 35659 33353 gene locus_tag LOCUS_31170 35659 33353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 37083 35737 gene locus_tag LOCUS_31180 37083 35737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31180 37409 39664 gene locus_tag LOCUS_31190 37409 39664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31190 39690 40295 gene locus_tag LOCUS_31200 39690 40295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31200 >Feature sequence052 2363 999 gene locus_tag LOCUS_31210 2363 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31210 3591 2452 gene locus_tag LOCUS_31220 3591 2452 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249077.1 protein_id gnl|my_center|LOCUS_31220 3866 3588 gene locus_tag LOCUS_31230 3866 3588 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064609.1 protein_id gnl|my_center|LOCUS_31230 5325 3871 gene locus_tag LOCUS_31240 5325 3871 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877784.1 protein_id gnl|my_center|LOCUS_31240 6885 5329 gene locus_tag LOCUS_31250 gene pruA 6885 5329 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257665.1 protein_id gnl|my_center|LOCUS_31250 7974 7225 gene locus_tag LOCUS_31260 7974 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 8092 10794 gene locus_tag LOCUS_31270 8092 10794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31270 10889 11554 gene locus_tag LOCUS_31280 gene mepA 10889 11554 CDS product penicillin-insensitive murein endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819795.1 protein_id gnl|my_center|LOCUS_31280 11597 13615 gene locus_tag LOCUS_31290 11597 13615 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517762.1 protein_id gnl|my_center|LOCUS_31290 14232 13603 gene locus_tag LOCUS_31300 14232 13603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 14381 15031 gene locus_tag LOCUS_31310 14381 15031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 15052 15654 gene locus_tag LOCUS_31320 15052 15654 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_31320 15654 16205 gene locus_tag LOCUS_31330 15654 16205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31330 16202 16792 gene locus_tag LOCUS_31340 gene yedF 16202 16792 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_31340 16796 17956 gene locus_tag LOCUS_31350 16796 17956 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392916.1 protein_id gnl|my_center|LOCUS_31350 17953 18204 gene locus_tag LOCUS_31360 17953 18204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31360 18201 20117 gene locus_tag LOCUS_31370 gene selB 18201 20117 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940778.1 protein_id gnl|my_center|LOCUS_31370 20977 20153 gene locus_tag LOCUS_31380 20977 20153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31380 23482 21092 gene locus_tag LOCUS_31390 23482 21092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 23687 24667 gene locus_tag LOCUS_31400 gene pqqE 23687 24667 CDS product pyrroloquinoline quinone biosynthesis protein PqqE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532078.1 protein_id gnl|my_center|LOCUS_31400 24667 25770 gene locus_tag LOCUS_31410 24667 25770 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080577263.1 protein_id gnl|my_center|LOCUS_31410 25770 26594 gene locus_tag LOCUS_31420 25770 26594 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943148.1 protein_id gnl|my_center|LOCUS_31420 26638 28068 gene locus_tag LOCUS_31430 26638 28068 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259098.1 protein_id gnl|my_center|LOCUS_31430 28154 29587 gene locus_tag LOCUS_31440 gene aspA 28154 29587 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384943.1 protein_id gnl|my_center|LOCUS_31440 29786 31363 gene locus_tag LOCUS_31450 29786 31363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31450 31395 32873 gene locus_tag LOCUS_31460 31395 32873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 34175 33165 gene locus_tag LOCUS_31470 34175 33165 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_31470 35923 34184 gene locus_tag LOCUS_31480 35923 34184 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_31480 37343 36057 gene locus_tag LOCUS_31490 37343 36057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31490 39603 37501 gene locus_tag LOCUS_31500 39603 37501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence053 1736 111 gene locus_tag LOCUS_31510 gene bgaS 1736 111 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_31510 2041 2379 gene locus_tag LOCUS_31520 2041 2379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31520 2493 3521 gene locus_tag LOCUS_31530 2493 3521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31530 3812 3591 gene locus_tag LOCUS_31540 3812 3591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31540 4209 3868 gene locus_tag LOCUS_31550 4209 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 4786 4238 gene locus_tag LOCUS_31560 4786 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31560 5960 4929 gene locus_tag LOCUS_31570 5960 4929 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038545.1 protein_id gnl|my_center|LOCUS_31570 7456 5993 gene locus_tag LOCUS_31580 7456 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 8351 7551 gene locus_tag LOCUS_31590 8351 7551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 9732 8356 gene locus_tag LOCUS_31600 gene mgtE 9732 8356 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432938.1 protein_id gnl|my_center|LOCUS_31600 10136 11212 gene locus_tag LOCUS_31610 gene rsgA 10136 11212 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459864.1 protein_id gnl|my_center|LOCUS_31610 11351 12613 gene locus_tag LOCUS_31620 11351 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31620 13036 12620 gene locus_tag LOCUS_31630 13036 12620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31630 13933 13115 gene locus_tag LOCUS_31640 13933 13115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274430.1 protein_id gnl|my_center|LOCUS_31640 14093 15517 gene locus_tag LOCUS_31650 14093 15517 CDS product cation-efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939066.1 protein_id gnl|my_center|LOCUS_31650 15607 16569 gene locus_tag LOCUS_31660 15607 16569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 16755 16671 gene locus_tag LOCUS_t00390 16755 16671 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 16882 16810 gene locus_tag LOCUS_t00400 16882 16810 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18955 16973 gene locus_tag LOCUS_31670 18955 16973 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938364.1 protein_id gnl|my_center|LOCUS_31670 20574 19066 gene locus_tag LOCUS_31680 20574 19066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31680 21394 21101 gene locus_tag LOCUS_31690 21394 21101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31690 21978 21376 gene locus_tag LOCUS_31700 21978 21376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 22332 22165 gene locus_tag LOCUS_31710 22332 22165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31710 22273 22596 gene locus_tag LOCUS_31720 22273 22596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 23923 25254 gene locus_tag LOCUS_31730 gene dnaA 23923 25254 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000428017.1 protein_id gnl|my_center|LOCUS_31730 25486 26604 gene locus_tag LOCUS_31740 gene dnaN 25486 26604 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_31740 26668 27036 gene locus_tag LOCUS_31750 26668 27036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31750 27044 29083 gene locus_tag LOCUS_31760 27044 29083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 29271 31859 gene locus_tag LOCUS_31770 29271 31859 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942746.1 protein_id gnl|my_center|LOCUS_31770 31856 32764 gene locus_tag LOCUS_31780 31856 32764 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939546.1 protein_id gnl|my_center|LOCUS_31780 32851 33516 gene locus_tag LOCUS_31790 32851 33516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31790 34117 33482 gene locus_tag LOCUS_31800 34117 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 36076 34208 gene locus_tag LOCUS_31810 gene mnmG 36076 34208 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_31810 37408 36323 gene locus_tag LOCUS_31820 37408 36323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 38594 37446 gene locus_tag LOCUS_31830 38594 37446 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_31830 >Feature sequence054 323 1483 gene locus_tag LOCUS_31840 323 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 1490 2794 gene locus_tag LOCUS_31850 1490 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 2797 2922 gene locus_tag LOCUS_31860 2797 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 3131 3445 gene locus_tag LOCUS_31870 gene trxA 3131 3445 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_31870 3604 5094 gene locus_tag LOCUS_31880 3604 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31880 5118 5843 gene locus_tag LOCUS_31890 5118 5843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31890 5891 6376 gene locus_tag LOCUS_31900 5891 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 6516 9575 gene locus_tag LOCUS_31910 6516 9575 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267231.1 protein_id gnl|my_center|LOCUS_31910 9773 11056 gene locus_tag LOCUS_31920 9773 11056 CDS product double-cubane-cluster-containing anaerobic reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545072.1 protein_id gnl|my_center|LOCUS_31920 11945 11436 gene locus_tag LOCUS_31930 11945 11436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31930 15175 12056 gene locus_tag LOCUS_31940 15175 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 15835 15293 gene locus_tag LOCUS_31950 15835 15293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31950 17030 15945 gene locus_tag LOCUS_31960 17030 15945 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388877.1 protein_id gnl|my_center|LOCUS_31960 18117 17164 gene locus_tag LOCUS_31970 18117 17164 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839121.1 protein_id gnl|my_center|LOCUS_31970 19875 18181 gene locus_tag LOCUS_31980 19875 18181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31980 20691 19948 gene locus_tag LOCUS_31990 20691 19948 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_31990 21805 20699 gene locus_tag LOCUS_32000 21805 20699 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066036.1 protein_id gnl|my_center|LOCUS_32000 23238 21799 gene locus_tag LOCUS_32010 23238 21799 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484466.1 protein_id gnl|my_center|LOCUS_32010 24794 23238 gene locus_tag LOCUS_32020 24794 23238 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776685.1 protein_id gnl|my_center|LOCUS_32020 25006 25446 gene locus_tag LOCUS_32030 25006 25446 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942028.1 protein_id gnl|my_center|LOCUS_32030 25475 25984 gene locus_tag LOCUS_32040 25475 25984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32040 27383 26058 gene locus_tag LOCUS_32050 27383 26058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32050 28644 27517 gene locus_tag LOCUS_32060 28644 27517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32060 29377 28724 gene locus_tag LOCUS_32070 29377 28724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32070 30842 29406 gene locus_tag LOCUS_32080 gene gatB 30842 29406 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933868.1 protein_id gnl|my_center|LOCUS_32080 32305 30839 gene locus_tag LOCUS_32090 gene gatA 32305 30839 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_32090 32604 32302 gene locus_tag LOCUS_32100 gene gatC 32604 32302 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544984.1 protein_id gnl|my_center|LOCUS_32100 35038 32621 gene locus_tag LOCUS_32110 35038 32621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32110 35201 36295 gene locus_tag LOCUS_32120 35201 36295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 36364 37803 gene locus_tag LOCUS_32130 36364 37803 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_32130 >Feature sequence055 1849 137 gene locus_tag LOCUS_32140 1849 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32140 2567 1965 gene locus_tag LOCUS_32150 2567 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 3181 2564 gene locus_tag LOCUS_32160 3181 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32160 3675 3310 gene locus_tag LOCUS_32170 3675 3310 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_32170 3773 4564 gene locus_tag LOCUS_32180 3773 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32180 4589 4909 gene locus_tag LOCUS_32190 4589 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32190 5090 6139 gene locus_tag LOCUS_32200 5090 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32200 6196 7029 gene locus_tag LOCUS_32210 6196 7029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32210 7238 8446 gene locus_tag LOCUS_32220 7238 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 8508 8771 gene locus_tag LOCUS_32230 8508 8771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 10983 8794 gene locus_tag LOCUS_32240 10983 8794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32240 11196 11852 gene locus_tag LOCUS_32250 11196 11852 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965814.1 protein_id gnl|my_center|LOCUS_32250 11878 12345 gene locus_tag LOCUS_32260 11878 12345 CDS product glyoxalase/bleomycin resistance/dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064815.1 protein_id gnl|my_center|LOCUS_32260 13668 12352 gene locus_tag LOCUS_32270 13668 12352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32270 13749 14453 gene locus_tag LOCUS_32280 13749 14453 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023580.1 protein_id gnl|my_center|LOCUS_32280 15494 14493 gene locus_tag LOCUS_32290 15494 14493 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888889.1 protein_id gnl|my_center|LOCUS_32290 15664 16248 gene locus_tag LOCUS_32300 15664 16248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32300 16312 17673 gene locus_tag LOCUS_32310 16312 17673 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_32310 18244 17699 gene locus_tag LOCUS_32320 18244 17699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 18910 18290 gene locus_tag LOCUS_32330 18910 18290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32330 19228 18974 gene locus_tag LOCUS_32340 19228 18974 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_32340 19353 20897 gene locus_tag LOCUS_32350 19353 20897 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_32350 23131 20912 gene locus_tag LOCUS_32360 23131 20912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 23796 23338 gene locus_tag LOCUS_32370 23796 23338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 23974 24897 gene locus_tag LOCUS_32380 23974 24897 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227729.1 protein_id gnl|my_center|LOCUS_32380 27026 24894 gene locus_tag LOCUS_32390 27026 24894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32390 27444 28376 gene locus_tag LOCUS_32400 27444 28376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32400 28385 29737 gene locus_tag LOCUS_32410 28385 29737 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142259.1 protein_id gnl|my_center|LOCUS_32410 30263 29751 gene locus_tag LOCUS_32420 30263 29751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 30766 30374 gene locus_tag LOCUS_32430 30766 30374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 31085 31783 gene locus_tag LOCUS_32440 31085 31783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32440 31799 32386 gene locus_tag LOCUS_32450 gene lpoB 31799 32386 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706416.1 protein_id gnl|my_center|LOCUS_32450 32395 33630 gene locus_tag LOCUS_32460 32395 33630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32460 33648 34061 gene locus_tag LOCUS_32470 33648 34061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32470 34088 34846 gene locus_tag LOCUS_32480 34088 34846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32480 34984 35970 gene locus_tag LOCUS_32490 34984 35970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 36004 37413 gene locus_tag LOCUS_32500 36004 37413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32500 >Feature