>Feature sequence001 1247 147 gene locus_tag LOCUS_00010 1247 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1514 2524 gene locus_tag LOCUS_00020 gene murB 1514 2524 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106928.1 protein_id gnl|my_center|LOCUS_00020 3328 2537 gene locus_tag LOCUS_00030 3328 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964028.1 protein_id gnl|my_center|LOCUS_00030 3723 3325 gene locus_tag LOCUS_00040 3723 3325 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_00040 4444 3731 gene locus_tag LOCUS_00050 4444 3731 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_00050 9040 4487 gene locus_tag LOCUS_00060 9040 4487 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963727.1 protein_id gnl|my_center|LOCUS_00060 9018 10034 gene locus_tag LOCUS_00070 gene tsaD 9018 10034 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787941.1 protein_id gnl|my_center|LOCUS_00070 10157 10531 gene locus_tag LOCUS_00080 10157 10531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10714 12189 gene locus_tag LOCUS_00090 10714 12189 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107869.1 protein_id gnl|my_center|LOCUS_00090 12400 13053 gene locus_tag LOCUS_00100 12400 13053 CDS product vitamin B12 dependent-methionine synthase activation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137082021.1 protein_id gnl|my_center|LOCUS_00100 13057 14046 gene locus_tag LOCUS_00110 13057 14046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 14217 15344 gene locus_tag LOCUS_00120 gene dnaN 14217 15344 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788748.1 protein_id gnl|my_center|LOCUS_00120 15616 16422 gene locus_tag LOCUS_00130 15616 16422 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788747.1 protein_id gnl|my_center|LOCUS_00130 16430 17041 gene locus_tag LOCUS_00140 16430 17041 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791742.1 protein_id gnl|my_center|LOCUS_00140 17109 17354 gene locus_tag LOCUS_00150 17109 17354 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680104.1 protein_id gnl|my_center|LOCUS_00150 17345 17668 gene locus_tag LOCUS_00160 17345 17668 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680107.1 protein_id gnl|my_center|LOCUS_00160 18479 17685 gene locus_tag LOCUS_00170 18479 17685 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_00170 19752 18538 gene locus_tag LOCUS_00180 19752 18538 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_00180 19852 20376 gene locus_tag LOCUS_00190 19852 20376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_00190 22470 20422 gene locus_tag LOCUS_00200 gene htpG 22470 20422 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_00200 23421 22555 gene locus_tag LOCUS_00210 23421 22555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23471 23677 gene locus_tag LOCUS_00220 23471 23677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 25011 23791 gene locus_tag LOCUS_00230 25011 23791 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_00230 25781 25071 gene locus_tag LOCUS_00240 25781 25071 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_00240 26551 25934 gene locus_tag LOCUS_00250 26551 25934 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658321.1 protein_id gnl|my_center|LOCUS_00250 26750 28180 gene locus_tag LOCUS_00260 gene pyk 26750 28180 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_00260 28173 29006 gene locus_tag LOCUS_00270 28173 29006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 29473 29009 gene locus_tag LOCUS_00280 29473 29009 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080162.1 protein_id gnl|my_center|LOCUS_00280 30706 29600 gene locus_tag LOCUS_00290 30706 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31115 32200 gene locus_tag LOCUS_00300 gene mltG 31115 32200 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_00300 32398 34794 gene locus_tag LOCUS_00310 32398 34794 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202406.1 protein_id gnl|my_center|LOCUS_00310 34805 35599 gene locus_tag LOCUS_00320 34805 35599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36440 35766 gene locus_tag LOCUS_00330 gene kdsB 36440 35766 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_00330 36644 37891 gene locus_tag LOCUS_00340 36644 37891 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_00340 37920 38399 gene locus_tag LOCUS_00350 37920 38399 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017469.1 protein_id gnl|my_center|LOCUS_00350 38406 39686 gene locus_tag LOCUS_00360 38406 39686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39706 40071 gene locus_tag LOCUS_00370 gene secG 39706 40071 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_00370 40335 40613 gene locus_tag LOCUS_00380 40335 40613 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_00380 40640 42274 gene locus_tag LOCUS_00390 gene groL 40640 42274 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763228.1 protein_id gnl|my_center|LOCUS_00390 42362 43519 gene locus_tag LOCUS_00400 42362 43519 CDS product PLP-dependent aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102168594.1 protein_id gnl|my_center|LOCUS_00400 43516 44499 gene locus_tag LOCUS_00410 43516 44499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00410 44548 45300 gene locus_tag LOCUS_00420 44548 45300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00420 47858 45309 gene locus_tag LOCUS_00430 47858 45309 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795608.1 protein_id gnl|my_center|LOCUS_00430 48030 48725 gene locus_tag LOCUS_00440 48030 48725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 50800 48761 gene locus_tag LOCUS_00450 50800 48761 CDS product oligopeptidase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963026.1 protein_id gnl|my_center|LOCUS_00450 52775 50976 gene locus_tag LOCUS_00460 52775 50976 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939228.1 protein_id gnl|my_center|LOCUS_00460 54223 53036 gene locus_tag LOCUS_00470 54223 53036 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785371.1 protein_id gnl|my_center|LOCUS_00470 54826 54236 gene locus_tag LOCUS_00480 54826 54236 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760005.1 protein_id gnl|my_center|LOCUS_00480 55068 54871 gene locus_tag LOCUS_00490 55068 54871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55685 55044 gene locus_tag LOCUS_00500 55685 55044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 56420 55716 gene locus_tag LOCUS_00510 56420 55716 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_00510 56583 58709 gene locus_tag LOCUS_00520 56583 58709 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_00520 59519 58860 gene locus_tag LOCUS_00530 59519 58860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 61871 59529 gene locus_tag LOCUS_00540 61871 59529 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109202.1 protein_id gnl|my_center|LOCUS_00540 62781 62089 gene locus_tag LOCUS_00550 62781 62089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 63119 64075 gene locus_tag LOCUS_00560 gene arcC 63119 64075 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_00560 64130 65131 gene locus_tag LOCUS_00570 gene argF 64130 65131 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885260.1 protein_id gnl|my_center|LOCUS_00570 65603 65121 gene locus_tag LOCUS_00580 65603 65121 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788959.1 protein_id gnl|my_center|LOCUS_00580 68339 65901 gene locus_tag LOCUS_00590 gene feoB 68339 65901 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_00590 68542 69279 gene locus_tag LOCUS_00600 68542 69279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 69953 69576 gene locus_tag LOCUS_00610 69953 69576 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_00610 70142 71092 gene locus_tag LOCUS_00620 gene nusB 70142 71092 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768080.1 protein_id gnl|my_center|LOCUS_00620 71089 71526 gene locus_tag LOCUS_00630 71089 71526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 71551 71874 gene locus_tag LOCUS_00640 gene yajC 71551 71874 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775925.1 protein_id gnl|my_center|LOCUS_00640 72271 73248 gene locus_tag LOCUS_00650 72271 73248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 73248 73841 gene locus_tag LOCUS_00660 gene coaE 73248 73841 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_00660 73910 74374 gene locus_tag LOCUS_00670 73910 74374 CDS product DUF5606 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760341.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence002 1596 595 gene locus_tag LOCUS_00680 1596 595 CDS product GRP family sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471147.1 protein_id gnl|my_center|LOCUS_00680 2909 1857 gene locus_tag LOCUS_00690 2909 1857 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_00690 3483 3010 gene locus_tag LOCUS_00700 3483 3010 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963157.1 protein_id gnl|my_center|LOCUS_00700 4452 4000 gene locus_tag LOCUS_00710 4452 4000 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403898.1 protein_id gnl|my_center|LOCUS_00710 5194 4496 gene locus_tag LOCUS_00720 5194 4496 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963158.1 protein_id gnl|my_center|LOCUS_00720 5453 5725 gene locus_tag LOCUS_00730 5453 5725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 5718 6221 gene locus_tag LOCUS_00740 5718 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 6218 6700 gene locus_tag LOCUS_00750 6218 6700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 6854 6702 gene locus_tag LOCUS_00760 6854 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7483 6872 gene locus_tag LOCUS_00770 7483 6872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 9598 7559 gene locus_tag LOCUS_00780 9598 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 10699 10112 gene locus_tag LOCUS_00790 10699 10112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 12041 10731 gene locus_tag LOCUS_00800 gene murA 12041 10731 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108085.1 protein_id gnl|my_center|LOCUS_00800 12665 12057 gene locus_tag LOCUS_00810 12665 12057 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_00810 15107 12774 gene locus_tag LOCUS_00820 15107 12774 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107378.1 protein_id gnl|my_center|LOCUS_00820 15404 15195 gene locus_tag LOCUS_00830 15404 15195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 16140 17495 gene locus_tag LOCUS_00840 16140 17495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 19847 17691 gene locus_tag LOCUS_00850 19847 17691 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_00850 20077 20526 gene locus_tag LOCUS_00860 gene rpsL 20077 20526 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963473.1 protein_id gnl|my_center|LOCUS_00860 20554 21030 gene locus_tag LOCUS_00870 gene rpsG 20554 21030 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_00870 21057 23168 gene locus_tag LOCUS_00880 gene fusA 21057 23168 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791539.1 protein_id gnl|my_center|LOCUS_00880 23182 23487 gene locus_tag LOCUS_00890 gene rpsJ 23182 23487 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782187.1 protein_id gnl|my_center|LOCUS_00890 23540 24139 gene locus_tag LOCUS_00900 gene rplC 23540 24139 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963469.1 protein_id gnl|my_center|LOCUS_00900 24159 24782 gene locus_tag LOCUS_00910 gene rplD 24159 24782 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782191.1 protein_id gnl|my_center|LOCUS_00910 24798 25088 gene locus_tag LOCUS_00920 gene rplW 24798 25088 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_00920 25095 25919 gene locus_tag LOCUS_00930 gene rplB 25095 25919 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_00930 25928 26203 gene locus_tag LOCUS_00940 gene rpsS 25928 26203 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_00940 26226 26648 gene locus_tag LOCUS_00950 gene rplV 26226 26648 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558069.1 protein_id gnl|my_center|LOCUS_00950 26658 27359 gene locus_tag LOCUS_00960 gene rpsC 26658 27359 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782201.1 protein_id gnl|my_center|LOCUS_00960 27430 27810 gene locus_tag LOCUS_00970 gene rplP 27430 27810 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_00970 27819 28016 gene locus_tag LOCUS_00980 gene rpmC 27819 28016 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782204.1 protein_id gnl|my_center|LOCUS_00980 28029 28286 gene locus_tag LOCUS_00990 gene rpsQ 28029 28286 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963461.1 protein_id gnl|my_center|LOCUS_00990 28289 28654 gene locus_tag LOCUS_01000 gene rplN 28289 28654 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296340.1 protein_id gnl|my_center|LOCUS_01000 28683 29006 gene locus_tag LOCUS_01010 gene rplX 28683 29006 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791554.1 protein_id gnl|my_center|LOCUS_01010 29006 29563 gene locus_tag LOCUS_01020 gene rplE 29006 29563 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_01020 29567 29836 gene locus_tag LOCUS_01030 gene rpsN 29567 29836 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_01030 29868 30260 gene locus_tag LOCUS_01040 gene rpsH 29868 30260 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_01040 30276 30836 gene locus_tag LOCUS_01050 gene rplF 30276 30836 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_01050 30855 31214 gene locus_tag LOCUS_01060 gene rplR 30855 31214 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_01060 31221 31736 gene locus_tag LOCUS_01070 gene rpsE 31221 31736 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_01070 31736 31927 gene locus_tag LOCUS_01080 gene rpmD 31736 31927 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296332.1 protein_id gnl|my_center|LOCUS_01080 31941 32393 gene locus_tag LOCUS_01090 gene rplO 31941 32393 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762046.1 protein_id gnl|my_center|LOCUS_01090 32393 33730 gene locus_tag LOCUS_01100 gene secY 32393 33730 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782223.1 protein_id gnl|my_center|LOCUS_01100 33771 34559 gene locus_tag LOCUS_01110 gene map 33771 34559 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_01110 34561 34779 gene locus_tag LOCUS_01120 gene infA 34561 34779 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_01120 34931 35308 gene locus_tag LOCUS_01130 gene rpsM 34931 35308 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558050.1 protein_id gnl|my_center|LOCUS_01130 35318 35707 gene locus_tag LOCUS_01140 gene rpsK 35318 35707 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_01140 35745 36353 gene locus_tag LOCUS_01150 gene rpsD 35745 36353 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762050.1 protein_id gnl|my_center|LOCUS_01150 36372 37364 gene locus_tag LOCUS_01160 36372 37364 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782229.1 protein_id gnl|my_center|LOCUS_01160 37369 37920 gene locus_tag LOCUS_01170 gene rplQ 37369 37920 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762052.1 protein_id gnl|my_center|LOCUS_01170 38246 40144 gene locus_tag LOCUS_01180 38246 40144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 40158 43487 gene locus_tag LOCUS_01190 40158 43487 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_01190 45222 43489 gene locus_tag LOCUS_01200 45222 43489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 45477 46142 gene locus_tag LOCUS_01210 45477 46142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 46201 47004 gene locus_tag LOCUS_01220 46201 47004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 47016 48692 gene locus_tag LOCUS_01230 gene ettA 47016 48692 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776885.1 protein_id gnl|my_center|LOCUS_01230 48905 50698 gene locus_tag LOCUS_01240 48905 50698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 50781 53645 gene locus_tag LOCUS_01250 50781 53645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 53771 55135 gene locus_tag LOCUS_01260 gene hisS 53771 55135 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_01260 55346 56848 gene locus_tag LOCUS_01270 gene hutH 55346 56848 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962994.1 protein_id gnl|my_center|LOCUS_01270 57452 56976 gene locus_tag LOCUS_01280 57452 56976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 57891 57430 gene locus_tag LOCUS_01290 57891 57430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 58485 57916 gene locus_tag LOCUS_01300 58485 57916 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_01300 59827 58472 gene locus_tag LOCUS_01310 59827 58472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 62032 59999 gene locus_tag LOCUS_01320 62032 59999 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766126.1 protein_id gnl|my_center|LOCUS_01320 62206 63303 gene locus_tag LOCUS_01330 gene ychF 62206 63303 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_01330 64542 63364 gene locus_tag LOCUS_01340 64542 63364 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114146.1 protein_id gnl|my_center|LOCUS_01340 67174 64754 gene locus_tag LOCUS_01350 67174 64754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 68054 69271 gene locus_tag LOCUS_01360 68054 69271 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_01360 >Feature sequence003 1248 349 gene locus_tag LOCUS_01370 1248 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2602 1307 gene locus_tag LOCUS_01380 2602 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3712 2759 gene locus_tag LOCUS_01390 3712 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 4681 4136 gene locus_tag LOCUS_01400 4681 4136 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_01400 5882 4686 gene locus_tag LOCUS_01410 5882 4686 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_01410 6043 7500 gene locus_tag LOCUS_01420 6043 7500 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_01420 7713 7552 gene locus_tag LOCUS_01430 7713 7552 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_01430 8053 8829 gene locus_tag LOCUS_01440 8053 8829 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_01440 8810 9454 gene locus_tag LOCUS_01450 8810 9454 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_01450 11014 9461 gene locus_tag LOCUS_01460 gene citF 11014 9461 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_01460 12278 11058 gene locus_tag LOCUS_01470 12278 11058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 13372 12470 gene locus_tag LOCUS_01480 13372 12470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 13844 13443 gene locus_tag LOCUS_01490 gene mce 13844 13443 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789532.1 protein_id gnl|my_center|LOCUS_01490 17286 14209 gene locus_tag LOCUS_01500 17286 14209 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_01500 17485 20787 gene locus_tag LOCUS_01510 17485 20787 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_01510 21038 21478 gene locus_tag LOCUS_01520 21038 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 21510 22226 gene locus_tag LOCUS_01530 21510 22226 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755966.1 protein_id gnl|my_center|LOCUS_01530 22513 24144 gene locus_tag LOCUS_01540 22513 24144 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392693.1 protein_id gnl|my_center|LOCUS_01540 24435 24226 gene locus_tag LOCUS_01550 24435 24226 CDS product DUF6485 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081411.1 protein_id gnl|my_center|LOCUS_01550 25615 24446 gene locus_tag LOCUS_01560 25615 24446 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789686.1 protein_id gnl|my_center|LOCUS_01560 27634 25679 gene locus_tag LOCUS_01570 27634 25679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 28289 27648 gene locus_tag LOCUS_01580 28289 27648 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_01580 29600 28638 gene locus_tag LOCUS_01590 29600 28638 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01590 30011 29769 gene locus_tag LOCUS_01600 30011 29769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767659.1 protein_id gnl|my_center|LOCUS_01600 31260 30055 gene locus_tag LOCUS_01610 31260 30055 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767660.1 protein_id gnl|my_center|LOCUS_01610 32234 31353 gene locus_tag LOCUS_01620 32234 31353 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767656.1 protein_id gnl|my_center|LOCUS_01620 32387 33442 gene locus_tag LOCUS_01630 32387 33442 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768800.1 protein_id gnl|my_center|LOCUS_01630 33453 34343 gene locus_tag LOCUS_01640 33453 34343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 35535 34510 gene locus_tag LOCUS_01650 35535 34510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 37044 35695 gene locus_tag LOCUS_01660 37044 35695 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_01660 38495 37101 gene locus_tag LOCUS_01670 38495 37101 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767657.1 protein_id gnl|my_center|LOCUS_01670 39383 38505 gene locus_tag LOCUS_01680 gene galU 39383 38505 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876273.1 protein_id gnl|my_center|LOCUS_01680 40442 39438 gene locus_tag LOCUS_01690 40442 39438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 41188 40439 gene locus_tag LOCUS_01700 41188 40439 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_01700 42876 41200 gene locus_tag LOCUS_01710 42876 41200 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_01710 43519 42866 gene locus_tag LOCUS_01720 43519 42866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 44692 43640 gene locus_tag LOCUS_01730 44692 43640 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01730 45043 46206 gene locus_tag LOCUS_01740 45043 46206 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016043.1 protein_id gnl|my_center|LOCUS_01740 48076 46217 gene locus_tag LOCUS_01750 48076 46217 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_01750 50875 48080 gene locus_tag LOCUS_01760 50875 48080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 51903 50884 gene locus_tag LOCUS_01770 51903 50884 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_01770 52125 52946 gene locus_tag LOCUS_01780 52125 52946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 53044 56133 gene locus_tag LOCUS_01790 53044 56133 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_01790 56206 57402 gene locus_tag LOCUS_01800 56206 57402 CDS product 4-O-beta-D-mannosyl-D-glucose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202169.1 protein_id gnl|my_center|LOCUS_01800 57399 59834 gene locus_tag LOCUS_01810 57399 59834 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082399.1 protein_id gnl|my_center|LOCUS_01810 59929 60537 gene locus_tag LOCUS_01820 59929 60537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 60657 62924 gene locus_tag LOCUS_01830 60657 62924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 62963 64510 gene locus_tag LOCUS_01840 62963 64510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 64498 65529 gene locus_tag LOCUS_01850 64498 65529 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211618.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence004 601 2076 gene locus_tag LOCUS_01860 gene crtI 601 2076 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066789316.1 protein_id gnl|my_center|LOCUS_01860 3845 2073 gene locus_tag LOCUS_01870 3845 2073 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796864.1 protein_id gnl|my_center|LOCUS_01870 4159 5259 gene locus_tag LOCUS_01880 4159 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 5282 5806 gene locus_tag LOCUS_01890 gene fldA 5282 5806 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140311.1 protein_id gnl|my_center|LOCUS_01890 5888 6820 gene locus_tag LOCUS_01900 5888 6820 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_01900 6817 8100 gene locus_tag LOCUS_01910 6817 8100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 8233 8982 gene locus_tag LOCUS_01920 gene gpmA 8233 8982 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_01920 9200 9358 gene locus_tag LOCUS_01930 9200 9358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 9528 9992 gene locus_tag LOCUS_01940 9528 9992 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931970.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01940 10149 10586 gene locus_tag LOCUS_01950 10149 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 10590 11132 gene locus_tag LOCUS_01960 10590 11132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 11294 11707 gene locus_tag LOCUS_01970 11294 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 11830 16146 gene locus_tag LOCUS_01980 11830 16146 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203498.1 protein_id gnl|my_center|LOCUS_01980 16158 17291 gene locus_tag LOCUS_01990 16158 17291 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963037.1 protein_id gnl|my_center|LOCUS_01990 17465 18379 gene locus_tag LOCUS_02000 17465 18379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791694.1 protein_id gnl|my_center|LOCUS_02000 19708 18479 gene locus_tag LOCUS_02010 19708 18479 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797236.1 protein_id gnl|my_center|LOCUS_02010 20517 19705 gene locus_tag LOCUS_02020 20517 19705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_02020 20868 20524 gene locus_tag LOCUS_02030 gene rbfA 20868 20524 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761924.1 protein_id gnl|my_center|LOCUS_02030 21160 22149 gene locus_tag LOCUS_02040 gene trpS 21160 22149 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_02040 22349 24301 gene locus_tag LOCUS_02050 gene dnaG 22349 24301 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_02050 24430 25122 gene locus_tag LOCUS_02060 24430 25122 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_02060 26384 25119 gene locus_tag LOCUS_02070 gene metK 26384 25119 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_02070 26513 26439 gene locus_tag LOCUS_t00010 26513 26439 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 26674 27453 gene locus_tag LOCUS_02080 26674 27453 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787611.1 protein_id gnl|my_center|LOCUS_02080 27450 28193 gene locus_tag LOCUS_02090 27450 28193 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_02090 29818 28208 gene locus_tag LOCUS_02100 29818 28208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 29962 31476 gene locus_tag LOCUS_02110 29962 31476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 32108 31473 gene locus_tag LOCUS_02120 32108 31473 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_02120 32211 33383 gene locus_tag LOCUS_02130 32211 33383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_02130 33380 33988 gene locus_tag LOCUS_02140 33380 33988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 33966 35048 gene locus_tag LOCUS_02150 gene mtnA 33966 35048 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529406.1 protein_id gnl|my_center|LOCUS_02150 35069 35821 gene locus_tag LOCUS_02160 35069 35821 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_02160 35847 38024 gene locus_tag LOCUS_02170 gene rnr 35847 38024 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161889612.1 protein_id gnl|my_center|LOCUS_02170 38174 38401 gene locus_tag LOCUS_02180 38174 38401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 40674 38461 gene locus_tag LOCUS_02190 40674 38461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 40827 43067 gene locus_tag LOCUS_02200 40827 43067 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203216.1 protein_id gnl|my_center|LOCUS_02200 43243 43977 gene locus_tag LOCUS_02210 43243 43977 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_02210 43987 45045 gene locus_tag LOCUS_02220 43987 45045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 45100 45855 gene locus_tag LOCUS_02230 45100 45855 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403515.1 protein_id gnl|my_center|LOCUS_02230 45862 46833 gene locus_tag LOCUS_02240 45862 46833 CDS product ligase-associated DNA damage response exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337473.1 protein_id gnl|my_center|LOCUS_02240 47122 47976 gene locus_tag LOCUS_02250 47122 47976 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112902643.1 protein_id gnl|my_center|LOCUS_02250 48442 48206 gene locus_tag LOCUS_02260 48442 48206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 49589 48549 gene locus_tag LOCUS_02270 49589 48549 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927014.1 protein_id gnl|my_center|LOCUS_02270 50079 49600 gene locus_tag LOCUS_02280 50079 49600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 50261 51631 gene locus_tag LOCUS_02290 50261 51631 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943456.1 protein_id gnl|my_center|LOCUS_02290 51628 53019 gene locus_tag LOCUS_02300 51628 53019 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058098.1 protein_id gnl|my_center|LOCUS_02300 53351 53163 gene locus_tag LOCUS_02310 53351 53163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 54015 53446 gene locus_tag LOCUS_02320 54015 53446 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023653.1 protein_id gnl|my_center|LOCUS_02320 54230 56332 gene locus_tag LOCUS_02330 54230 56332 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_02330 56348 56983 gene locus_tag LOCUS_02340 56348 56983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 57140 57832 gene locus_tag LOCUS_02350 57140 57832 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_02350 57882 58445 gene locus_tag LOCUS_02360 57882 58445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 58445 59026 gene locus_tag LOCUS_02370 58445 59026 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868085.1 protein_id gnl|my_center|LOCUS_02370 59469 59023 gene locus_tag LOCUS_02380 59469 59023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 59530 59446 gene locus_tag LOCUS_t00020 59530 59446 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence005 530 1786 gene locus_tag LOCUS_02390 530 1786 CDS product capsule assembly Wzi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180983106.1 protein_id gnl|my_center|LOCUS_02390 2073 1888 gene locus_tag LOCUS_02400 2073 1888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 2842 2258 gene locus_tag LOCUS_02410 2842 2258 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203508.1 protein_id gnl|my_center|LOCUS_02410 4053 2839 gene locus_tag LOCUS_02420 4053 2839 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202424.1 protein_id gnl|my_center|LOCUS_02420 4868 4059 gene locus_tag LOCUS_02430 4868 4059 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795343.1 protein_id gnl|my_center|LOCUS_02430 6114 4861 gene locus_tag LOCUS_02440 6114 4861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 6834 6133 gene locus_tag LOCUS_02450 6834 6133 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674022.1 protein_id gnl|my_center|LOCUS_02450 7540 6839 gene locus_tag LOCUS_02460 7540 6839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 9150 8002 gene locus_tag LOCUS_02470 9150 8002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 9490 9140 gene locus_tag LOCUS_02480 9490 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 11205 10333 gene locus_tag LOCUS_02490 11205 10333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 12421 11477 gene locus_tag LOCUS_02500 12421 11477 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064504886.1 protein_id gnl|my_center|LOCUS_02500 15007 14051 gene locus_tag LOCUS_02510 15007 14051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 15478 15206 gene locus_tag LOCUS_02520 15478 15206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 16625 17605 gene locus_tag LOCUS_02530 16625 17605 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815896.1 protein_id gnl|my_center|LOCUS_02530 19662 17626 gene locus_tag LOCUS_02540 gene metG 19662 17626 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_02540 19719 20630 gene locus_tag LOCUS_02550 19719 20630 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_02550 20634 20996 gene locus_tag LOCUS_02560 20634 20996 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764002.1 protein_id gnl|my_center|LOCUS_02560 21053 21589 gene locus_tag LOCUS_02570 21053 21589 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583637.1 protein_id gnl|my_center|LOCUS_02570 21716 22843 gene locus_tag LOCUS_02580 gene gmd 21716 22843 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_02580 22868 23971 gene locus_tag LOCUS_02590 22868 23971 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808880.1 protein_id gnl|my_center|LOCUS_02590 23976 24479 gene locus_tag LOCUS_02600 23976 24479 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788621.1 protein_id gnl|my_center|LOCUS_02600 24669 27005 gene locus_tag LOCUS_02610 24669 27005 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_02610 27008 27865 gene locus_tag LOCUS_02620 27008 27865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 29092 27887 gene locus_tag LOCUS_02630 29092 27887 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121756.1 protein_id gnl|my_center|LOCUS_02630 29864 29094 gene locus_tag LOCUS_02640 29864 29094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 31865 30027 gene locus_tag LOCUS_02650 31865 30027 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763976.1 protein_id gnl|my_center|LOCUS_02650 35182 31877 gene locus_tag LOCUS_02660 35182 31877 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130856111.1 protein_id gnl|my_center|LOCUS_02660 36626 35424 gene locus_tag LOCUS_02670 36626 35424 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761426.1 protein_id gnl|my_center|LOCUS_02670 37245 36688 gene locus_tag LOCUS_02680 37245 36688 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_02680 37316 38026 gene locus_tag LOCUS_02690 37316 38026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 38519 38016 gene locus_tag LOCUS_02700 38519 38016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 40028 38640 gene locus_tag LOCUS_02710 40028 38640 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107794.1 protein_id gnl|my_center|LOCUS_02710 42645 40222 gene locus_tag LOCUS_02720 42645 40222 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_02720 43278 42808 gene locus_tag LOCUS_02730 gene rnhA 43278 42808 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_02730 45444 43288 gene locus_tag LOCUS_02740 45444 43288 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789096.1 protein_id gnl|my_center|LOCUS_02740 46168 45575 gene locus_tag LOCUS_02750 46168 45575 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_02750 47321 46152 gene locus_tag LOCUS_02760 47321 46152 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_02760 47451 48044 gene locus_tag LOCUS_02770 47451 48044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 48531 49208 gene locus_tag LOCUS_02780 48531 49208 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107524.1 protein_id gnl|my_center|LOCUS_02780 49205 50446 gene locus_tag LOCUS_02790 49205 50446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 50457 51740 gene locus_tag LOCUS_02800 50457 51740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 51751 52677 gene locus_tag LOCUS_02810 51751 52677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 52679 55711 gene locus_tag LOCUS_02820 52679 55711 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_02820 55727 56908 gene locus_tag LOCUS_02830 55727 56908 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108825.1 protein_id gnl|my_center|LOCUS_02830 56982 57446 gene locus_tag LOCUS_02840 56982 57446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 58536 57967 gene locus_tag