sequence056 160 423 gene locus_tag LOCUS_32510 160 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 1779 451 gene locus_tag LOCUS_32520 1779 451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32520 2686 1799 gene locus_tag LOCUS_32530 2686 1799 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_32530 3975 2683 gene locus_tag LOCUS_32540 3975 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 4147 4623 gene locus_tag LOCUS_32550 4147 4623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32550 4646 5068 gene locus_tag LOCUS_32560 4646 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32560 6027 5053 gene locus_tag LOCUS_32570 6027 5053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 6137 7024 gene locus_tag LOCUS_32580 6137 7024 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545813.1 protein_id gnl|my_center|LOCUS_32580 8716 7061 gene locus_tag LOCUS_32590 8716 7061 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791317.1 protein_id gnl|my_center|LOCUS_32590 8864 11440 gene locus_tag LOCUS_32600 8864 11440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 12358 11564 gene locus_tag LOCUS_32610 12358 11564 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_32610 13379 12429 gene locus_tag LOCUS_32620 13379 12429 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391781.1 protein_id gnl|my_center|LOCUS_32620 14227 13376 gene locus_tag LOCUS_32630 14227 13376 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943550.1 protein_id gnl|my_center|LOCUS_32630 14415 15593 gene locus_tag LOCUS_32640 14415 15593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 15586 16881 gene locus_tag LOCUS_32650 15586 16881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32650 17804 16878 gene locus_tag LOCUS_32660 17804 16878 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_32660 18910 17801 gene locus_tag LOCUS_32670 18910 17801 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_32670 20267 18900 gene locus_tag LOCUS_32680 20267 18900 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528956.1 protein_id gnl|my_center|LOCUS_32680 21670 20450 gene locus_tag LOCUS_32690 21670 20450 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_32690 24118 21866 gene locus_tag LOCUS_32700 gene pcrA 24118 21866 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029870.1 protein_id gnl|my_center|LOCUS_32700 24406 25743 gene locus_tag LOCUS_32710 24406 25743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 25740 27326 gene locus_tag LOCUS_32720 25740 27326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32720 27461 28813 gene locus_tag LOCUS_32730 27461 28813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32730 30252 29074 gene locus_tag LOCUS_32740 30252 29074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 30630 30959 gene locus_tag LOCUS_32750 30630 30959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 30976 31908 gene locus_tag LOCUS_32760 30976 31908 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_32760 31946 33085 gene locus_tag LOCUS_32770 31946 33085 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_32770 33209 34123 gene locus_tag LOCUS_32780 33209 34123 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_32780 34125 35528 gene locus_tag LOCUS_32790 gene cysS 34125 35528 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_32790 35700 36020 gene locus_tag LOCUS_32800 35700 36020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence057 327 932 gene locus_tag LOCUS_32810 327 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32810 1575 976 gene locus_tag LOCUS_32820 1575 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32820 1950 1636 gene locus_tag LOCUS_32830 1950 1636 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_32830 2063 3541 gene locus_tag LOCUS_32840 gene glpK 2063 3541 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888563.1 protein_id gnl|my_center|LOCUS_32840 3812 3618 gene locus_tag LOCUS_32850 3812 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 3956 3825 gene locus_tag LOCUS_32860 3956 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 4958 4332 gene locus_tag LOCUS_32870 4958 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 6191 7666 gene locus_tag LOCUS_32880 6191 7666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 7768 8592 gene locus_tag LOCUS_32890 7768 8592 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_32890 10185 8593 gene locus_tag LOCUS_32900 10185 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32900 10964 10209 gene locus_tag LOCUS_32910 10964 10209 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921388.1 protein_id gnl|my_center|LOCUS_32910 12021 11515 gene locus_tag LOCUS_32920 12021 11515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 12996 12139 gene locus_tag LOCUS_32930 12996 12139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 13663 13085 gene locus_tag LOCUS_32940 13663 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32940 13887 15011 gene locus_tag LOCUS_32950 13887 15011 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000246120.1 protein_id gnl|my_center|LOCUS_32950 15160 16101 gene locus_tag LOCUS_32960 15160 16101 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_32960 16094 16861 gene locus_tag LOCUS_32970 16094 16861 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_32970 16868 18511 gene locus_tag LOCUS_32980 16868 18511 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849195.1 protein_id gnl|my_center|LOCUS_32980 18514 20121 gene locus_tag LOCUS_32990 18514 20121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32990 20182 20409 gene locus_tag LOCUS_33000 gene rpoZ 20182 20409 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_33000 20421 20606 gene locus_tag LOCUS_33010 20421 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 20667 21791 gene locus_tag LOCUS_33020 gene dnaJ 20667 21791 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_33020 21922 22590 gene locus_tag LOCUS_33030 21922 22590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33030 22744 23214 gene locus_tag LOCUS_33040 22744 23214 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073661.1 protein_id gnl|my_center|LOCUS_33040 24051 23248 gene locus_tag LOCUS_33050 24051 23248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33050 26769 24124 gene locus_tag LOCUS_33060 26769 24124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 26937 27566 gene locus_tag LOCUS_33070 26937 27566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33070 28545 27571 gene locus_tag LOCUS_33080 28545 27571 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388962.1 protein_id gnl|my_center|LOCUS_33080 28734 29642 gene locus_tag LOCUS_33090 28734 29642 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111019.1 protein_id gnl|my_center|LOCUS_33090 31068 29728 gene locus_tag LOCUS_33100 31068 29728 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203597.1 protein_id gnl|my_center|LOCUS_33100 33430 31301 gene locus_tag LOCUS_33110 33430 31301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33110 33630 34010 gene locus_tag LOCUS_33120 33630 34010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 35827 34022 gene locus_tag LOCUS_33130 35827 34022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 >Feature sequence058 <1 1955 gene locus_tag LOCUS_33140 <1 1955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein 2291 2025 gene locus_tag LOCUS_33150 2291 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 2876 2406 gene locus_tag LOCUS_33160 2876 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33160 4119 2956 gene locus_tag LOCUS_33170 4119 2956 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_33170 4539 4249 gene locus_tag LOCUS_33180 4539 4249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33180 5573 4614 gene locus_tag LOCUS_33190 5573 4614 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107858.1 protein_id gnl|my_center|LOCUS_33190 5790 6722 gene locus_tag LOCUS_33200 5790 6722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33200 8210 7278 gene locus_tag LOCUS_33210 8210 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33210 10098 8359 gene locus_tag LOCUS_33220 10098 8359 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_33220 11141 10203 gene locus_tag LOCUS_33230 11141 10203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33230 12100 11192 gene locus_tag LOCUS_33240 12100 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33240 14031 12148 gene locus_tag LOCUS_33250 14031 12148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33250 14408 15952 gene locus_tag LOCUS_33260 14408 15952 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227051.1 protein_id gnl|my_center|LOCUS_33260 16015 17346 gene locus_tag LOCUS_33270 16015 17346 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940912.1 protein_id gnl|my_center|LOCUS_33270 18504 17371 gene locus_tag LOCUS_33280 18504 17371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 19181 18504 gene locus_tag LOCUS_33290 19181 18504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 20450 19281 gene locus_tag LOCUS_33300 20450 19281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 22180 20792 gene locus_tag LOCUS_33310 22180 20792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33310 22483 22259 gene locus_tag LOCUS_33320 22483 22259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 23338 22538 gene locus_tag LOCUS_33330 23338 22538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33330 24222 23335 gene locus_tag LOCUS_33340 24222 23335 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990818.1 protein_id gnl|my_center|LOCUS_33340 25231 24335 gene locus_tag LOCUS_33350 25231 24335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 25536 27947 gene locus_tag LOCUS_33360 25536 27947 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225895010.1 protein_id gnl|my_center|LOCUS_33360 28127 28507 gene locus_tag LOCUS_33370 28127 28507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33370 28664 29014 gene locus_tag LOCUS_33380 28664 29014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33380 29289 30470 gene locus_tag LOCUS_33390 29289 30470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33390 31462 30491 gene locus_tag LOCUS_33400 31462 30491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33400 31588 32475 gene locus_tag LOCUS_33410 31588 32475 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932822.1 protein_id gnl|my_center|LOCUS_33410 32602 34026 gene locus_tag LOCUS_33420 32602 34026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33420 >Feature sequence059 1682 159 gene locus_tag LOCUS_33430 gene xylB 1682 159 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_33430 2843 1692 gene locus_tag LOCUS_33440 2843 1692 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393522.1 protein_id gnl|my_center|LOCUS_33440 3587 5881 gene locus_tag LOCUS_33450 3587 5881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 6289 5891 gene locus_tag LOCUS_33460 6289 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 6437 7693 gene locus_tag LOCUS_33470 6437 7693 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_33470 7762 9300 gene locus_tag LOCUS_33480 7762 9300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 9312 9770 gene locus_tag LOCUS_33490 9312 9770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33490 10248 9790 gene locus_tag LOCUS_33500 10248 9790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33500 12034 10310 gene locus_tag LOCUS_33510 12034 10310 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_33510 12209 15586 gene locus_tag LOCUS_33520 gene metH 12209 15586 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226749.1 protein_id gnl|my_center|LOCUS_33520 15654 17483 gene locus_tag LOCUS_33530 15654 17483 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_33530 17496 17657 gene locus_tag LOCUS_33540 17496 17657 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875795.1 protein_id gnl|my_center|LOCUS_33540 17682 18593 gene locus_tag LOCUS_33550 17682 18593 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082086.1 protein_id gnl|my_center|LOCUS_33550 18753 20447 gene locus_tag LOCUS_33560 18753 20447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33560 20685 20527 gene locus_tag LOCUS_33570 20685 20527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33570 20789 21613 gene locus_tag LOCUS_33580 gene larE 20789 21613 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584116.1 protein_id gnl|my_center|LOCUS_33580 21600 22691 gene locus_tag LOCUS_33590 gene mnmA 21600 22691 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943205.1 protein_id gnl|my_center|LOCUS_33590 22717 23457 gene locus_tag LOCUS_33600 22717 23457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33600 24047 23466 gene locus_tag LOCUS_33610 gene yihA 24047 23466 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732571.1 protein_id gnl|my_center|LOCUS_33610 25373 24051 gene locus_tag LOCUS_33620 25373 24051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33620 26693 25377 gene locus_tag LOCUS_33630 26693 25377 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_33630 26888 27307 gene locus_tag LOCUS_33640 26888 27307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33640 27347 28096 gene locus_tag LOCUS_33650 27347 28096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33650 28188 30440 gene locus_tag LOCUS_33660 28188 30440 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839960.1 protein_id gnl|my_center|LOCUS_33660 30522 31058 gene locus_tag LOCUS_33670 30522 31058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33670 31055 32395 gene locus_tag LOCUS_33680 gene xseA 31055 32395 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_33680 34235 32400 gene locus_tag LOCUS_33690 34235 32400 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814586.1 protein_id gnl|my_center|LOCUS_33690 >Feature sequence060 1652 402 gene locus_tag LOCUS_33700 gene ftsZ 1652 402 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232167.1 protein_id gnl|my_center|LOCUS_33700 2928 1699 gene locus_tag LOCUS_33710 gene ftsA 2928 1699 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_33710 3785 2925 gene locus_tag LOCUS_33720 3785 2925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 4749 3799 gene locus_tag LOCUS_33730 4749 3799 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_33730 5671 4736 gene locus_tag LOCUS_33740 gene murB 5671 4736 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963832.1 protein_id gnl|my_center|LOCUS_33740 7053 5668 gene locus_tag LOCUS_33750 gene murC 7053 5668 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_33750 8231 7047 gene locus_tag LOCUS_33760 gene spoVE 8231 7047 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244810.1 protein_id gnl|my_center|LOCUS_33760 9556 8228 gene locus_tag LOCUS_33770 gene murD 9556 8228 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943696.1 protein_id gnl|my_center|LOCUS_33770 10959 9556 gene locus_tag LOCUS_33780 10959 9556 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943698.1 protein_id gnl|my_center|LOCUS_33780 12475 10964 gene locus_tag LOCUS_33790 12475 10964 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943699.1 protein_id gnl|my_center|LOCUS_33790 14563 12488 gene locus_tag LOCUS_33800 14563 12488 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_33800 14924 14550 gene locus_tag LOCUS_33810 14924 14550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 15881 14955 gene locus_tag LOCUS_33820 gene rsmH 15881 14955 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_33820 16327 15881 gene locus_tag LOCUS_33830 gene mraZ 16327 15881 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874670.1 protein_id gnl|my_center|LOCUS_33830 16951 16544 gene locus_tag LOCUS_33840 16951 16544 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_33840 18636 16951 gene locus_tag LOCUS_33850 18636 16951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 18888 19505 gene locus_tag LOCUS_33860 18888 19505 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_33860 19522 20706 gene locus_tag LOCUS_33870 gene coaBC 19522 20706 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_33870 21900 20713 gene locus_tag LOCUS_33880 21900 20713 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888346.1 protein_id gnl|my_center|LOCUS_33880 23218 21974 gene locus_tag LOCUS_33890 gene rifK 23218 21974 CDS product 3-amino-5-hydroxybenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222557.1 protein_id gnl|my_center|LOCUS_33890 23819 23361 gene locus_tag LOCUS_33900 23819 23361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33900 25175 23832 gene locus_tag LOCUS_33910 25175 23832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33910 27502 25172 gene locus_tag LOCUS_33920 27502 25172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33920 27676 29886 gene locus_tag LOCUS_33930 27676 29886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33930 30023 31195 gene locus_tag LOCUS_33940 30023 31195 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_33940 31197 32459 gene locus_tag LOCUS_33950 gene icd 31197 32459 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868777.1 protein_id gnl|my_center|LOCUS_33950 32884 32471 gene locus_tag LOCUS_33960 32884 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33960 >Feature sequence061 120 395 gene locus_tag LOCUS_33970 120 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33970 503 811 gene locus_tag LOCUS_33980 503 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 808 2040 gene locus_tag LOCUS_33990 808 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 2096 2551 gene locus_tag LOCUS_34000 gene smpB 2096 2551 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_34000 3334 2594 gene locus_tag LOCUS_34010 3334 2594 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388824.1 protein_id gnl|my_center|LOCUS_34010 4049 3348 gene locus_tag LOCUS_34020 4049 3348 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388822.1 protein_id gnl|my_center|LOCUS_34020 4828 4046 gene locus_tag LOCUS_34030 4828 4046 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388821.1 protein_id gnl|my_center|LOCUS_34030 5283 4879 gene locus_tag LOCUS_34040 5283 4879 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528705.1 protein_id gnl|my_center|LOCUS_34040 5507 6628 gene locus_tag LOCUS_34050 5507 6628 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_34050 7482 6625 gene locus_tag LOCUS_34060 7482 6625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 8690 7653 gene locus_tag LOCUS_34070 8690 7653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 9731 8709 gene locus_tag LOCUS_34080 9731 8709 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_34080 10876 9908 gene locus_tag LOCUS_34090 gene pssA 10876 9908 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_34090 11522 10857 gene locus_tag LOCUS_34100 11522 10857 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_34100 11857 11633 gene locus_tag LOCUS_34110 11857 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34110 12551 11865 gene locus_tag LOCUS_34120 gene tsaB 12551 11865 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942558.1 protein_id gnl|my_center|LOCUS_34120 14212 12548 gene locus_tag LOCUS_34130 14212 12548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34130 15381 14212 gene locus_tag LOCUS_34140 15381 14212 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_34140 16228 15392 gene locus_tag LOCUS_34150 16228 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34150 16945 16232 gene locus_tag LOCUS_34160 16945 16232 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087625.1 protein_id gnl|my_center|LOCUS_34160 17580 17023 gene locus_tag LOCUS_34170 gene frr 17580 17023 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001280006.1 protein_id gnl|my_center|LOCUS_34170 18301 17585 gene locus_tag LOCUS_34180 gene pyrH 18301 17585 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942564.1 protein_id gnl|my_center|LOCUS_34180 20374 18374 gene locus_tag LOCUS_34190 20374 18374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34190 20567 20914 gene locus_tag LOCUS_34200 20567 20914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34200 20911 21276 gene locus_tag LOCUS_34210 gene dksA 20911 21276 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545075.1 protein_id gnl|my_center|LOCUS_34210 21294 22373 gene locus_tag LOCUS_34220 21294 22373 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_34220 22392 22820 gene locus_tag LOCUS_34230 22392 22820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 22875 23828 gene locus_tag LOCUS_34240 22875 23828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 23832 25409 gene locus_tag LOCUS_34250 23832 25409 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_34250 25406 26224 gene locus_tag LOCUS_34260 25406 26224 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975354.1 protein_id gnl|my_center|LOCUS_34260 26221 26757 gene locus_tag LOCUS_34270 26221 26757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34270 26754 27611 gene locus_tag LOCUS_34280 26754 27611 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176621.1 protein_id gnl|my_center|LOCUS_34280 27684 29684 gene locus_tag LOCUS_34290 27684 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 30048 30407 gene locus_tag LOCUS_34300 30048 30407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34300 30551 31042 gene locus_tag LOCUS_34310 30551 31042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 31063 31854 gene locus_tag LOCUS_34320 31063 31854 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227837.1 protein_id gnl|my_center|LOCUS_34320 >Feature sequence062 1859 1065 gene locus_tag LOCUS_34330 1859 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 2344 1859 gene locus_tag LOCUS_34340 2344 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34340 3317 2496 gene locus_tag LOCUS_34350 3317 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 5774 3483 gene locus_tag LOCUS_34360 5774 3483 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000790264.1 protein_id gnl|my_center|LOCUS_34360 6689 5904 gene locus_tag LOCUS_34370 gene folE2 6689 5904 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_34370 7584 6697 gene locus_tag LOCUS_34380 gene folD 7584 6697 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_34380 7768 8754 gene locus_tag LOCUS_34390 7768 8754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34390 8898 10052 gene locus_tag LOCUS_34400 8898 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000775723.1 protein_id gnl|my_center|LOCUS_34400 10759 10094 gene locus_tag LOCUS_34410 10759 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 17410 10772 gene locus_tag LOCUS_34420 17410 10772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 18141 17677 gene locus_tag LOCUS_34430 18141 17677 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_34430 19508 18252 gene locus_tag LOCUS_34440 19508 18252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34440 20115 19510 gene locus_tag LOCUS_34450 20115 19510 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_34450 22048 20129 gene locus_tag LOCUS_34460 22048 20129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34460 22375 22749 gene locus_tag LOCUS_34470 22375 22749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34470 22902 23204 gene locus_tag LOCUS_34480 22902 23204 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_34480 23217 24344 gene locus_tag LOCUS_34490 23217 24344 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_34490 24450 25049 gene locus_tag LOCUS_34500 24450 25049 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_34500 25181 25687 gene locus_tag LOCUS_34510 25181 25687 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_34510 25702 27456 gene locus_tag LOCUS_34520 25702 27456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 27460 28614 gene locus_tag LOCUS_34530 27460 28614 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147320.1 protein_id gnl|my_center|LOCUS_34530 28611 29498 gene locus_tag LOCUS_34540 28611 29498 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_34540 29666 30295 gene locus_tag LOCUS_34550 29666 30295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879725.1 protein_id gnl|my_center|LOCUS_34550 30404 31207 gene locus_tag LOCUS_34560 gene lsrF 30404 31207 CDS product 3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933433.1 protein_id gnl|my_center|LOCUS_34560 31226 32254 gene locus_tag LOCUS_34570 31226 32254 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_34570 >Feature sequence063 97 1143 gene locus_tag LOCUS_34580 gene galT 97 1143 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097520.1 protein_id gnl|my_center|LOCUS_34580 1163 2572 gene locus_tag LOCUS_34590 1163 2572 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392725.1 protein_id gnl|my_center|LOCUS_34590 3733 2753 gene locus_tag LOCUS_34600 3733 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367345.1 protein_id gnl|my_center|LOCUS_34600 4977 3730 gene locus_tag LOCUS_34610 gene ablA 4977 3730 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_34610 6037 4991 gene locus_tag LOCUS_34620 gene kdd 6037 4991 CDS product L-erythro-3,5-diaminohexanoate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015884.1 protein_id gnl|my_center|LOCUS_34620 6869 6048 gene locus_tag LOCUS_34630 6869 6048 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_34630 7082 7954 gene locus_tag LOCUS_34640 gene galU 7082 7954 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_34640 7951 10497 gene locus_tag LOCUS_34650 gene priA 7951 10497 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_34650 10537 12186 gene locus_tag LOCUS_34660 10537 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 13474 12194 gene locus_tag LOCUS_34670 13474 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 13686 14024 gene locus_tag LOCUS_34680 13686 14024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34680 14081 14815 gene locus_tag LOCUS_34690 14081 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34690 14889 15944 gene locus_tag LOCUS_34700 gene fni 14889 15944 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_34700 16652 15993 gene locus_tag LOCUS_34710 16652 15993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34710 16811 17590 gene locus_tag LOCUS_34720 16811 17590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34720 19716 17659 gene locus_tag LOCUS_34730 19716 17659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 19932 23396 gene locus_tag LOCUS_34740 19932 23396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34740 23647 23483 gene locus_tag LOCUS_34750 23647 23483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 23714 24706 gene locus_tag LOCUS_34760 23714 24706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34760 24815 25768 gene locus_tag LOCUS_34770 24815 25768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 26157 26441 gene locus_tag LOCUS_34780 26157 26441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34780 27114 26446 gene locus_tag LOCUS_34790 27114 26446 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485336.1 protein_id gnl|my_center|LOCUS_34790 28508 27111 gene locus_tag LOCUS_34800 28508 27111 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937720.1 protein_id gnl|my_center|LOCUS_34800 30972 28531 gene locus_tag LOCUS_34810 30972 28531 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940909.1 protein_id gnl|my_center|LOCUS_34810 31085 31426 gene locus_tag LOCUS_34820 31085 31426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34820 >Feature sequence064 367 1848 gene locus_tag LOCUS_34830 367 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 2052 1870 gene locus_tag LOCUS_34840 2052 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 2345 3190 gene locus_tag LOCUS_34850 2345 3190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 3216 4037 gene locus_tag LOCUS_34860 3216 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 4059 4634 gene locus_tag LOCUS_34870 4059 4634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34870 5120 4674 gene locus_tag LOCUS_34880 5120 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34880 5290 6309 gene locus_tag LOCUS_34890 gene ychF 5290 6309 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_34890 7021 6299 gene locus_tag LOCUS_34900 7021 6299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259617.1 protein_id gnl|my_center|LOCUS_34900 7752 7931 gene locus_tag LOCUS_34910 7752 7931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34910 8168 9952 gene locus_tag LOCUS_34920 8168 9952 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156206934.1 protein_id gnl|my_center|LOCUS_34920 11248 9974 gene locus_tag LOCUS_34930 11248 9974 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_34930 13069 11261 gene locus_tag LOCUS_34940 13069 11261 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_34940 16356 13195 gene locus_tag LOCUS_34950 16356 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34950 16578 19295 gene locus_tag LOCUS_34960 16578 19295 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_34960 19292 20377 gene locus_tag LOCUS_34970 19292 20377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 22103 20391 gene locus_tag LOCUS_34980 22103 20391 CDS product carbamoyltransferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230581.1 protein_id gnl|my_center|LOCUS_34980 23382 22135 gene locus_tag LOCUS_34990 23382 22135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34990 23512 24159 gene locus_tag LOCUS_35000 23512 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35000 24288 26006 gene locus_tag LOCUS_35010 24288 26006 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943274.1 protein_id gnl|my_center|LOCUS_35010 26151 29612 gene locus_tag LOCUS_35020 26151 29612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_35020 29613 30977 gene locus_tag LOCUS_35030 29613 30977 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796447.1 protein_id gnl|my_center|LOCUS_35030 >Feature sequence065 903 157 gene locus_tag LOCUS_35040 903 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35040 1579 920 gene locus_tag LOCUS_35050 1579 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35050 1766 3250 gene locus_tag LOCUS_35060 1766 3250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35060 3258 3479 gene locus_tag LOCUS_35070 3258 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35070 4720 3497 gene locus_tag LOCUS_35080 4720 3497 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879797.1 protein_id gnl|my_center|LOCUS_35080 5069 4845 gene locus_tag LOCUS_35090 gene infA 5069 4845 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879986.1 protein_id gnl|my_center|LOCUS_35090 5732 5187 gene locus_tag LOCUS_35100 5732 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35100 6581 5802 gene locus_tag LOCUS_35110 gene rsmE 6581 5802 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001222508.1 protein_id gnl|my_center|LOCUS_35110 7441 6551 gene locus_tag LOCUS_35120 gene prmA 7441 6551 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_35120 8190 7438 gene locus_tag LOCUS_35130 8190 7438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35130 8276 9961 gene locus_tag LOCUS_35140 8276 9961 CDS product S49 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390371.1 protein_id gnl|my_center|LOCUS_35140 10454 10032 gene locus_tag LOCUS_35150 10454 10032 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085192.1 protein_id gnl|my_center|LOCUS_35150 11258 10521 gene locus_tag LOCUS_35160 11258 10521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35160 12145 11387 gene locus_tag LOCUS_35170 12145 11387 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066731.1 protein_id gnl|my_center|LOCUS_35170 13473 12163 gene locus_tag LOCUS_35180 13473 12163 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082320.1 protein_id gnl|my_center|LOCUS_35180 13866 13522 gene locus_tag LOCUS_35190 gene rsfS 13866 13522 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943827.1 protein_id gnl|my_center|LOCUS_35190 14089 14487 gene locus_tag LOCUS_35200 14089 14487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35200 14484 15419 gene locus_tag LOCUS_35210 14484 15419 CDS product N-acyl homoserine lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019565706.1 protein_id gnl|my_center|LOCUS_35210 15508 16641 gene locus_tag LOCUS_35220 15508 16641 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057244.1 protein_id gnl|my_center|LOCUS_35220 17451 16642 gene locus_tag LOCUS_35230 17451 16642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35230 17636 19405 gene locus_tag LOCUS_35240 17636 19405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 