LOCUS_02850 58536 57967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 59771 58548 gene locus_tag LOCUS_02860 59771 58548 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963213.1 protein_id gnl|my_center|LOCUS_02860 60254 59814 gene locus_tag LOCUS_02870 gene tsaE 60254 59814 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_02870 61804 60251 gene locus_tag LOCUS_02880 61804 60251 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence006 1232 375 gene locus_tag LOCUS_02890 1232 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2446 1400 gene locus_tag LOCUS_02900 2446 1400 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962339.1 protein_id gnl|my_center|LOCUS_02900 2941 2462 gene locus_tag LOCUS_02910 2941 2462 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209282.1 protein_id gnl|my_center|LOCUS_02910 3010 3606 gene locus_tag LOCUS_02920 3010 3606 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_02920 3617 4651 gene locus_tag LOCUS_02930 3617 4651 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_02930 4781 8218 gene locus_tag LOCUS_02940 gene ileS 4781 8218 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_02940 8271 8654 gene locus_tag LOCUS_02950 8271 8654 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_02950 8860 9504 gene locus_tag LOCUS_02960 8860 9504 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787678.1 protein_id gnl|my_center|LOCUS_02960 9791 11329 gene locus_tag LOCUS_02970 9791 11329 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789843.1 protein_id gnl|my_center|LOCUS_02970 11481 12098 gene locus_tag LOCUS_02980 11481 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 12085 14796 gene locus_tag LOCUS_02990 12085 14796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 14853 16520 gene locus_tag LOCUS_03000 14853 16520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 16532 18016 gene locus_tag LOCUS_03010 16532 18016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 18082 18336 gene locus_tag LOCUS_03020 18082 18336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 19031 18348 gene locus_tag LOCUS_03030 19031 18348 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000303.1 protein_id gnl|my_center|LOCUS_03030 19171 20403 gene locus_tag LOCUS_03040 19171 20403 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_03040 20408 21106 gene locus_tag LOCUS_03050 20408 21106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 21128 21442 gene locus_tag LOCUS_03060 21128 21442 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393134.1 protein_id gnl|my_center|LOCUS_03060 21461 21961 gene locus_tag LOCUS_03070 21461 21961 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_03070 22786 22028 gene locus_tag LOCUS_03080 22786 22028 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963507.1 protein_id gnl|my_center|LOCUS_03080 23526 22783 gene locus_tag LOCUS_03090 23526 22783 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_03090 23642 24739 gene locus_tag LOCUS_03100 23642 24739 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_03100 25730 24858 gene locus_tag LOCUS_03110 gene gldN 25730 24858 CDS product gliding motility protein GldN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964072.1 protein_id gnl|my_center|LOCUS_03110 27362 25734 gene locus_tag LOCUS_03120 gene gldM 27362 25734 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_03120 28375 27401 gene locus_tag LOCUS_03130 28375 27401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 29737 28406 gene locus_tag LOCUS_03140 gene gldK 29737 28406 CDS product gliding motility lipoprotein GldK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964075.1 protein_id gnl|my_center|LOCUS_03140 30753 29821 gene locus_tag LOCUS_03150 30753 29821 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_03150 32079 30916 gene locus_tag LOCUS_03160 32079 30916 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_03160 34413 32086 gene locus_tag LOCUS_03170 gene topA 34413 32086 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765309.1 protein_id gnl|my_center|LOCUS_03170 34500 36839 gene locus_tag LOCUS_03180 34500 36839 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_03180 38530 36842 gene locus_tag LOCUS_03190 38530 36842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206616.1 protein_id gnl|my_center|LOCUS_03190 39005 38523 gene locus_tag LOCUS_03200 39005 38523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 40367 39009 gene locus_tag LOCUS_03210 gene radA 40367 39009 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_03210 40894 40370 gene locus_tag LOCUS_03220 40894 40370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 41474 41124 gene locus_tag LOCUS_03230 41474 41124 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785327.1 protein_id gnl|my_center|LOCUS_03230 42336 41488 gene locus_tag LOCUS_03240 gene panC 42336 41488 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202230.1 protein_id gnl|my_center|LOCUS_03240 42602 43432 gene locus_tag LOCUS_03250 42602 43432 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_03250 43447 44733 gene locus_tag LOCUS_03260 43447 44733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 44735 46570 gene locus_tag LOCUS_03270 gene glmS 44735 46570 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962290.1 protein_id gnl|my_center|LOCUS_03270 47650 46583 gene locus_tag LOCUS_03280 gene rfbB 47650 46583 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963426.1 protein_id gnl|my_center|LOCUS_03280 48804 47758 gene locus_tag LOCUS_03290 gene galE 48804 47758 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107362.1 protein_id gnl|my_center|LOCUS_03290 50095 48806 gene locus_tag LOCUS_03300 50095 48806 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_03300 51063 50113 gene locus_tag LOCUS_03310 51063 50113 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_03310 51684 51100 gene locus_tag LOCUS_03320 51684 51100 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03320 52892 51765 gene locus_tag LOCUS_03330 52892 51765 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_03330 55548 53080 gene locus_tag LOCUS_03340 55548 53080 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202522.1 protein_id gnl|my_center|LOCUS_03340 57412 55802 gene locus_tag LOCUS_03350 57412 55802 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963409.1 protein_id gnl|my_center|LOCUS_03350 58911 58633 gene locus_tag LOCUS_03360 58911 58633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 >Feature sequence007 1540 179 gene locus_tag LOCUS_03370 1540 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 2083 2811 gene locus_tag LOCUS_03380 2083 2811 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000993603.1 protein_id gnl|my_center|LOCUS_03380 2867 3775 gene locus_tag LOCUS_03390 gene cysD 2867 3775 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_03390 3884 5122 gene locus_tag LOCUS_03400 3884 5122 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_03400 5223 6314 gene locus_tag LOCUS_03410 5223 6314 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_03410 6324 7376 gene locus_tag LOCUS_03420 6324 7376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 9076 7559 gene locus_tag LOCUS_03430 9076 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 9221 12670 gene locus_tag LOCUS_03440 9221 12670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 12667 15324 gene locus_tag LOCUS_03450 12667 15324 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202101.1 protein_id gnl|my_center|LOCUS_03450 15659 18019 gene locus_tag LOCUS_03460 15659 18019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 18029 20566 gene locus_tag LOCUS_03470 18029 20566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 21401 20556 gene locus_tag LOCUS_03480 21401 20556 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_03480 22627 21542 gene locus_tag LOCUS_03490 22627 21542 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_03490 24206 22758 gene locus_tag LOCUS_03500 24206 22758 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789122.1 protein_id gnl|my_center|LOCUS_03500 27338 24261 gene locus_tag LOCUS_03510 27338 24261 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203176.1 protein_id gnl|my_center|LOCUS_03510 27977 27438 gene locus_tag LOCUS_03520 27977 27438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 29631 28570 gene locus_tag LOCUS_03530 29631 28570 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761587.1 protein_id gnl|my_center|LOCUS_03530 30604 29624 gene locus_tag LOCUS_03540 30604 29624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 31732 30608 gene locus_tag LOCUS_03550 31732 30608 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107521.1 protein_id gnl|my_center|LOCUS_03550 32006 32815 gene locus_tag LOCUS_03560 32006 32815 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393019.1 protein_id gnl|my_center|LOCUS_03560 32881 33930 gene locus_tag LOCUS_03570 32881 33930 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869322.1 protein_id gnl|my_center|LOCUS_03570 34439 33990 gene locus_tag LOCUS_03580 34439 33990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 34503 34721 gene locus_tag LOCUS_03590 34503 34721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 34718 34984 gene locus_tag LOCUS_03600 34718 34984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 37432 35045 gene locus_tag LOCUS_03610 37432 35045 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926964.1 protein_id gnl|my_center|LOCUS_03610 37687 41181 gene locus_tag LOCUS_03620 gene dnaE 37687 41181 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_03620 41223 41543 gene locus_tag LOCUS_03630 gene trxA 41223 41543 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784741.1 protein_id gnl|my_center|LOCUS_03630 41549 42130 gene locus_tag LOCUS_03640 41549 42130 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802006.1 protein_id gnl|my_center|LOCUS_03640 45368 42132 gene locus_tag LOCUS_03650 45368 42132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 47623 45365 gene locus_tag LOCUS_03660 47623 45365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 48889 47816 gene locus_tag LOCUS_03670 gene ribD 48889 47816 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964125.1 protein_id gnl|my_center|LOCUS_03670 48913 49770 gene locus_tag LOCUS_03680 gene prmC 48913 49770 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_03680 49781 50599 gene locus_tag LOCUS_03690 49781 50599 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_03690 50599 51717 gene locus_tag LOCUS_03700 50599 51717 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_03700 51920 52495 gene locus_tag LOCUS_03710 51920 52495 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_03710 53334 52612 gene locus_tag LOCUS_03720 53334 52612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 54003 53470 gene locus_tag LOCUS_03730 gene rimM 54003 53470 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_03730 54600 54031 gene locus_tag LOCUS_03740 54600 54031 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763025.1 protein_id gnl|my_center|LOCUS_03740 <56077 54736 gene locus_tag LOCUS_03750 <56077 54736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932175.1:DUF389 domain-containing protein >Feature sequence008 1260 625 gene locus_tag LOCUS_03760 1260 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1799 1413 gene locus_tag LOCUS_03770 1799 1413 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_03770 2080 2760 gene locus_tag LOCUS_03780 2080 2760 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789787.1 protein_id gnl|my_center|LOCUS_03780 3414 3052 gene locus_tag LOCUS_03790 3414 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4307 3657 gene locus_tag LOCUS_03800 4307 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 6135 4369 gene locus_tag LOCUS_03810 gene aspS 6135 4369 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765710.1 protein_id gnl|my_center|LOCUS_03810 6204 6656 gene locus_tag LOCUS_03820 6204 6656 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_03820 6802 6993 gene locus_tag LOCUS_03830 6802 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7008 7943 gene locus_tag LOCUS_03840 gene nadA 7008 7943 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762783.1 protein_id gnl|my_center|LOCUS_03840 9269 8028 gene locus_tag LOCUS_03850 gene aroA 9269 8028 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_03850 9370 9849 gene locus_tag LOCUS_03860 9370 9849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 9836 10942 gene locus_tag LOCUS_03870 gene dprA 9836 10942 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769083.1 protein_id gnl|my_center|LOCUS_03870 11112 12452 gene locus_tag LOCUS_03880 gene gdhA 11112 12452 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_03880 12552 13322 gene locus_tag LOCUS_03890 12552 13322 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_03890 13417 14445 gene locus_tag LOCUS_03900 13417 14445 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_03900 14510 14600 gene locus_tag LOCUS_t00030 14510 14600 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 14697 15485 gene locus_tag LOCUS_03910 14697 15485 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_03910 15490 15930 gene locus_tag LOCUS_03920 15490 15930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 15942 16532 gene locus_tag LOCUS_03930 15942 16532 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_03930 16553 17020 gene locus_tag LOCUS_03940 16553 17020 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_03940 18157 17213 gene locus_tag LOCUS_03950 18157 17213 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932054.1 protein_id gnl|my_center|LOCUS_03950 19842 18163 gene locus_tag LOCUS_03960 19842 18163 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880772.1 protein_id gnl|my_center|LOCUS_03960 20234 20160 gene locus_tag LOCUS_t00040 20234 20160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 20398 21321 gene locus_tag LOCUS_03970 20398 21321 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_03970 21328 22884 gene locus_tag LOCUS_03980 21328 22884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 23082 25841 gene locus_tag LOCUS_03990 gene leuS 23082 25841 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108648.1 protein_id gnl|my_center|LOCUS_03990 25841 26704 gene locus_tag LOCUS_04000 25841 26704 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769516.1 protein_id gnl|my_center|LOCUS_04000 27300 26722 gene locus_tag LOCUS_04010 gene purN 27300 26722 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108788.1 protein_id gnl|my_center|LOCUS_04010 27474 27713 gene locus_tag LOCUS_04020 27474 27713 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_04020 27732 28982 gene locus_tag LOCUS_04030 gene fabF 27732 28982 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201893.1 protein_id gnl|my_center|LOCUS_04030 29057 29725 gene locus_tag LOCUS_04040 29057 29725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 29736 30167 gene locus_tag LOCUS_04050 29736 30167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 30293 30727 gene locus_tag LOCUS_04060 30293 30727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 30752 32653 gene locus_tag LOCUS_04070 30752 32653 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202956.1 protein_id gnl|my_center|LOCUS_04070 33621 32647 gene locus_tag LOCUS_04080 33621 32647 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_04080 34600 33755 gene locus_tag LOCUS_04090 34600 33755 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_04090 35030 35494 gene locus_tag LOCUS_04100 gene mraZ 35030 35494 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801871.1 protein_id gnl|my_center|LOCUS_04100 35495 36391 gene locus_tag LOCUS_04110 gene rsmH 35495 36391 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763720.1 protein_id gnl|my_center|LOCUS_04110 36394 36771 gene locus_tag LOCUS_04120 36394 36771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 36784 38901 gene locus_tag LOCUS_04130 36784 38901 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964161.1 protein_id gnl|my_center|LOCUS_04130 38903 40366 gene locus_tag LOCUS_04140 38903 40366 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201929.1 protein_id gnl|my_center|LOCUS_04140 40379 41629 gene locus_tag LOCUS_04150 gene mraY 40379 41629 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_04150 41731 43071 gene locus_tag LOCUS_04160 gene murD 41731 43071 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763714.1 protein_id gnl|my_center|LOCUS_04160 43073 44248 gene locus_tag LOCUS_04170 43073 44248 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964157.1 protein_id gnl|my_center|LOCUS_04170 44220 45356 gene locus_tag LOCUS_04180 gene murG 44220 45356 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784003.1 protein_id gnl|my_center|LOCUS_04180 45346 46734 gene locus_tag LOCUS_04190 gene murC 45346 46734 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784002.1 protein_id gnl|my_center|LOCUS_04190 46767 47507 gene locus_tag LOCUS_04200 46767 47507 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108836.1 protein_id gnl|my_center|LOCUS_04200 47504 48874 gene locus_tag LOCUS_04210 gene ftsA 47504 48874 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034098846.1 protein_id gnl|my_center|LOCUS_04210 48906 50375 gene locus_tag LOCUS_04220 48906 50375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 50443 50892 gene locus_tag LOCUS_04230 50443 50892 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964151.1 protein_id gnl|my_center|LOCUS_04230 53139 51019 gene locus_tag LOCUS_04240 53139 51019 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_04240 54533 53268 gene locus_tag LOCUS_04250 54533 53268 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_04250 55289 54711 gene locus_tag LOCUS_04260 gene lptC 55289 54711 CDS product LPS export ABC transporter periplasmic protein LptC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964520.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence009 1906 731 gene locus_tag LOCUS_04270 1906 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3048 1912 gene locus_tag LOCUS_04280 gene csm5 3048 1912 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496894.1 protein_id gnl|my_center|LOCUS_04280 4056 3052 gene locus_tag LOCUS_04290 4056 3052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4741 4061 gene locus_tag LOCUS_04300 gene csm3 4741 4061 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_04300 5138 4770 gene locus_tag LOCUS_04310 gene csm2 5138 4770 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256464.1 protein_id gnl|my_center|LOCUS_04310 7829 5154 gene locus_tag LOCUS_04320 7829 5154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 8598 7831 gene locus_tag LOCUS_04330 8598 7831 CDS product CRISPR-associated endonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065262.1 protein_id gnl|my_center|LOCUS_04330 9693 8716 gene locus_tag LOCUS_04340 9693 8716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 10326 9727 gene locus_tag LOCUS_04350 10326 9727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 10621 10346 gene locus_tag LOCUS_04360 10621 10346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 10958 10578 gene locus_tag LOCUS_04370 10958 10578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 11586 11044 gene locus_tag LOCUS_04380 11586 11044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 11786 13231 gene locus_tag LOCUS_04390 11786 13231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13331 13498 gene locus_tag LOCUS_04400 13331 13498 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_04400 14565 13558 gene locus_tag LOCUS_04410 gene gldB 14565 13558 CDS product gliding motility lipoprotein GldB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202220.1 protein_id gnl|my_center|LOCUS_04410 15334 14660 gene locus_tag LOCUS_04420 gene rsmI 15334 14660 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_04420 16050 15331 gene locus_tag LOCUS_04430 16050 15331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 16394 18859 gene locus_tag LOCUS_04440 16394 18859 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_04440 18860 20728 gene locus_tag LOCUS_04450 18860 20728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 21439 20738 gene locus_tag LOCUS_04460 21439 20738 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_04460 23165 21513 gene locus_tag LOCUS_04470 23165 21513 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403181.1 protein_id gnl|my_center|LOCUS_04470 23621 24241 gene locus_tag LOCUS_04480 23621 24241 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_04480 24425 25453 gene locus_tag LOCUS_04490 24425 25453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 25446 26270 gene locus_tag LOCUS_04500 25446 26270 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940762.1 protein_id gnl|my_center|LOCUS_04500 26283 26786 gene locus_tag LOCUS_04510 26283 26786 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251027.1 protein_id gnl|my_center|LOCUS_04510 26796 27725 gene locus_tag LOCUS_04520 26796 27725 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389175.1 protein_id gnl|my_center|LOCUS_04520 27738 28157 gene locus_tag LOCUS_04530 27738 28157 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_04530 28159 28680 gene locus_tag LOCUS_04540 28159 28680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 28688 29917 gene locus_tag LOCUS_04550 28688 29917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04550 29914 31776 gene locus_tag LOCUS_04560 29914 31776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 31790 32356 gene locus_tag LOCUS_04570 31790 32356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 32353 32784 gene locus_tag LOCUS_04580 32353 32784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04580 32786 33127 gene locus_tag LOCUS_04590 32786 33127 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_04590 33128 34642 gene locus_tag LOCUS_04600 33128 34642 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_04600 34650 35135 gene locus_tag LOCUS_04610 34650 35135 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_04610 35135 35392 gene locus_tag LOCUS_04620 35135 35392 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146638.1 protein_id gnl|my_center|LOCUS_04620 35385 35729 gene locus_tag LOCUS_04630 gene mnhG 35385 35729 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867826.1 protein_id gnl|my_center|LOCUS_04630 35757 36368 gene locus_tag LOCUS_04640 35757 36368 CDS product formate hydrogenlyase complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393672.1 protein_id gnl|my_center|LOCUS_04640 36365 36901 gene locus_tag LOCUS_04650 36365 36901 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_04650 36888 37337 gene locus_tag LOCUS_04660 36888 37337 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_04660 41016 37939 gene locus_tag LOCUS_04670 41016 37939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 42403 41777 gene locus_tag LOCUS_04680 42403 41777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 43237 42410 gene locus_tag LOCUS_04690 gene ispE 43237 42410 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_04690 43646 45940 gene locus_tag LOCUS_04700 43646 45940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 45952 48003 gene locus_tag LOCUS_04710 45952 48003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 48325 49851 gene locus_tag LOCUS_04720 gene dnaB 48325 49851 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_04720 50539 49853 gene locus_tag LOCUS_04730 50539 49853 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_04730 50611 51699 gene locus_tag LOCUS_04740 50611 51699 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765688.1 protein_id gnl|my_center|LOCUS_04740 51776 53083 gene locus_tag LOCUS_04750 51776 53083 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence010 743 2377 gene locus_tag LOCUS_04760 gene pruA 743 2377 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_04760 3676 2393 gene locus_tag LOCUS_04770 3676 2393 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962586.1 protein_id gnl|my_center|LOCUS_04770 3900 5162 gene locus_tag LOCUS_04780 3900 5162 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765874.1 protein_id gnl|my_center|LOCUS_04780 5192 6361 gene locus_tag LOCUS_04790 5192 6361 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763477.1 protein_id gnl|my_center|LOCUS_04790 6384 7109 gene locus_tag LOCUS_04800 6384 7109 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787203.1 protein_id gnl|my_center|LOCUS_04800 7119 7739 gene locus_tag LOCUS_04810 7119 7739 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787205.1 protein_id gnl|my_center|LOCUS_04810 7768 8385 gene locus_tag LOCUS_04820 gene nqrE 7768 8385 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787208.1 protein_id gnl|my_center|LOCUS_04820 8407 9654 gene locus_tag LOCUS_04830 gene nqrF 8407 9654 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007337386.1 protein_id gnl|my_center|LOCUS_04830 9710 10666 gene locus_tag LOCUS_04840 9710 10666 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_04840 10693 11667 gene locus_tag LOCUS_04850 10693 11667 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123535.1 protein_id gnl|my_center|LOCUS_04850 12645 12418 gene locus_tag LOCUS_04860 12645 12418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 12776 15214 gene locus_tag LOCUS_04870 12776 15214 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962878.1 protein_id gnl|my_center|LOCUS_04870 15287 15883 gene locus_tag LOCUS_04880 15287 15883 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787276.1 protein_id gnl|my_center|LOCUS_04880 16395 15898 gene locus_tag LOCUS_04890 16395 15898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 17018 16395 gene locus_tag LOCUS_04900 17018 16395 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_04900 18045 17029 gene locus_tag LOCUS_04910 gene holA 18045 17029 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787842.1 protein_id gnl|my_center|LOCUS_04910 18096 18584 gene locus_tag LOCUS_04920 18096 18584 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_04920 19131 18562 gene locus_tag LOCUS_04930 19131 18562 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963346.1 protein_id gnl|my_center|LOCUS_04930 20459 19131 gene locus_tag LOCUS_04940 20459 19131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 22373 20589 gene locus_tag LOCUS_04950 22373 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 27000 22531 gene locus_tag LOCUS_04960 27000 22531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 28542 27196 gene locus_tag LOCUS_04970 28542 27196 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_04970 30525 28552 gene locus_tag LOCUS_04980 30525 28552 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_04980 31892 30612 gene locus_tag LOCUS_04990 gene lysA 31892 30612 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876948.1 protein_id gnl|my_center|LOCUS_04990 32632 32009 gene locus_tag LOCUS_05000 gene recR 32632 32009 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_05000 32750 34201 gene locus_tag LOCUS_05010 32750 34201 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_05010 36188 34389 gene locus_tag LOCUS_05020 36188 34389 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963830.1 protein_id gnl|my_center|LOCUS_05020 38866 36236 gene locus_tag LOCUS_05030 gene alaS 38866 36236 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_05030 39015 39986 gene locus_tag LOCUS_05040 39015 39986 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760911.1 protein_id gnl|my_center|LOCUS_05040 40122 40457 gene locus_tag LOCUS_05050 40122 40457 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_05050 40500 41594 gene locus_tag LOCUS_05060 40500 41594 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765714.1 protein_id gnl|my_center|LOCUS_05060 41598 42380 gene locus_tag LOCUS_05070 41598 42380 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_05070 43699 42398 gene locus_tag LOCUS_05080 43699 42398 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291447.1 protein_id gnl|my_center|LOCUS_05080 45285 43795 gene locus_tag LOCUS_05090 gene gldJ 45285 43795 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_05090 46283 45348 gene locus_tag LOCUS_05100 46283 45348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 46556 50263 gene locus_tag LOCUS_05110 gene porU 46556 50263 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_05110 50313 51548 gene locus_tag LOCUS_05120 gene porV 50313 51548 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_05120 51636 52109 gene locus_tag LOCUS_05130 gene ispF 51636 52109 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404396.1 protein_id gnl|my_center|LOCUS_05130 52120 52419 gene locus_tag LOCUS_05140 52120 52419 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244013.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence011 <1 873 gene locus_tag LOCUS_05150 <1 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760612.1:TonB-dependent receptor 1638 997 gene locus_tag LOCUS_05160 1638 997 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783764.1 protein_id gnl|my_center|LOCUS_05160 2391 1645 gene locus_tag LOCUS_05170 gene larB 2391 1645 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_05170 3235 2429 gene locus_tag LOCUS_05180 gene larE 3235 2429 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357133.1 protein_id gnl|my_center|LOCUS_05180 4432 3239 gene locus_tag LOCUS_05190 gene larC 4432 3239 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964092.1 protein_id gnl|my_center|LOCUS_05190 5428 4553 gene locus_tag LOCUS_05200 5428 4553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5561 6127 gene locus_tag LOCUS_05210 5561 6127 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766886.1 protein_id gnl|my_center|LOCUS_05210 6203 7201 gene locus_tag LOCUS_05220 6203 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 7325 8854 gene locus_tag LOCUS_05230 7325 8854 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794770.1 protein_id gnl|my_center|LOCUS_05230 8979 11435 gene locus_tag LOCUS_05240 8979 11435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 11585 12160 gene locus_tag LOCUS_05250 11585 12160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 12743 12186 gene locus_tag LOCUS_05260 gene efp 12743 12186 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931853.1 protein_id gnl|my_center|LOCUS_05260 14153 12867 gene locus_tag LOCUS_05270 14153 12867 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_05270 14538 15578 gene locus_tag LOCUS_05280 14538 15578 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_05280 15618 16130 gene locus_tag LOCUS_05290 15618 16130 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203292.1 protein_id gnl|my_center|LOCUS_05290 16309 16151 gene locus_tag LOCUS_05300 16309 16151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 17092 16799 gene locus_tag LOCUS_05310 17092 16799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 17716 17186 gene locus_tag LOCUS_05320 17716 17186 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_05320 19393 17723 gene locus_tag LOCUS_05330 19393 17723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 20594 19509 gene locus_tag LOCUS_05340 20594 19509 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_05340 22794 20584 gene locus_tag LOCUS_05350 22794 20584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 23360 22857 gene locus_tag LOCUS_05360 23360 22857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 23722 23345 gene locus_tag LOCUS_05370 23722 23345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 23957 24634 gene locus_tag LOCUS_05380 23957 24634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 24646 25482 gene locus_tag LOCUS_05390 24646 25482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 27448 25439 gene locus_tag LOCUS_05400 27448 25439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 27759 27674 gene locus_tag LOCUS_t00050 27759 27674 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27871 27787 gene locus_tag LOCUS_t00060 27871 27787 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 28725 28045 gene locus_tag LOCUS_05410 28725 28045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 31085 28872 gene locus_tag LOCUS_05420 31085 28872 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109162.1 protein_id gnl|my_center|LOCUS_05420 31172 33118 gene locus_tag LOCUS_05430 gene thrS 31172 33118 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786570.1 protein_id gnl|my_center|LOCUS_05430 33241 33717 gene locus_tag LOCUS_05440 gene infC 33241 33717 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_05440 33740 33937 gene locus_tag LOCUS_05450 gene rpmI 33740 33937 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_05450 34129 34389 gene locus_tag LOCUS_05460 34129 34389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 34585 35301 gene locus_tag LOCUS_05470 gene dapB 34585 35301 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_05470 35605 37011 gene locus_tag LOCUS_05480 gene lepB 35605 37011 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_05480 38760 37174 gene locus_tag LOCUS_05490 38760 37174 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765637.1 protein_id gnl|my_center|LOCUS_05490 39671 38766 gene locus_tag LOCUS_05500 39671 38766 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107441.1 protein_id gnl|my_center|LOCUS_05500 40025 40366 gene locus_tag LOCUS_05510 40025 40366 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192097.1 protein_id gnl|my_center|LOCUS_05510 40378 41058 gene locus_tag LOCUS_05520 40378 41058 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_05520 41064 41465 gene locus_tag LOCUS_05530 41064 41465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 44488 41504 gene locus_tag LOCUS_05540 44488 41504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 45060 46952 gene locus_tag LOCUS_05550 45060 46952 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108596.1 protein_id gnl|my_center|LOCUS_05550 47880 46936 gene locus_tag LOCUS_05560 47880 46936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 48224 49858 gene locus_tag LOCUS_05570 48224 49858 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421524.1 protein_id gnl|my_center|LOCUS_05570 49936 50994 gene locus_tag LOCUS_05580 gene rlmN 49936 50994 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840521.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence012 1053 382 gene locus_tag LOCUS_05590 1053 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 1679 1182 gene locus_tag LOCUS_05600 1679 1182 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_05600 4357 1970 gene locus_tag LOCUS_05610 4357 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7785 4738 gene locus_tag LOCUS_05620 7785 4738 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201890.1 protein_id gnl|my_center|LOCUS_05620 7966 8601 gene locus_tag LOCUS_05630 7966 8601 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_05630 8640 9986 gene locus_tag LOCUS_05640 8640 9986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 9988 11121 gene locus_tag LOCUS_05650 9988 11121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 11150 14569 gene locus_tag LOCUS_05660 11150 14569 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_05660 14674 16923 gene locus_tag LOCUS_05670 14674 16923 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766160.1 protein_id gnl|my_center|LOCUS_05670 18240 17173 gene locus_tag LOCUS_05680 gene hemW 18240 17173 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_05680 18351 18785 gene locus_tag LOCUS_05690 18351 18785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 19203 18787 gene locus_tag LOCUS_05700 gene rirA 19203 18787 CDS product iron-responsive transcriptional regulator RirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310047.1 protein_id gnl|my_center|LOCUS_05700 19647 19207 gene locus_tag LOCUS_05710 gene rpiB 19647 19207 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_05710 20145 21743 gene locus_tag LOCUS_05720 20145 21743 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_058118852.1 protein_id gnl|my_center|LOCUS_05720 21750 22772 gene locus_tag LOCUS_05730 gene ruvB 21750 22772 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_05730 23682 22963 gene locus_tag LOCUS_05740 23682 22963 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_05740 24721 23687 gene locus_tag LOCUS_05750 gene pheS 24721 23687 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_05750 25548 24730 gene locus_tag LOCUS_05760 25548 24730 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_05760 25669 26478 gene locus_tag LOCUS_05770 25669 26478 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733110.1 protein_id gnl|my_center|LOCUS_05770 26480 27985 gene locus_tag LOCUS_05780 26480 27985 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964538.1 protein_id gnl|my_center|LOCUS_05780 27960 28397 gene locus_tag LOCUS_05790 gene dut 27960 28397 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_05790 28399 30090 gene locus_tag LOCUS_05800 28399 30090 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201932.1 protein_id gnl|my_center|LOCUS_05800 30083 30850 gene locus_tag LOCUS_05810 30083 30850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 30870 32030 gene locus_tag LOCUS_05820 30870 32030 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964527.1 protein_id gnl|my_center|LOCUS_05820 32088 32489 gene locus_tag LOCUS_05830 32088 32489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 32486 32905 gene locus_tag LOCUS_05840 gene ybeY 32486 32905 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_05840 33005 34882 gene locus_tag LOCUS_05850 gene mnmG 33005 34882 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_05850 34970 36604 gene locus_tag LOCUS_05860 gene ade 34970 36604 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_05860 36614 38419 gene locus_tag LOCUS_05870 gene uvrC 36614 38419 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_05870 38581 39810 gene locus_tag LOCUS_05880 38581 39810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 40809 39835 gene locus_tag LOCUS_05890 40809 39835 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_05890 41030 41380 gene locus_tag LOCUS_05900 41030 41380 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925448.1 protein_id gnl|my_center|LOCUS_05900 41419 41868 gene locus_tag LOCUS_05910 41419 41868 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_05910 42198 45098 gene locus_tag LOCUS_05920 gene polA 42198 45098 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108723.1 protein_id gnl|my_center|LOCUS_05920 45112 45345 gene locus_tag LOCUS_05930 45112 45345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 45897 45448 gene locus_tag LOCUS_05940 45897 45448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 46234 46010 gene locus_tag LOCUS_05950 gene yidD 46234 46010 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779696.1 protein_id gnl|my_center|LOCUS_05950 46619 46215 gene locus_tag LOCUS_05960 46619 46215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 47401 46643 gene locus_tag LOCUS_05970 47401 46643 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_05970 48467 47421 gene locus_tag LOCUS_05980 48467 47421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 48724 50391 gene locus_tag LOCUS_05990 gene asnB 48724 50391 CDS product asparagine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107317.1 protein_id gnl|my_center|LOCUS_05990 51258 50401 gene locus_tag LOCUS_06000 51258 50401 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707642.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence013 2675 1203 gene locus_tag LOCUS_06010 2675 1203 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_06010 3483 2791 gene locus_tag LOCUS_06020 3483 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3850 4326 gene locus_tag LOCUS_06030 3850 4326 CDS product TspO/MBR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024098.1 protein_id gnl|my_center|LOCUS_06030 4345 4617 gene locus_tag LOCUS_06040 4345 4617 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_06040 4912 4643 gene locus_tag LOCUS_06050 4912 4643 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_06050 5583 4909 gene locus_tag LOCUS_06060 5583 4909 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787899.1 protein_id gnl|my_center|LOCUS_06060 7501 5669 gene locus_tag LOCUS_06070 7501 5669 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_06070 8166 7504 gene locus_tag LOCUS_06080 8166 7504 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172461640.1 protein_id gnl|my_center|LOCUS_06080 9247 8213 gene locus_tag LOCUS_06090 9247 8213 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_06090 10252 9260 gene locus_tag LOCUS_06100 10252 9260 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_06100 11258 10254 gene locus_tag LOCUS_06110 11258 10254 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107515.1 protein_id gnl|my_center|LOCUS_06110 12159 11281 gene locus_tag LOCUS_06120 12159 11281 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_06120 12473 12174 gene locus_tag LOCUS_06130 12473 12174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 13638 12643 gene locus_tag LOCUS_06140 13638 12643 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_06140 13806 14609 gene locus_tag LOCUS_06150 gene truA 13806 14609 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963544.1 protein_id gnl|my_center|LOCUS_06150 14804 16225 gene locus_tag LOCUS_06160 14804 16225 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405406.1 protein_id gnl|my_center|LOCUS_06160 16230 17012 gene locus_tag LOCUS_06170 16230 17012 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_06170 17023 17790 gene locus_tag LOCUS_06180 17023 17790 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202198.1 protein_id gnl|my_center|LOCUS_06180 18648 17785 gene locus_tag LOCUS_06190 18648 17785 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_06190 18809 19561 gene locus_tag LOCUS_06200 18809 19561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 20525 19650 gene locus_tag LOCUS_06210 gene folD 20525 19650 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767914.1 protein_id gnl|my_center|LOCUS_06210 21974 20643 gene locus_tag LOCUS_06220 gene ffh 21974 20643 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789195.1 protein_id gnl|my_center|LOCUS_06220 23785 21989 gene locus_tag LOCUS_06230 gene argS 23785 21989 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_06230 24923 23994 gene locus_tag LOCUS_06240 24923 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 25193 24924 gene locus_tag LOCUS_06250 25193 24924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 26277 25273 gene locus_tag LOCUS_06260 26277 25273 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_06260 27486 26461 gene locus_tag LOCUS_06270 27486 26461 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311292.1 protein_id gnl|my_center|LOCUS_06270 27784 27509 gene locus_tag LOCUS_06280 27784 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 28949 27792 gene locus_tag LOCUS_06290 28949 27792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766585.1 protein_id gnl|my_center|LOCUS_06290 31096 28946 gene locus_tag LOCUS_06300 31096 28946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 32168 31212 gene locus_tag LOCUS_06310 32168 31212 CDS product YncE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004293828.1 protein_id gnl|my_center|LOCUS_06310 34195 32315 gene locus_tag LOCUS_06320 34195 32315 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004311295.1 protein_id gnl|my_center|LOCUS_06320 34589 36589 gene locus_tag LOCUS_06330 gene ligA 34589 36589 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202856.1 protein_id gnl|my_center|LOCUS_06330 36640 37224 gene locus_tag LOCUS_06340 36640 37224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 37221 38108 gene locus_tag LOCUS_06350 gene dapA 37221 38108 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_06350 41442 38134 gene locus_tag LOCUS_06360 gene secA 41442 38134 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202248.1 protein_id gnl|my_center|LOCUS_06360 44078 41580 gene locus_tag LOCUS_06370 44078 41580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 44244 44600 gene locus_tag LOCUS_06380 44244 44600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 45116 44604 gene locus_tag LOCUS_06390 45116 44604 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020219.1 protein_id gnl|my_center|LOCUS_06390 46406 45138 gene locus_tag LOCUS_06400 gene icd 46406 45138 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_06400 48226 46409 gene locus_tag LOCUS_06410 48226 46409 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802867.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence014 2323 1496 gene locus_tag LOCUS_06420 2323 1496 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794957.1 protein_id gnl|my_center|LOCUS_06420 2427 3998 gene locus_tag LOCUS_06430 2427 3998 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404213.1 protein_id gnl|my_center|LOCUS_06430 4008 5507 gene locus_tag LOCUS_06440 gene glpK 4008 5507 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943390.1 protein_id gnl|my_center|LOCUS_06440 5530 6261 gene locus_tag LOCUS_06450 5530 6261 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081684.1 protein_id gnl|my_center|LOCUS_06450 6983 10060 gene locus_tag LOCUS_06460 6983 10060 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108168.1 protein_id gnl|my_center|LOCUS_06460 10073 12031 gene locus_tag LOCUS_06470 10073 12031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 15172 12218 gene locus_tag LOCUS_06480 15172 12218 CDS product glycosyl hydrolase 115 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226354.1 protein_id gnl|my_center|LOCUS_06480 16559 15186 gene locus_tag LOCUS_06490 16559 15186 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_06490 18403 16562 gene locus_tag LOCUS_06500 18403 16562 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_06500 18609 19691 gene locus_tag LOCUS_06510 18609 19691 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_06510 19728 20762 gene locus_tag LOCUS_06520 19728 20762 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584060.1 protein_id gnl|my_center|LOCUS_06520 20855 22267 gene locus_tag LOCUS_06530 gene rlmD 20855 22267 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107369.1 protein_id gnl|my_center|LOCUS_06530 22269 22514 gene locus_tag LOCUS_06540 22269 22514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 22802 22713 gene locus_tag LOCUS_t00070 22802 22713 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 23043 23822 gene locus_tag LOCUS_06550 23043 23822 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037441.1 protein_id gnl|my_center|LOCUS_06550 23806 25350 gene locus_tag LOCUS_06560 23806 25350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 25447 26244 gene locus_tag LOCUS_06570 25447 26244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 30144 26368 gene locus_tag LOCUS_06580 30144 26368 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227523.1 protein_id gnl|my_center|LOCUS_06580 32689 30170 gene locus_tag LOCUS_06590 32689 30170 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198598584.1 protein_id gnl|my_center|LOCUS_06590 32820 33935 gene locus_tag LOCUS_06600 32820 33935 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_06600 33946 35928 gene locus_tag LOCUS_06610 33946 35928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 35960 37252 gene locus_tag LOCUS_06620 35960 37252 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_06620 37669 37325 gene locus_tag LOCUS_06630 37669 37325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 37929 38483 gene locus_tag LOCUS_06640 37929 38483 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_06640 39640 38939 gene locus_tag LOCUS_06650 gene mip 39640 38939 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_06650 40394 39666 gene locus_tag LOCUS_06660 40394 39666 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346532.1 protein_id gnl|my_center|LOCUS_06660 41165 40494 gene locus_tag LOCUS_06670 gene mnmD 41165 40494 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_06670 41649 42530 gene locus_tag LOCUS_06680 41649 42530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 46243 42551 gene locus_tag LOCUS_06690 46243 42551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence015 630 400 gene locus_tag LOCUS_06700 630 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1510 764 gene locus_tag LOCUS_06710 1510 764 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784332.1 protein_id gnl|my_center|LOCUS_06710 2680 1517 gene locus_tag LOCUS_06720 2680 1517 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763566.1 protein_id gnl|my_center|LOCUS_06720 3875 2685 gene locus_tag LOCUS_06730 3875 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 4137 6113 gene locus_tag LOCUS_06740 4137 6113 CDS product glycogen debranching enzyme N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202228.1 protein_id gnl|my_center|LOCUS_06740 6110 7399 gene locus_tag LOCUS_06750 6110 7399 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767983.1 protein_id gnl|my_center|LOCUS_06750 7447 9081 gene locus_tag LOCUS_06760 7447 9081 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_06760 9131 13360 gene locus_tag LOCUS_06770 9131 13360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 15399 13378 gene locus_tag LOCUS_06780 15399 13378 CDS product alpha amylase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787605.1 protein_id gnl|my_center|LOCUS_06780 16134 15736 gene locus_tag LOCUS_06790 16134 15736 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000203920.1 protein_id gnl|my_center|LOCUS_06790 16319 17338 gene locus_tag LOCUS_06800 16319 17338 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_06800 17356 18042 gene locus_tag LOCUS_06810 17356 18042 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964914.1 protein_id gnl|my_center|LOCUS_06810 18639 18058 gene locus_tag LOCUS_06820 18639 18058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 19624 18680 gene locus_tag LOCUS_06830 19624 18680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 20409 19627 gene locus_tag LOCUS_06840 20409 19627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 21646 20447 gene locus_tag LOCUS_06850 21646 20447 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_06850 21895 22620 gene locus_tag LOCUS_06860 21895 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 22642 23610 gene locus_tag LOCUS_06870 22642 23610 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_06870 24709 23546 gene locus_tag LOCUS_06880 24709 23546 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_06880 25644 24724 gene locus_tag LOCUS_06890 25644 24724 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791185.1 protein_id gnl|my_center|LOCUS_06890 26457 25648 gene locus_tag LOCUS_06900 26457 25648 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963286.1 protein_id gnl|my_center|LOCUS_06900 28348 26522 gene locus_tag LOCUS_06910 gene mutL 28348 26522 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_06910 28649 28362 gene locus_tag LOCUS_06920 28649 28362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 28949 29539 gene locus_tag LOCUS_06930 gene lpcA 28949 29539 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420499.1 protein_id gnl|my_center|LOCUS_06930 29543 31081 gene locus_tag LOCUS_06940 29543 31081 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008661626.1 protein_id gnl|my_center|LOCUS_06940 32112 31078 gene locus_tag LOCUS_06950 32112 31078 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919370.1 protein_id gnl|my_center|LOCUS_06950 32274 32993 gene locus_tag LOCUS_06960 32274 32993 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719245.1 protein_id gnl|my_center|LOCUS_06960 33010 34824 gene locus_tag LOCUS_06970 33010 34824 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_06970 36787 35213 gene locus_tag LOCUS_06980 36787 35213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 38080 36893 gene locus_tag LOCUS_06990 38080 36893 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795962.1 protein_id gnl|my_center|LOCUS_06990 38476 38087 gene locus_tag LOCUS_07000 38476 38087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 38773 39102 gene locus_tag LOCUS_07010 38773 39102 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790218.1 protein_id gnl|my_center|LOCUS_07010 39109 39459 gene locus_tag LOCUS_07020 39109 39459 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263753.1 protein_id gnl|my_center|LOCUS_07020 40648 39437 gene locus_tag LOCUS_07030 40648 39437 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_07030 42073 40835 gene locus_tag LOCUS_07040 gene pfp 42073 40835 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870466.1 protein_id gnl|my_center|LOCUS_07040 42281 42745 gene locus_tag LOCUS_07050 42281 42745 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762666.1 protein_id gnl|my_center|LOCUS_07050 42827 43879 gene locus_tag LOCUS_07060 gene prfB 42827 43879 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence016 2044 689 gene locus_tag LOCUS_07070 2044 689 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_07070 1311 1401 gene locus_tag LOCUS_t00080 1311 1401 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3416 2034 gene locus_tag LOCUS_07080 3416 2034 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202702.1 protein_id gnl|my_center|LOCUS_07080 3705 4964 gene locus_tag LOCUS_07090 3705 4964 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_07090 4985 5674 gene locus_tag LOCUS_07100 4985 5674 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_07100 5779 6081 gene locus_tag LOCUS_07110 5779 6081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 6192 7514 gene locus_tag LOCUS_07120 6192 7514 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_07120 7832 8329 gene locus_tag LOCUS_07130 7832 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 9966 8317 gene locus_tag LOCUS_07140 9966 8317 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838626.1 protein_id gnl|my_center|LOCUS_07140 11261 9966 gene locus_tag LOCUS_07150 11261 9966 CDS product acetylxylan esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921690.1 protein_id gnl|my_center|LOCUS_07150 14651 11322 gene locus_tag LOCUS_07160 14651 11322 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162445741.1 protein_id gnl|my_center|LOCUS_07160 14979 16433 gene locus_tag LOCUS_07170 14979 16433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_07170 16430 17473 gene locus_tag LOCUS_07180 16430 17473 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815003.1 protein_id gnl|my_center|LOCUS_07180 19179 17758 gene locus_tag LOCUS_07190 19179 17758 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_07190 19325 19681 gene locus_tag LOCUS_07200 19325 19681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 19886 22282 gene locus_tag LOCUS_07210 19886 22282 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_07210 22424 23941 gene locus_tag LOCUS_07220 22424 23941 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109230.1 protein_id gnl|my_center|LOCUS_07220 23986 25101 gene locus_tag LOCUS_07230 23986 25101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 25671 25132 gene locus_tag LOCUS_07240 25671 25132 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_07240 25853 27928 gene locus_tag LOCUS_07250 25853 27928 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036303.1 protein_id gnl|my_center|LOCUS_07250 27946 28317 gene locus_tag LOCUS_07260 27946 28317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 28332 29804 gene locus_tag LOCUS_07270 28332 29804 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764285.1 protein_id gnl|my_center|LOCUS_07270 30559 29882 gene locus_tag LOCUS_07280 30559 29882 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459797.1 protein_id gnl|my_center|LOCUS_07280 30803 31228 gene locus_tag LOCUS_07290 30803 31228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 31242 31796 gene locus_tag LOCUS_07300 31242 31796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 31823 32074 gene locus_tag LOCUS_07310 31823 32074 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878063.1 protein_id gnl|my_center|LOCUS_07310 32080 32481 gene locus_tag LOCUS_07320 32080 32481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 32484 33785 gene locus_tag LOCUS_07330 32484 33785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 33782 35713 gene locus_tag LOCUS_07340 33782 35713 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018621.1 protein_id gnl|my_center|LOCUS_07340 35729 36007 gene locus_tag LOCUS_07350 35729 36007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 36007 37059 gene locus_tag LOCUS_07360 36007 37059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 37240 38106 gene locus_tag LOCUS_07370 37240 38106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 40543 38150 gene locus_tag LOCUS_07380 gene lon 40543 38150 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882677.1 protein_id gnl|my_center|LOCUS_07380 41585 40869 gene locus_tag LOCUS_07390 41585 40869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 >Feature sequence017 965 333 gene locus_tag LOCUS_07400 gene pyrE 965 333 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762667.1 protein_id gnl|my_center|LOCUS_07400 859 1581 gene locus_tag LOCUS_07410 859 1581 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097944.1 protein_id gnl|my_center|LOCUS_07410 3408 1690 gene locus_tag LOCUS_07420 gene recJ 3408 1690 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_07420 4108 3431 gene locus_tag LOCUS_07430 gene lipB 4108 3431 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787244.1 protein_id gnl|my_center|LOCUS_07430 4940 4101 gene locus_tag LOCUS_07440 gene lipA 4940 4101 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764405.1 protein_id gnl|my_center|LOCUS_07440 5156 6886 gene locus_tag LOCUS_07450 gene lysS 5156 6886 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_07450 6990 7769 gene locus_tag LOCUS_07460 6990 7769 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766589.1 protein_id gnl|my_center|LOCUS_07460 7934 8818 gene locus_tag LOCUS_07470 7934 8818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 9047 12082 gene locus_tag LOCUS_07480 9047 12082 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_07480 12094 13560 gene locus_tag LOCUS_07490 12094 13560 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108628.1 protein_id gnl|my_center|LOCUS_07490 13650 15380 gene locus_tag LOCUS_07500 13650 15380 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706185.1 protein_id gnl|my_center|LOCUS_07500 15434 16558 gene locus_tag LOCUS_07510 15434 16558 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203242.1 protein_id gnl|my_center|LOCUS_07510 16577 17680 gene locus_tag LOCUS_07520 16577 17680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 17773 20058 gene locus_tag LOCUS_07530 17773 20058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 20081 21484 gene locus_tag LOCUS_07540 20081 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 21609 22262 gene locus_tag LOCUS_07550 21609 22262 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786661.1 protein_id gnl|my_center|LOCUS_07550 22598 23653 gene locus_tag LOCUS_07560 22598 23653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 23712 24887 gene locus_tag LOCUS_07570 23712 24887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 25279 24986 gene locus_tag LOCUS_07580 25279 24986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 26481 27191 gene locus_tag LOCUS_07590 26481 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 27862 29091 gene locus_tag LOCUS_07600 gene serA 27862 29091 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071152.1 protein_id gnl|my_center|LOCUS_07600 29162 30508 gene locus_tag LOCUS_07610 29162 30508 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790898.1 protein_id gnl|my_center|LOCUS_07610 31909 30566 gene locus_tag LOCUS_07620 31909 30566 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_07620 32099 32710 gene locus_tag LOCUS_07630 32099 32710 CDS product acyl carrier protein phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963009.1 protein_id gnl|my_center|LOCUS_07630 34141 32717 gene locus_tag LOCUS_07640 gene rodA 34141 32717 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_07640 35957 34107 gene locus_tag LOCUS_07650 gene mrdA 35957 34107 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_07650 36466 35960 gene locus_tag LOCUS_07660 36466 35960 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964507.1 protein_id gnl|my_center|LOCUS_07660 37287 36463 gene locus_tag LOCUS_07670 gene mreC 37287 36463 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_07670 38334 37312 gene locus_tag LOCUS_07680 38334 37312 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_07680 39925 38399 gene locus_tag LOCUS_07690 gene purH 39925 38399 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_07690 40892 40077 gene locus_tag LOCUS_07700 40892 40077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence018 2746 3363 gene locus_tag LOCUS_07710 2746 3363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3367 4512 gene locus_tag LOCUS_07720 3367 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4518 5213 gene locus_tag LOCUS_07730 4518 5213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_07730 5226 6398 gene locus_tag LOCUS_07740 5226 6398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6395 7672 gene locus_tag LOCUS_07750 6395 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7676 8419 gene locus_tag LOCUS_07760 7676 8419 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095709.1 protein_id gnl|my_center|LOCUS_07760 9162 8434 gene locus_tag LOCUS_07770 gene phoU 9162 8434 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788573.1 protein_id gnl|my_center|LOCUS_07770 10030 9206 gene locus_tag LOCUS_07780 gene pstB 10030 9206 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538553.1 protein_id gnl|my_center|LOCUS_07780 11443 10163 gene locus_tag LOCUS_07790 11443 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 12523 12450 gene locus_tag LOCUS_t00090 12523 12450 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 12681 13295 gene locus_tag LOCUS_07800 12681 13295 CDS product V-type ATP synthase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788438.1 protein_id gnl|my_center|LOCUS_07800 13299 14153 gene locus_tag LOCUS_07810 13299 14153 CDS product DUF2764 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788436.1 protein_id gnl|my_center|LOCUS_07810 14169 15926 gene locus_tag LOCUS_07820 14169 15926 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538526.1 protein_id gnl|my_center|LOCUS_07820 15926 17248 gene locus_tag LOCUS_07830 15926 17248 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762991.1 protein_id gnl|my_center|LOCUS_07830 17264 17866 gene locus_tag LOCUS_07840 17264 17866 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788431.1 protein_id gnl|my_center|LOCUS_07840 17863 19869 gene locus_tag LOCUS_07850 17863 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 19874 20344 gene locus_tag LOCUS_07860 19874 20344 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_07860 20508 21542 gene locus_tag LOCUS_07870 20508 21542 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939164.1 protein_id gnl|my_center|LOCUS_07870 21553 22071 gene locus_tag LOCUS_07880 21553 22071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 22043 22681 gene locus_tag LOCUS_07890 22043 22681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 22733 23041 gene locus_tag LOCUS_07900 gene lsrG 22733 23041 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175221.1 protein_id gnl|my_center|LOCUS_07900 23035 24207 gene locus_tag LOCUS_07910 23035 24207 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_07910 24258 25085 gene locus_tag LOCUS_07920 gene larE 24258 25085 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_07920 25072 25404 gene locus_tag LOCUS_07930 25072 25404 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932034.1 protein_id gnl|my_center|LOCUS_07930 25606 25812 gene locus_tag LOCUS_07940 gene rpmB 25606 25812 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787937.1 protein_id gnl|my_center|LOCUS_07940 25825 26007 gene locus_tag LOCUS_07950 gene rpmG 25825 26007 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002560155.1 protein_id gnl|my_center|LOCUS_07950 26018 26170 gene locus_tag LOCUS_07960 26018 26170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 26240 27190 gene locus_tag LOCUS_07970 gene ftsY 26240 27190 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_07970 27190 28536 gene locus_tag LOCUS_07980 gene rimO 27190 28536 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787933.1 protein_id gnl|my_center|LOCUS_07980 31100 28551 gene locus_tag LOCUS_07990 31100 28551 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_07990 31402 33894 gene locus_tag LOCUS_08000 gene gyrA 31402 33894 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_08000 33997 35331 gene locus_tag LOCUS_08010 33997 35331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 36746 35571 gene locus_tag LOCUS_08020 36746 35571 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_08020 36884 38020 gene locus_tag LOCUS_08030 36884 38020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 38017 39450 gene locus_tag LOCUS_08040 38017 39450 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392280.1 protein_id gnl|my_center|LOCUS_08040 39588 39515 gene locus_tag LOCUS_t00100 39588 39515 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39668 39594 gene locus_tag LOCUS_t00110 39668 39594 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 39753 40331 gene locus_tag LOCUS_08050 39753 40331 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000200970.1 protein_id gnl|my_center|LOCUS_08050 <40978 40357 gene locus_tag LOCUS_08060 <40978 40357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765729.1:universal stress protein >Feature sequence019 2 604 gene locus_tag LOCUS_08070 2 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 620 3787 gene locus_tag LOCUS_08080 620 3787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4321 4148 gene locus_tag LOCUS_08090 4321 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 4667 5839 gene locus_tag LOCUS_08100 4667 5839 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_08100 5922 8024 gene locus_tag LOCUS_08110 5922 8024 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_08110 8277 9362 gene locus_tag LOCUS_08120 gene prfA 8277 9362 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785133.1 protein_id gnl|my_center|LOCUS_08120 9383 10216 gene locus_tag LOCUS_08130 gene pyrF 9383 10216 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_08130 10225 11511 gene locus_tag LOCUS_08140 10225 11511 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_08140 11557 12474 gene locus_tag LOCUS_08150 gene rfbD 11557 12474 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_08150 12562 12831 gene locus_tag LOCUS_08160 gene rpsO 12562 12831 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_08160 12970 15099 gene locus_tag LOCUS_08170 gene pnp 12970 15099 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791373.1 protein_id gnl|my_center|LOCUS_08170 15466 17583 gene locus_tag LOCUS_08180 15466 17583 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_08180 17713 19455 gene locus_tag LOCUS_08190 17713 19455 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761919.1 protein_id gnl|my_center|LOCUS_08190 20081 19542 gene locus_tag LOCUS_08200 20081 19542 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_08200 21667 20201 gene locus_tag LOCUS_08210 21667 20201 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107495.1 protein_id gnl|my_center|LOCUS_08210 23048 21687 gene locus_tag LOCUS_08220 23048 21687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339253.1 protein_id gnl|my_center|LOCUS_08220 24455 23052 gene locus_tag LOCUS_08230 24455 23052 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071114.1 protein_id gnl|my_center|LOCUS_08230 25880 24492 gene locus_tag LOCUS_08240 gene glmM 25880 24492 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009194034.1 protein_id gnl|my_center|LOCUS_08240 25943 26911 gene locus_tag LOCUS_08250 25943 26911 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_08250 26913 27644 gene locus_tag LOCUS_08260 26913 27644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 28291 27863 gene locus_tag LOCUS_08270 28291 27863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 28933 28304 gene locus_tag LOCUS_08280 28933 28304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256711.1 protein_id gnl|my_center|LOCUS_08280 30186 28930 gene locus_tag LOCUS_08290 30186 28930 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256710.1 protein_id gnl|my_center|LOCUS_08290 31140 30208 gene locus_tag LOCUS_08300 31140 30208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 31759 31343 gene locus_tag LOCUS_08310 31759 31343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 32733 31780 gene locus_tag LOCUS_08320 gene trxB 32733 31780 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393897.1 protein_id gnl|my_center|LOCUS_08320 33106 32750 gene locus_tag LOCUS_08330 33106 32750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 33504 33124 gene locus_tag LOCUS_08340 33504 33124 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_08340 33685 34380 gene locus_tag LOCUS_08350 33685 34380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 35985 34429 gene locus_tag LOCUS_08360 35985 34429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence020 195 1295 gene locus_tag LOCUS_08370 gene wecB 195 1295 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_08370 1299 2012 gene locus_tag LOCUS_08380 1299 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2028 3299 gene locus_tag LOCUS_08390 2028 3299 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767234.1 protein_id gnl|my_center|LOCUS_08390 3296 4045 gene locus_tag LOCUS_08400 3296 4045 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_08400 4064 5209 gene locus_tag LOCUS_08410 gene wecB 4064 5209 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048109.1 protein_id gnl|my_center|LOCUS_08410 7715 5193 gene locus_tag LOCUS_08420 7715 5193 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797373.1 protein_id gnl|my_center|LOCUS_08420 9305 7752 gene locus_tag LOCUS_08430 9305 7752 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762559.1 protein_id gnl|my_center|LOCUS_08430 9927 9376 gene locus_tag LOCUS_08440 9927 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 10387 10980 gene locus_tag LOCUS_08450 10387 10980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 10993 11343 gene locus_tag LOCUS_08460 10993 11343 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813353.1 protein_id gnl|my_center|LOCUS_08460 11360 12943 gene locus_tag LOCUS_08470 11360 12943 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962836.1 protein_id gnl|my_center|LOCUS_08470 13000 13071 gene locus_tag LOCUS_t00120 13000 13071 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 13251 14708 gene locus_tag LOCUS_08480 13251 14708 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048253.1 protein_id gnl|my_center|LOCUS_08480 14716 15654 gene locus_tag LOCUS_08490 14716 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 15683 16396 gene locus_tag LOCUS_08500 gene aat 15683 16396 