19602 21185 gene locus_tag LOCUS_35250 19602 21185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35250 21204 22586 gene locus_tag LOCUS_35260 21204 22586 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048639.1 protein_id gnl|my_center|LOCUS_35260 22590 23876 gene locus_tag LOCUS_35270 22590 23876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35270 24490 23900 gene locus_tag LOCUS_35280 24490 23900 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140095.1 protein_id gnl|my_center|LOCUS_35280 25032 24631 gene locus_tag LOCUS_35290 25032 24631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 25315 25851 gene locus_tag LOCUS_35300 25315 25851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 25916 27082 gene locus_tag LOCUS_35310 25916 27082 CDS product lipocalin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898675.1 protein_id gnl|my_center|LOCUS_35310 27095 27940 gene locus_tag LOCUS_35320 27095 27940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35320 28769 28326 gene locus_tag LOCUS_35330 28769 28326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 28723 29784 gene locus_tag LOCUS_35340 28723 29784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 >Feature sequence066 2572 1277 gene locus_tag LOCUS_35350 2572 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35350 4001 2748 gene locus_tag LOCUS_35360 4001 2748 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_35360 4706 4014 gene locus_tag LOCUS_35370 4706 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35370 5568 4723 gene locus_tag LOCUS_35380 gene panB 5568 4723 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_35380 6138 6425 gene locus_tag LOCUS_35390 6138 6425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 8095 6599 gene locus_tag LOCUS_35400 8095 6599 CDS product phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388252.1 protein_id gnl|my_center|LOCUS_35400 8260 8108 gene locus_tag LOCUS_35410 8260 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35410 9563 8307 gene locus_tag LOCUS_35420 9563 8307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 10439 9594 gene locus_tag LOCUS_35430 10439 9594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 11486 10458 gene locus_tag LOCUS_35440 11486 10458 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_35440 14010 11497 gene locus_tag LOCUS_35450 14010 11497 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249244.1 protein_id gnl|my_center|LOCUS_35450 14747 14007 gene locus_tag LOCUS_35460 14747 14007 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_35460 14891 15814 gene locus_tag LOCUS_35470 14891 15814 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942288.1 protein_id gnl|my_center|LOCUS_35470 17004 15811 gene locus_tag LOCUS_35480 17004 15811 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337813.1 protein_id gnl|my_center|LOCUS_35480 17365 17814 gene locus_tag LOCUS_35490 17365 17814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35490 17958 19088 gene locus_tag LOCUS_35500 17958 19088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35500 19147 20202 gene locus_tag LOCUS_35510 19147 20202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35510 20226 21266 gene locus_tag LOCUS_35520 gene aroB 20226 21266 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_35520 21268 22566 gene locus_tag LOCUS_35530 21268 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35530 22601 23785 gene locus_tag LOCUS_35540 gene aroA 22601 23785 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861345.1 protein_id gnl|my_center|LOCUS_35540 23782 24774 gene locus_tag LOCUS_35550 gene aroC 23782 24774 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878173.1 protein_id gnl|my_center|LOCUS_35550 24967 27015 gene locus_tag LOCUS_35560 24967 27015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35560 27159 27086 gene locus_tag LOCUS_t00410 27159 27086 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 27282 27983 gene locus_tag LOCUS_35570 27282 27983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35570 27987 29102 gene locus_tag LOCUS_35580 27987 29102 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002227959.1 protein_id gnl|my_center|LOCUS_35580 29113 29586 gene locus_tag LOCUS_35590 29113 29586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35590 >Feature sequence067 1974 526 gene locus_tag LOCUS_35600 1974 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35600 2399 5734 gene locus_tag LOCUS_35610 2399 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35610 6191 5799 gene locus_tag LOCUS_35620 6191 5799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 6547 6236 gene locus_tag LOCUS_35630 6547 6236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 7354 6842 gene locus_tag LOCUS_35640 7354 6842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35640 8438 7371 gene locus_tag LOCUS_35650 8438 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35650 9720 8455 gene locus_tag LOCUS_35660 9720 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 10979 9717 gene locus_tag LOCUS_35670 10979 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 16133 10992 gene locus_tag LOCUS_35680 16133 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 17050 16400 gene locus_tag LOCUS_35690 17050 16400 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941948.1 protein_id gnl|my_center|LOCUS_35690 18154 17153 gene locus_tag LOCUS_35700 18154 17153 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921432.1 protein_id gnl|my_center|LOCUS_35700 18367 20064 gene locus_tag LOCUS_35710 18367 20064 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080205.1 protein_id gnl|my_center|LOCUS_35710 20061 20909 gene locus_tag LOCUS_35720 20061 20909 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023015.1 protein_id gnl|my_center|LOCUS_35720 20948 21511 gene locus_tag LOCUS_35730 20948 21511 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965783.1 protein_id gnl|my_center|LOCUS_35730 23668 21521 gene locus_tag LOCUS_35740 23668 21521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35740 25121 23922 gene locus_tag LOCUS_35750 25121 23922 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_35750 25299 27449 gene locus_tag LOCUS_35760 25299 27449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35760 28733 27453 gene locus_tag LOCUS_35770 28733 27453 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257660.1 protein_id gnl|my_center|LOCUS_35770 >Feature sequence068 1390 1157 gene locus_tag LOCUS_35780 1390 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35780 1389 2666 gene locus_tag LOCUS_35790 1389 2666 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_35790 2690 3928 gene locus_tag LOCUS_35800 2690 3928 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_35800 3969 4301 gene locus_tag LOCUS_35810 3969 4301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35810 4654 4298 gene locus_tag LOCUS_35820 4654 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35820 4788 6128 gene locus_tag LOCUS_35830 4788 6128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 6201 7976 gene locus_tag LOCUS_35840 6201 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 9644 8061 gene locus_tag LOCUS_35850 9644 8061 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402342.1 protein_id gnl|my_center|LOCUS_35850 9779 10111 gene locus_tag LOCUS_35860 9779 10111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35860 10121 10513 gene locus_tag LOCUS_35870 10121 10513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35870 10570 10872 gene locus_tag LOCUS_35880 10570 10872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 13151 10953 gene locus_tag LOCUS_35890 13151 10953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 13332 14120 gene locus_tag LOCUS_35900 13332 14120 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256393.1 protein_id gnl|my_center|LOCUS_35900 14124 15419 gene locus_tag LOCUS_35910 gene purB 14124 15419 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_35910 15420 16211 gene locus_tag LOCUS_35920 gene fdhD 15420 16211 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990022.1 protein_id gnl|my_center|LOCUS_35920 16296 16934 gene locus_tag LOCUS_35930 16296 16934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 16931 18226 gene locus_tag LOCUS_35940 16931 18226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35940 18386 21412 gene locus_tag LOCUS_35950 gene fdnG 18386 21412 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941441.1 protein_id gnl|my_center|LOCUS_35950 21425 22084 gene locus_tag LOCUS_35960 21425 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35960 22152 23087 gene locus_tag LOCUS_35970 22152 23087 CDS product formate dehydrogenase accessory protein FdhE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937880.1 protein_id gnl|my_center|LOCUS_35970 23090 23704 gene locus_tag LOCUS_35980 23090 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 24150 23725 gene locus_tag LOCUS_35990 24150 23725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35990 25349 24165 gene locus_tag LOCUS_36000 gene rlmI 25349 24165 CDS product 23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140485.1 protein_id gnl|my_center|LOCUS_36000 25778 25356 gene locus_tag LOCUS_36010 25778 25356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36010 27945 25801 gene locus_tag LOCUS_36020 27945 25801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36020 >Feature sequence069 602 775 gene locus_tag LOCUS_36030 602 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36030 890 1429 gene locus_tag LOCUS_36040 890 1429 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868386.1 protein_id gnl|my_center|LOCUS_36040 2091 1426 gene locus_tag LOCUS_36050 2091 1426 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704391.1 protein_id gnl|my_center|LOCUS_36050 2398 2177 gene locus_tag LOCUS_36060 2398 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 5663 2451 gene locus_tag LOCUS_36070 5663 2451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 6220 5882 gene locus_tag LOCUS_36080 6220 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36080 8889 6391 gene locus_tag LOCUS_36090 8889 6391 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975861.1 protein_id gnl|my_center|LOCUS_36090 10236 9043 gene locus_tag LOCUS_36100 10236 9043 CDS product sialidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119313.1 protein_id gnl|my_center|LOCUS_36100 10925 10374 gene locus_tag LOCUS_36110 10925 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 11211 12554 gene locus_tag LOCUS_36120 11211 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36120 12697 14220 gene locus_tag LOCUS_36130 12697 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36130 14304 15989 gene locus_tag LOCUS_36140 14304 15989 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114865.1 protein_id gnl|my_center|LOCUS_36140 15986 22822 gene locus_tag LOCUS_36150 15986 22822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36150 22819 23943 gene locus_tag LOCUS_36160 22819 23943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36160 24109 24513 gene locus_tag LOCUS_36170 24109 24513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36170 25230 25694 gene locus_tag LOCUS_36180 25230 25694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 25738 26937 gene locus_tag LOCUS_36190 25738 26937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36190 26997 27398 gene locus_tag LOCUS_36200 26997 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence070 329 913 gene locus_tag LOCUS_36210 gene clpP 329 913 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_36210 925 1782 gene locus_tag LOCUS_36220 925 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36220 1786 3405 gene locus_tag LOCUS_36230 1786 3405 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902151.1 protein_id gnl|my_center|LOCUS_36230 4834 3368 gene locus_tag LOCUS_36240 4834 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36240 5163 4978 gene locus_tag LOCUS_36250 5163 4978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36250 5074 6528 gene locus_tag LOCUS_36260 5074 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36260 8751 6601 gene locus_tag LOCUS_36270 8751 6601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36270 10167 8980 gene locus_tag LOCUS_36280 10167 8980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36280 10526 11392 gene locus_tag LOCUS_36290 10526 11392 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939203.1 protein_id gnl|my_center|LOCUS_36290 11412 12977 gene locus_tag LOCUS_36300 11412 12977 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811612.1 protein_id gnl|my_center|LOCUS_36300 13045 13494 gene locus_tag LOCUS_36310 13045 13494 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939205.1 protein_id gnl|my_center|LOCUS_36310 14891 13497 gene locus_tag LOCUS_36320 14891 13497 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879259.1 protein_id gnl|my_center|LOCUS_36320 15047 15820 gene locus_tag LOCUS_36330 15047 15820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36330 15904 16965 gene locus_tag LOCUS_36340 15904 16965 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546142.1 protein_id gnl|my_center|LOCUS_36340 17069 17506 gene locus_tag LOCUS_36350 gene tadA 17069 17506 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_36350 17514 17603 gene locus_tag LOCUS_t00420 17514 17603 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17631 17720 gene locus_tag LOCUS_t00430 17631 17720 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17882 18247 gene locus_tag LOCUS_36360 17882 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36360 18460 19812 gene locus_tag LOCUS_36370 18460 19812 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_36370 19898 20626 gene locus_tag LOCUS_36380 19898 20626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36380 20735 21601 gene locus_tag LOCUS_36390 20735 21601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36390 24507 21781 gene locus_tag LOCUS_36400 24507 21781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36400 24629 25666 gene locus_tag LOCUS_36410 24629 25666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36410 25713 26816 gene locus_tag LOCUS_36420 25713 26816 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_36420 >Feature sequence071 290 1333 gene locus_tag LOCUS_36430 290 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36430 1391 2167 gene locus_tag LOCUS_36440 1391 2167 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_36440 2276 4174 gene locus_tag LOCUS_36450 2276 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36450 4232 4894 gene locus_tag LOCUS_36460 4232 4894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36460 6381 4891 gene locus_tag LOCUS_36470 6381 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36470 7176 6391 gene locus_tag LOCUS_36480 7176 6391 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_36480 7314 8726 gene locus_tag LOCUS_36490 7314 8726 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_36490 8723 10165 gene locus_tag LOCUS_36500 8723 10165 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902969.1 protein_id gnl|my_center|LOCUS_36500 11710 10529 gene locus_tag LOCUS_36510 11710 10529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36510 12444 12205 gene locus_tag LOCUS_36520 12444 12205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36520 12859 12482 gene locus_tag LOCUS_36530 12859 12482 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_36530 13136 13882 gene locus_tag LOCUS_36540 13136 13882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36540 14213 13971 gene locus_tag LOCUS_36550 14213 13971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36550 14657 14842 gene locus_tag LOCUS_36560 14657 14842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36560 15012 16664 gene locus_tag LOCUS_36570 15012 16664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36570 16805 16683 gene locus_tag LOCUS_36580 16805 16683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36580 16962 17792 gene locus_tag LOCUS_36590 16962 17792 CDS product ArdC-like ssDNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785691.1 protein_id gnl|my_center|LOCUS_36590 17829 18320 gene locus_tag LOCUS_36600 17829 18320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36600 19307 