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_08500 17176 16613 gene locus_tag LOCUS_08510 gene frr 17176 16613 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764014.1 protein_id gnl|my_center|LOCUS_08510 18007 17291 gene locus_tag LOCUS_08520 gene pyrH 18007 17291 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784714.1 protein_id gnl|my_center|LOCUS_08520 19109 18267 gene locus_tag LOCUS_08530 gene tsf 19109 18267 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_08530 20110 19136 gene locus_tag LOCUS_08540 gene rpsB 20110 19136 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760802.1 protein_id gnl|my_center|LOCUS_08540 20601 20215 gene locus_tag LOCUS_08550 gene rpsI 20601 20215 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_08550 21062 20607 gene locus_tag LOCUS_08560 gene rplM 21062 20607 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782434.1 protein_id gnl|my_center|LOCUS_08560 21222 22775 gene locus_tag LOCUS_08570 21222 22775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 22949 23353 gene locus_tag LOCUS_08580 22949 23353 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657895.1 protein_id gnl|my_center|LOCUS_08580 23899 23357 gene locus_tag LOCUS_08590 23899 23357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 24216 25487 gene locus_tag LOCUS_08600 gene purD 24216 25487 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_08600 25637 26491 gene locus_tag LOCUS_08610 25637 26491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 26959 26504 gene locus_tag LOCUS_08620 26959 26504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 27868 26975 gene locus_tag LOCUS_08630 27868 26975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 31221 28135 gene locus_tag LOCUS_08640 31221 28135 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_08640 31615 31241 gene locus_tag LOCUS_08650 31615 31241 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_08650 32199 31627 gene locus_tag LOCUS_08660 32199 31627 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393747.1 protein_id gnl|my_center|LOCUS_08660 34832 32211 gene locus_tag LOCUS_08670 34832 32211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 35635 34838 gene locus_tag LOCUS_08680 35635 34838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 36199 35642 gene locus_tag LOCUS_08690 36199 35642 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402806.1 protein_id gnl|my_center|LOCUS_08690 <37064 36203 gene locus_tag LOCUS_08700 <37064 36203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230589.1:protein-glutamate O-methyltransferase CheR >Feature sequence021 261 1235 gene locus_tag LOCUS_08710 261 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1429 3336 gene locus_tag LOCUS_08720 1429 3336 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_08720 3472 7155 gene locus_tag LOCUS_08730 gene metH 3472 7155 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_08730 7212 8180 gene locus_tag LOCUS_08740 gene metF 7212 8180 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792069.1 protein_id gnl|my_center|LOCUS_08740 8345 8851 gene locus_tag LOCUS_08750 gene tpx 8345 8851 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003894924.1 protein_id gnl|my_center|LOCUS_08750 9019 8946 gene locus_tag LOCUS_t00130 9019 8946 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9123 10352 gene locus_tag LOCUS_08760 9123 10352 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769163.1 protein_id gnl|my_center|LOCUS_08760 10349 10996 gene locus_tag LOCUS_08770 10349 10996 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_08770 11065 11952 gene locus_tag LOCUS_08780 11065 11952 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963566.1 protein_id gnl|my_center|LOCUS_08780 12535 13038 gene locus_tag LOCUS_08790 12535 13038 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784022.1 protein_id gnl|my_center|LOCUS_08790 13172 14383 gene locus_tag LOCUS_08800 13172 14383 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_08800 14512 16659 gene locus_tag LOCUS_08810 gene bglX 14512 16659 CDS product beta-glucosidase BglX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203679.1 protein_id gnl|my_center|LOCUS_08810 16931 16845 gene locus_tag LOCUS_t00140 16931 16845 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 17134 17061 gene locus_tag LOCUS_t00150 17134 17061 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 19250 17298 gene locus_tag LOCUS_08820 19250 17298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 20198 19395 gene locus_tag LOCUS_08830 20198 19395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 20450 21616 gene locus_tag LOCUS_08840 20450 21616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 24200 21621 gene locus_tag LOCUS_08850 gene mutS 24200 21621 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108646.1 protein_id gnl|my_center|LOCUS_08850 24736 25197 gene locus_tag LOCUS_08860 24736 25197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 25458 26807 gene locus_tag LOCUS_08870 25458 26807 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_08870 27600 26821 gene locus_tag LOCUS_08880 27600 26821 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_08880 28280 27615 gene locus_tag LOCUS_08890 28280 27615 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_08890 28664 28284 gene locus_tag LOCUS_08900 28664 28284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 31701 28699 gene locus_tag LOCUS_08910 gene secDF 31701 28699 CDS product protein translocase subunit SecDF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765303.1 protein_id gnl|my_center|LOCUS_08910 31865 32686 gene locus_tag LOCUS_08920 31865 32686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 33101 34300 gene locus_tag LOCUS_08930 gene sucC 33101 34300 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_08930 34604 35773 gene locus_tag LOCUS_08940 34604 35773 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_08940 35786 36439 gene locus_tag LOCUS_08950 35786 36439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence022 1083 1457 gene locus_tag LOCUS_08960 gene rsfS 1083 1457 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_08960 1470 3596 gene locus_tag LOCUS_08970 gene ftsH 1470 3596 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695721.1 protein_id gnl|my_center|LOCUS_08970 3605 3826 gene locus_tag LOCUS_08980 3605 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3823 4644 gene locus_tag LOCUS_08990 3823 4644 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_08990 4634 5317 gene locus_tag LOCUS_09000 4634 5317 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759606.1 protein_id gnl|my_center|LOCUS_09000 5412 5687 gene locus_tag LOCUS_09010 5412 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5874 7106 gene locus_tag LOCUS_09020 5874 7106 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933933.1 protein_id gnl|my_center|LOCUS_09020 7670 7146 gene locus_tag LOCUS_09030 7670 7146 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767597.1 protein_id gnl|my_center|LOCUS_09030 10312 7679 gene locus_tag LOCUS_09040 10312 7679 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_09040 12186 10357 gene locus_tag LOCUS_09050 12186 10357 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_09050 13178 12378 gene locus_tag LOCUS_09060 13178 12378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 13930 13184 gene locus_tag LOCUS_09070 13930 13184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 14110 14694 gene locus_tag LOCUS_09080 14110 14694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 15683 14718 gene locus_tag LOCUS_09090 15683 14718 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986275.1 protein_id gnl|my_center|LOCUS_09090 16257 15670 gene locus_tag LOCUS_09100 16257 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 17267 16269 gene locus_tag LOCUS_09110 gene obgE 17267 16269 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109231.1 protein_id gnl|my_center|LOCUS_09110 17955 17380 gene locus_tag LOCUS_09120 17955 17380 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963489.1 protein_id gnl|my_center|LOCUS_09120 18516 17968 gene locus_tag LOCUS_09130 gene hpt 18516 17968 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760055.1 protein_id gnl|my_center|LOCUS_09130 18643 19104 gene locus_tag LOCUS_09140 gene purE 18643 19104 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797496.1 protein_id gnl|my_center|LOCUS_09140 19243 19956 gene locus_tag LOCUS_09150 19243 19956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 20027 22027 gene locus_tag LOCUS_09160 20027 22027 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797103.1 protein_id gnl|my_center|LOCUS_09160 23474 22062 gene locus_tag LOCUS_09170 23474 22062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 23945 23481 gene locus_tag LOCUS_09180 gene coaD 23945 23481 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_09180 24635 24096 gene locus_tag LOCUS_09190 24635 24096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 27244 24818 gene locus_tag LOCUS_09200 gene lon 27244 24818 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793926.1 protein_id gnl|my_center|LOCUS_09200 28532 27330 gene locus_tag LOCUS_09210 28532 27330 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_09210 28860 28597 gene locus_tag LOCUS_09220 28860 28597 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_09220 30136 28919 gene locus_tag LOCUS_09230 30136 28919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_09230 31672 30191 gene locus_tag LOCUS_09240 31672 30191 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_09240 33077 31737 gene locus_tag LOCUS_09250 33077 31737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 33215 33289 gene locus_tag LOCUS_t00160 33215 33289 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 33851 33486 gene locus_tag LOCUS_09260 33851 33486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 34547 34095 gene locus_tag LOCUS_09270 34547 34095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 35106 34582 gene locus_tag LOCUS_09280 gene dfrA 35106 34582 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_09280 35969 35103 gene locus_tag LOCUS_09290 35969 35103 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence023 699 2489 gene locus_tag LOCUS_09300 699 2489 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878377.1 protein_id gnl|my_center|LOCUS_09300 2509 4668 gene locus_tag LOCUS_09310 2509 4668 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_09310 4717 5658 gene locus_tag LOCUS_09320 4717 5658 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583128.1 protein_id gnl|my_center|LOCUS_09320 5808 6650 gene locus_tag LOCUS_09330 5808 6650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7117 6638 gene locus_tag LOCUS_09340 gene folK 7117 6638 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_09340 7931 9697 gene locus_tag LOCUS_09350 gene sppA 7931 9697 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_09350 9770 10873 gene locus_tag LOCUS_09360 gene lpxK 9770 10873 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_09360 13502 10893 gene locus_tag LOCUS_09370 13502 10893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 13783 14790 gene locus_tag LOCUS_09380 13783 14790 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762581.1 protein_id gnl|my_center|LOCUS_09380 16035 14821 gene locus_tag LOCUS_09390 gene hflX 16035 14821 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759581.1 protein_id gnl|my_center|LOCUS_09390 17289 16114 gene locus_tag LOCUS_09400 17289 16114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963930.1 protein_id gnl|my_center|LOCUS_09400 18093 17407 gene locus_tag LOCUS_09410 18093 17407 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_09410 18447 18521 gene locus_tag LOCUS_t00170 18447 18521 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18610 19242 gene locus_tag LOCUS_09420 18610 19242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203360.1 protein_id gnl|my_center|LOCUS_09420 19981 19283 gene locus_tag LOCUS_09430 19981 19283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 20202 21788 gene locus_tag LOCUS_09440 20202 21788 CDS product DUF4139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962278.1 protein_id gnl|my_center|LOCUS_09440 22271 22029 gene locus_tag LOCUS_09450 22271 22029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 22594 25263 gene locus_tag LOCUS_09460 22594 25263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 26409 25291 gene locus_tag LOCUS_09470 26409 25291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201898.1 protein_id gnl|my_center|LOCUS_09470 26525 29611 gene locus_tag LOCUS_09480 26525 29611 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_09480 29615 30238 gene locus_tag LOCUS_09490 29615 30238 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783668.1 protein_id gnl|my_center|LOCUS_09490 30238 31137 gene locus_tag LOCUS_09500 30238 31137 CDS product HPr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389232.1 protein_id gnl|my_center|LOCUS_09500 31207 31485 gene locus_tag LOCUS_09510 31207 31485 CDS product PqqD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388607.1 protein_id gnl|my_center|LOCUS_09510 31487 31939 gene locus_tag LOCUS_09520 31487 31939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 32561 31944 gene locus_tag LOCUS_09530 32561 31944 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 protein_id gnl|my_center|LOCUS_09530 32766 33617 gene locus_tag LOCUS_09540 32766 33617 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002079012.1 protein_id gnl|my_center|LOCUS_09540 >Feature sequence024 324 2798 gene locus_tag LOCUS_09550 324 2798 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208292391.1 protein_id gnl|my_center|LOCUS_09550 3319 3834 gene locus_tag LOCUS_09560 3319 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 4563 3850 gene locus_tag LOCUS_09570 gene trmD 4563 3850 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765722.1 protein_id gnl|my_center|LOCUS_09570 4772 5218 gene locus_tag LOCUS_09580 4772 5218 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_09580 5388 7409 gene locus_tag LOCUS_09590 5388 7409 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764283.1 protein_id gnl|my_center|LOCUS_09590 7451 9109 gene locus_tag LOCUS_09600 7451 9109 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964003.1 protein_id gnl|my_center|LOCUS_09600 9152 11047 gene locus_tag LOCUS_09610 gene yidC 9152 11047 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_09610 11634 11140 gene locus_tag LOCUS_09620 gene ribH 11634 11140 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_09620 12357 11662 gene locus_tag LOCUS_09630 12357 11662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_09630 12500 13624 gene locus_tag LOCUS_09640 gene recF 12500 13624 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785234.1 protein_id gnl|my_center|LOCUS_09640 13611 13901 gene locus_tag LOCUS_09650 13611 13901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 13907 15265 gene locus_tag LOCUS_09660 gene tilS 13907 15265 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_09660 15682 16287 gene locus_tag LOCUS_09670 15682 16287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 16590 19244 gene locus_tag LOCUS_09680 16590 19244 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928597.1 protein_id gnl|my_center|LOCUS_09680 19979 19218 gene locus_tag LOCUS_09690 19979 19218 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898511.1 protein_id gnl|my_center|LOCUS_09690 21479 20022 gene locus_tag LOCUS_09700 21479 20022 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964225.1 protein_id gnl|my_center|LOCUS_09700 21623 22030 gene locus_tag LOCUS_09710 21623 22030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 22576 22145 gene locus_tag LOCUS_09720 22576 22145 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963530.1 protein_id gnl|my_center|LOCUS_09720 22714 23730 gene locus_tag LOCUS_09730 22714 23730 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_09730 23714 24253 gene locus_tag LOCUS_09740 23714 24253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 24366 25283 gene locus_tag LOCUS_09750 24366 25283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 26009 25284 gene locus_tag LOCUS_09760 26009 25284 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963342.1 protein_id gnl|my_center|LOCUS_09760 26356 27117 gene locus_tag LOCUS_09770 26356 27117 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963237.1 protein_id gnl|my_center|LOCUS_09770 27249 29072 gene locus_tag LOCUS_09780 27249 29072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 29069 30103 gene locus_tag LOCUS_09790 gene asnA 29069 30103 CDS product aspartate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790904.1 protein_id gnl|my_center|LOCUS_09790 30230 31498 gene locus_tag LOCUS_09800 30230 31498 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767711.1 protein_id gnl|my_center|LOCUS_09800 31765 33543 gene locus_tag LOCUS_09810 31765 33543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 33631 33705 gene locus_tag LOCUS_t00180 33631 33705 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence025 482 1084 gene locus_tag LOCUS_09820 482 1084 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_09820 2273 1305 gene locus_tag LOCUS_09830 2273 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3783 2266 gene locus_tag LOCUS_09840 3783 2266 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_09840 4511 3780 gene locus_tag LOCUS_09850 4511 3780 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_09850 5467 4538 gene locus_tag LOCUS_09860 5467 4538 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_09860 5855 6430 gene locus_tag LOCUS_09870 gene sodB 5855 6430 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357051.1 protein_id gnl|my_center|LOCUS_09870 6513 7568 gene locus_tag LOCUS_09880 6513 7568 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_09880 8345 7569 gene locus_tag LOCUS_09890 8345 7569 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727458.1 protein_id gnl|my_center|LOCUS_09890 8754 9422 gene locus_tag LOCUS_09900 8754 9422 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120291.1 protein_id gnl|my_center|LOCUS_09900 10008 9433 gene locus_tag LOCUS_09910 10008 9433 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_09910 11532 10621 gene locus_tag LOCUS_09920 11532 10621 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403322.1 protein_id gnl|my_center|LOCUS_09920 16692 11737 gene locus_tag LOCUS_09930 16692 11737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 16980 22976 gene locus_tag LOCUS_09940 16980 22976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 23032 28974 gene locus_tag LOCUS_09950 23032 28974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 29101 30093 gene locus_tag LOCUS_09960 29101 30093 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_09960 30210 30824 gene locus_tag LOCUS_09970 30210 30824 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789239.1 protein_id gnl|my_center|LOCUS_09970 30835 32118 gene locus_tag LOCUS_09980 30835 32118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 32413 32108 gene locus_tag LOCUS_09990 32413 32108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence026 1356 781 gene locus_tag LOCUS_10000 1356 781 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103689.1 protein_id gnl|my_center|LOCUS_10000 2035 1334 gene locus_tag LOCUS_10010 2035 1334 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000553324.1 protein_id gnl|my_center|LOCUS_10010 2194 5286 gene locus_tag LOCUS_10020 2194 5286 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797422.1 protein_id gnl|my_center|LOCUS_10020 5283 6968 gene locus_tag LOCUS_10030 5283 6968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8635 7022 gene locus_tag LOCUS_10040 8635 7022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 10476 8890 gene locus_tag LOCUS_10050 10476 8890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 11948 10656 gene locus_tag LOCUS_10060 11948 10656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 13848 12313 gene locus_tag LOCUS_10070 13848 12313 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785902.1 protein_id gnl|my_center|LOCUS_10070 17253 13861 gene locus_tag LOCUS_10080 17253 13861 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785421.1 protein_id gnl|my_center|LOCUS_10080 18561 17479 gene locus_tag LOCUS_10090 18561 17479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 19386 18799 gene locus_tag LOCUS_10100 19386 18799 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799168.1 protein_id gnl|my_center|LOCUS_10100 20030 22015 gene locus_tag LOCUS_10110 gene gyrB 20030 22015 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783987.1 protein_id gnl|my_center|LOCUS_10110 22042 22749 gene locus_tag LOCUS_10120 22042 22749 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788818.1 protein_id gnl|my_center|LOCUS_10120 22766 24064 gene locus_tag LOCUS_10130 22766 24064 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929976.1 protein_id gnl|my_center|LOCUS_10130 25160 24057 gene locus_tag LOCUS_10140 25160 24057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 25405 25157 gene locus_tag LOCUS_10150 25405 25157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 26284 25505 gene locus_tag LOCUS_10160 26284 25505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 27774 26281 gene locus_tag LOCUS_10170 27774 26281 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769615.1 protein_id gnl|my_center|LOCUS_10170 28674 27778 gene locus_tag LOCUS_10180 28674 27778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 29707 28805 gene locus_tag LOCUS_10190 29707 28805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 31019 29685 gene locus_tag LOCUS_10200 31019 29685 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047913.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence027 426 773 gene locus_tag LOCUS_10210 gene ssb 426 773 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361980.1 protein_id gnl|my_center|LOCUS_10210 982 2478 gene locus_tag LOCUS_10220 gene amrB 982 2478 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_10220 2498 4999 gene locus_tag LOCUS_10230 2498 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5992 5018 gene locus_tag LOCUS_10240 5992 5018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6272 7729 gene locus_tag LOCUS_10250 gene mnmE 6272 7729 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_10250 8728 7769 gene locus_tag LOCUS_10260 gene xylF 8728 7769 CDS product D-xylose ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936757.1 protein_id gnl|my_center|LOCUS_10260 9985 8864 gene locus_tag LOCUS_10270 9985 8864 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_10270 10799 10356 gene locus_tag LOCUS_10280 10799 10356 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962997.1 protein_id gnl|my_center|LOCUS_10280 11587 13188 gene locus_tag LOCUS_10290 11587 13188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 13228 14484 gene locus_tag LOCUS_10300 13228 14484 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_10300 17396 14466 gene locus_tag LOCUS_10310 17396 14466 CDS product FAD-binding and (Fe-S)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143425.1 protein_id gnl|my_center|LOCUS_10310 17679 18680 gene locus_tag LOCUS_10320 gene pta 17679 18680 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_10320 18708 19676 gene locus_tag LOCUS_10330 18708 19676 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_10330 19688 20893 gene locus_tag LOCUS_10340 19688 20893 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_10340 20920 21825 gene locus_tag LOCUS_10350 gene ptb 20920 21825 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_10350 21847 22962 gene locus_tag LOCUS_10360 gene buk 21847 22962 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964967.1 protein_id gnl|my_center|LOCUS_10360 23663 22959 gene locus_tag LOCUS_10370 23663 22959 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963511.1 protein_id gnl|my_center|LOCUS_10370 23698 24318 gene locus_tag LOCUS_10380 23698 24318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 24433 24948 gene locus_tag LOCUS_10390 24433 24948 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790721.1 protein_id gnl|my_center|LOCUS_10390 25310 24954 gene locus_tag LOCUS_10400 25310 24954 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545197.1 protein_id gnl|my_center|LOCUS_10400 25684 25346 gene locus_tag LOCUS_10410 25684 25346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 26847 25699 gene locus_tag LOCUS_10420 26847 25699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 27168 28490 gene locus_tag LOCUS_10430 27168 28490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 29189 28491 gene locus_tag LOCUS_10440 29189 28491 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_10440 30081 29380 gene locus_tag LOCUS_10450 30081 29380 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_10450 30245 30718 gene locus_tag LOCUS_10460 30245 30718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence028 409 2208 gene locus_tag LOCUS_10470 409 2208 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107202.1 protein_id gnl|my_center|LOCUS_10470 2237 3664 gene locus_tag LOCUS_10480 2237 3664 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_10480 4313 3702 gene locus_tag LOCUS_10490 4313 3702 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_10490 4548 4979 gene locus_tag LOCUS_10500 4548 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 5188 5760 gene locus_tag LOCUS_10510 5188 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 6229 9051 gene locus_tag LOCUS_10520 6229 9051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 10315 9071 gene locus_tag LOCUS_10530 10315 9071 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_10530 10513 11649 gene locus_tag LOCUS_10540 10513 11649 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_10540 11646 12893 gene locus_tag LOCUS_10550 11646 12893 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532433.1 protein_id gnl|my_center|LOCUS_10550 14072 12903 gene locus_tag LOCUS_10560 14072 12903 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_10560 14530 14132 gene locus_tag LOCUS_10570 14530 14132 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963807.1 protein_id gnl|my_center|LOCUS_10570 14676 17303 gene locus_tag LOCUS_10580 14676 17303 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109217.1 protein_id gnl|my_center|LOCUS_10580 17942 17307 gene locus_tag LOCUS_10590 gene pdxH 17942 17307 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869074.1 protein_id gnl|my_center|LOCUS_10590 18865 18008 gene locus_tag LOCUS_10600 gene nadC 18865 18008 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_10600 19262 18849 gene locus_tag LOCUS_10610 19262 18849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 19379 19855 gene locus_tag LOCUS_10620 gene rlmH 19379 19855 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107863.1 protein_id gnl|my_center|LOCUS_10620 19852 23586 gene locus_tag LOCUS_10630 19852 23586 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_10630 23695 27909 gene locus_tag LOCUS_10640 23695 27909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 27917 28852 gene locus_tag LOCUS_10650 27917 28852 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_10650 28857 30341 gene locus_tag LOCUS_10660 28857 30341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence029 2979 1012 gene locus_tag LOCUS_10670 2979 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10670 4617 2995 gene locus_tag LOCUS_10680 4617 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 5673 4663 gene locus_tag LOCUS_10690 5673 4663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 6336 5755 gene locus_tag LOCUS_10700 6336 5755 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_10700 7088 6402 gene locus_tag LOCUS_10710 7088 6402 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962317.1 protein_id gnl|my_center|LOCUS_10710 8039 7443 gene locus_tag LOCUS_10720 8039 7443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8844 8101 gene locus_tag LOCUS_10730 8844 8101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 10366 9113 gene locus_tag LOCUS_10740 10366 9113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 11225 10425 gene locus_tag LOCUS_10750 11225 10425 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_10750 11986 11270 gene locus_tag LOCUS_10760 gene tsaB 11986 11270 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790587.1 protein_id gnl|my_center|LOCUS_10760 13345 12005 gene locus_tag LOCUS_10770 13345 12005 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_10770 14743 13352 gene locus_tag LOCUS_10780 14743 13352 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964214.1 protein_id gnl|my_center|LOCUS_10780 14962 15681 gene locus_tag LOCUS_10790 14962 15681 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767602.1 protein_id gnl|my_center|LOCUS_10790 15692 16081 gene locus_tag LOCUS_10800 15692 16081 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932629.1 protein_id gnl|my_center|LOCUS_10800 17478 16315 gene locus_tag LOCUS_10810 17478 16315 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109126.1 protein_id gnl|my_center|LOCUS_10810 19380 17662 gene locus_tag LOCUS_10820 19380 17662 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_10820 19781 21466 gene locus_tag LOCUS_10830 gene ggt 19781 21466 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071048.1 protein_id gnl|my_center|LOCUS_10830 21575 21718 gene locus_tag LOCUS_10840 21575 21718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 22106 22711 gene locus_tag LOCUS_10850 22106 22711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 22850 23173 gene locus_tag LOCUS_10860 22850 23173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 23211 29351 gene locus_tag LOCUS_10870 23211 29351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 29423 29776 gene locus_tag LOCUS_10880 29423 29776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 29879 30346 gene locus_tag LOCUS_10890 29879 30346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence030 185 652 gene locus_tag LOCUS_10900 185 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 664 1152 gene locus_tag LOCUS_10910 664 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2438 1410 gene locus_tag LOCUS_10920 2438 1410 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762561.1 protein_id gnl|my_center|LOCUS_10920 2634 3638 gene locus_tag LOCUS_10930 2634 3638 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107209.1 protein_id gnl|my_center|LOCUS_10930 5537 3681 gene locus_tag LOCUS_10940 5537 3681 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_10940 5695 7170 gene locus_tag LOCUS_10950 gene guaB 5695 7170 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_10950 7286 9172 gene locus_tag LOCUS_10960 7286 9172 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963306.1 protein_id gnl|my_center|LOCUS_10960 9269 10129 gene locus_tag LOCUS_10970 9269 10129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 10135 11493 gene locus_tag LOCUS_10980 10135 11493 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_10980 11571 13025 gene locus_tag LOCUS_10990 11571 13025 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993642.1 protein_id gnl|my_center|LOCUS_10990 13480 13259 gene locus_tag LOCUS_11000 13480 13259 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558131.1 protein_id gnl|my_center|LOCUS_11000 14114 13557 gene locus_tag LOCUS_11010 14114 13557 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_11010 14880 14137 gene locus_tag LOCUS_11020 14880 14137 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_11020 15754 14939 gene locus_tag LOCUS_11030 15754 14939 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_11030 15883 17988 gene locus_tag LOCUS_11040 gene recG 15883 17988 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109022.1 protein_id gnl|my_center|LOCUS_11040 18115 18534 gene locus_tag LOCUS_11050 18115 18534 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765125.1 protein_id gnl|my_center|LOCUS_11050 18543 19406 gene locus_tag LOCUS_11060 18543 19406 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_11060 19430 20758 gene locus_tag LOCUS_11070 gene rsxC 19430 20758 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_11070 20762 21769 gene locus_tag LOCUS_11080 20762 21769 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_11080 21762 22391 gene locus_tag LOCUS_11090 21762 22391 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_11090 22418 23014 gene locus_tag LOCUS_11100 22418 23014 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_11100 23031 23603 gene locus_tag LOCUS_11110 gene rsxA 23031 23603 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778198.1 protein_id gnl|my_center|LOCUS_11110 24985 23624 gene locus_tag LOCUS_11120 24985 23624 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656298.1 protein_id gnl|my_center|LOCUS_11120 25730 24975 gene locus_tag LOCUS_11130 25730 24975 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_11130 26020 26490 gene locus_tag LOCUS_11140 26020 26490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 28913 26508 gene locus_tag LOCUS_11150 28913 26508 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000454344.1 protein_id gnl|my_center|LOCUS_11150 29047 30384 gene locus_tag LOCUS_11160 29047 30384 CDS product DUF5982 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713980.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence031 13830 12481 gene locus_tag LOCUS_11170 13830 12481 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503865.1 protein_id gnl|my_center|LOCUS_11170 15696 13954 gene locus_tag LOCUS_11180 15696 13954 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767002.1 protein_id gnl|my_center|LOCUS_11180 18140 15798 gene locus_tag LOCUS_11190 18140 15798 CDS product glycoside hydrolase family 65 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965973.1 protein_id gnl|my_center|LOCUS_11190 18860 18192 gene locus_tag LOCUS_11200 gene pgmB 18860 18192 CDS product beta-phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288121.1 protein_id gnl|my_center|LOCUS_11200 20188 18857 gene locus_tag LOCUS_11210 20188 18857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_11210 21599 20484 gene locus_tag LOCUS_11220 21599 20484 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789577.1 protein_id gnl|my_center|LOCUS_11220 21916 24891 gene locus_tag LOCUS_11230 21916 24891 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_11230 24894 26504 gene locus_tag LOCUS_11240 24894 26504 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098075356.1 protein_id gnl|my_center|LOCUS_11240 26527 27600 gene locus_tag LOCUS_11250 26527 27600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence032 1469 2335 gene locus_tag LOCUS_11260 1469 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2337 4661 gene locus_tag LOCUS_11270 2337 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 5391 4732 gene locus_tag LOCUS_11280 5391 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 6165 7079 gene locus_tag LOCUS_11290 gene metA 6165 7079 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764097.1 protein_id gnl|my_center|LOCUS_11290 8582 7440 gene locus_tag LOCUS_11300 gene amrS 8582 7440 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_11300 9952 9128 gene locus_tag LOCUS_11310 gene kdsA 9952 9128 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759991.1 protein_id gnl|my_center|LOCUS_11310 11274 9973 gene locus_tag LOCUS_11320 11274 9973 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_11320 11414 12460 gene locus_tag LOCUS_11330 11414 12460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839453.1 protein_id gnl|my_center|LOCUS_11330 12593 14779 gene locus_tag LOCUS_11340 12593 14779 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107405.1 protein_id gnl|my_center|LOCUS_11340 15156 14782 gene locus_tag LOCUS_11350 15156 14782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 15368 16210 gene locus_tag LOCUS_11360 15368 16210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 16255 17145 gene locus_tag LOCUS_11370 16255 17145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 17149 17571 gene locus_tag LOCUS_11380 17149 17571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 17626 18261 gene locus_tag LOCUS_11390 17626 18261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 19498 18278 gene locus_tag LOCUS_11400 19498 18278 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_11400 19613 20614 gene locus_tag LOCUS_11410 19613 20614 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_11410 20694 21563 gene locus_tag LOCUS_11420 gene sucD 20694 21563 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_11420 21596 22342 gene locus_tag LOCUS_11430 gene fabG 21596 22342 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_11430 24136 22376 gene locus_tag LOCUS_11440 24136 22376 CDS product phosphoenolpyruvate carboxykinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948795.1 protein_id gnl|my_center|LOCUS_11440 24274 25518 gene locus_tag LOCUS_11450 24274 25518 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403427.1 protein_id gnl|my_center|LOCUS_11450 25614 25898 gene locus_tag LOCUS_11460 25614 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967828.1 protein_id gnl|my_center|LOCUS_11460 25920 27191 gene locus_tag LOCUS_11470 25920 27191 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693669.1 protein_id gnl|my_center|LOCUS_11470 28001 27201 gene locus_tag LOCUS_11480 28001 27201 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108052.1 protein_id gnl|my_center|LOCUS_11480 29041 27998 gene locus_tag LOCUS_11490 gene selD 29041 27998 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001370476.1 protein_id gnl|my_center|LOCUS_11490 <29975 29050 gene locus_tag LOCUS_11500 <29975 29050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124924.1:tRNA 2-selenouridine(34) synthase MnmH >Feature sequence033 501 767 gene locus_tag LOCUS_11510 501 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 901 1506 gene locus_tag LOCUS_11520 901 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1776 2894 gene locus_tag LOCUS_11530 1776 2894 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_11530 2885 3487 gene locus_tag LOCUS_11540 gene sigW 2885 3487 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_11540 3502 4152 gene locus_tag LOCUS_11550 gene rsmG 3502 4152 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765865.1 protein_id gnl|my_center|LOCUS_11550 5036 6394 gene locus_tag LOCUS_11560 5036 6394 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_11560 7672 6401 gene locus_tag LOCUS_11570 7672 6401 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789791.1 protein_id gnl|my_center|LOCUS_11570 8028 9572 gene locus_tag LOCUS_11580 8028 9572 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081020.1 protein_id gnl|my_center|LOCUS_11580 9587 9943 gene locus_tag LOCUS_11590 9587 9943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 11107 9983 gene locus_tag LOCUS_11600 gene mqnE 11107 9983 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_11600 13910 11088 gene locus_tag LOCUS_11610 13910 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 14731 13946 gene locus_tag LOCUS_11620 14731 13946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 15495 14716 gene locus_tag LOCUS_11630 15495 14716 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_11630 15963 15496 gene locus_tag LOCUS_11640 15963 15496 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_11640 18287 16023 gene locus_tag LOCUS_11650 18287 16023 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_11650 20051 18546 gene locus_tag LOCUS_11660 20051 18546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 23055 20179 gene locus_tag LOCUS_11670 gene gcvP 23055 20179 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765866.1 protein_id gnl|my_center|LOCUS_11670 23852 23220 gene locus_tag LOCUS_11680 23852 23220 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_11680 24562 23912 gene locus_tag LOCUS_11690 24562 23912 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_11690 24743 25648 gene locus_tag LOCUS_11700 24743 25648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 26553 28019 gene locus_tag LOCUS_11710 26553 28019 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_11710 28719 28084 gene locus_tag LOCUS_11720 gene thpR 28719 28084 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_11720 28707 29369 gene locus_tag LOCUS_11730 gene elbB 28707 29369 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence034 592 1872 gene locus_tag LOCUS_11740 gene eno 592 1872 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933619.1 protein_id gnl|my_center|LOCUS_11740 1978 3609 gene locus_tag LOCUS_11750 1978 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 5554 3770 gene locus_tag LOCUS_11760 5554 3770 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_11760 6370 5576 gene locus_tag LOCUS_11770 6370 5576 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_11770 7713 6382 gene locus_tag LOCUS_11780 7713 6382 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_11780 8692 7721 gene locus_tag LOCUS_11790 8692 7721 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_11790 9478 8729 gene locus_tag LOCUS_11800 9478 8729 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_11800 9643 11364 gene locus_tag LOCUS_11810 9643 11364 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868766.1 protein_id gnl|my_center|LOCUS_11810 11540 12286 gene locus_tag LOCUS_11820 11540 12286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 12519 12310 gene locus_tag LOCUS_11830 12519 12310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 15183 12532 gene locus_tag LOCUS_11840 15183 12532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 15182 15361 gene locus_tag LOCUS_11850 15182 15361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 16744 15353 gene locus_tag LOCUS_11860 gene xseA 16744 15353 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764150.1 protein_id gnl|my_center|LOCUS_11860 18425 16752 gene locus_tag LOCUS_11870 18425 16752 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_11870 19246 18422 gene locus_tag LOCUS_11880 19246 18422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 21321 19417 gene locus_tag LOCUS_11890 21321 19417 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_11890 23371 21905 gene locus_tag LOCUS_11900 gene cysS 23371 21905 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762954.1 protein_id gnl|my_center|LOCUS_11900 24793 26559 gene locus_tag LOCUS_11910 gene asnB 24793 26559 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088751.1 protein_id gnl|my_center|LOCUS_11910 26561 26695 gene locus_tag LOCUS_11920 26561 26695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence035 1774 2598 gene locus_tag LOCUS_11930 1774 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2595 3152 gene locus_tag LOCUS_11940 2595 3152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3163 3816 gene locus_tag LOCUS_11950 3163 3816 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_11950 7360 4067 gene locus_tag LOCUS_11960 7360 4067 CDS product glycoside hydrolase family 38 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766599.1 protein_id gnl|my_center|LOCUS_11960 7550 8629 gene locus_tag LOCUS_11970 7550 8629 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583040.1 protein_id gnl|my_center|LOCUS_11970 11017 8687 gene locus_tag LOCUS_11980 11017 8687 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229046.1 protein_id gnl|my_center|LOCUS_11980 13424 11052 gene locus_tag LOCUS_11990 13424 11052 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_11990 13598 15919 gene locus_tag LOCUS_12000 13598 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 20453 16032 gene locus_tag LOCUS_12010 20453 16032 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109153.1 protein_id gnl|my_center|LOCUS_12010 20647 21831 gene locus_tag LOCUS_12020 20647 21831 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963681.1 protein_id gnl|my_center|LOCUS_12020 21853 24150 gene locus_tag LOCUS_12030 21853 24150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 24270 25616 gene locus_tag LOCUS_12040 24270 25616 CDS product pectate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109109.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence036 1335 3131 gene locus_tag LOCUS_12050 1335 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3203 3841 gene locus_tag LOCUS_12060 3203 3841 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_12060 4324 3914 gene locus_tag LOCUS_12070 gene mscL 4324 3914 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_12070 4959 4468 gene locus_tag LOCUS_12080 4959 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 6756 4984 gene locus_tag LOCUS_12090 6756 4984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 6893 9070 gene locus_tag LOCUS_12100 6893 9070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 9305 11359 gene locus_tag LOCUS_12110 9305 11359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 12153 11401 gene locus_tag LOCUS_12120 12153 11401 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_12120 13692 12175 gene locus_tag LOCUS_12130 13692 12175 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941403.1 protein_id gnl|my_center|LOCUS_12130 15126 13699 gene locus_tag LOCUS_12140 15126 13699 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941402.1 protein_id gnl|my_center|LOCUS_12140 15743 15129 gene locus_tag LOCUS_12150 15743 15129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_12150 16669 15749 gene locus_tag LOCUS_12160 16669 15749 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941400.1 protein_id gnl|my_center|LOCUS_12160 18621 16666 gene locus_tag LOCUS_12170 18621 16666 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941395.1 protein_id gnl|my_center|LOCUS_12170 18983 19189 gene locus_tag LOCUS_12180 18983 19189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 19158 20090 gene locus_tag LOCUS_12190 19158 20090 CDS product aryldialkylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584001.1 protein_id gnl|my_center|LOCUS_12190 21291 20302 gene locus_tag LOCUS_12200 21291 20302 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_12200 23028 21295 gene locus_tag LOCUS_12210 23028 21295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 23938 23048 gene locus_tag LOCUS_12220 23938 23048 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_12220 24077 24682 gene locus_tag LOCUS_12230 24077 24682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022892.1 protein_id gnl|my_center|LOCUS_12230 24788 27175 gene locus_tag LOCUS_12240 24788 27175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 27181 27912 gene locus_tag LOCUS_12250 27181 27912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12250 >Feature sequence037 432 1181 gene locus_tag LOCUS_12260 432 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1186 1563 gene locus_tag LOCUS_12270 1186 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1949 2545 gene locus_tag LOCUS_12280 1949 2545 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000844912.1 protein_id gnl|my_center|LOCUS_12280 2556 3404 gene locus_tag LOCUS_12290 2556 3404 CDS product toast rack family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948880.1 protein_id gnl|my_center|LOCUS_12290 4048 3770 gene locus_tag LOCUS_12300 4048 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 5716 4379 gene locus_tag LOCUS_12310 gene gdhA 5716 4379 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203378.1 protein_id gnl|my_center|LOCUS_12310 9036 6067 gene locus_tag LOCUS_12320 9036 6067 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_12320 12512 9033 gene locus_tag LOCUS_12330 12512 9033 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790471.1 protein_id gnl|my_center|LOCUS_12330 14355 12739 gene locus_tag LOCUS_12340 gene lnt 14355 12739 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_12340 14742 15380 gene locus_tag LOCUS_12350 14742 15380 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_12350 15450 17270 gene locus_tag LOCUS_12360 15450 17270 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_12360 18076 17261 gene locus_tag LOCUS_12370 gene murI 18076 17261 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_12370 18687 18166 gene locus_tag LOCUS_12380 18687 18166 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010536380.1 protein_id gnl|my_center|LOCUS_12380 19234 18722 gene locus_tag LOCUS_12390 19234 18722 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_12390 21824 19254 gene locus_tag LOCUS_12400 21824 19254 CDS product POTRA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784370.1 protein_id gnl|my_center|LOCUS_12400 22577 21837 gene locus_tag LOCUS_12410 22577 21837 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_12410 23278 22589 gene locus_tag LOCUS_12420 23278 22589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 24073 23279 gene locus_tag LOCUS_12430 24073 23279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 25119 24241 gene locus_tag LOCUS_12440 25119 24241 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203537.1 protein_id gnl|my_center|LOCUS_12440 25810 25145 gene locus_tag LOCUS_12450 25810 25145 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_12450 25852 26565 gene locus_tag LOCUS_12460 25852 26565 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791132.1 protein_id gnl|my_center|LOCUS_12460 26562 27395 gene locus_tag LOCUS_12470 26562 27395 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403707.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence038 2106 130 gene locus_tag LOCUS_12480 2106 130 CDS product DUF4838 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107588.1 protein_id gnl|my_center|LOCUS_12480 3250 2462 gene locus_tag LOCUS_12490 3250 2462 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919506.1 protein_id gnl|my_center|LOCUS_12490 3456 4223 gene locus_tag LOCUS_12500 3456 4223 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038842.1 protein_id gnl|my_center|LOCUS_12500 4420 4686 gene locus_tag LOCUS_12510 4420 4686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 4670 7087 gene locus_tag LOCUS_12520 4670 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 7230 9500 gene locus_tag LOCUS_12530 gene hypF 7230 9500 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940975.1 protein_id gnl|my_center|LOCUS_12530 9511 9855 gene locus_tag LOCUS_12540 gene hypA 9511 9855 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_12540 9900 10781 gene locus_tag LOCUS_12550 gene hypB 9900 10781 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933458.1 protein_id gnl|my_center|LOCUS_12550 12214 10919 gene locus_tag LOCUS_12560 12214 10919 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_12560 14734 12578 gene locus_tag LOCUS_12570 14734 12578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 14919 16976 gene locus_tag LOCUS_12580 14919 16976 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770054.1 protein_id gnl|my_center|LOCUS_12580 17089 17514 gene locus_tag LOCUS_12590 17089 17514 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763158.1 protein_id gnl|my_center|LOCUS_12590 17524 18819 gene locus_tag LOCUS_12600 17524 18819 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_12600 18993 20333 gene locus_tag LOCUS_12610 18993 20333 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_12610 20447 20692 gene locus_tag LOCUS_12620 20447 20692 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_12620 20698 21774 gene locus_tag LOCUS_12630 20698 21774 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_12630 21771 22562 gene locus_tag LOCUS_12640 21771 22562 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_12640 22606 23160 gene locus_tag LOCUS_12650 22606 23160 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786493.1 protein_id gnl|my_center|LOCUS_12650 23502 24098 gene locus_tag LOCUS_12660 23502 24098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 24130 24795 gene locus_tag LOCUS_12670 24130 24795 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042729.1 protein_id gnl|my_center|LOCUS_12670 24921 25553 gene locus_tag LOCUS_12680 24921 25553 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538559.1 protein_id gnl|my_center|LOCUS_12680 26458 25721 gene locus_tag LOCUS_12690 26458 25721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence039 2315 330 gene locus_tag LOCUS_12700 2315 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 3138 3211 gene locus_tag LOCUS_t00190 3138 3211 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4123 3395 gene locus_tag LOCUS_12710 4123 3395 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115502769.1 protein_id gnl|my_center|LOCUS_12710 6195 4270 gene locus_tag LOCUS_12720 6195 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 6915 6292 gene locus_tag LOCUS_12730 6915 6292 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_12730 7250 6996 gene locus_tag LOCUS_12740 7250 6996 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_12740 8589 7459 gene locus_tag LOCUS_12750 8589 7459 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202951.1 protein_id gnl|my_center|LOCUS_12750 9709 8600 gene locus_tag LOCUS_12760 9709 8600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_12760 10371 9706 gene locus_tag LOCUS_12770 10371 9706 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920670.1 protein_id gnl|my_center|LOCUS_12770 11121 10378 gene locus_tag LOCUS_12780 11121 10378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 12037 11126 gene locus_tag LOCUS_12790 12037 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 12932 12039 gene locus_tag LOCUS_12800 12932 12039 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788227.1 protein_id gnl|my_center|LOCUS_12800 14305 12965 gene locus_tag LOCUS_12810 14305 12965 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048692557.1 protein_id gnl|my_center|LOCUS_12810 14999 14364 gene locus_tag LOCUS_12820 14999 14364 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_12820 15383 15108 gene locus_tag LOCUS_12830 15383 15108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 15327 17096 gene locus_tag LOCUS_12840 15327 17096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17099 17944 gene locus_tag LOCUS_12850 17099 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 18101 18703 gene locus_tag LOCUS_12860 gene rpoE 18101 18703 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193971.1 protein_id gnl|my_center|LOCUS_12860 18700 19251 gene locus_tag LOCUS_12870 18700 19251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 19226 20320 gene locus_tag LOCUS_12880 19226 20320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 22167 20329 gene locus_tag LOCUS_12890 22167 20329 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767705.1 protein_id gnl|my_center|LOCUS_12890 22264 23256 gene locus_tag LOCUS_12900 22264 23256 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072178.1 protein_id gnl|my_center|LOCUS_12900 23613 23242 gene locus_tag LOCUS_12910 23613 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 24279 23614 gene locus_tag LOCUS_12920 24279 23614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 24466 24852 gene locus_tag LOCUS_12930 24466 24852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 25039 27312 gene locus_tag LOCUS_12940 25039 27312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence040 1994 585 gene locus_tag LOCUS_12950 1994 585 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962677.1 protein_id gnl|my_center|LOCUS_12950 2285 3121 gene locus_tag LOCUS_12960 2285 3121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 3335 4456 gene locus_tag LOCUS_12970 3335 4456 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582795.1 protein_id gnl|my_center|LOCUS_12970 4708 6954 gene locus_tag LOCUS_12980 4708 6954 CDS product GH92 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108651.1 protein_id gnl|my_center|LOCUS_12980 8181 6958 gene locus_tag LOCUS_12990 gene clpX 8181 6958 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791864.1 protein_id gnl|my_center|LOCUS_12990 8879 8193 gene locus_tag LOCUS_13000 gene clpP 8879 8193 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782306.1 protein_id gnl|my_center|LOCUS_13000 10239 8881 gene locus_tag LOCUS_13010 gene tig 10239 8881 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791866.1 protein_id gnl|my_center|LOCUS_13010 10463 10381 gene locus_tag LOCUS_t00200 10463 10381 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 10632 10877 gene locus_tag LOCUS_13020 10632 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 11088 11951 gene locus_tag LOCUS_13030 11088 11951 CDS product gluconolaconase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537577.1 protein_id gnl|my_center|LOCUS_13030 12717 11995 gene locus_tag LOCUS_13040 gene lptB 12717 11995 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760767.1 protein_id gnl|my_center|LOCUS_13040 15128 12720 gene locus_tag LOCUS_13050 15128 12720 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_13050 16069 15263 gene locus_tag LOCUS_13060 gene tatC 16069 15263 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_13060 16567 18756 gene locus_tag LOCUS_13070 gene recQ 16567 18756 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791861.1 protein_id gnl|my_center|LOCUS_13070 20101 18914 gene locus_tag LOCUS_13080 20101 18914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 21281 20139 gene locus_tag LOCUS_13090 21281 20139 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_13090 24493 21284 gene locus_tag LOCUS_13100 24493 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 25924 24515 gene locus_tag LOCUS_13110 25924 24515 CDS product nucleoside transporter C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403312.1 protein_id gnl|my_center|LOCUS_13110 26540 25926 gene locus_tag LOCUS_13120 26540 25926 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence041 378 1730 gene locus_tag LOCUS_13130 378 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1859 1784 gene locus_tag LOCUS_t00210 1859 1784 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1978 2053 gene locus_tag LOCUS_t00220 1978 2053 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2459 2692 gene locus_tag LOCUS_13140 2459 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963931.1 protein_id gnl|my_center|LOCUS_13140 2747 3706 gene locus_tag LOCUS_13150 2747 3706 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229247.1 protein_id gnl|my_center|LOCUS_13150 6362 3708 gene locus_tag LOCUS_13160 6362 3708 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202271.1 protein_id gnl|my_center|LOCUS_13160 7788 6658 gene locus_tag LOCUS_13170 7788 6658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 7862 7938 gene locus_tag LOCUS_t00230 7862 7938 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8191 8655 gene locus_tag LOCUS_13180 8191 8655 CDS product DUF5362 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962899.1 protein_id gnl|my_center|LOCUS_13180 8729 9529 gene locus_tag LOCUS_13190 8729 9529 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_13190 13600 9566 gene locus_tag LOCUS_13200 13600 9566 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760378.1 protein_id gnl|my_center|LOCUS_13200 15118 13952 gene locus_tag LOCUS_13210 15118 13952 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796113.1 protein_id gnl|my_center|LOCUS_13210 18588 15178 gene locus_tag LOCUS_13220 18588 15178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 20291 18789 gene locus_tag LOCUS_13230 20291 18789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 22098 20371 gene locus_tag LOCUS_13240 22098 20371 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767780.1 protein_id gnl|my_center|LOCUS_13240 25314 22123 gene locus_tag LOCUS_13250 25314 22123 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103036562.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence042 3049 1163 gene locus_tag LOCUS_13260 3049 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 3605 3135 gene locus_tag LOCUS_13270 3605 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 4122 3706 gene locus_tag LOCUS_13280 4122 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4270 5778 gene locus_tag LOCUS_13290 gene araA 4270 5778 CDS product L-arabinose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210591.1 protein_id gnl|my_center|LOCUS_13290 5973 7211 gene locus_tag LOCUS_13300 5973 7211 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_13300 7579 8115 gene locus_tag LOCUS_13310 7579 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 8454 8245 gene locus_tag LOCUS_13320 8454 8245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 10173 8467 gene locus_tag LOCUS_13330 10173 8467 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_13330 10353 12218 gene locus_tag LOCUS_13340 10353 12218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 12222 12917 gene locus_tag LOCUS_13350 12222 12917 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760645.1 protein_id gnl|my_center|LOCUS_13350 13096 13779 gene locus_tag LOCUS_13360 gene araD 13096 13779 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_13360 13799 15469 gene locus_tag LOCUS_13370 gene araB 13799 15469 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951845.1 protein_id gnl|my_center|LOCUS_13370 15459 16409 gene locus_tag LOCUS_13380 15459 16409 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_13380 16839 17744 gene locus_tag LOCUS_13390 16839 17744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 18100 19938 gene locus_tag LOCUS_13400 18100 19938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 21025 19967 gene locus_tag LOCUS_13410 21025 19967 CDS product DUF4380 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039215.1 protein_id gnl|my_center|LOCUS_13410 22298 21375 gene locus_tag LOCUS_13420 22298 21375 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_13420 23200 22427 gene locus_tag LOCUS_13430 23200 22427 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_13430 24711 23221 gene locus_tag LOCUS_13440 24711 23221 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence043 32 402 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcgtcccgcacgggacgcgtggattgaaac 879 1463 gene locus_tag LOCUS_13450 879 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1687 1959 gene locus_tag LOCUS_13460 1687 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2582 1998 gene locus_tag LOCUS_13470 2582 1998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2921 2598 gene locus_tag LOCUS_13480 2921 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 3318 4268 gene locus_tag LOCUS_13490 3318 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 5617 4811 gene locus_tag LOCUS_13500 5617 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 6750 5632 gene locus_tag LOCUS_13510 6750 5632 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073343.1 protein_id gnl|my_center|LOCUS_13510 7721 6822 gene locus_tag LOCUS_13520 7721 6822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 9786 7858 gene locus_tag LOCUS_13530 9786 7858 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_13530 10064 11488 gene locus_tag LOCUS_13540 10064 11488 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032496674.1 protein_id gnl|my_center|LOCUS_13540 11494 12513 gene locus_tag LOCUS_13550 11494 12513 CDS product zinc-binding alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031699.1 protein_id gnl|my_center|LOCUS_13550 12526 13593 gene locus_tag LOCUS_13560 12526 13593 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_13560 16797 13714 gene locus_tag LOCUS_13570 16797 13714 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_13570 17293 18387 gene locus_tag LOCUS_13580 17293 18387 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803908.1 protein_id gnl|my_center|LOCUS_13580 19124 18507 gene locus_tag LOCUS_13590 19124 18507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 19310 20446 gene locus_tag LOCUS_13600 19310 20446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 20493 21038 gene locus_tag LOCUS_13610 20493 21038 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791124.1 protein_id gnl|my_center|LOCUS_13610 21187 22491 gene locus_tag LOCUS_13620 21187 22491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 23503 22553 gene locus_tag LOCUS_13630 23503 22553 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767297.1 protein_id gnl|my_center|LOCUS_13630 23748 24047 gene locus_tag LOCUS_13640 23748 24047 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963789.1 protein_id gnl|my_center|LOCUS_13640 24050 24523 gene locus_tag LOCUS_13650 24050 24523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 24525 25505 gene locus_tag LOCUS_13660 gene floA 24525 25505 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760314.1 protein_id gnl|my_center|LOCUS_13660 25662 25751 gene locus_tag LOCUS_t00240 25662 25751 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 1410 202 gene locus_tag LOCUS_13670 1410 202 CDS product D-galactonate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770856.1 protein_id gnl|my_center|LOCUS_13670 2169 1420 gene locus_tag LOCUS_13680 2169 1420 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991075.1 protein_id gnl|my_center|LOCUS_13680 4386 2182 gene locus_tag LOCUS_13690 4386 2182 CDS product alpha-glucuronidase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275545.1 protein_id gnl|my_center|LOCUS_13690 6646 4664 gene locus_tag LOCUS_13700 6646 4664 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008657202.1 protein_id gnl|my_center|LOCUS_13700 6811 8244 gene locus_tag LOCUS_13710 6811 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 8292 9356 gene locus_tag LOCUS_13720 gene pdxA 8292 9356 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785465.1 protein_id gnl|my_center|LOCUS_13720 9605 10909 gene locus_tag LOCUS_13730 9605 10909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 11315 11902 gene locus_tag LOCUS_13740 gene ruvA 11315 11902 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766351.1 protein_id gnl|my_center|LOCUS_13740 11919 19421 gene locus_tag LOCUS_13750 gene sprA 11919 19421 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_13750 19488 19868 gene locus_tag LOCUS_13760 gene gcvH 19488 19868 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203673.1 protein_id gnl|my_center|LOCUS_13760 22850 19869 gene locus_tag LOCUS_13770 gene infB 22850 19869 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_13770 24169 22931 gene locus_tag LOCUS_13780 gene nusA 24169 22931 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_13780 24651 24187 gene locus_tag LOCUS_13790 24651 24187 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_13790 25094 24747 gene locus_tag LOCUS_13800 25094 24747 CDS product DUF3127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788752.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence045 1929 3794 gene locus_tag LOCUS_13810 1929 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 3967 5790 gene locus_tag LOCUS_13820 3967 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 5882 6673 gene locus_tag LOCUS_13830 5882 6673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 6828 7928 gene locus_tag LOCUS_13840 6828 7928 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679442.1 protein_id gnl|my_center|LOCUS_13840 9690 7948 gene locus_tag LOCUS_13850 9690 7948 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108981.1 protein_id gnl|my_center|LOCUS_13850 10344 9718 gene locus_tag LOCUS_13860 10344 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 10586 11116 gene locus_tag LOCUS_13870 10586 11116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 13026 11230 gene locus_tag LOCUS_13880 13026 11230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 14021 13242 gene locus_tag LOCUS_13890 14021 13242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 14768 14034 gene locus_tag LOCUS_13900 14768 14034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 15895 14765 gene locus_tag LOCUS_13910 15895 14765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 16613 16017 gene locus_tag LOCUS_13920 16613 16017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 18998 17064 gene locus_tag LOCUS_13930 18998 17064 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_13930 20775 19213 gene locus_tag LOCUS_13940 20775 19213 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107210.1 protein_id gnl|my_center|LOCUS_13940 20969 20772 gene locus_tag LOCUS_13950 20969 20772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 21776 21021 gene locus_tag LOCUS_13960 21776 21021 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_13960 21979 24408 gene locus_tag LOCUS_13970 21979 24408 CDS product beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082478.