18636 gene locus_tag LOCUS_36610 19307 18636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36610 20670 20846 gene locus_tag LOCUS_36620 20670 20846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36620 20942 22261 gene locus_tag LOCUS_36630 20942 22261 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_36630 22534 23970 gene locus_tag LOCUS_36640 22534 23970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36640 25677 23965 gene locus_tag LOCUS_36650 25677 23965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36650 26195 25677 gene locus_tag LOCUS_36660 26195 25677 CDS product DUF2924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383514.1 protein_id gnl|my_center|LOCUS_36660 26401 26192 gene locus_tag LOCUS_36670 26401 26192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36670 >Feature sequence072 993 145 gene locus_tag LOCUS_36680 993 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36680 1814 993 gene locus_tag LOCUS_36690 1814 993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_36690 2781 1801 gene locus_tag LOCUS_36700 2781 1801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_36700 3100 5058 gene locus_tag LOCUS_36710 3100 5058 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_36710 5055 7559 gene locus_tag LOCUS_36720 5055 7559 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941012.1 protein_id gnl|my_center|LOCUS_36720 7958 7569 gene locus_tag LOCUS_36730 7958 7569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36730 8314 10563 gene locus_tag LOCUS_36740 8314 10563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36740 10586 11323 gene locus_tag LOCUS_36750 10586 11323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36750 11386 12645 gene locus_tag LOCUS_36760 11386 12645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36760 14836 12794 gene locus_tag LOCUS_36770 14836 12794 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937911.1 protein_id gnl|my_center|LOCUS_36770 17429 15387 gene locus_tag LOCUS_36780 17429 15387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36780 17645 17460 gene locus_tag LOCUS_36790 17645 17460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36790 17833 18525 gene locus_tag LOCUS_36800 17833 18525 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143168.1 protein_id gnl|my_center|LOCUS_36800 18522 19397 gene locus_tag LOCUS_36810 18522 19397 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_36810 19453 19911 gene locus_tag LOCUS_36820 19453 19911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36820 20394 22808 gene locus_tag LOCUS_36830 20394 22808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36830 22822 23820 gene locus_tag LOCUS_36840 22822 23820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36840 23983 24984 gene locus_tag LOCUS_36850 23983 24984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36850 25143 25063 gene locus_tag LOCUS_t00440 25143 25063 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence073 529 134 gene locus_tag LOCUS_36860 529 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36860 701 522 gene locus_tag LOCUS_36870 701 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36870 898 1200 gene locus_tag LOCUS_36880 898 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36880 1503 1267 gene locus_tag LOCUS_36890 1503 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36890 2727 1534 gene locus_tag LOCUS_36900 2727 1534 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_36900 3185 4171 gene locus_tag LOCUS_36910 3185 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36910 4165 4509 gene locus_tag LOCUS_36920 4165 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36920 4479 4922 gene locus_tag LOCUS_36930 4479 4922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36930 5405 6742 gene locus_tag LOCUS_36940 5405 6742 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 protein_id gnl|my_center|LOCUS_36940 7315 8568 gene locus_tag LOCUS_36950 7315 8568 CDS product carbohydrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899577.1 protein_id gnl|my_center|LOCUS_36950 8674 8943 gene locus_tag LOCUS_36960 8674 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36960 8983 9972 gene locus_tag LOCUS_36970 8983 9972 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941871.1 protein_id gnl|my_center|LOCUS_36970 10008 11192 gene locus_tag LOCUS_36980 10008 11192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36980 12776 11247 gene locus_tag LOCUS_36990 12776 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36990 13065 13754 gene locus_tag LOCUS_37000 13065 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37000 13777 14562 gene locus_tag LOCUS_37010 13777 14562 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073550381.1 protein_id gnl|my_center|LOCUS_37010 14962 14576 gene locus_tag LOCUS_37020 14962 14576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37020 16584 14959 gene locus_tag LOCUS_37030 16584 14959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_37030 16691 16764 gene locus_tag LOCUS_t00450 16691 16764 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 18910 16871 gene locus_tag LOCUS_37040 18910 16871 CDS product OPT family oligopeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768135.1 protein_id gnl|my_center|LOCUS_37040 19352 19660 gene locus_tag LOCUS_37050 19352 19660 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_37050 19778 20947 gene locus_tag LOCUS_37060 gene sucC 19778 20947 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002721255.1 protein_id gnl|my_center|LOCUS_37060 20944 21819 gene locus_tag LOCUS_37070 gene sucD 20944 21819 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941720.1 protein_id gnl|my_center|LOCUS_37070 21847 23202 gene locus_tag LOCUS_37080 21847 23202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37080 23564 23373 gene locus_tag LOCUS_37090 23564 23373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37090 >Feature sequence074 <1 1335 gene locus_tag LOCUS_37100 <1 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185359.1:potassium-transporting ATPase subunit KdpA 1356 3419 gene locus_tag LOCUS_37110 gene kdpB 1356 3419 CDS product potassium-transporting ATPase subunit KdpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816820.1 protein_id gnl|my_center|LOCUS_37110 3430 4017 gene locus_tag LOCUS_37120 gene kdpC 3430 4017 CDS product potassium-transporting ATPase subunit KdpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814050.1 protein_id gnl|my_center|LOCUS_37120 4014 6713 gene locus_tag LOCUS_37130 4014 6713 CDS product sensor histidine kinase KdpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943120.1 protein_id gnl|my_center|LOCUS_37130 6717 7412 gene locus_tag LOCUS_37140 gene kdpE 6717 7412 CDS product two-component system response regulator KdpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025470747.1 protein_id gnl|my_center|LOCUS_37140 8346 7423 gene locus_tag LOCUS_37150 8346 7423 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937965.1 protein_id gnl|my_center|LOCUS_37150 9274 8330 gene locus_tag LOCUS_37160 gene cysK 9274 8330 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257225.1 protein_id gnl|my_center|LOCUS_37160 9668 10297 gene locus_tag LOCUS_37170 9668 10297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37170 10301 10759 gene locus_tag LOCUS_37180 gene dtd 10301 10759 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_37180 10816 11343 gene locus_tag LOCUS_37190 10816 11343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37190 11425 13458 gene locus_tag LOCUS_37200 gene metG 11425 13458 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301615.1 protein_id gnl|my_center|LOCUS_37200 13490 13756 gene locus_tag LOCUS_37210 13490 13756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37210 14903 13776 gene locus_tag LOCUS_37220 14903 13776 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384817.1 protein_id gnl|my_center|LOCUS_37220 15611 14970 gene locus_tag LOCUS_37230 15611 14970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37230 15777 17705 gene locus_tag LOCUS_37240 15777 17705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37240 17719 18186 gene locus_tag LOCUS_37250 17719 18186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37250 19693 18161 gene locus_tag LOCUS_37260 19693 18161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37260 21215 19818 gene locus_tag LOCUS_37270 gene gltX 21215 19818 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545418.1 protein_id gnl|my_center|LOCUS_37270 22025 21219 gene locus_tag LOCUS_37280 22025 21219 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_37280 23043 22027 gene locus_tag LOCUS_37290 23043 22027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37290 >Feature sequence075 1893 154 gene locus_tag LOCUS_37300 gene argS 1893 154 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225071.1 protein_id gnl|my_center|LOCUS_37300 2283 1930 gene locus_tag LOCUS_37310 2283 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37310 2676 2317 gene locus_tag LOCUS_37320 2676 2317 CDS product phosphomannose isomerase type II C-terminal cupin domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017550.1 protein_id gnl|my_center|LOCUS_37320 3471 2824 gene locus_tag LOCUS_37330 gene fsa 3471 2824 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_37330 4210 3488 gene locus_tag LOCUS_37340 4210 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37340 5191 4361 gene locus_tag LOCUS_37350 5191 4361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37350 6056 5172 gene locus_tag LOCUS_37360 6056 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37360 8239 6053 gene locus_tag LOCUS_37370 8239 6053 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256716.1 protein_id gnl|my_center|LOCUS_37370 8313 9209 gene locus_tag LOCUS_37380 8313 9209 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_37380 9516 11846 gene locus_tag LOCUS_37390 9516 11846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37390 12055 14094 gene locus_tag LOCUS_37400 12055 14094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37400 14091 16433 gene locus_tag LOCUS_37410 14091 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37410 16729 19215 gene locus_tag LOCUS_37420 16729 19215 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599517.1 protein_id gnl|my_center|LOCUS_37420 19402 20553 gene locus_tag LOCUS_37430 19402 20553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37430 22037 20604 gene locus_tag LOCUS_37440 22037 20604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37440 >Feature sequence076 838 2124 gene locus_tag LOCUS_37450 gene thiC 838 2124 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_37450 2121 2936 gene locus_tag LOCUS_37460 gene thiF 2121 2936 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_37460 2918 3121 gene locus_tag LOCUS_37470 2918 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37470 3123 3914 gene locus_tag LOCUS_37480 gene thiG 3123 3914 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704009.1 protein_id gnl|my_center|LOCUS_37480 4097 5029 gene locus_tag LOCUS_37490 gene thiH 4097 5029 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962602.1 protein_id gnl|my_center|LOCUS_37490 5059 5715 gene locus_tag LOCUS_37500 gene thiE 5059 5715 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256280.1 protein_id gnl|my_center|LOCUS_37500 5882 6529 gene locus_tag LOCUS_37510 5882 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37510 6616 7812 gene locus_tag LOCUS_37520 gene tyrS 6616 7812 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_37520 7895 8545 gene locus_tag LOCUS_37530 7895 8545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37530 8545 9465 gene locus_tag LOCUS_37540 8545 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37540 9462 10736 gene locus_tag LOCUS_37550 9462 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37550 10739 11734 gene locus_tag LOCUS_37560 10739 11734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37560 11836 13398 gene locus_tag LOCUS_37570 11836 13398 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393063.1 protein_id gnl|my_center|LOCUS_37570 13385 14455 gene locus_tag LOCUS_37580 13385 14455 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_37580 14548 15717 gene locus_tag LOCUS_37590 14548 15717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37590 15714 16664 gene locus_tag LOCUS_37600 15714 16664 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009932949.1 protein_id gnl|my_center|LOCUS_37600 17717 16674 gene locus_tag LOCUS_37610 17717 16674 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_37610 18698 17721 gene locus_tag LOCUS_37620 18698 17721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37620 19883 18786 gene locus_tag LOCUS_37630 19883 18786 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_37630 21128 19977 gene locus_tag LOCUS_37640 21128 19977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37640 >Feature sequence077 2323 1040 gene locus_tag LOCUS_37650 gene eno 2323 1040 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_37650 3535 2432 gene locus_tag LOCUS_37660 gene rocD 3535 2432 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085639.1 protein_id gnl|my_center|LOCUS_37660 4135 3773 gene locus_tag LOCUS_37670 4135 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37670 5746 4145 gene locus_tag LOCUS_37680 5746 4145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37680 6029 6838 gene locus_tag LOCUS_37690 6029 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37690 9589 7313 gene locus_tag LOCUS_37700 9589 7313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37700 10781 9582 gene locus_tag LOCUS_37710 10781 9582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37710 10964 12079 gene locus_tag LOCUS_37720 10964 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37720 12221 13594 gene locus_tag LOCUS_37730 gene tig 12221 13594 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048204.1 protein_id gnl|my_center|LOCUS_37730 13663 14280 gene locus_tag LOCUS_37740 gene clpP 13663 14280 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_37740 14277 15533 gene locus_tag LOCUS_37750 gene clpX 14277 15533 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_37750 15553 18000 gene locus_tag LOCUS_37760 gene lon 15553 18000 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942434.1 protein_id gnl|my_center|LOCUS_37760 18073 19542 gene locus_tag LOCUS_37770 18073 19542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37770 >Feature sequence078 1246 164 gene locus_tag LOCUS_37780 1246 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37780 2111 1341 gene locus_tag LOCUS_37790 2111 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37790 2251 3699 gene locus_tag LOCUS_37800 2251 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37800 3740 5413 gene locus_tag LOCUS_37810 3740 5413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37810 5410 8478 gene locus_tag LOCUS_37820 5410 8478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37820 11083 8486 gene locus_tag LOCUS_37830 11083 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37830 12569 11094 gene locus_tag LOCUS_37840 12569 11094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37840 13270 12713 gene locus_tag LOCUS_37850 13270 12713 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022735.1 protein_id gnl|my_center|LOCUS_37850 14275 13274 gene locus_tag LOCUS_37860 14275 13274 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_37860 15036 14272 gene locus_tag LOCUS_37870 15036 14272 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189750.1 protein_id gnl|my_center|LOCUS_37870 15191 15892 gene locus_tag LOCUS_37880 15191 15892 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113600.1 protein_id gnl|my_center|LOCUS_37880 15920 17128 gene locus_tag LOCUS_37890 15920 17128 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225003.1 protein_id gnl|my_center|LOCUS_37890 17145 18209 gene locus_tag LOCUS_37900 17145 18209 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267697.1 protein_id gnl|my_center|LOCUS_37900 18778 18218 gene locus_tag LOCUS_37910 18778 18218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37910 18953 19624 gene locus_tag LOCUS_37920 18953 19624 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403974.1 protein_id gnl|my_center|LOCUS_37920 >Feature sequence079 1635 121 gene locus_tag LOCUS_37930 1635 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37930 1796 3325 gene locus_tag LOCUS_37940 1796 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37940 4294 3335 gene locus_tag LOCUS_37950 4294 3335 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227915.1 protein_id gnl|my_center|LOCUS_37950 4742 4347 gene locus_tag LOCUS_37960 4742 4347 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065851.1 protein_id gnl|my_center|LOCUS_37960 4935 6578 gene locus_tag LOCUS_37970 4935 6578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37970 6599 7240 gene locus_tag LOCUS_37980 6599 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37980 8285 7494 gene locus_tag LOCUS_37990 8285 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_37990 9390 8347 gene locus_tag LOCUS_38000 9390 8347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38000 10872 9526 gene locus_tag LOCUS_38010 10872 9526 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257949.1 protein_id gnl|my_center|LOCUS_38010 13288 10958 gene locus_tag LOCUS_38020 13288 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38020 13479 15257 gene locus_tag LOCUS_38030 gene aspS 13479 15257 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_38030 15264 16562 gene locus_tag LOCUS_38040 gene asnS 15264 16562 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_38040 16751 17608 gene locus_tag LOCUS_38050 16751 17608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38050 17844 18467 gene locus_tag LOCUS_38060 17844 18467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38060 >Feature sequence080 1779 877 gene locus_tag LOCUS_38070 1779 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38070 3362 2676 gene locus_tag LOCUS_38080 gene queC 3362 2676 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941151.1 protein_id gnl|my_center|LOCUS_38080 4757 3375 gene locus_tag LOCUS_38090 4757 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38090 5700 4843 gene locus_tag LOCUS_38100 5700 4843 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_38100 6622 5702 gene locus_tag LOCUS_38110 6622 5702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38110 6829 6638 gene locus_tag LOCUS_38120 6829 6638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38120 8919 6874 gene locus_tag LOCUS_38130 8919 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38130 11045 8916 gene locus_tag LOCUS_38140 11045 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38140 12464 11163 gene locus_tag LOCUS_38150 12464 11163 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_38150 12678 13598 gene locus_tag LOCUS_38160 12678 13598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38160 13693 14286 gene locus_tag LOCUS_38170 13693 14286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38170 14261 16573 gene locus_tag LOCUS_38180 14261 16573 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941478.1 protein_id gnl|my_center|LOCUS_38180 >Feature sequence081 169 405 gene locus_tag LOCUS_38190 169 405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38190 570 1667 gene locus_tag LOCUS_38200 570 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38200 1750 2550 gene locus_tag LOCUS_38210 1750 2550 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390142.1 protein_id gnl|my_center|LOCUS_38210 2547 3365 gene locus_tag LOCUS_38220 2547 3365 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390141.1 protein_id gnl|my_center|LOCUS_38220 3433 4446 gene locus_tag LOCUS_38230 3433 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38230 5165 4614 gene locus_tag LOCUS_38240 5165 4614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38240 5350 6918 gene locus_tag LOCUS_38250 5350 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38250 7277 6933 gene locus_tag LOCUS_38260 7277 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38260 9447 7360 gene locus_tag LOCUS_38270 9447 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38270 9596 10954 gene locus_tag LOCUS_38280 9596 10954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38280 11442 10972 gene locus_tag LOCUS_38290 11442 10972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38290 12791 11451 gene locus_tag LOCUS_38300 12791 11451 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_38300 13457 12828 gene locus_tag LOCUS_38310 13457 12828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38310 13601 14536 gene locus_tag LOCUS_38320 13601 14536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38320 15820 14546 gene locus_tag LOCUS_38330 15820 14546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38330 16353 15850 gene locus_tag LOCUS_38340 16353 15850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38340 >Feature sequence082 849 2810 gene locus_tag LOCUS_38350 849 2810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38350 5019 2830 gene locus_tag LOCUS_38360 5019 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38360 7251 5038 gene locus_tag LOCUS_38370 7251 5038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38370 7708 7385 gene locus_tag LOCUS_38380 7708 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38380 8810 7770 gene locus_tag LOCUS_38390 8810 7770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38390 9365 8829 gene locus_tag LOCUS_38400 9365 8829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38400 11171 9477 gene locus_tag LOCUS_38410 11171 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38410 11468 11190 gene locus_tag LOCUS_38420 11468 11190 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941004.1 protein_id gnl|my_center|LOCUS_38420 12274 11561 gene locus_tag LOCUS_38430 12274 11561 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_38430 13548 12271 gene locus_tag LOCUS_38440 13548 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38440 14012 13611 gene locus_tag LOCUS_38450 14012 13611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38450 14532 14134 gene locus_tag LOCUS_38460 14532 14134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38460 15153 14749 gene locus_tag LOCUS_38470 15153 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38470 15607 15197 gene locus_tag LOCUS_38480 15607 15197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38480 >Feature sequence083 610 242 gene locus_tag LOCUS_38490 gene queD 610 242 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546681.1 protein_id gnl|my_center|LOCUS_38490 2003 615 gene locus_tag LOCUS_38500 2003 615 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_38500 2689 2171 gene locus_tag LOCUS_38510 2689 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38510 3615 2707 gene locus_tag LOCUS_38520 3615 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38520 5749 3623 gene locus_tag LOCUS_38530 5749 3623 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259393.1 protein_id gnl|my_center|LOCUS_38530 6005 6547 gene locus_tag LOCUS_38540 6005 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38540 6783 8405 gene locus_tag LOCUS_38550 6783 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38550 9627 8497 gene locus_tag LOCUS_38560 9627 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38560 9987 10340 gene locus_tag LOCUS_38570 9987 10340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38570 10401 11354 gene locus_tag LOCUS_38580 gene mtgA 10401 11354 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933680.1 protein_id gnl|my_center|LOCUS_38580 12885 11410 gene locus_tag LOCUS_38590 12885 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38590 15181 13973 gene locus_tag LOCUS_38600 15181 13973 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271945.1 protein_id gnl|my_center|LOCUS_38600 15717 15178 gene locus_tag LOCUS_38610 15717 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38610 >Feature sequence084 233 2632 gene locus_tag LOCUS_38620 233 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38620 2640 3503 gene locus_tag LOCUS_38630 2640 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38630 6047 3594 gene locus_tag LOCUS_38640 6047 3594 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_38640 7721 6540 gene locus_tag LOCUS_38650 7721 6540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38650 8180 7818 gene locus_tag LOCUS_38660 8180 7818 CDS product DUF3795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990835.1 protein_id gnl|my_center|LOCUS_38660 9772 8249 gene locus_tag LOCUS_38670 9772 8249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38670 10022 11482 gene locus_tag LOCUS_38680 10022 11482 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_38680 12036 11617 gene locus_tag LOCUS_38690 12036 11617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38690 12261 12109 gene locus_tag LOCUS_38700 12261 12109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38700 13446 12604 gene locus_tag LOCUS_38710 13446 12604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38710 >Feature sequence085 1846 476 gene locus_tag LOCUS_38720 1846 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38720 3137 2046 gene locus_tag LOCUS_38730 3137 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38730 6685 3197 gene locus_tag LOCUS_38740 6685 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38740 7053 6682 gene locus_tag LOCUS_38750 7053 6682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38750 7631 7056 gene locus_tag LOCUS_38760 7631 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38760 8502 7876 gene locus_tag LOCUS_38770 8502 7876 CDS product DUF2239 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083415.1 protein_id gnl|my_center|LOCUS_38770 9012 8644 gene locus_tag LOCUS_38780 9012 8644 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382842.1 protein_id gnl|my_center|LOCUS_38780 9452 9069 gene locus_tag LOCUS_38790 9452 9069 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_38790 9689 10441 gene locus_tag LOCUS_38800 9689 10441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38800 10482 12569 gene locus_tag LOCUS_38810 gene feoB 10482 12569 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_38810 12582 12779 gene locus_tag LOCUS_38820 12582 12779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38820 14470 13058 gene locus_tag LOCUS_38830 14470 13058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38830 >Feature sequence086 453 1391 gene locus_tag LOCUS_38840 453 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38840 2140 1310 gene locus_tag LOCUS_38850 2140 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38850 3270 2227 gene locus_tag LOCUS_38860 gene xerC 3270 2227 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_38860 5383 3812 gene locus_tag LOCUS_38870 5383 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38870 7682 5400 gene locus_tag LOCUS_38880 7682 5400 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_38880 7841 8038 gene locus_tag LOCUS_38890 7841 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38890 8628 10709 gene locus_tag LOCUS_38900 8628 10709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38900 10706 12838 gene locus_tag LOCUS_38910 10706 12838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38910 13578 12817 gene locus_tag LOCUS_38920 13578 12817 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405277.1 protein_id gnl|my_center|LOCUS_38920 15074 13575 gene locus_tag LOCUS_38930 15074 13575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38930 >Feature sequence087 1946 1041 gene locus_tag LOCUS_38940 1946 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38940 2307 2594 gene locus_tag LOCUS_38950 2307 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38950 2679 4469 gene locus_tag LOCUS_38960 2679 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38960 4466 5347 gene locus_tag LOCUS_38970 4466 5347 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582429.1 protein_id gnl|my_center|LOCUS_38970 5344 6387 gene locus_tag LOCUS_38980 gene hflK 5344 6387 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_38980 8577 6886 gene locus_tag LOCUS_38990 8577 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_38990 8771 9214 gene locus_tag LOCUS_39000 8771 9214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39000 9225 11906 gene locus_tag LOCUS_39010 9225 11906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39010 11911 12684 gene locus_tag LOCUS_39020 11911 12684 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_39020 12745 14124 gene locus_tag LOCUS_39030 12745 14124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39030 >Feature sequence088 1117 1227 gene locus_tag LOCUS_r00010 1117 1227 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 2137 1391 gene locus_tag LOCUS_39040 gene rlmB 2137 1391 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887393.1 protein_id gnl|my_center|LOCUS_39040 2273 2863 gene locus_tag LOCUS_39050 2273 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39050 3596 2913 gene locus_tag LOCUS_39060 3596 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39060 4063 5793 gene locus_tag LOCUS_39070 4063 5793 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080010.1 protein_id gnl|my_center|LOCUS_39070 6697 5798 gene locus_tag LOCUS_39080 6697 5798 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704637.1 protein_id gnl|my_center|LOCUS_39080 7988 6702 gene locus_tag LOCUS_39090 7988 6702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112480.1 protein_id gnl|my_center|LOCUS_39090 9346 8117 gene locus_tag LOCUS_39100 9346 8117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39100 11646 9604 gene locus_tag LOCUS_39110 11646 9604 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941590.1 protein_id gnl|my_center|LOCUS_39110 12894 11695 gene locus_tag LOCUS_39120 12894 11695 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814068.1 protein_id gnl|my_center|LOCUS_39120 >Feature sequence089 346 1761 gene locus_tag LOCUS_39130 346 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39130 2419 1769 gene locus_tag LOCUS_39140 2419 1769 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065832.1 protein_id gnl|my_center|LOCUS_39140 3090 2494 gene locus_tag LOCUS_39150 3090 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39150 3336 4862 gene locus_tag LOCUS_39160 3336 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39160 5007 6194 gene locus_tag LOCUS_39170 5007 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39170 6214 7578 gene locus_tag LOCUS_39180 6214 7578 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_39180 8612 7584 gene locus_tag LOCUS_39190 8612 7584 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_39190 9817 8603 gene locus_tag LOCUS_39200 9817 8603 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176623.1 protein_id gnl|my_center|LOCUS_39200 10862 9825 gene locus_tag LOCUS_39210 10862 9825 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_39210 12307 10859 gene locus_tag LOCUS_39220 12307 10859 CDS product putative O-glycosylation ligase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390842.1 protein_id gnl|my_center|LOCUS_39220 13635 12310 gene locus_tag LOCUS_39230 13635 12310 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060802.1 protein_id gnl|my_center|LOCUS_39230 >Feature sequence090 195 1472 gene locus_tag LOCUS_39240 gene hutI 195 1472 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532303.1 protein_id gnl|my_center|LOCUS_39240 2645 1521 gene locus_tag LOCUS_39250 2645 1521 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000654729.1 protein_id gnl|my_center|LOCUS_39250 2887 4617 gene locus_tag LOCUS_39260 2887 4617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39260 5491 4862 gene locus_tag LOCUS_39270 5491 4862 CDS product RpiB/LacA/LacB family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035410.1 protein_id gnl|my_center|LOCUS_39270 5728 7398 gene locus_tag LOCUS_39280 5728 7398 CDS product putative transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175115.1 protein_id gnl|my_center|LOCUS_39280 7457 7672 gene locus_tag LOCUS_39290 7457 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940932.1 protein_id gnl|my_center|LOCUS_39290 7795 9534 gene locus_tag LOCUS_39300 7795 9534 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879425.1 protein_id gnl|my_center|LOCUS_39300 9744 9577 gene locus_tag LOCUS_39310 9744 9577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39310 