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence046 <1 1607 gene locus_tag LOCUS_13980 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202542.1:glycoside hydrolase family 2 TIM barrel-domain containing protein 1730 2959 gene locus_tag LOCUS_13990 1730 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 4434 2950 gene locus_tag LOCUS_14000 4434 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5459 4434 gene locus_tag LOCUS_14010 5459 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 6761 5484 gene locus_tag LOCUS_14020 gene tyrS 6761 5484 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_14020 7662 7126 gene locus_tag LOCUS_14030 7662 7126 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767606.1 protein_id gnl|my_center|LOCUS_14030 7866 8765 gene locus_tag LOCUS_14040 7866 8765 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_14040 8876 10465 gene locus_tag LOCUS_14050 8876 10465 CDS product CotH kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533131.1 protein_id gnl|my_center|LOCUS_14050 10534 10462 gene locus_tag LOCUS_t00250 10534 10462 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10710 11456 gene locus_tag LOCUS_14060 10710 11456 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482649.1 protein_id gnl|my_center|LOCUS_14060 11464 12684 gene locus_tag LOCUS_14070 11464 12684 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482600.1 protein_id gnl|my_center|LOCUS_14070 12699 13922 gene locus_tag LOCUS_14080 12699 13922 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482694.1 protein_id gnl|my_center|LOCUS_14080 13948 14640 gene locus_tag LOCUS_14090 13948 14640 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482754.1 protein_id gnl|my_center|LOCUS_14090 14766 15821 gene locus_tag LOCUS_14100 14766 15821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_14100 15869 17455 gene locus_tag LOCUS_14110 15869 17455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 17877 19892 gene locus_tag LOCUS_14120 17877 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 20572 19847 gene locus_tag LOCUS_14130 20572 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 21096 20569 gene locus_tag LOCUS_14140 21096 20569 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963569.1 protein_id gnl|my_center|LOCUS_14140 21644 21123 gene locus_tag LOCUS_14150 21644 21123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 22548 21712 gene locus_tag LOCUS_14160 22548 21712 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963568.1 protein_id gnl|my_center|LOCUS_14160 23961 22552 gene locus_tag LOCUS_14170 gene crtI 23961 22552 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence047 1464 316 gene locus_tag LOCUS_14180 1464 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2727 1561 gene locus_tag LOCUS_14190 2727 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3076 4956 gene locus_tag LOCUS_14200 gene asnB 3076 4956 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807086.1 protein_id gnl|my_center|LOCUS_14200 4968 6701 gene locus_tag LOCUS_14210 4968 6701 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_14210 6698 7996 gene locus_tag LOCUS_14220 6698 7996 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921284.1 protein_id gnl|my_center|LOCUS_14220 8021 8986 gene locus_tag LOCUS_14230 8021 8986 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229150.1 protein_id gnl|my_center|LOCUS_14230 8997 9905 gene locus_tag LOCUS_14240 8997 9905 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986782.1 protein_id gnl|my_center|LOCUS_14240 9909 11477 gene locus_tag LOCUS_14250 9909 11477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 12097 11507 gene locus_tag LOCUS_14260 12097 11507 CDS product HAD-IB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207732.1 protein_id gnl|my_center|LOCUS_14260 12341 14872 gene locus_tag LOCUS_14270 12341 14872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 14890 15951 gene locus_tag LOCUS_14280 14890 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 17509 16007 gene locus_tag LOCUS_14290 17509 16007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 18359 17553 gene locus_tag LOCUS_14300 18359 17553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 18727 23379 gene locus_tag LOCUS_14310 18727 23379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence048 790 599 gene locus_tag LOCUS_14320 790 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1324 2178 gene locus_tag LOCUS_14330 1324 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 6855 2239 gene locus_tag LOCUS_14340 6855 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 7811 7020 gene locus_tag LOCUS_14350 7811 7020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 10784 7908 gene locus_tag LOCUS_14360 10784 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202277.1 protein_id gnl|my_center|LOCUS_14360 11138 10788 gene locus_tag LOCUS_14370 11138 10788 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_14370 11320 14406 gene locus_tag LOCUS_14380 11320 14406 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_14380 15461 14478 gene locus_tag LOCUS_14390 15461 14478 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964493.1 protein_id gnl|my_center|LOCUS_14390 15524 17023 gene locus_tag LOCUS_14400 15524 17023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 17037 18119 gene locus_tag LOCUS_14410 gene carA 17037 18119 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788241.1 protein_id gnl|my_center|LOCUS_14410 18928 18284 gene locus_tag LOCUS_14420 18928 18284 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_14420 19296 19015 gene locus_tag LOCUS_14430 19296 19015 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_14430 20804 19380 gene locus_tag LOCUS_14440 20804 19380 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964981.1 protein_id gnl|my_center|LOCUS_14440 <23472 20831 gene locus_tag LOCUS_14450 <23472 20831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107318.1:glutamate synthase large subunit >Feature sequence049 340 1644 gene locus_tag LOCUS_14460 340 1644 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964430.1 protein_id gnl|my_center|LOCUS_14460 1647 2573 gene locus_tag LOCUS_14470 1647 2573 CDS product GYDIA family GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143470457.1 protein_id gnl|my_center|LOCUS_14470 3038 3742 gene locus_tag LOCUS_14480 3038 3742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3739 4698 gene locus_tag LOCUS_14490 3739 4698 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962484.1 protein_id gnl|my_center|LOCUS_14490 4830 4756 gene locus_tag LOCUS_t00260 4830 4756 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5404 6048 gene locus_tag LOCUS_14500 5404 6048 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109354.1 protein_id gnl|my_center|LOCUS_14500 6059 7057 gene locus_tag LOCUS_14510 6059 7057 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086819.1 protein_id gnl|my_center|LOCUS_14510 7955 7155 gene locus_tag LOCUS_14520 gene ccsA 7955 7155 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201987.1 protein_id gnl|my_center|LOCUS_14520 9214 7970 gene locus_tag LOCUS_14530 9214 7970 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933224.1 protein_id gnl|my_center|LOCUS_14530 10111 9320 gene locus_tag LOCUS_14540 10111 9320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 10520 13303 gene locus_tag LOCUS_14550 10520 13303 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_14550 13411 13911 gene locus_tag LOCUS_14560 13411 13911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 14098 13922 gene locus_tag LOCUS_14570 14098 13922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 14251 17208 gene locus_tag LOCUS_14580 14251 17208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 17657 17202 gene locus_tag LOCUS_14590 17657 17202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 17743 19173 gene locus_tag LOCUS_14600 17743 19173 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_14600 19189 19917 gene locus_tag LOCUS_14610 19189 19917 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_14610 20385 20017 gene locus_tag LOCUS_14620 gene rplS 20385 20017 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_14620 22265 20583 gene locus_tag LOCUS_14630 22265 20583 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_14630 <23410 22595 gene locus_tag LOCUS_14640 <23410 22595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228869.1:iron-containing alcohol dehydrogenase >Feature sequence050 1414 86 gene locus_tag LOCUS_14650 gene xylA 1414 86 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107447.1 protein_id gnl|my_center|LOCUS_14650 2922 1438 gene locus_tag LOCUS_14660 2922 1438 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202802.1 protein_id gnl|my_center|LOCUS_14660 6803 2976 gene locus_tag LOCUS_14670 6803 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 6998 8230 gene locus_tag LOCUS_14680 6998 8230 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202171.1 protein_id gnl|my_center|LOCUS_14680 9420 8260 gene locus_tag LOCUS_14690 9420 8260 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044964.1 protein_id gnl|my_center|LOCUS_14690 9653 10738 gene locus_tag LOCUS_14700 9653 10738 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093830137.1 protein_id gnl|my_center|LOCUS_14700 12045 10735 gene locus_tag LOCUS_14710 12045 10735 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_14710 12724 12056 gene locus_tag LOCUS_14720 12724 12056 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919369.1 protein_id gnl|my_center|LOCUS_14720 12792 13850 gene locus_tag LOCUS_14730 12792 13850 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206578673.1 protein_id gnl|my_center|LOCUS_14730 13863 14705 gene locus_tag LOCUS_14740 gene kduI 13863 14705 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_14740 14818 15621 gene locus_tag LOCUS_14750 14818 15621 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002320630.1 protein_id gnl|my_center|LOCUS_14750 15658 16953 gene locus_tag LOCUS_14760 15658 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 17446 16979 gene locus_tag LOCUS_14770 17446 16979 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070053.1 protein_id gnl|my_center|LOCUS_14770 19323 17497 gene locus_tag LOCUS_14780 19323 17497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 19649 19326 gene locus_tag LOCUS_14790 19649 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 20692 19646 gene locus_tag LOCUS_14800 20692 19646 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880213.1 protein_id gnl|my_center|LOCUS_14800 21770 20703 gene locus_tag LOCUS_14810 21770 20703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 22477 21767 gene locus_tag LOCUS_14820 22477 21767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 >Feature sequence051 537 1391 gene locus_tag LOCUS_14830 537 1391 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764407.1 protein_id gnl|my_center|LOCUS_14830 1405 1575 gene locus_tag LOCUS_14840 1405 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 2651 1929 gene locus_tag LOCUS_14850 2651 1929 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202238.1 protein_id gnl|my_center|LOCUS_14850 2782 3315 gene locus_tag LOCUS_14860 2782 3315 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962868.1 protein_id gnl|my_center|LOCUS_14860 7821 3307 gene locus_tag LOCUS_14870 7821 3307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 8672 7827 gene locus_tag LOCUS_14880 gene prmA 8672 7827 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795115.1 protein_id gnl|my_center|LOCUS_14880 9532 8783 gene locus_tag LOCUS_14890 gene tpiA 9532 8783 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_14890 10749 9661 gene locus_tag LOCUS_14900 10749 9661 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_14900 12062 10824 gene locus_tag LOCUS_14910 12062 10824 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_14910 12786 12067 gene locus_tag LOCUS_14920 12786 12067 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812008.1 protein_id gnl|my_center|LOCUS_14920 12910 13713 gene locus_tag LOCUS_14930 gene folP 12910 13713 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796563.1 protein_id gnl|my_center|LOCUS_14930 13734 14525 gene locus_tag LOCUS_14940 gene cdaA 13734 14525 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_14940 15176 14514 gene locus_tag LOCUS_14950 gene plsY 15176 14514 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_14950 16830 15214 gene locus_tag LOCUS_14960 gene pckA 16830 15214 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069538.1 protein_id gnl|my_center|LOCUS_14960 19914 17200 gene locus_tag LOCUS_14970 gene ppdK 19914 17200 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941243.1 protein_id gnl|my_center|LOCUS_14970 20939 20028 gene locus_tag LOCUS_14980 gene xerD 20939 20028 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_14980 21359 21883 gene locus_tag LOCUS_14990 21359 21883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence052 441 38 gene locus_tag LOCUS_tm00010 441 38 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 581 1801 gene locus_tag LOCUS_15000 581 1801 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_15000 1913 2110 gene locus_tag LOCUS_15010 1913 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3112 2447 gene locus_tag LOCUS_15020 gene rpe 3112 2447 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_15020 3800 3171 gene locus_tag LOCUS_15030 3800 3171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 5098 3788 gene locus_tag LOCUS_15040 5098 3788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 7256 5088 gene locus_tag LOCUS_15050 7256 5088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 8608 7253 gene locus_tag LOCUS_15060 gene fslC 8608 7253 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_15060 9656 8610 gene locus_tag LOCUS_15070 9656 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 9948 9700 gene locus_tag LOCUS_15080 9948 9700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 11259 10396 gene locus_tag LOCUS_15090 11259 10396 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_15090 11667 13343 gene locus_tag LOCUS_15100 11667 13343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 13585 17133 gene locus_tag LOCUS_15110 gene nifJ 13585 17133 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767789.1 protein_id gnl|my_center|LOCUS_15110 17314 17742 gene locus_tag LOCUS_15120 gene ruvX 17314 17742 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766074.1 protein_id gnl|my_center|LOCUS_15120 17752 18333 gene locus_tag LOCUS_15130 gene def 17752 18333 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_15130 18517 19158 gene locus_tag LOCUS_15140 18517 19158 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_15140 21277 19163 gene locus_tag LOCUS_15150 21277 19163 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_15150 21443 22456 gene locus_tag LOCUS_15160 21443 22456 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence053 1383 397 gene locus_tag LOCUS_15170 gene sph 1383 397 CDS product sphingomyelin phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193577588.1 protein_id gnl|my_center|LOCUS_15170 1970 3259 gene locus_tag LOCUS_15180 1970 3259 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814817.1 protein_id gnl|my_center|LOCUS_15180 4335 3148 gene locus_tag LOCUS_15190 4335 3148 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986397.1 protein_id gnl|my_center|LOCUS_15190 6200 4332 gene locus_tag LOCUS_15200 6200 4332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6460 6206 gene locus_tag LOCUS_15210 6460 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 6648 7115 gene locus_tag LOCUS_15220 gene nuoE 6648 7115 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_15220 7096 9039 gene locus_tag LOCUS_15230 gene nuoF 7096 9039 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_15230 9050 10783 gene locus_tag LOCUS_15240 9050 10783 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_15240 10807 12807 gene locus_tag LOCUS_15250 10807 12807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 12810 13199 gene locus_tag LOCUS_15260 12810 13199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 13201 14337 gene locus_tag LOCUS_15270 13201 14337 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940825.1 protein_id gnl|my_center|LOCUS_15270 14355 14990 gene locus_tag LOCUS_15280 14355 14990 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549143.1 protein_id gnl|my_center|LOCUS_15280 15002 15937 gene locus_tag LOCUS_15290 15002 15937 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_15290 16098 18719 gene locus_tag LOCUS_15300 16098 18719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 19596 19147 gene locus_tag LOCUS_15310 19596 19147 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174003.1 protein_id gnl|my_center|LOCUS_15310 20411 19704 gene locus_tag LOCUS_15320 20411 19704 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437066.1 protein_id gnl|my_center|LOCUS_15320 21184 20408 gene locus_tag LOCUS_15330 21184 20408 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460561.1 protein_id gnl|my_center|LOCUS_15330 22139 21165 gene locus_tag LOCUS_15340 22139 21165 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence054 1070 2362 gene locus_tag LOCUS_15350 1070 2362 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291985.1 protein_id gnl|my_center|LOCUS_15350 2383 4425 gene locus_tag LOCUS_15360 2383 4425 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766152.1 protein_id gnl|my_center|LOCUS_15360 4521 5033 gene locus_tag LOCUS_15370 4521 5033 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800645.1 protein_id gnl|my_center|LOCUS_15370 5152 8553 gene locus_tag LOCUS_15380 5152 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 8674 11295 gene locus_tag LOCUS_15390 8674 11295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 11428 12930 gene locus_tag LOCUS_15400 11428 12930 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_15400 12945 14342 gene locus_tag LOCUS_15410 gene leuC 12945 14342 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799043.1 protein_id gnl|my_center|LOCUS_15410 14381 14980 gene locus_tag LOCUS_15420 gene leuD 14381 14980 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763198.1 protein_id gnl|my_center|LOCUS_15420 14984 16045 gene locus_tag LOCUS_15430 gene leuB 14984 16045 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767701.1 protein_id gnl|my_center|LOCUS_15430 16671 16225 gene locus_tag LOCUS_15440 16671 16225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 18597 17143 gene locus_tag LOCUS_15450 18597 17143 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772424.1 protein_id gnl|my_center|LOCUS_15450 18811 20142 gene locus_tag LOCUS_15460 18811 20142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 >Feature sequence055 177 3254 gene locus_tag LOCUS_15470 177 3254 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_15470 3670 3290 gene locus_tag LOCUS_15480 3670 3290 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_15480 4246 3695 gene locus_tag LOCUS_15490 4246 3695 CDS product SiaB family protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970449.1 protein_id gnl|my_center|LOCUS_15490 5017 4463 gene locus_tag LOCUS_15500 5017 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 5601 4987 gene locus_tag LOCUS_15510 gene pnuC 5601 4987 CDS product nicotinamide riboside transporter PnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202077.1 protein_id gnl|my_center|LOCUS_15510 7186 5606 gene locus_tag LOCUS_15520 7186 5606 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_15520 8772 7243 gene locus_tag LOCUS_15530 gene guaA 8772 7243 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124903406.1 protein_id gnl|my_center|LOCUS_15530 10034 8787 gene locus_tag LOCUS_15540 10034 8787 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_15540 11023 10067 gene locus_tag LOCUS_15550 11023 10067 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109212.1 protein_id gnl|my_center|LOCUS_15550 11387 11037 gene locus_tag LOCUS_15560 11387 11037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 13336 11399 gene locus_tag LOCUS_15570 gene rpsA 13336 11399 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775782.1 protein_id gnl|my_center|LOCUS_15570 13680 15017 gene locus_tag LOCUS_15580 13680 15017 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107472.1 protein_id gnl|my_center|LOCUS_15580 15054 15989 gene locus_tag LOCUS_15590 15054 15989 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_15590 16001 16906 gene locus_tag LOCUS_15600 gene rfbA 16001 16906 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002364387.1 protein_id gnl|my_center|LOCUS_15600 16921 17484 gene locus_tag LOCUS_15610 gene rfbC 16921 17484 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_15610 17481 18341 gene locus_tag LOCUS_15620 gene rfbD 17481 18341 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767804.1 protein_id gnl|my_center|LOCUS_15620 >Feature sequence056 5572 4832 gene locus_tag LOCUS_15630 gene recO 5572 4832 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108822.1 protein_id gnl|my_center|LOCUS_15630 7945 5645 gene locus_tag LOCUS_15640 7945 5645 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_15640 8591 8013 gene locus_tag LOCUS_15650 8591 8013 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_15650 9599 8751 gene locus_tag LOCUS_15660 9599 8751 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_15660 9875 13333 gene locus_tag LOCUS_15670 9875 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 13406 14425 gene locus_tag LOCUS_15680 13406 14425 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791729.1 protein_id gnl|my_center|LOCUS_15680 14450 15328 gene locus_tag LOCUS_15690 14450 15328 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_15690 15340 15606 gene locus_tag LOCUS_15700 15340 15606 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_15700 15634 16419 gene locus_tag LOCUS_15710 15634 16419 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_15710 16423 17124 gene locus_tag LOCUS_15720 gene truB 16423 17124 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783635.1 protein_id gnl|my_center|LOCUS_15720 17167 18222 gene locus_tag LOCUS_15730 gene queA 17167 18222 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence057 738 4 gene locus_tag LOCUS_15740 738 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1060 749 gene locus_tag LOCUS_15750 1060 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 3456 1129 gene locus_tag LOCUS_15760 3456 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3655 5271 gene locus_tag LOCUS_15770 3655 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 5292 5993 gene locus_tag LOCUS_15780 gene mtgA 5292 5993 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107650.1 protein_id gnl|my_center|LOCUS_15780 6393 6638 gene locus_tag LOCUS_15790 gene acpP 6393 6638 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_15790 6719 8866 gene locus_tag LOCUS_15800 6719 8866 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_15800 8894 9700 gene locus_tag LOCUS_15810 gene nagB 8894 9700 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761009.1 protein_id gnl|my_center|LOCUS_15810 9700 11685 gene locus_tag LOCUS_15820 9700 11685 CDS product DUF4954 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108193.1 protein_id gnl|my_center|LOCUS_15820 14448 11935 gene locus_tag LOCUS_15830 14448 11935 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039175.1 protein_id gnl|my_center|LOCUS_15830 15915 14584 gene locus_tag LOCUS_15840 15915 14584 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_15840 19055 15939 gene locus_tag LOCUS_15850 gene lacZ 19055 15939 CDS product beta-galactosidase LacZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080135.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence058 349 1653 gene locus_tag LOCUS_15860 349 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2182 1709 gene locus_tag LOCUS_15870 2182 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 2435 5818 gene locus_tag LOCUS_15880 2435 5818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 7195 5813 gene locus_tag LOCUS_15890 7195 5813 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272364.1 protein_id gnl|my_center|LOCUS_15890 7369 9177 gene locus_tag LOCUS_15900 7369 9177 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_15900 9299 10579 gene locus_tag LOCUS_15910 9299 10579 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107424.1 protein_id gnl|my_center|LOCUS_15910 10592 11374 gene locus_tag LOCUS_15920 10592 11374 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_15920 11745 13133 gene locus_tag LOCUS_15930 11745 13133 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_15930 13238 14584 gene locus_tag LOCUS_15940 13238 14584 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_15940 14620 15498 gene locus_tag LOCUS_15950 14620 15498 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962521.1 protein_id gnl|my_center|LOCUS_15950 15495 16076 gene locus_tag LOCUS_15960 gene gmk 15495 16076 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790592.1 protein_id gnl|my_center|LOCUS_15960 16115 16699 gene locus_tag LOCUS_15970 gene nadD 16115 16699 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797930.1 protein_id gnl|my_center|LOCUS_15970 18096 16669 gene locus_tag LOCUS_15980 18096 16669 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926053.1 protein_id gnl|my_center|LOCUS_15980 19014 18247 gene locus_tag LOCUS_15990 19014 18247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence059 <1 2244 gene locus_tag LOCUS_16000 <1 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein 3155 2589 gene locus_tag LOCUS_16010 3155 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 4077 3388 gene locus_tag LOCUS_16020 4077 3388 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022907.1 protein_id gnl|my_center|LOCUS_16020 4684 4088 gene locus_tag LOCUS_16030 4684 4088 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174663.1 protein_id gnl|my_center|LOCUS_16030 4932 5234 gene locus_tag LOCUS_16040 4932 5234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 5264 5779 gene locus_tag LOCUS_16050 5264 5779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 5834 6277 gene locus_tag LOCUS_16060 5834 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 6779 6285 gene locus_tag LOCUS_16070 6779 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 7306 6782 gene locus_tag LOCUS_16080 7306 6782 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948568.1 protein_id gnl|my_center|LOCUS_16080 7727 7311 gene locus_tag LOCUS_16090 7727 7311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 9117 7720 gene locus_tag LOCUS_16100 9117 7720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence060 2446 422 gene locus_tag LOCUS_16110 2446 422 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_16110 2569 3153 gene locus_tag LOCUS_16120 2569 3153 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_16120 3156 3605 gene locus_tag LOCUS_16130 3156 3605 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_16130 3602 4417 gene locus_tag LOCUS_16140 3602 4417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 4411 5556 gene locus_tag LOCUS_16150 4411 5556 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767913.1 protein_id gnl|my_center|LOCUS_16150 6851 5808 gene locus_tag LOCUS_16160 6851 5808 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_16160 7777 6875 gene locus_tag LOCUS_16170 7777 6875 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759751.1 protein_id gnl|my_center|LOCUS_16170 8711 7821 gene locus_tag LOCUS_16180 8711 7821 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_16180 9502 8708 gene locus_tag LOCUS_16190 9502 8708 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791250.1 protein_id gnl|my_center|LOCUS_16190 10937 9636 gene locus_tag LOCUS_16200 gene mtaB 10937 9636 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_16200 13148 11037 gene locus_tag LOCUS_16210 gene ppk1 13148 11037 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963117.1 protein_id gnl|my_center|LOCUS_16210 13812 13306 gene locus_tag LOCUS_16220 gene sixA 13812 13306 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931785.1 protein_id gnl|my_center|LOCUS_16220 15199 13868 gene locus_tag LOCUS_16230 15199 13868 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788731.1 protein_id gnl|my_center|LOCUS_16230 15305 15814 gene locus_tag LOCUS_16240 15305 15814 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060742.1 protein_id gnl|my_center|LOCUS_16240 15827 17146 gene locus_tag LOCUS_16250 15827 17146 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788733.1 protein_id gnl|my_center|LOCUS_16250 >Feature sequence061 665 21 gene locus_tag LOCUS_16260 665 21 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_16260 1090 1440 gene locus_tag LOCUS_16270 1090 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1493 2980 gene locus_tag LOCUS_16280 1493 2980 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_16280 3935 3159 gene locus_tag LOCUS_16290 3935 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 5511 4030 gene locus_tag LOCUS_16300 5511 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 7204 5600 gene locus_tag LOCUS_16310 7204 5600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 8697 7216 gene locus_tag LOCUS_16320 8697 7216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 10547 8889 gene locus_tag LOCUS_16330 10547 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 12456 10525 gene locus_tag LOCUS_16340 12456 10525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 14048 12525 gene locus_tag LOCUS_16350 14048 12525 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767239.1 protein_id gnl|my_center|LOCUS_16350 16932 14065 gene locus_tag LOCUS_16360 16932 14065 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767240.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence062 <1 880 gene locus_tag LOCUS_16370 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000863308.1:aconitate hydratase 2883 877 gene locus_tag LOCUS_16380 2883 877 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941861.1 protein_id gnl|my_center|LOCUS_16380 2972 3289 gene locus_tag LOCUS_16390 2972 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 3315 3665 gene locus_tag LOCUS_16400 3315 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 3832 4893 gene locus_tag LOCUS_16410 3832 4893 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_16410 4890 5807 gene locus_tag LOCUS_16420 gene miaA 4890 5807 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_16420 5809 6261 gene locus_tag LOCUS_16430 5809 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 7531 6242 gene locus_tag LOCUS_16440 7531 6242 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_16440 8717 7668 gene locus_tag LOCUS_16450 8717 7668 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064252964.1 protein_id gnl|my_center|LOCUS_16450 9702 8755 gene locus_tag LOCUS_16460 9702 8755 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785735.1 protein_id gnl|my_center|LOCUS_16460 10296 9718 gene locus_tag LOCUS_16470 10296 9718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 10713 12542 gene locus_tag LOCUS_16480 gene ilvD 10713 12542 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761033.1 protein_id gnl|my_center|LOCUS_16480 12564 14309 gene locus_tag LOCUS_16490 gene ilvB 12564 14309 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_16490 14314 14856 gene locus_tag LOCUS_16500 gene ilvN 14314 14856 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962616.1 protein_id gnl|my_center|LOCUS_16500 14871 15917 gene locus_tag LOCUS_16510 gene ilvC 14871 15917 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790693.1 protein_id gnl|my_center|LOCUS_16510 15986 16645 gene locus_tag LOCUS_16520 15986 16645 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202227.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence063 30 389 gene locus_tag LOCUS_16530 gene rpsF 30 389 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759739.1 protein_id gnl|my_center|LOCUS_16530 393 662 gene locus_tag LOCUS_16540 gene rpsR 393 662 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759740.1 protein_id gnl|my_center|LOCUS_16540 682 1128 gene locus_tag LOCUS_16550 gene rplI 682 1128 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759741.1 protein_id gnl|my_center|LOCUS_16550 3932 1341 gene locus_tag LOCUS_16560 3932 1341 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_16560 4105 5271 gene locus_tag LOCUS_16570 4105 5271 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840465.1 protein_id gnl|my_center|LOCUS_16570 5278 6198 gene locus_tag LOCUS_16580 5278 6198 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790918.1 protein_id gnl|my_center|LOCUS_16580 6537 7958 gene locus_tag LOCUS_16590 gene dnaA 6537 7958 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_16590 8019 8648 gene locus_tag LOCUS_16600 8019 8648 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_16600 8704 9594 gene locus_tag LOCUS_16610 gene pyrB 8704 9594 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787548.1 protein_id gnl|my_center|LOCUS_16610 9597 10067 gene locus_tag LOCUS_16620 gene pyrI 9597 10067 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_16620 10556 10074 gene locus_tag LOCUS_16630 10556 10074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10860 11744 gene locus_tag LOCUS_16640 10860 11744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 13390 11828 gene locus_tag LOCUS_16650 gene rny 13390 11828 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_16650 13941 13651 gene locus_tag LOCUS_16660 13941 13651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 14244 13954 gene locus_tag LOCUS_16670 14244 13954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 14541 15179 gene locus_tag LOCUS_16680 14541 15179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 15184 16245 gene locus_tag LOCUS_16690 15184 16245 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence064 435 1412 gene locus_tag LOCUS_16700 435 1412 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_16700 1415 4291 gene locus_tag LOCUS_16710 gene uvrA 1415 4291 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788190.1 protein_id gnl|my_center|LOCUS_16710 4404 5114 gene locus_tag LOCUS_16720 4404 5114 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_16720 5172 6662 gene locus_tag LOCUS_16730 5172 6662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 6659 8032 gene locus_tag LOCUS_16740 6659 8032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 8517 8056 gene locus_tag LOCUS_16750 gene smpB 8517 8056 CDS product SsrA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780358.1 protein_id gnl|my_center|LOCUS_16750 9137 8571 gene locus_tag LOCUS_16760 9137 8571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 10167 11114 gene locus_tag LOCUS_16770 gene miaA 10167 11114 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795937.1 protein_id gnl|my_center|LOCUS_16770 11558 11115 gene locus_tag LOCUS_16780 11558 11115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 13809 11698 gene locus_tag LOCUS_16790 13809 11698 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_16790 14867 13836 gene locus_tag LOCUS_16800 gene recA 14867 13836 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785787.1 protein_id gnl|my_center|LOCUS_16800 15349 14882 gene locus_tag LOCUS_16810 gene bcp 15349 14882 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence065 1502 2245 gene locus_tag LOCUS_16820 1502 2245 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203156.1 protein_id gnl|my_center|LOCUS_16820 2257 3603 gene locus_tag LOCUS_16830 2257 3603 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_16830 4252 3641 gene locus_tag LOCUS_16840 4252 3641 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107438.1 protein_id gnl|my_center|LOCUS_16840 5183 4236 gene locus_tag LOCUS_16850 5183 4236 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_16850 5394 6050 gene locus_tag LOCUS_16860 5394 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942499.1 protein_id gnl|my_center|LOCUS_16860 7329 6067 gene locus_tag LOCUS_16870 7329 6067 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_16870 7431 10796 gene locus_tag LOCUS_16880 gene mfd 7431 10796 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203155.1 protein_id gnl|my_center|LOCUS_16880 12952 10877 gene locus_tag LOCUS_16890 12952 10877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 13072 13809 gene locus_tag LOCUS_16900 13072 13809 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764531.1 protein_id gnl|my_center|LOCUS_16900 13793 15070 gene locus_tag LOCUS_16910 13793 15070 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785451.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence066 1586 2278 gene locus_tag LOCUS_16920 1586 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 2551 2282 gene locus_tag LOCUS_16930 2551 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 3332 2676 gene locus_tag LOCUS_16940 3332 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 5492 3345 gene locus_tag LOCUS_16950 5492 3345 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762583.1 protein_id gnl|my_center|LOCUS_16950 5538 6638 gene locus_tag LOCUS_16960 5538 6638 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929529.1 protein_id gnl|my_center|LOCUS_16960 6870 8681 gene locus_tag LOCUS_16970 6870 8681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 8692 9690 gene locus_tag LOCUS_16980 8692 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 9831 12017 gene locus_tag LOCUS_16990 9831 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 12061 13902 gene locus_tag LOCUS_17000 12061 13902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 13899 14039 gene locus_tag LOCUS_17010 13899 14039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 15077 14106 gene locus_tag LOCUS_17020 15077 14106 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_17020 15335 15787 gene locus_tag LOCUS_17030 15335 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 >Feature sequence067 202 402 gene locus_tag LOCUS_17040 202 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 521 1993 gene locus_tag LOCUS_17050 521 1993 CDS product SMP-30/gluconolactonase/LRE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088341588.1 protein_id gnl|my_center|LOCUS_17050 3208 2132 gene locus_tag LOCUS_17060 3208 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4200 3436 gene locus_tag LOCUS_17070 4200 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 9020 5037 gene locus_tag LOCUS_17080 9020 5037 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203355.1 protein_id gnl|my_center|LOCUS_17080 9404 9135 gene locus_tag LOCUS_17090 9404 9135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 10223 11896 gene locus_tag LOCUS_17100 10223 11896 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391657.1 protein_id gnl|my_center|LOCUS_17100 13037 11880 gene locus_tag LOCUS_17110 13037 11880 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001176863.1 protein_id gnl|my_center|LOCUS_17110 13081 14178 gene locus_tag LOCUS_17120 13081 14178 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003863093.1 protein_id gnl|my_center|LOCUS_17120 14234 15187 gene locus_tag LOCUS_17130 14234 15187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 15692 16234 gene locus_tag LOCUS_17140 15692 16234 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802164.1 protein_id gnl|my_center|LOCUS_17140 >Feature sequence068 251 57 gene locus_tag LOCUS_17150 251 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 1261 1683 gene locus_tag LOCUS_17160 1261 1683 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965528.1 protein_id gnl|my_center|LOCUS_17160 1736 3118 gene locus_tag LOCUS_17170 gene fumC 1736 3118 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650562.1 protein_id gnl|my_center|LOCUS_17170 3252 5144 gene locus_tag LOCUS_17180 gene mutA 3252 5144 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108132.1 protein_id gnl|my_center|LOCUS_17180 5155 7290 gene locus_tag LOCUS_17190 gene scpA 5155 7290 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000828556.1 protein_id gnl|my_center|LOCUS_17190 7511 8203 gene locus_tag LOCUS_17200 7511 8203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 8206 8613 gene locus_tag LOCUS_17210 8206 8613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 9449 8619 gene locus_tag LOCUS_17220 9449 8619 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_17220 9602 10984 gene locus_tag LOCUS_17230 9602 10984 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_17230 11064 11136 gene locus_tag LOCUS_t00270 11064 11136 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 11919 13469 gene locus_tag LOCUS_17240 gene mmdA 11919 13469 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868010.1 protein_id gnl|my_center|LOCUS_17240 13487 15013 gene locus_tag LOCUS_17250 gene accC 13487 15013 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057645.1 protein_id gnl|my_center|LOCUS_17250 15044 15577 gene locus_tag LOCUS_17260 15044 15577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 15654 15908 gene locus_tag LOCUS_17270 gene rpsT 15654 15908 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767624.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence069 524 141 gene locus_tag LOCUS_17280 524 141 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_17280 994 776 gene locus_tag LOCUS_17290 994 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1382 1008 gene locus_tag LOCUS_17300 1382 1008 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_17300 1750 1451 gene locus_tag LOCUS_17310 1750 1451 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963681.1 protein_id gnl|my_center|LOCUS_17310 2276 2091 gene locus_tag LOCUS_17320 2276 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 2469 2651 gene locus_tag LOCUS_17330 2469 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 3582 2803 gene locus_tag LOCUS_17340 3582 2803 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791104.1 protein_id gnl|my_center|LOCUS_17340 4600 3596 gene locus_tag LOCUS_17350 gene aroC 4600 3596 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020599.1 protein_id gnl|my_center|LOCUS_17350 5267 4608 gene locus_tag LOCUS_17360 gene aroD 5267 4608 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024466.1 protein_id gnl|my_center|LOCUS_17360 6282 5254 gene locus_tag LOCUS_17370 gene aroB 6282 5254 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196751.1 protein_id gnl|my_center|LOCUS_17370 7398 6295 gene locus_tag LOCUS_17380 7398 6295 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_17380 8273 7410 gene locus_tag LOCUS_17390 8273 7410 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993542.1 protein_id gnl|my_center|LOCUS_17390 8498 9145 gene locus_tag LOCUS_17400 gene nth 8498 9145 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203213.1 protein_id gnl|my_center|LOCUS_17400 9207 10085 gene locus_tag LOCUS_17410 9207 10085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 10323 11246 gene locus_tag LOCUS_17420 10323 11246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 11259 11699 gene locus_tag LOCUS_17430 11259 11699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 14508 11686 gene locus_tag LOCUS_17440 gene uvrA 14508 11686 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789604.1 protein_id gnl|my_center|LOCUS_17440 14742 15272 gene locus_tag LOCUS_17450 14742 15272 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence070 2058 988 gene locus_tag LOCUS_17460 2058 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2623 2060 gene locus_tag LOCUS_17470 2623 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3744 2731 gene locus_tag LOCUS_17480 3744 2731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 3889 5400 gene locus_tag LOCUS_17490 gene atpD 3889 5400 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761388.1 protein_id gnl|my_center|LOCUS_17490 5407 5667 gene locus_tag LOCUS_17500 5407 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933888.1 protein_id gnl|my_center|LOCUS_17500 7009 5675 gene locus_tag LOCUS_17510 7009 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 7645 7211 gene locus_tag LOCUS_17520 7645 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 7944 8690 gene locus_tag LOCUS_17530 7944 8690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 8687 9673 gene locus_tag LOCUS_17540 8687 9673 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_17540 9837 10154 gene locus_tag LOCUS_17550 9837 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 10386 11450 gene locus_tag LOCUS_17560 10386 11450 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817148.1 protein_id gnl|my_center|LOCUS_17560 11618 11543 gene locus_tag LOCUS_t00280 11618 11543 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 12010 11678 gene locus_tag LOCUS_17570 12010 11678 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_17570 12459 12007 gene locus_tag LOCUS_17580 gene dtd 12459 12007 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108726.1 protein_id gnl|my_center|LOCUS_17580 12590 15235 gene locus_tag LOCUS_17590 12590 15235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence071 1524 274 gene locus_tag LOCUS_17600 1524 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 2629 1535 gene locus_tag LOCUS_17610 2629 1535 CDS product glycoside hydrolase family 88 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107138.1 protein_id gnl|my_center|LOCUS_17610 4267 2990 gene locus_tag LOCUS_17620 4267 2990 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_17620 4990 4589 gene locus_tag LOCUS_17630 4990 4589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 6603 4987 gene locus_tag LOCUS_17640 6603 4987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 6794 7402 gene locus_tag LOCUS_17650 6794 7402 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772090.1 protein_id gnl|my_center|LOCUS_17650 7859 7407 gene locus_tag LOCUS_17660 7859 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17660 8390 7911 gene locus_tag LOCUS_17670 8390 7911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17670 9276 8455 gene locus_tag LOCUS_17680 gene proC 9276 8455 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_17680 10638 9373 gene locus_tag LOCUS_17690 10638 9373 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203214.1 protein_id gnl|my_center|LOCUS_17690 10724 11887 gene locus_tag LOCUS_17700 10724 11887 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_17700 11950 13140 gene locus_tag LOCUS_17710 gene ricT 11950 13140 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203582.1 protein_id gnl|my_center|LOCUS_17710 13121 13591 gene locus_tag LOCUS_17720 13121 13591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 13604 14317 gene locus_tag LOCUS_17730 gene trmB 13604 14317 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840567.1 protein_id gnl|my_center|LOCUS_17730 14283 14633 gene locus_tag LOCUS_17740 14283 14633 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_17740 >Feature sequence072 <1 1145 gene locus_tag LOCUS_17750 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679307.1:UvrD-helicase domain-containing protein 4327 1961 gene locus_tag LOCUS_17760 4327 1961 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035989.1 protein_id gnl|my_center|LOCUS_17760 4761 4345 gene locus_tag LOCUS_17770 4761 4345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 5636 4965 gene locus_tag LOCUS_17780 5636 4965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 6670 5921 gene locus_tag LOCUS_17790 6670 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 6942 12500 gene locus_tag LOCUS_17800 6942 12500 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_105100240.1 protein_id gnl|my_center|LOCUS_17800 12654 14258 gene locus_tag LOCUS_17810 12654 14258 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964301.1 protein_id gnl|my_center|LOCUS_17810 15053 14322 gene locus_tag LOCUS_17820 15053 14322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 >Feature sequence073 47 1627 gene locus_tag LOCUS_17830 47 1627 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_17830 1757 3472 gene locus_tag LOCUS_17840 1757 3472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 3763 5283 gene locus_tag LOCUS_17850 3763 5283 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_17850 5430 7085 gene locus_tag LOCUS_17860 5430 7085 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256698.1 protein_id gnl|my_center|LOCUS_17860 7300 9180 gene locus_tag LOCUS_17870 7300 9180 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303156.1 protein_id gnl|my_center|LOCUS_17870 9425 9192 gene locus_tag LOCUS_17880 9425 9192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 10152 9418 gene locus_tag LOCUS_17890 10152 9418 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_17890 10796 10164 gene locus_tag LOCUS_17900 10796 10164 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_17900 11538 10951 gene locus_tag LOCUS_17910 gene gldD 11538 10951 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_17910 12859 11543 gene locus_tag LOCUS_17920 12859 11543 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_17920 13315 12872 gene locus_tag LOCUS_17930 gene ssb 13315 12872 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_137264126.1 protein_id gnl|my_center|LOCUS_17930 14444 13365 gene locus_tag LOCUS_17940 gene mutY 14444 13365 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303166.1 protein_id gnl|my_center|LOCUS_17940 >Feature sequence074 1155 73 gene locus_tag LOCUS_17950 1155 73 CDS product arabinogalactan endo-1,4-beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036451.1 protein_id gnl|my_center|LOCUS_17950 1364 2635 gene locus_tag LOCUS_17960 1364 2635 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840969.1 protein_id gnl|my_center|LOCUS_17960 3154 2675 gene locus_tag LOCUS_17970 3154 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 6184 3314 gene locus_tag LOCUS_17980 6184 3314 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202548.1 protein_id gnl|my_center|LOCUS_17980 7616 6231 gene locus_tag LOCUS_17990 7616 6231 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109239.1 protein_id gnl|my_center|LOCUS_17990 9290 7941 gene locus_tag LOCUS_18000 9290 7941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 11936 9303 gene locus_tag LOCUS_18010 11936 9303 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_18010 13476 12202 gene locus_tag LOCUS_18020 13476 12202 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_18020 13861 14085 gene locus_tag LOCUS_18030 13861 14085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence075 246 1391 gene locus_tag LOCUS_18040 gene dnaJ 246 1391 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_18040 1460 2392 gene locus_tag LOCUS_18050 1460 2392 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_18050 2411 3763 gene locus_tag LOCUS_18060 2411 3763 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_18060 3763 4704 gene locus_tag LOCUS_18070 3763 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4709 5875 gene locus_tag LOCUS_18080 4709 5875 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_18080 5885 7249 gene locus_tag LOCUS_18090 5885 7249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8175 7297 gene locus_tag LOCUS_18100 8175 7297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 10779 9298 gene locus_tag LOCUS_18110 10779 9298 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_18110 11619 10813 gene locus_tag LOCUS_18120 11619 10813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12821 11625 gene locus_tag LOCUS_18130 12821 11625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 13097 14344 gene locus_tag LOCUS_18140 13097 14344 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228423.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence076 752 1072 gene locus_tag LOCUS_18150 752 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1069 1551 gene locus_tag LOCUS_18160 1069 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 1606 1917 gene locus_tag LOCUS_18170 1606 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2463 1990 gene locus_tag LOCUS_18180 2463 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 4006 2552 gene locus_tag LOCUS_18190 gene gnd 4006 2552 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688061.1 protein_id gnl|my_center|LOCUS_18190 5164 4028 gene locus_tag LOCUS_18200 gene pdxB 5164 4028 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108789.1 protein_id gnl|my_center|LOCUS_18200 6452 5169 gene locus_tag LOCUS_18210 6452 5169 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_18210 7335 6490 gene locus_tag LOCUS_18220 7335 6490 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245605.1 protein_id gnl|my_center|LOCUS_18220 8410 7328 gene locus_tag LOCUS_18230 8410 7328 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793311.1 protein_id gnl|my_center|LOCUS_18230 8585 9826 gene locus_tag LOCUS_18240 8585 9826 CDS product tagaturonate epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119734.1 protein_id gnl|my_center|LOCUS_18240 9835 11238 gene locus_tag LOCUS_18250 gene uxaC 9835 11238 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765680.1 protein_id gnl|my_center|LOCUS_18250 13478 11595 gene locus_tag LOCUS_18260 13478 11595 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695564.1 protein_id gnl|my_center|LOCUS_18260 14363 13644 gene locus_tag LOCUS_18270 14363 13644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 >Feature sequence077 1982 945 gene locus_tag LOCUS_18280 gene czcB 1982 945 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_18280 3412 2057 gene locus_tag LOCUS_18290 3412 2057 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791704.1 protein_id gnl|my_center|LOCUS_18290 4257 3676 gene locus_tag LOCUS_18300 4257 3676 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103300.1 protein_id gnl|my_center|LOCUS_18300 5010 4336 gene locus_tag LOCUS_18310 gene ung 5010 4336 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798174.1 protein_id gnl|my_center|LOCUS_18310 6269 5046 gene locus_tag LOCUS_18320 6269 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 7203 6283 gene locus_tag LOCUS_18330 gene gldA 7203 6283 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_18330 7351 8322 gene locus_tag LOCUS_18340 7351 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 8416 9201 gene locus_tag LOCUS_18350 8416 9201 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797101.1 protein_id gnl|my_center|LOCUS_18350 9206 10312 gene locus_tag LOCUS_18360 9206 10312 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_18360 10904 10293 gene locus_tag LOCUS_18370 10904 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 12392 10914 gene locus_tag LOCUS_18380 gene rpoN 12392 10914 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_18380 13870 12473 gene locus_tag LOCUS_18390 gene asnS 13870 12473 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203550.1 protein_id gnl|my_center|LOCUS_18390 14043 14222 gene locus_tag LOCUS_18400 14043 14222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 >Feature sequence078 71 355 gene locus_tag LOCUS_18410 71 355 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776335.1 protein_id gnl|my_center|LOCUS_18410 564 2111 gene locus_tag LOCUS_18420 564 2111 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_18420 2137 4179 gene locus_tag LOCUS_18430 2137 4179 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048693189.1 protein_id gnl|my_center|LOCUS_18430 5268 4225 gene locus_tag LOCUS_18440 5268 4225 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_18440 7113 5272 gene locus_tag LOCUS_18450 7113 5272 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_18450 7382 7900 gene locus_tag LOCUS_18460 7382 7900 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791506.1 protein_id gnl|my_center|LOCUS_18460 8986 7901 gene locus_tag LOCUS_18470 8986 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 9896 9105 gene locus_tag LOCUS_18480 9896 9105 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207498.1 protein_id gnl|my_center|LOCUS_18480 11265 9907 gene locus_tag LOCUS_18490 11265 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 12565 11270 gene locus_tag LOCUS_18500 12565 11270 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207163.1 protein_id gnl|my_center|LOCUS_18500 12826 13338 gene locus_tag LOCUS_18510 12826 13338 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861543.1 protein_id gnl|my_center|LOCUS_18510 13516 13878 gene locus_tag LOCUS_18520 13516 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 >Feature sequence079 302 1033 gene locus_tag LOCUS_18530 302 1033 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_18530 2389 1337 gene locus_tag LOCUS_18540 2389 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 4105 2504 gene locus_tag LOCUS_18550 4105 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 4597 4106 gene locus_tag LOCUS_18560 4597 4106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 5436 4699 gene locus_tag LOCUS_18570 5436 4699 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118831743.1 protein_id gnl|my_center|LOCUS_18570 5632 6819 gene locus_tag LOCUS_18580 5632 6819 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066535.1 protein_id gnl|my_center|LOCUS_18580 7544 6870 gene locus_tag LOCUS_18590 7544 6870 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_18590 10166 7689 gene locus_tag LOCUS_18600 10166 7689 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202542.1 protein_id gnl|my_center|LOCUS_18600 10959 10177 gene locus_tag LOCUS_18610 10959 10177 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_18610 12154 11219 gene locus_tag LOCUS_18620 12154 11219 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_18620 12807 12151 gene locus_tag LOCUS_18630 12807 12151 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_18630 13689 12814 gene locus_tag LOCUS_18640 13689 12814 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786129.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence080 2084 822 gene locus_tag LOCUS_18650 2084 822 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853214.1 protein_id gnl|my_center|LOCUS_18650 2576 2094 gene locus_tag LOCUS_18660 2576 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 4662 2692 gene locus_tag LOCUS_18670 4662 2692 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_18670 5891 4659 gene locus_tag LOCUS_18680 5891 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 6895 5903 gene locus_tag LOCUS_18690 6895 5903 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529475.1 protein_id gnl|my_center|LOCUS_18690 7648 7001 gene locus_tag LOCUS_18700 7648 7001 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964173.1 protein_id gnl|my_center|LOCUS_18700 8475 7645 gene locus_tag LOCUS_18710 8475 7645 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 protein_id gnl|my_center|LOCUS_18710 9686 8487 gene locus_tag LOCUS_18720 9686 8487 CDS product mannitol-1-phosphate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209620.1 protein_id gnl|my_center|LOCUS_18720 12156 9700 gene locus_tag LOCUS_18730 12156 9700 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_18730 13431 12190 gene locus_tag LOCUS_18740 gene acoC 13431 12190 CDS product acetoin dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244059.1 protein_id gnl|my_center|LOCUS_18740 >Feature sequence081 1206 97 gene locus_tag LOCUS_18750 1206 97 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18750 1544 2044 gene locus_tag LOCUS_18760 1544 2044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2726 2112 gene locus_tag LOCUS_18770 2726 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 2871 4283 gene locus_tag LOCUS_18780 2871 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 4437 4362 gene locus_tag LOCUS_t00290 4437 4362 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4626 7415 gene locus_tag LOCUS_18790 4626 7415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203680.1 protein_id gnl|my_center|LOCUS_18790 7717 10665 gene locus_tag LOCUS_18800 7717 10665 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203678.1 protein_id gnl|my_center|LOCUS_18800 10675 12153 gene locus_tag LOCUS_18810 10675 12153 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203677.1 protein_id gnl|my_center|LOCUS_18810 12185 13438 gene locus_tag LOCUS_18820 12185 13438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 >Feature sequence082 249 175 gene locus_tag LOCUS_t00300 249 175 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 903 1280 gene locus_tag LOCUS_18830 903 1280 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_18830 1463 2860 gene locus_tag LOCUS_18840 1463 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 2857 4062 gene locus_tag LOCUS_18850 2857 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 4059 5243 gene locus_tag LOCUS_18860 4059 5243 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_18860 5197 6474 gene locus_tag LOCUS_18870 5197 6474 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_18870 6479 7465 gene locus_tag LOCUS_18880 gene fmt 6479 7465 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770001.1 protein_id gnl|my_center|LOCUS_18880 8357 7410 gene locus_tag LOCUS_18890 8357 7410 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786259.1 protein_id gnl|my_center|LOCUS_18890 9251 8574 gene locus_tag LOCUS_18900 9251 8574 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_18900 10069 9254 gene locus_tag LOCUS_18910 gene panB 10069 9254 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_18910 10290 12203 gene locus_tag LOCUS_18920 gene dnaK 10290 12203 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764765.1 protein_id gnl|my_center|LOCUS_18920 13449 12640 gene locus_tag LOCUS_18930 13449 12640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18930 13751 13464 gene locus_tag LOCUS_18940 13751 13464 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055138255.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence083 1150 1818 gene locus_tag LOCUS_18950 1150 1818 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_18950 1838 3778 gene locus_tag LOCUS_18960 1838 3778 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783490.1 protein_id gnl|my_center|LOCUS_18960 3831 4571 gene locus_tag LOCUS_18970 3831 4571 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933915.1 protein_id gnl|my_center|LOCUS_18970 6004 4616 gene locus_tag LOCUS_18980 6004 4616 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_18980 6328 7059 gene locus_tag LOCUS_18990 6328 7059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790656.1 protein_id gnl|my_center|LOCUS_18990 7970 7041 gene locus_tag LOCUS_19000 7970 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 8011 9018 gene locus_tag LOCUS_19010 gene dusB 8011 9018 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964342.1 protein_id gnl|my_center|LOCUS_19010 10586 9006 gene locus_tag LOCUS_19020 gene nadB 10586 9006 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_19020 11925 10570 gene locus_tag LOCUS_19030 11925 10570 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259349.1 protein_id gnl|my_center|LOCUS_19030 13294 12023 gene locus_tag LOCUS_19040 13294 12023 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence084 1036 62 gene locus_tag LOCUS_19050 1036 62 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120607.1 protein_id gnl|my_center|LOCUS_19050 2191 1244 gene locus_tag LOCUS_19060 2191 1244 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003563892.1 protein_id gnl|my_center|LOCUS_19060 2480 3349 gene locus_tag LOCUS_19070 2480 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 3361 4146 gene locus_tag LOCUS_19080 3361 4146 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121747.1 protein_id gnl|my_center|LOCUS_19080 4311 5372 gene locus_tag LOCUS_19090 4311 5372 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403493.1 protein_id gnl|my_center|LOCUS_19090 5383 8430 gene locus_tag LOCUS_19100 5383 8430 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838342.1 protein_id gnl|my_center|LOCUS_19100 8445 9827 gene locus_tag LOCUS_19110 8445 9827 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764018.1 protein_id gnl|my_center|LOCUS_19110 9896 10696 gene locus_tag LOCUS_19120 9896 10696 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_19120 10909 12993 gene locus_tag LOCUS_19130 10909 12993 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_19130 >Feature sequence085 <1 1158 gene locus_tag LOCUS_19140 <1 1158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405119.1:glycosyltransferase family 4 protein 1169 2242 gene locus_tag LOCUS_19150 1169 2242 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050765261.1 protein_id gnl|my_center|LOCUS_19150 2255 3007 gene locus_tag LOCUS_19160 2255 3007 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203060.1 protein_id gnl|my_center|LOCUS_19160 3373 3008 gene locus_tag LOCUS_19170 3373 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 3642 5117 gene locus_tag LOCUS_19180 3642 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 5399 7867 gene locus_tag LOCUS_19190 5399 7867 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_19190 8604 7882 gene locus_tag LOCUS_19200 8604 7882 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107357.1 protein_id gnl|my_center|LOCUS_19200 12536 8856 gene locus_tag LOCUS_19210 12536 8856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence086 425 628 gene locus_tag LOCUS_19220 425 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 1242 838 gene locus_tag LOCUS_19230 1242 838 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881282.1 protein_id gnl|my_center|LOCUS_19230 1467 2336 gene locus_tag LOCUS_19240 1467 2336 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_19240 2323 3315 gene locus_tag LOCUS_19250 2323 3315 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764326.1 protein_id gnl|my_center|LOCUS_19250 4258 3392 gene locus_tag LOCUS_19260 gene ubiA 4258 3392 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_19260 4764 4255 gene locus_tag LOCUS_19270 4764 4255 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_19270 7221 4768 gene locus_tag LOCUS_19280 gene pheT 7221 4768 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_19280 7435 8211 gene locus_tag LOCUS_19290 gene surE 7435 8211 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964421.1 protein_id gnl|my_center|LOCUS_19290 8208 8504 gene locus_tag LOCUS_19300 8208 8504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 8536 9666 gene locus_tag LOCUS_19310 gene lpxB 8536 9666 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784854.1 protein_id gnl|my_center|LOCUS_19310 9666 10796 gene locus_tag LOCUS_19320 9666 10796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 10854 11618 gene locus_tag LOCUS_19330 gene gldF 10854 11618 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_19330 >Feature sequence087 1431 82 gene locus_tag LOCUS_19340 1431 82 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119366.1 protein_id gnl|my_center|LOCUS_19340 2875 1442 gene locus_tag LOCUS_19350 2875 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 4448 3102 gene locus_tag LOCUS_19360 4448 3102 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_19360 4698 5306 gene locus_tag LOCUS_19370 gene nrfH 4698 5306 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_19370 5324 6799 gene locus_tag LOCUS_19380 gene nrfA 5324 6799 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201986.1 protein_id gnl|my_center|LOCUS_19380 6908 7642 gene locus_tag LOCUS_19390 6908 7642 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_19390 7790 8824 gene locus_tag LOCUS_19400 7790 8824 CDS product DUF1593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008668242.1 protein_id gnl|my_center|LOCUS_19400 10726 9059 gene locus_tag LOCUS_19410 10726 9059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 13107 10906 gene locus_tag LOCUS_19420 13107 10906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence088 1763 2590 gene locus_tag LOCUS_19430 1763 2590 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787685.1 protein_id gnl|my_center|LOCUS_19430 3236 2562 gene locus_tag LOCUS_19440 3236 2562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4107 3352 gene locus_tag LOCUS_19450 gene ubiE 4107 3352 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024980308.1 protein_id gnl|my_center|LOCUS_19450 4253 4095 gene locus_tag LOCUS_19460 4253 4095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 4207 4959 gene locus_tag LOCUS_19470 4207 4959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 4971 6047 gene locus_tag LOCUS_19480 4971 6047 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_19480 6820 6068 gene locus_tag LOCUS_19490 6820 6068 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763940.1 protein_id gnl|my_center|LOCUS_19490 7664 8446 gene locus_tag LOCUS_19500 7664 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 8557 9564 gene locus_tag LOCUS_19510 gene gap 8557 9564 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759940.1 protein_id gnl|my_center|LOCUS_19510 10090 9710 gene locus_tag LOCUS_19520 10090 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 11371 10103 gene locus_tag LOCUS_19530 11371 10103 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964122.1 protein_id gnl|my_center|LOCUS_19530 >Feature sequence089 <1 910 gene locus_tag LOCUS_19540 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108480.1:translational GTPase TypA 1216 1647 gene locus_tag LOCUS_19550 1216 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 1644 2108 gene locus_tag LOCUS_19560 1644 2108 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454240.1 protein_id gnl|my_center|LOCUS_19560 2329 3999 gene locus_tag LOCUS_19570 2329 3999 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201875.1 protein_id gnl|my_center|LOCUS_19570 7150 4004 gene locus_tag LOCUS_19580 7150 4004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 8202 7366 gene locus_tag LOCUS_19590 8202 7366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 9801 8281 gene locus_tag LOCUS_19600 9801 8281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 12753 9814 gene locus_tag LOCUS_19610 12753 9814 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202056.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence090 437 1192 gene locus_tag LOCUS_19620 gene hisF 437 1192 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203119.1 protein_id gnl|my_center|LOCUS_19620 1200 1793 gene locus_tag LOCUS_19630 gene hisIE 1200 1793 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_19630 2179 1820 gene locus_tag LOCUS_19640 2179 1820 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933716.1 protein_id gnl|my_center|LOCUS_19640 3997 2198 gene locus_tag LOCUS_19650 3997 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19650 6134 4167 gene locus_tag LOCUS_19660 6134 4167 CDS product M13 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814533.1 protein_id gnl|my_center|LOCUS_19660 7459 6248 gene locus_tag LOCUS_19670 gene rocD 7459 6248 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_19670 7635 8189 gene locus_tag LOCUS_19680 7635 8189 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067426.1 protein_id gnl|my_center|LOCUS_19680 8423 11362 gene locus_tag LOCUS_19690 8423 11362 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109087.