10806 9913 gene locus_tag LOCUS_39320 10806 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39320 12601 10859 gene locus_tag LOCUS_39330 12601 10859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39330 <13669 12628 gene locus_tag LOCUS_39340 <13669 12628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_063172931.1:tetratricopeptide repeat-containing sulfotransferase family protein >Feature sequence091 287 2047 gene locus_tag LOCUS_39350 287 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39350 2044 2466 gene locus_tag LOCUS_39360 2044 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39360 2463 3647 gene locus_tag LOCUS_39370 2463 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39370 3650 4870 gene locus_tag LOCUS_39380 3650 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39380 6182 5124 gene locus_tag LOCUS_39390 6182 5124 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942134.1 protein_id gnl|my_center|LOCUS_39390 7117 6170 gene locus_tag LOCUS_39400 7117 6170 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_39400 8424 7114 gene locus_tag LOCUS_39410 8424 7114 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393758.1 protein_id gnl|my_center|LOCUS_39410 8558 10399 gene locus_tag LOCUS_39420 8558 10399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39420 11573 10413 gene locus_tag LOCUS_39430 11573 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39430 12463 11573 gene locus_tag LOCUS_39440 12463 11573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39440 >Feature sequence092 352 101 gene locus_tag LOCUS_39450 352 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39450 234 1943 gene locus_tag LOCUS_39460 234 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39460 3038 1956 gene locus_tag LOCUS_39470 3038 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39470 3229 3909 gene locus_tag LOCUS_39480 3229 3909 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986744.1 protein_id gnl|my_center|LOCUS_39480 4173 4850 gene locus_tag LOCUS_39490 4173 4850 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986744.1 protein_id gnl|my_center|LOCUS_39490 5238 4954 gene locus_tag LOCUS_39500 5238 4954 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945172.1 protein_id gnl|my_center|LOCUS_39500 6566 5481 gene locus_tag LOCUS_39510 6566 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39510 7503 6577 gene locus_tag LOCUS_39520 7503 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39520 9722 7572 gene locus_tag LOCUS_39530 9722 7572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39530 9918 11123 gene locus_tag LOCUS_39540 9918 11123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39540 11498 11713 gene locus_tag LOCUS_39550 11498 11713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39550 11691 12623 gene locus_tag LOCUS_39560 11691 12623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39560 >Feature sequence093 2274 178 gene locus_tag LOCUS_39570 gene fusA 2274 178 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_39570 3020 2550 gene locus_tag LOCUS_39580 gene rpsG 3020 2550 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943490.1 protein_id gnl|my_center|LOCUS_39580 3406 3035 gene locus_tag LOCUS_39590 gene rpsL 3406 3035 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869933.1 protein_id gnl|my_center|LOCUS_39590 7756 3530 gene locus_tag LOCUS_39600 gene rpoC 7756 3530 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_39600 12074 7803 gene locus_tag LOCUS_39610 gene rpoB 12074 7803 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_39610 12631 12242 gene locus_tag LOCUS_39620 gene rplL 12631 12242 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_39620 >Feature sequence094 1315 107 gene locus_tag LOCUS_39630 1315 107 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869162.1 protein_id gnl|my_center|LOCUS_39630 1488 2930 gene locus_tag LOCUS_39640 1488 2930 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948061.1 protein_id gnl|my_center|LOCUS_39640 5601 2956 gene locus_tag LOCUS_39650 5601 2956 CDS product carbohydrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205661056.1 protein_id gnl|my_center|LOCUS_39650 5850 6233 gene locus_tag LOCUS_39660 5850 6233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39660 6259 7704 gene locus_tag LOCUS_39670 6259 7704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39670 7719 9269 gene locus_tag LOCUS_39680 7719 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39680 11088 9328 gene locus_tag LOCUS_39690 11088 9328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39690 12051 11092 gene locus_tag LOCUS_39700 12051 11092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39700 >Feature sequence095 346 2094 gene locus_tag LOCUS_39710 346 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39710 2097 4019 gene locus_tag LOCUS_39720 2097 4019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39720 4765 4016 gene locus_tag LOCUS_39730 gene tatC 4765 4016 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_39730 5582 4902 gene locus_tag LOCUS_39740 5582 4902 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969534.1 protein_id gnl|my_center|LOCUS_39740 6257 5592 gene locus_tag LOCUS_39750 6257 5592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39750 7124 6345 gene locus_tag LOCUS_39760 7124 6345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39760 7687 7130 gene locus_tag LOCUS_39770 7687 7130 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_39770 8070 9527 gene locus_tag LOCUS_39780 8070 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39780 9511 10653 gene locus_tag LOCUS_39790 gene galK 9511 10653 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028786.1 protein_id gnl|my_center|LOCUS_39790 10705 11433 gene locus_tag LOCUS_39800 10705 11433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39800 >Feature sequence096 383 1027 gene locus_tag LOCUS_39810 383 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39810 1027 2391 gene locus_tag LOCUS_39820 1027 2391 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_39820 2397 3263 gene locus_tag LOCUS_39830 2397 3263 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545543.1 protein_id gnl|my_center|LOCUS_39830 3266 4186 gene locus_tag LOCUS_39840 3266 4186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_39840 4183 5139 gene locus_tag LOCUS_39850 4183 5139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_39850 5136 6266 gene locus_tag LOCUS_39860 5136 6266 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_39860 6276 7415 gene locus_tag LOCUS_39870 6276 7415 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_39870 7719 8285 gene locus_tag LOCUS_39880 7719 8285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39880 8428 9588 gene locus_tag LOCUS_39890 8428 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39890 9625 10272 gene locus_tag LOCUS_39900 9625 10272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39900 10393 10905 gene locus_tag LOCUS_39910 10393 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39910 10940 11230 gene locus_tag LOCUS_39920 10940 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39920 11255 11554 gene locus_tag LOCUS_39930 11255 11554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39930 >Feature sequence097 1893 658 gene locus_tag LOCUS_39940 1893 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39940 2764 1880 gene locus_tag LOCUS_39950 gene truA 2764 1880 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258260.1 protein_id gnl|my_center|LOCUS_39950 3461 2769 gene locus_tag LOCUS_39960 3461 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39960 4519 3458 gene locus_tag LOCUS_39970 4519 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39970 5793 4636 gene locus_tag LOCUS_39980 5793 4636 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065191.1 protein_id gnl|my_center|LOCUS_39980 6006 6509 gene locus_tag LOCUS_39990 6006 6509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_39990 6530 7453 gene locus_tag LOCUS_40000 gene nadA 6530 7453 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_40000 7997 7467 gene locus_tag LOCUS_40010 7997 7467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40010 8461 8042 gene locus_tag LOCUS_40020 8461 8042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40020 11267 8529 gene locus_tag LOCUS_40030 11267 8529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40030 11377 11769 gene locus_tag LOCUS_40040 11377 11769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40040 >Feature sequence098 957 148 gene locus_tag LOCUS_40050 957 148 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404263.1 protein_id gnl|my_center|LOCUS_40050 1127 3301 gene locus_tag LOCUS_40060 1127 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40060 3331 3807 gene locus_tag LOCUS_40070 gene greA 3331 3807 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920688.1 protein_id gnl|my_center|LOCUS_40070 4513 3827 gene locus_tag LOCUS_40080 4513 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40080 5618 4599 gene locus_tag LOCUS_40090 5618 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40090 6035 5658 gene locus_tag LOCUS_40100 6035 5658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40100 8643 6052 gene locus_tag LOCUS_40110 8643 6052 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141986.1 protein_id gnl|my_center|LOCUS_40110 9817 9227 gene locus_tag LOCUS_40120 9817 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40120 10988 9837 gene locus_tag LOCUS_40130 10988 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40130 11620 11000 gene locus_tag LOCUS_40140 11620 11000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40140 >Feature sequence099 219 734 gene locus_tag LOCUS_40150 219 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40150 739 2838 gene locus_tag LOCUS_40160 739 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40160 2857 3159 gene locus_tag LOCUS_40170 2857 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40170 4500 3148 gene locus_tag LOCUS_40180 gene rimO 4500 3148 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943823.1 protein_id gnl|my_center|LOCUS_40180 5477 4497 gene locus_tag LOCUS_40190 5477 4497 CDS product 2-hydroxyacyl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943556.1 protein_id gnl|my_center|LOCUS_40190 5809 5489 gene locus_tag LOCUS_40200 5809 5489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40200 6451 5882 gene locus_tag LOCUS_40210 6451 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40210 6674 8494 gene locus_tag LOCUS_40220 6674 8494 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122985.1 protein_id gnl|my_center|LOCUS_40220 8498 8899 gene locus_tag LOCUS_40230 8498 8899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40230 9661 8891 gene locus_tag LOCUS_40240 9661 8891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40240 9900 9658 gene locus_tag LOCUS_40250 9900 9658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40250 10864 10403 gene locus_tag LOCUS_40260 10864 10403 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_40260 >Feature sequence100 268 1287 gene locus_tag LOCUS_40270 268 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40270 1990 1292 gene locus_tag LOCUS_40280 1990 1292 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_40280 2259 2065 gene locus_tag LOCUS_40290 2259 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40290 4382 2403 gene locus_tag LOCUS_40300 4382 2403 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_40300 5497 6279 gene locus_tag LOCUS_40310 5497 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40310 6342 7166 gene locus_tag LOCUS_40320 6342 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40320 7179 7772 gene locus_tag LOCUS_40330 7179 7772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40330 9876 7810 gene locus_tag LOCUS_40340 gene glyS 9876 7810 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_40340 10796 9873 gene locus_tag LOCUS_40350 gene glyQ 10796 9873 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_40350 >Feature sequence101 2616 832 gene locus_tag LOCUS_40360 2616 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40360 5258 2613 gene locus_tag LOCUS_40370 gene mutS 5258 2613 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_40370 6776 5361 gene locus_tag LOCUS_40380 6776 5361 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391671.1 protein_id gnl|my_center|LOCUS_40380 7652 6795 gene locus_tag LOCUS_40390 7652 6795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40390 8638 7718 gene locus_tag LOCUS_40400 8638 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40400 9135 8635 gene locus_tag LOCUS_40410 9135 8635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40410 9365 9141 gene locus_tag LOCUS_40420 9365 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40420 9692 9375 gene locus_tag LOCUS_40430 9692 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40430 11149 9689 gene locus_tag LOCUS_40440 gene selA 11149 9689 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393981.1 protein_id gnl|my_center|LOCUS_40440 >Feature sequence102 1887 883 gene locus_tag LOCUS_40450 1887 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40450 3475 2630 gene locus_tag LOCUS_40460 3475 2630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40460 4908 3472 gene locus_tag LOCUS_40470 4908 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40470 5372 4983 gene locus_tag LOCUS_40480 5372 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40480 6093 5383 gene locus_tag LOCUS_40490 6093 5383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40490 6878 6237 gene locus_tag LOCUS_40500 gene pgsA 6878 6237 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_40500 7484 6882 gene locus_tag LOCUS_40510 7484 6882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40510 7672 9273 gene locus_tag LOCUS_40520 gene nadB 7672 9273 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_40520 10465 9539 gene locus_tag LOCUS_40530 10465 9539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40530 >Feature sequence103 1251 187 gene locus_tag LOCUS_40540 gene pseI 1251 187 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_40540 2011 1235 gene locus_tag LOCUS_40550 2011 1235 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004544386.1 protein_id gnl|my_center|LOCUS_40550 3067 2024 gene locus_tag LOCUS_40560 gene pseG 3067 2024 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986989.1 protein_id gnl|my_center|LOCUS_40560 3374 5599 gene locus_tag LOCUS_40570 3374 5599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40570 6128 5520 gene locus_tag LOCUS_40580 6128 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40580 8788 6209 gene locus_tag LOCUS_40590 8788 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40590 10674 9013 gene locus_tag LOCUS_40600 gene hutU 10674 9013 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_40600 10785 11118 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcagccccccgtgcggggggagcac >Feature sequence104 3384 334 gene locus_tag LOCUS_40610 3384 334 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_40610 4348 3419 gene locus_tag LOCUS_40620 4348 3419 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_40620 4696 5931 gene locus_tag LOCUS_40630 4696 5931 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393061.1 protein_id gnl|my_center|LOCUS_40630 5957 6418 gene locus_tag LOCUS_40640 gene gspG 5957 6418 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_40640 6426 6992 gene locus_tag LOCUS_40650 6426 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40650 6989 7498 gene locus_tag LOCUS_40660 6989 7498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40660 7495 8304 gene locus_tag LOCUS_40670 7495 8304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40670 8304 9455 gene locus_tag LOCUS_40680 8304 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40680 9816 10397 gene locus_tag LOCUS_40690 9816 10397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40690 10500 10691 gene locus_tag LOCUS_40700 10500 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40700 >Feature sequence105 5397 1405 gene locus_tag LOCUS_40710 5397 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40710 6085 6726 gene locus_tag LOCUS_40720 6085 6726 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193838.1 protein_id gnl|my_center|LOCUS_40720 7927 6737 gene locus_tag LOCUS_40730 7927 6737 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_40730 8512 7949 gene locus_tag LOCUS_40740 8512 7949 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020386.1 protein_id gnl|my_center|LOCUS_40740 10165 8558 gene locus_tag LOCUS_40750 10165 8558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40750 10310 10753 gene locus_tag LOCUS_40760 10310 10753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40760 >Feature sequence106 2916 610 gene locus_tag LOCUS_40770 2916 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40770 3148 4125 gene locus_tag LOCUS_40780 3148 4125 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_40780 4122 5420 gene locus_tag LOCUS_40790 4122 5420 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_40790 8019 5443 gene locus_tag LOCUS_40800 8019 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40800 9614 8016 gene locus_tag LOCUS_40810 9614 8016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40810 10591 9785 gene locus_tag LOCUS_40820 10591 9785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40820 >Feature sequence107 1471 149 gene locus_tag LOCUS_40830 1471 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40830 2812 1481 gene locus_tag LOCUS_40840 2812 1481 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_40840 3964 2831 gene locus_tag LOCUS_40850 3964 2831 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942417.1 protein_id gnl|my_center|LOCUS_40850 4873 3968 gene locus_tag LOCUS_40860 4873 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40860 5550 4870 gene locus_tag LOCUS_40870 gene ftsE 5550 4870 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768285.1 protein_id gnl|my_center|LOCUS_40870 6375 5668 gene locus_tag LOCUS_40880 6375 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40880 6661 7926 gene locus_tag LOCUS_40890 6661 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40890 8003 9175 gene locus_tag LOCUS_40900 8003 9175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40900 >Feature sequence108 304 990 gene locus_tag LOCUS_40910 304 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40910 2987 1068 gene locus_tag LOCUS_40920 2987 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40920 3206 5626 gene locus_tag LOCUS_40930 gene leuS 3206 5626 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392105.1 protein_id gnl|my_center|LOCUS_40930 5835 5623 gene locus_tag LOCUS_40940 5835 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40940 6029 5853 gene locus_tag LOCUS_40950 6029 5853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40950 6276 7556 gene locus_tag LOCUS_40960 6276 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40960 7713 8555 gene locus_tag LOCUS_40970 7713 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40970 10336 8639 gene locus_tag LOCUS_40980 10336 8639 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_40980 >Feature sequence109 1926 217 gene locus_tag LOCUS_40990 1926 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_40990 3839 2061 gene locus_tag LOCUS_41000 3839 2061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41000 4290 5888 gene locus_tag LOCUS_41010 4290 5888 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_41010 6332 5934 gene locus_tag LOCUS_41020 6332 5934 CDS product DUF488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200901.1 protein_id gnl|my_center|LOCUS_41020 6844 8334 gene locus_tag LOCUS_41030 6844 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41030 8433 9647 gene locus_tag LOCUS_41040 8433 9647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_41040 >Feature sequence110 2699 774 gene locus_tag LOCUS_41050 2699 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41050 2968 3615 gene locus_tag LOCUS_41060 gene purN 2968 3615 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209601260.1 protein_id gnl|my_center|LOCUS_41060 3643 4896 gene locus_tag LOCUS_41070 3643 4896 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_41070 5301 6269 gene locus_tag LOCUS_41080 5301 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41080 7465 6326 gene locus_tag LOCUS_41090 7465 6326 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_41090 8690 7545 gene locus_tag LOCUS_41100 gene acdA 8690 7545 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_41100 >Feature sequence111 270 1658 gene locus_tag LOCUS_41110 270 1658 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_41110 2276 1752 gene locus_tag LOCUS_41120 2276 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41120 2687 3427 gene locus_tag LOCUS_41130 2687 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41130 3596 4531 gene locus_tag LOCUS_41140 gene chlG 3596 4531 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257954.1 protein_id gnl|my_center|LOCUS_41140 4521 5822 gene locus_tag LOCUS_41150 4521 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41150 5904 7358 gene locus_tag LOCUS_41160 5904 7358 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_41160 7986 7336 gene locus_tag LOCUS_41170 7986 7336 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903682.1 protein_id gnl|my_center|LOCUS_41170 >Feature sequence112 116 346 gene locus_tag LOCUS_41180 116 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41180 1954 419 gene locus_tag LOCUS_41190 1954 419 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_41190 2105 2863 gene locus_tag LOCUS_41200 2105 2863 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401910.1 protein_id gnl|my_center|LOCUS_41200 3093 4595 gene locus_tag LOCUS_41210 gene glgA 3093 4595 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_41210 5349 4603 gene locus_tag LOCUS_41220 5349 4603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_41220 6143 5349 gene locus_tag LOCUS_41230 6143 5349 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_41230 7018 6140 gene locus_tag LOCUS_41240 7018 6140 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259594.1 protein_id gnl|my_center|LOCUS_41240 7932 7015 gene locus_tag LOCUS_41250 7932 7015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41250 >Feature sequence113 503 2245 gene locus_tag LOCUS_41260 503 2245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41260 2242 4635 gene locus_tag LOCUS_41270 2242 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839139.1 protein_id gnl|my_center|LOCUS_41270 4729 6399 gene locus_tag LOCUS_41280 4729 6399 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545239.1 protein_id gnl|my_center|LOCUS_41280 6472 6547 gene locus_tag LOCUS_t00460 6472 6547 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6806 7036 gene locus_tag LOCUS_41290 6806 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41290 7033 7869 gene locus_tag LOCUS_41300 7033 7869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41300 >Feature sequence114 1410 205 gene locus_tag LOCUS_41310 1410 205 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008922.1 protein_id gnl|my_center|LOCUS_41310 2573 1407 gene locus_tag LOCUS_41320 2573 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41320 3537 2581 gene locus_tag LOCUS_41330 3537 2581 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109013.1 protein_id gnl|my_center|LOCUS_41330 4193 3534 gene locus_tag LOCUS_41340 4193 3534 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393814.1 protein_id gnl|my_center|LOCUS_41340 5612 4203 gene locus_tag LOCUS_41350 5612 4203 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_41350 5756 6538 gene locus_tag LOCUS_41360 gene mazG 5756 6538 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_41360 6693 7076 gene locus_tag LOCUS_41370 6693 7076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41370 >Feature sequence115 231 2594 gene locus_tag LOCUS_41380 231 2594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41380 2591 3067 gene locus_tag LOCUS_41390 2591 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41390 3226 6744 gene locus_tag LOCUS_41400 gene mfd 3226 6744 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940695.1 protein_id gnl|my_center|LOCUS_41400 >Feature sequence116 660 256 gene locus_tag LOCUS_41410 660 256 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392136.1 protein_id gnl|my_center|LOCUS_41410 1279 842 gene locus_tag LOCUS_41420 1279 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392741.1 protein_id gnl|my_center|LOCUS_41420 2624 1299 gene locus_tag LOCUS_41430 2624 1299 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459119.1 protein_id gnl|my_center|LOCUS_41430 2811 3539 gene locus_tag LOCUS_41440 2811 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41440 3559 5367 gene locus_tag LOCUS_41450 3559 5367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41450 6538 5408 gene locus_tag LOCUS_41460 6538 5408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41460 6817 6587 gene locus_tag LOCUS_41470 6817 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41470 >Feature sequence117 899 321 gene locus_tag LOCUS_41480 899 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41480 1677 934 gene locus_tag LOCUS_41490 1677 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41490 2084 1689 gene locus_tag LOCUS_41500 2084 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41500 3571 2099 gene locus_tag LOCUS_41510 3571 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41510 3994 4281 gene locus_tag LOCUS_41520 gene groES 3994 4281 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770495.1 protein_id gnl|my_center|LOCUS_41520 4331 5974 gene locus_tag LOCUS_41530 gene groL 4331 5974 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_41530 >Feature sequence118 204 809 gene locus_tag LOCUS_41540 gene lexA 204 809 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942262.1 protein_id gnl|my_center|LOCUS_41540 928 2118 gene locus_tag LOCUS_41550 gene hydF 928 2118 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939056.1 protein_id gnl|my_center|LOCUS_41550 2115 3137 gene locus_tag LOCUS_41560 gene hydE 2115 3137 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079975.1 protein_id gnl|my_center|LOCUS_41560 3118 4497 gene locus_tag LOCUS_41570 3118 4497 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939054.1 protein_id gnl|my_center|LOCUS_41570 4542 5942 gene locus_tag LOCUS_41580 gene hydG 4542 5942 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079985.1 protein_id gnl|my_center|LOCUS_41580 >Feature sequence119 443 1180 gene locus_tag LOCUS_41590 443 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41590 2535 1225 gene locus_tag LOCUS_41600 2535 1225 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948947.1 protein_id gnl|my_center|LOCUS_41600 3587 2634 gene locus_tag LOCUS_41610 3587 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41610 3996 4862 gene locus_tag LOCUS_41620 3996 4862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41620 5330 4914 gene locus_tag LOCUS_41630 5330 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41630 >Feature sequence120 414 1292 gene locus_tag LOCUS_41640 414 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41640 1337 3916 gene locus_tag LOCUS_41650 gene gspD 1337 3916 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009315212.1 protein_id gnl|my_center|LOCUS_41650 3923 5629 gene locus_tag LOCUS_41660 gene gspE 3923 5629 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041913993.1 protein_id gnl|my_center|LOCUS_41660 >Feature sequence121 246 455 gene locus_tag LOCUS_41670 246 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41670 1404 475 gene locus_tag LOCUS_41680 1404 475 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020974.1 protein_id gnl|my_center|LOCUS_41680 2137 1406 gene locus_tag LOCUS_41690 2137 1406 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020975.1 protein_id gnl|my_center|LOCUS_41690 3248 2226 gene locus_tag LOCUS_41700 3248 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41700 5012 3627 gene locus_tag LOCUS_41710 5012 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41710 >Feature sequence122 2748 829 gene locus_tag LOCUS_41720 2748 829 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121692.1 protein_id gnl|my_center|LOCUS_41720 3552 2845 gene locus_tag LOCUS_41730 3552 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41730 3868 3569 gene locus_tag LOCUS_41740 3868 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41740 4545 3952 gene locus_tag LOCUS_41750 4545 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41750 5035 4703 gene locus_tag LOCUS_41760 5035 4703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41760 >Feature sequence123 323 616 gene locus_tag LOCUS_41770 323 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41770 706 2220 gene locus_tag LOCUS_41780 706 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41780 2224 2988 gene locus_tag LOCUS_41790 2224 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41790 4591 3350 gene locus_tag LOCUS_41800 4591 3350 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173514544.1 protein_id gnl|my_center|LOCUS_41800 4903 5100 gene locus_tag LOCUS_41810 4903 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41810 >Feature sequence124 379 1713 gene locus_tag LOCUS_41820 379 1713 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_41820 1791 2150 gene locus_tag LOCUS_41830 1791 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41830 2173 3969 gene locus_tag LOCUS_41840 2173 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41840 >Feature sequence125 1462 248 gene locus_tag LOCUS_41850 1462 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41850 2010 1459 gene locus_tag LOCUS_41860 2010 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41860 >Feature sequence126 777 1997 gene locus_tag LOCUS_41870 777 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41870 3315 2020 gene locus_tag LOCUS_41880 3315 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41880 3799 4002 gene locus_tag LOCUS_41890 3799 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41890 >Feature sequence127 337 774 gene locus_tag LOCUS_41900 337 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41900 775 2214 gene locus_tag LOCUS_41910 775 2214 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000742927.1 protein_id gnl|my_center|LOCUS_41910 >Feature sequence128 1540 212 gene locus_tag LOCUS_41920 1540 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41920 3282 1612 gene locus_tag LOCUS_41930 3282 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41930 >Feature sequence129 148 375 gene locus_tag LOCUS_41940 148 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41940 2445 562 gene locus_tag LOCUS_41950 gene oadA 2445 562 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_41950 3006 2554 gene locus_tag LOCUS_41960 3006 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_41960 >Feature sequence130 1380 676 gene locus_tag LOCUS_41970 gene rplA 1380 676 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002020168.1 protein_id gnl|my_center|LOCUS_41970 1833 1405 gene locus_tag LOCUS_41980 gene rplK 1833 1405 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_41980 2553 2017 gene locus_tag LOCUS_41990 gene nusG 2553 2017 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_41990 2754 2566 gene locus_tag LOCUS_42000 2754 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42000 2991 2830 gene locus_tag LOCUS_42010 gene rpmG 2991 2830 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904076.1 protein_id gnl|my_center|LOCUS_42010 >Feature sequence131 696 175 gene locus_tag LOCUS_42020 696 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42020 1868 693 gene locus_tag LOCUS_42030 1868 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42030 2864 1941 gene locus_tag LOCUS_42040 2864 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42040 >Feature sequence132 719 928 gene locus_tag LOCUS_42050 719 928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42050 925 1989 gene locus_tag LOCUS_42060 925 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42060 >Feature sequence133 480 226 gene locus_tag LOCUS_42070 480 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42070 1353 646 gene locus_tag LOCUS_42080 1353 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42080 >Feature sequence134 2 1210 gene locus_tag LOCUS_42090 2 1210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_42090