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence091 619 1005 gene locus_tag LOCUS_19700 619 1005 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460531.1 protein_id gnl|my_center|LOCUS_19700 984 1286 gene locus_tag LOCUS_19710 984 1286 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811823.1 protein_id gnl|my_center|LOCUS_19710 2661 1474 gene locus_tag LOCUS_19720 2661 1474 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_19720 3037 2669 gene locus_tag LOCUS_19730 3037 2669 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_19730 6338 3051 gene locus_tag LOCUS_19740 6338 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 6515 7519 gene locus_tag LOCUS_19750 6515 7519 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796193.1 protein_id gnl|my_center|LOCUS_19750 7531 8628 gene locus_tag LOCUS_19760 gene meaB 7531 8628 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_19760 8633 9733 gene locus_tag LOCUS_19770 8633 9733 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815367.1 protein_id gnl|my_center|LOCUS_19770 9738 10805 gene locus_tag LOCUS_19780 9738 10805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 10837 12228 gene locus_tag LOCUS_19790 gene lpdA 10837 12228 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence092 700 1497 gene locus_tag LOCUS_19800 700 1497 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_19800 1593 3119 gene locus_tag LOCUS_19810 gene xylB 1593 3119 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393521.1 protein_id gnl|my_center|LOCUS_19810 3116 4675 gene locus_tag LOCUS_19820 3116 4675 CDS product sodium/sugar symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422351.1 protein_id gnl|my_center|LOCUS_19820 4802 5059 gene locus_tag LOCUS_19830 4802 5059 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_19830 5046 6143 gene locus_tag LOCUS_19840 gene hypD 5046 6143 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_19840 6136 7185 gene locus_tag LOCUS_19850 gene hypE 6136 7185 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933452.1 protein_id gnl|my_center|LOCUS_19850 8339 7398 gene locus_tag LOCUS_19860 8339 7398 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907889.1 protein_id gnl|my_center|LOCUS_19860 9628 8354 gene locus_tag LOCUS_19870 9628 8354 CDS product DUF4153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181621.1 protein_id gnl|my_center|LOCUS_19870 10037 11008 gene locus_tag LOCUS_19880 10037 11008 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714630.1 protein_id gnl|my_center|LOCUS_19880 12115 11042 gene locus_tag LOCUS_19890 12115 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence093 <1 1747 gene locus_tag LOCUS_19900 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964233.1:glycoside hydrolase family 44 protein 1998 2765 gene locus_tag LOCUS_19910 1998 2765 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202553.1 protein_id gnl|my_center|LOCUS_19910 4467 2785 gene locus_tag LOCUS_19920 4467 2785 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_19920 4636 5415 gene locus_tag LOCUS_19930 4636 5415 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_19930 5429 5950 gene locus_tag LOCUS_19940 5429 5950 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767850.1 protein_id gnl|my_center|LOCUS_19940 5963 6916 gene locus_tag LOCUS_19950 5963 6916 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_19950 6919 7530 gene locus_tag LOCUS_19960 6919 7530 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_19960 7692 8093 gene locus_tag LOCUS_19970 gene nikR 7692 8093 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943609.1 protein_id gnl|my_center|LOCUS_19970 8122 9477 gene locus_tag LOCUS_19980 8122 9477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19980 9490 11337 gene locus_tag LOCUS_19990 9490 11337 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695098.1 protein_id gnl|my_center|LOCUS_19990 11345 12064 gene locus_tag LOCUS_20000 11345 12064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 >Feature sequence094 357 1631 gene locus_tag LOCUS_20010 357 1631 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_20010 2410 1652 gene locus_tag LOCUS_20020 gene rsmA 2410 1652 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784867.1 protein_id gnl|my_center|LOCUS_20020 2518 3420 gene locus_tag LOCUS_20030 2518 3420 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_20030 3428 4855 gene locus_tag LOCUS_20040 gene ahcY 3428 4855 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932403.1 protein_id gnl|my_center|LOCUS_20040 5376 4915 gene locus_tag LOCUS_20050 5376 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 5381 5734 gene locus_tag LOCUS_20060 5381 5734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 5724 6293 gene locus_tag LOCUS_20070 5724 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 6448 6921 gene locus_tag LOCUS_20080 gene greA 6448 6921 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791379.1 protein_id gnl|my_center|LOCUS_20080 6932 7327 gene locus_tag LOCUS_20090 6932 7327 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_20090 7949 7392 gene locus_tag LOCUS_20100 gene ruvC 7949 7392 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_20100 9109 7958 gene locus_tag LOCUS_20110 9109 7958 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_20110 10163 9276 gene locus_tag LOCUS_20120 10163 9276 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_20120 11472 10198 gene locus_tag LOCUS_20130 gene serS 11472 10198 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_20130 11820 11560 gene locus_tag LOCUS_20140 gene rpmA 11820 11560 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785336.1 protein_id gnl|my_center|LOCUS_20140 <12358 11851 gene locus_tag LOCUS_20150 <12358 11851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964307.1:50S ribosomal protein L21 >Feature sequence095 228 638 gene locus_tag LOCUS_20160 228 638 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_20160 1229 657 gene locus_tag LOCUS_20170 gene trxA 1229 657 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788325.1 protein_id gnl|my_center|LOCUS_20170 2024 1296 gene locus_tag LOCUS_20180 2024 1296 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108916.1 protein_id gnl|my_center|LOCUS_20180 2702 2049 gene locus_tag LOCUS_20190 2702 2049 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963856.1 protein_id gnl|my_center|LOCUS_20190 4227 2689 gene locus_tag LOCUS_20200 gene gltX 4227 2689 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765418.1 protein_id gnl|my_center|LOCUS_20200 4911 4273 gene locus_tag LOCUS_20210 4911 4273 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809593.1 protein_id gnl|my_center|LOCUS_20210 5346 5756 gene locus_tag LOCUS_20220 5346 5756 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_20220 5828 6787 gene locus_tag LOCUS_20230 5828 6787 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_20230 6913 8100 gene locus_tag LOCUS_20240 gene kbl 6913 8100 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203088.1 protein_id gnl|my_center|LOCUS_20240 8170 10128 gene locus_tag LOCUS_20250 8170 10128 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764318.1 protein_id gnl|my_center|LOCUS_20250 10351 10154 gene locus_tag LOCUS_20260 10351 10154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20260 11412 10363 gene locus_tag LOCUS_20270 11412 10363 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957761.1 protein_id gnl|my_center|LOCUS_20270 12257 11667 gene locus_tag LOCUS_20280 12257 11667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 >Feature sequence096 786 2363 gene locus_tag LOCUS_20290 786 2363 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786020.1 protein_id gnl|my_center|LOCUS_20290 3001 2342 gene locus_tag LOCUS_20300 3001 2342 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933918.1 protein_id gnl|my_center|LOCUS_20300 3692 3003 gene locus_tag LOCUS_20310 3692 3003 CDS product 2-phosphosulfolactate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233050.1 protein_id gnl|my_center|LOCUS_20310 4174 3722 gene locus_tag LOCUS_20320 4174 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 4782 4198 gene locus_tag LOCUS_20330 4782 4198 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_20330 5102 4857 gene locus_tag LOCUS_20340 5102 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 6607 5099 gene locus_tag LOCUS_20350 6607 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 6999 6613 gene locus_tag LOCUS_20360 6999 6613 CDS product DUF1987 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444620.1 protein_id gnl|my_center|LOCUS_20360 8902 7115 gene locus_tag LOCUS_20370 8902 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 9052 9435 gene locus_tag LOCUS_20380 9052 9435 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_20380 10387 9443 gene locus_tag LOCUS_20390 10387 9443 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073173113.1 protein_id gnl|my_center|LOCUS_20390 10526 10329 gene locus_tag LOCUS_20400 10526 10329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 10796 12133 gene locus_tag LOCUS_20410 10796 12133 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107706.1 protein_id gnl|my_center|LOCUS_20410 >Feature sequence097 408 1340 gene locus_tag LOCUS_20420 408 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 1420 5751 gene locus_tag LOCUS_20430 1420 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 5761 7824 gene locus_tag LOCUS_20440 5761 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence098 1260 640 gene locus_tag LOCUS_20450 gene thrH 1260 640 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116438.1 protein_id gnl|my_center|LOCUS_20450 2680 1274 gene locus_tag LOCUS_20460 gene thrC 2680 1274 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_20460 5121 2692 gene locus_tag LOCUS_20470 gene thrA 5121 2692 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108282.1 protein_id gnl|my_center|LOCUS_20470 6285 5353 gene locus_tag LOCUS_20480 gene fabD 6285 5353 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_20480 7223 6585 gene locus_tag LOCUS_20490 gene folE 7223 6585 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_20490 7660 7244 gene locus_tag LOCUS_20500 7660 7244 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_20500 7737 8444 gene locus_tag LOCUS_20510 7737 8444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 8441 9277 gene locus_tag LOCUS_20520 8441 9277 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228771.1 protein_id gnl|my_center|LOCUS_20520 9290 10261 gene locus_tag LOCUS_20530 gene rfaD 9290 10261 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_20530 10494 10273 gene locus_tag LOCUS_20540 10494 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 >Feature sequence099 335 135 gene locus_tag LOCUS_20550 335 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 435 1334 gene locus_tag LOCUS_20560 435 1334 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 protein_id gnl|my_center|LOCUS_20560 2247 1345 gene locus_tag LOCUS_20570 2247 1345 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_20570 2430 3497 gene locus_tag LOCUS_20580 gene porQ 2430 3497 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_20580 3505 4206 gene locus_tag LOCUS_20590 gene cmk 3505 4206 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_20590 4252 5127 gene locus_tag LOCUS_20600 4252 5127 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_20600 5199 6176 gene locus_tag LOCUS_20610 gene pfkA 5199 6176 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790668.1 protein_id gnl|my_center|LOCUS_20610 6280 8760 gene locus_tag LOCUS_20620 gene priA 6280 8760 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203607.1 protein_id gnl|my_center|LOCUS_20620 8817 9818 gene locus_tag LOCUS_20630 gene rfaE1 8817 9818 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_20630 9869 9943 gene locus_tag LOCUS_t00310 9869 9943 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10330 11319 gene locus_tag LOCUS_20640 10330 11319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 >Feature sequence100 1031 423 gene locus_tag LOCUS_20650 gene hisH 1031 423 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803062.1 protein_id gnl|my_center|LOCUS_20650 1914 1033 gene locus_tag LOCUS_20660 gene purU 1914 1033 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_20660 3044 1914 gene locus_tag LOCUS_20670 gene hisB 3044 1914 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_20670 4082 3048 gene locus_tag LOCUS_20680 gene hisC 4082 3048 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_20680 5483 4176 gene locus_tag LOCUS_20690 gene hisD 5483 4176 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203178.1 protein_id gnl|my_center|LOCUS_20690 6374 5517 gene locus_tag LOCUS_20700 gene hisG 6374 5517 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760516.1 protein_id gnl|my_center|LOCUS_20700 6655 8028 gene locus_tag LOCUS_20710 6655 8028 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021662.1 protein_id gnl|my_center|LOCUS_20710 8101 10926 gene locus_tag LOCUS_20720 8101 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 >Feature sequence101 <1 1699 gene locus_tag LOCUS_20730 <1 1699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203085.1:DNA repair protein RecN 1753 2583 gene locus_tag LOCUS_20740 1753 2583 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_20740 2758 3915 gene locus_tag LOCUS_20750 2758 3915 CDS product DUF819 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861193.1 protein_id gnl|my_center|LOCUS_20750 4568 3909 gene locus_tag LOCUS_20760 4568 3909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 4826 6082 gene locus_tag LOCUS_20770 gene hutI 4826 6082 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_20770 6121 7806 gene locus_tag LOCUS_20780 6121 7806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 8751 7837 gene locus_tag LOCUS_20790 8751 7837 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_20790 9962 8748 gene locus_tag LOCUS_20800 gene coaBC 9962 8748 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_20800 10300 9962 gene locus_tag LOCUS_20810 10300 9962 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_20810 <11095 10320 gene locus_tag LOCUS_20820 <11095 10320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788200.1:outer membrane protein assembly factor BamD >Feature sequence102 1665 853 gene locus_tag LOCUS_20830 gene proB 1665 853 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_20830 2344 1676 gene locus_tag LOCUS_20840 2344 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3698 2355 gene locus_tag LOCUS_20850 gene argH 3698 2355 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_20850 4982 3741 gene locus_tag LOCUS_20860 4982 3741 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082326.1 protein_id gnl|my_center|LOCUS_20860 5591 5079 gene locus_tag LOCUS_20870 5591 5079 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762699.1 protein_id gnl|my_center|LOCUS_20870 5661 8882 gene locus_tag LOCUS_20880 gene carB 5661 8882 CDS product carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107320.1 protein_id gnl|my_center|LOCUS_20880 8892 9596 gene locus_tag LOCUS_20890 8892 9596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 >Feature sequence103 3196 71 gene locus_tag LOCUS_20900 3196 71 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_20900 3408 5960 gene locus_tag LOCUS_20910 3408 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20910 6071 8797 gene locus_tag LOCUS_20920 6071 8797 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227576.1 protein_id gnl|my_center|LOCUS_20920 8833 9840 gene locus_tag LOCUS_20930 8833 9840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 >Feature sequence104 93 2036 gene locus_tag LOCUS_20940 93 2036 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108029.1 protein_id gnl|my_center|LOCUS_20940 2050 2811 gene locus_tag LOCUS_20950 2050 2811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 4444 3041 gene locus_tag LOCUS_20960 4444 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 4663 6678 gene locus_tag LOCUS_20970 gene uvrB 4663 6678 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_20970 7551 6691 gene locus_tag LOCUS_20980 7551 6691 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_20980 9174 7738 gene locus_tag LOCUS_20990 9174 7738 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_20990 9298 10083 gene locus_tag LOCUS_21000 gene dapF 9298 10083 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence105 333 1679 gene locus_tag LOCUS_21010 333 1679 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555764.1 protein_id gnl|my_center|LOCUS_21010 1651 2121 gene locus_tag LOCUS_21020 1651 2121 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 protein_id gnl|my_center|LOCUS_21020 2219 2620 gene locus_tag LOCUS_21030 2219 2620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 2690 3091 gene locus_tag LOCUS_21040 2690 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 3200 4417 gene locus_tag LOCUS_21050 3200 4417 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546088.1 protein_id gnl|my_center|LOCUS_21050 4507 6183 gene locus_tag LOCUS_21060 4507 6183 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680032.1 protein_id gnl|my_center|LOCUS_21060 6443 7405 gene locus_tag LOCUS_21070 6443 7405 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941760.1 protein_id gnl|my_center|LOCUS_21070 7417 8304 gene locus_tag LOCUS_21080 gene pstC 7417 8304 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_21080 8294 9151 gene locus_tag LOCUS_21090 gene pstA 8294 9151 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256173.1 protein_id gnl|my_center|LOCUS_21090 >Feature sequence106 2437 989 gene locus_tag LOCUS_21100 2437 989 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056543.1 protein_id gnl|my_center|LOCUS_21100 2757 2449 gene locus_tag LOCUS_21110 2757 2449 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_21110 3908 2754 gene locus_tag LOCUS_21120 3908 2754 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020567.1 protein_id gnl|my_center|LOCUS_21120 4140 6965 gene locus_tag LOCUS_21130 4140 6965 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964496.1 protein_id gnl|my_center|LOCUS_21130 6971 8260 gene locus_tag LOCUS_21140 gene odhB 6971 8260 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_21140 8633 8361 gene locus_tag LOCUS_21150 8633 8361 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_21150 9159 9248 gene locus_tag LOCUS_t00320 9159 9248 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 433 2772 gene locus_tag LOCUS_21160 gene pbpC 433 2772 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_21160 5669 2793 gene locus_tag LOCUS_21170 5669 2793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 6660 5734 gene locus_tag LOCUS_21180 gene rsgA 6660 5734 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_21180 7388 6657 gene locus_tag LOCUS_21190 7388 6657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 8703 7492 gene locus_tag LOCUS_21200 gene lhgO 8703 7492 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_21200 <9424 8797 gene locus_tag LOCUS_21210 <9424 8797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014518967.1:aminotransferase class IV >Feature sequence108 293 1315 gene locus_tag LOCUS_21220 293 1315 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_21220 1379 2203 gene locus_tag LOCUS_21230 1379 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 2436 3413 gene locus_tag LOCUS_21240 2436 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 5415 3820 gene locus_tag LOCUS_21250 5415 3820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 5729 5947 gene locus_tag LOCUS_21260 5729 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 5955 7523 gene locus_tag LOCUS_21270 5955 7523 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_21270 7513 8661 gene locus_tag LOCUS_21280 gene cydB 7513 8661 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_21280 >Feature sequence109 616 873 gene locus_tag LOCUS_21290 616 873 CDS product DUF6364 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002676042.1 protein_id gnl|my_center|LOCUS_21290 866 1294 gene locus_tag LOCUS_21300 866 1294 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_21300 1384 1626 gene locus_tag LOCUS_21310 1384 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1699 2604 gene locus_tag LOCUS_21320 1699 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 2744 3064 gene locus_tag LOCUS_21330 2744 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 5542 3599 gene locus_tag LOCUS_21340 5542 3599 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964000.1 protein_id gnl|my_center|LOCUS_21340 6501 5554 gene locus_tag LOCUS_21350 6501 5554 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_21350 7466 6513 gene locus_tag LOCUS_21360 7466 6513 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764423.1 protein_id gnl|my_center|LOCUS_21360 7560 8351 gene locus_tag LOCUS_21370 7560 8351 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_21370 >Feature sequence110 1601 426 gene locus_tag LOCUS_21380 gene mnmA 1601 426 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_21380 2422 1661 gene locus_tag LOCUS_21390 gene pgl 2422 1661 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263331.1 protein_id gnl|my_center|LOCUS_21390 3982 2435 gene locus_tag LOCUS_21400 gene zwf 3982 2435 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800449.1 protein_id gnl|my_center|LOCUS_21400 5355 4228 gene locus_tag LOCUS_21410 5355 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 5644 7185 gene locus_tag LOCUS_21420 5644 7185 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957930.1 protein_id gnl|my_center|LOCUS_21420 7191 8012 gene locus_tag LOCUS_21430 7191 8012 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389695.1 protein_id gnl|my_center|LOCUS_21430 >Feature sequence111 <1 526 gene locus_tag LOCUS_21440 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767780.1:RagB/SusD family nutrient uptake outer membrane protein 1976 600 gene locus_tag LOCUS_21450 1976 600 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530022.1 protein_id gnl|my_center|LOCUS_21450 3064 2330 gene locus_tag LOCUS_21460 gene rlmB 3064 2330 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_21460 4329 3061 gene locus_tag LOCUS_21470 4329 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 6337 4376 gene locus_tag LOCUS_21480 6337 4376 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_21480 7723 6458 gene locus_tag LOCUS_21490 7723 6458 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303135.1 protein_id gnl|my_center|LOCUS_21490 <8910 7732 gene locus_tag LOCUS_21500 <8910 7732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205661056.1:carbohydrate-binding protein >Feature sequence112 558 76 gene locus_tag LOCUS_21510 gene nuoE 558 76 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_21510 2377 590 gene locus_tag LOCUS_21520 2377 590 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868906.1 protein_id gnl|my_center|LOCUS_21520 4195 2399 gene locus_tag LOCUS_21530 gene nuoF 4195 2399 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766746.1 protein_id gnl|my_center|LOCUS_21530 4612 4211 gene locus_tag LOCUS_21540 4612 4211 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868904.1 protein_id gnl|my_center|LOCUS_21540 5271 4678 gene locus_tag LOCUS_21550 5271 4678 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_21550 6008 5268 gene locus_tag LOCUS_21560 6008 5268 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869446.1 protein_id gnl|my_center|LOCUS_21560 6343 6005 gene locus_tag LOCUS_21570 6343 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583278.1 protein_id gnl|my_center|LOCUS_21570 7709 6330 gene locus_tag LOCUS_21580 7709 6330 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_21580 8124 7699 gene locus_tag LOCUS_21590 8124 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 8538 8128 gene locus_tag LOCUS_21600 8538 8128 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583279.1 protein_id gnl|my_center|LOCUS_21600 >Feature sequence113 1035 682 gene locus_tag LOCUS_21610 1035 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 2669 1152 gene locus_tag LOCUS_21620 2669 1152 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_21620 3298 2696 gene locus_tag LOCUS_21630 3298 2696 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_21630 4952 3360 gene locus_tag LOCUS_21640 4952 3360 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202519.1 protein_id gnl|my_center|LOCUS_21640 5430 5017 gene locus_tag LOCUS_21650 5430 5017 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788096.1 protein_id gnl|my_center|LOCUS_21650 5518 7971 gene locus_tag LOCUS_21660 5518 7971 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence114 1033 89 gene locus_tag LOCUS_21670 1033 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21670 2323 1052 gene locus_tag LOCUS_21680 2323 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 2420 3661 gene locus_tag LOCUS_21690 2420 3661 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_21690 5104 3734 gene locus_tag LOCUS_21700 5104 3734 CDS product O-antigen export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107240.1 protein_id gnl|my_center|LOCUS_21700 6106 5117 gene locus_tag LOCUS_21710 6106 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 <8756 6103 gene locus_tag LOCUS_21720 <8756 6103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031477.1:carbohydrate-binding protein >Feature sequence115 98 1690 gene locus_tag LOCUS_21730 98 1690 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161269931.1 protein_id gnl|my_center|LOCUS_21730 1809 4583 gene locus_tag LOCUS_21740 1809 4583 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036929.1 protein_id gnl|my_center|LOCUS_21740 4588 5226 gene locus_tag LOCUS_21750 4588 5226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 5243 7528 gene locus_tag LOCUS_21760 5243 7528 CDS product family 20 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005822184.1 protein_id gnl|my_center|LOCUS_21760 8484 7678 gene locus_tag LOCUS_21770 8484 7678 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963972.1 protein_id gnl|my_center|LOCUS_21770 >Feature sequence116 <1 2358 gene locus_tag LOCUS_21780 <1 2358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005804147.1:efflux RND transporter permease subunit 2484 2786 gene locus_tag LOCUS_21790 2484 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 2813 3436 gene locus_tag LOCUS_21800 2813 3436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3543 4262 gene locus_tag LOCUS_21810 3543 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 5166 4270 gene locus_tag LOCUS_21820 5166 4270 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_21820 <8673 5176 gene locus_tag LOCUS_21830 <8673 5176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence117 653 859 gene locus_tag LOCUS_21840 653 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 2277 916 gene locus_tag LOCUS_21850 2277 916 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056076.1 protein_id gnl|my_center|LOCUS_21850 2366 5161 gene locus_tag LOCUS_21860 2366 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 5770 5165 gene locus_tag LOCUS_21870 5770 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 7189 5777 gene locus_tag LOCUS_21880 7189 5777 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022878.1 protein_id gnl|my_center|LOCUS_21880 7969 7211 gene locus_tag LOCUS_21890 7969 7211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence118 2108 204 gene locus_tag LOCUS_21900 2108 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 2952 2236 gene locus_tag LOCUS_21910 gene deoC 2952 2236 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037228457.1 protein_id gnl|my_center|LOCUS_21910 3680 2964 gene locus_tag LOCUS_21920 3680 2964 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000854956.1 protein_id gnl|my_center|LOCUS_21920 3871 5727 gene locus_tag LOCUS_21930 3871 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 6094 8145 gene locus_tag LOCUS_21940 6094 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21940 >Feature sequence119 4135 890 gene locus_tag LOCUS_21950 4135 890 CDS product SusC/RagA family TonB-linked outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963475.1 protein_id gnl|my_center|LOCUS_21950 7166 4269 gene locus_tag LOCUS_21960 7166 4269 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393372.1 protein_id gnl|my_center|LOCUS_21960 7525 7265 gene locus_tag LOCUS_21970 7525 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 8304 7849 gene locus_tag LOCUS_21980 8304 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 >Feature sequence120 656 1567 gene locus_tag LOCUS_21990 gene cysK 656 1567 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_21990 1702 2118 gene locus_tag LOCUS_22000 1702 2118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788667.1 protein_id gnl|my_center|LOCUS_22000 2136 3236 gene locus_tag LOCUS_22010 2136 3236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 4259 3294 gene locus_tag LOCUS_22020 4259 3294 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083159.1 protein_id gnl|my_center|LOCUS_22020 4416 5216 gene locus_tag LOCUS_22030 4416 5216 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016269488.1 protein_id gnl|my_center|LOCUS_22030 5237 6112 gene locus_tag LOCUS_22040 5237 6112 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_22040 6093 6737 gene locus_tag LOCUS_22050 6093 6737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 >Feature sequence121 66 1055 gene locus_tag LOCUS_22060 66 1055 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_22060 1048 1854 gene locus_tag LOCUS_22070 1048 1854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966274.1 protein_id gnl|my_center|LOCUS_22070 2717 1857 gene locus_tag LOCUS_22080 2717 1857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_22080 2830 3972 gene locus_tag LOCUS_22090 2830 3972 CDS product sugar MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763289.1 protein_id gnl|my_center|LOCUS_22090 3969 5087 gene locus_tag LOCUS_22100 3969 5087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22100 5100 6065 gene locus_tag LOCUS_22110 5100 6065 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784451.1 protein_id gnl|my_center|LOCUS_22110 6583 7854 gene locus_tag LOCUS_22120 6583 7854 CDS product IS256-like element ISRm5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969783.1 protein_id gnl|my_center|LOCUS_22120 >Feature sequence122 190 118 gene locus_tag LOCUS_t00330 190 118 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 458 850 gene locus_tag LOCUS_22130 458 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 870 1742 gene locus_tag LOCUS_22140 870 1742 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_22140 1748 2893 gene locus_tag LOCUS_22150 1748 2893 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_22150 2904 4223 gene locus_tag LOCUS_22160 gene rseP 2904 4223 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_22160 4298 4525 gene locus_tag LOCUS_22170 4298 4525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 5233 6144 gene locus_tag LOCUS_22180 5233 6144 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_22180 7249 6146 gene locus_tag LOCUS_22190 gene mqnC 7249 6146 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393344.1 protein_id gnl|my_center|LOCUS_22190 7937 7455 gene locus_tag LOCUS_22200 7937 7455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 >Feature sequence123 <1 772 gene locus_tag LOCUS_22210 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963773.1:choice-of-anchor L domain-containing protein 769 1788 gene locus_tag LOCUS_22220 769 1788 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964200.1 protein_id gnl|my_center|LOCUS_22220 4379 2307 gene locus_tag LOCUS_22230 4379 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 6456 4390 gene locus_tag LOCUS_22240 6456 4390 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575935.1 protein_id gnl|my_center|LOCUS_22240 6660 7031 gene locus_tag LOCUS_22250 6660 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 >Feature sequence124 2024 576 gene locus_tag LOCUS_22260 gene sufB 2024 576 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767607.1 protein_id gnl|my_center|LOCUS_22260 2158 3204 gene locus_tag LOCUS_22270 gene thiL 2158 3204 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203294.1 protein_id gnl|my_center|LOCUS_22270 4011 3211 gene locus_tag LOCUS_22280 gene lpxA 4011 3211 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_22280 5371 4016 gene locus_tag LOCUS_22290 5371 4016 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963124.1 protein_id gnl|my_center|LOCUS_22290 6566 5508 gene locus_tag LOCUS_22300 gene lpxD 6566 5508 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202193.1 protein_id gnl|my_center|LOCUS_22300 7847 6582 gene locus_tag LOCUS_22310 7847 6582 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759882.1 protein_id gnl|my_center|LOCUS_22310 >Feature sequence125 <1 1281 gene locus_tag LOCUS_22320 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109197.1:TonB-dependent receptor plug domain-containing protein 2062 3612 gene locus_tag LOCUS_22330 2062 3612 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759736.1 protein_id gnl|my_center|LOCUS_22330 3622 4311 gene locus_tag LOCUS_22340 3622 4311 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_22340 4339 5478 gene locus_tag LOCUS_22350 4339 5478 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393149.1 protein_id gnl|my_center|LOCUS_22350 7271 5484 gene locus_tag LOCUS_22360 gene lepA 7271 5484 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_22360 >Feature sequence126 224 1576 gene locus_tag LOCUS_22370 gene purB 224 1576 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791759.1 protein_id gnl|my_center|LOCUS_22370 2385 1552 gene locus_tag LOCUS_22380 2385 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22380 2579 4381 gene locus_tag LOCUS_22390 2579 4381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783855.1 protein_id gnl|my_center|LOCUS_22390 4405 5361 gene locus_tag LOCUS_22400 4405 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 5361 6218 gene locus_tag LOCUS_22410 5361 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 7331 6225 gene locus_tag LOCUS_22420 gene amrB 7331 6225 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986781.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence127 7148 3846 gene locus_tag LOCUS_22430 7148 3846 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence128 4986 2251 gene locus_tag LOCUS_22440 4986 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 5186 6055 gene locus_tag LOCUS_22450 5186 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 6098 6442 gene locus_tag LOCUS_22460 6098 6442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 6641 7318 gene locus_tag LOCUS_22470 6641 7318 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_22470 >Feature sequence129 471 1391 gene locus_tag LOCUS_22480 471 1391 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_22480 1408 2655 gene locus_tag LOCUS_22490 1408 2655 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_22490 2664 3329 gene locus_tag LOCUS_22500 2664 3329 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_22500 3375 4352 gene locus_tag LOCUS_22510 3375 4352 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_22510 5590 4382 gene locus_tag LOCUS_22520 5590 4382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 <7367 5601 gene locus_tag LOCUS_22530 <7367 5601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein >Feature sequence130 <1 2241 gene locus_tag LOCUS_22540 <1 2241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107599.1:UvrD-helicase domain-containing protein 2238 3224 gene locus_tag LOCUS_22550 2238 3224 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761007.1 protein_id gnl|my_center|LOCUS_22550 3226 6093 gene locus_tag LOCUS_22560 3226 6093 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107600.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence131 <1 1145 gene locus_tag LOCUS_22570 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967042.1:caspase family protein 1361 2053 gene locus_tag LOCUS_22580 gene radC 1361 2053 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_22580 3060 4832 gene locus_tag LOCUS_22590 3060 4832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 >Feature sequence132 1066 137 gene locus_tag LOCUS_22600 1066 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 1510 3906 gene locus_tag LOCUS_22610 1510 3906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 4297 5157 gene locus_tag LOCUS_22620 4297 5157 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_22620 5329 6147 gene locus_tag LOCUS_22630 5329 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 6978 6202 gene locus_tag LOCUS_22640 gene trpA 6978 6202 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_22640 >Feature sequence133 894 819 gene locus_tag LOCUS_t00340 894 819 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 1509 970 gene locus_tag LOCUS_22650 1509 970 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_22650 2345 1500 gene locus_tag LOCUS_22660 2345 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 3029 2352 gene locus_tag LOCUS_22670 3029 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784817.1 protein_id gnl|my_center|LOCUS_22670 3162 4475 gene locus_tag LOCUS_22680 3162 4475 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764222.1 protein_id gnl|my_center|LOCUS_22680 6438 4498 gene locus_tag LOCUS_22690 6438 4498 CDS product TonB-dependent receptor plug domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839978.1 protein_id gnl|my_center|LOCUS_22690 6939 6523 gene locus_tag LOCUS_22700 6939 6523 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_22700 >Feature sequence134 2841 1177 gene locus_tag LOCUS_22710 2841 1177 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107663.1 protein_id gnl|my_center|LOCUS_22710 3238 5892 gene locus_tag LOCUS_22720 3238 5892 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073389.1 protein_id gnl|my_center|LOCUS_22720 6104 6802 gene locus_tag LOCUS_22730 6104 6802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 7170 6814 gene locus_tag LOCUS_22740 7170 6814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 >Feature sequence135 2472 1360 gene locus_tag LOCUS_22750 2472 1360 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790532.1 protein_id gnl|my_center|LOCUS_22750 4328 3147 gene locus_tag LOCUS_22760 4328 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22760 4718 4527 gene locus_tag LOCUS_22770 4718 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 5608 4916 gene locus_tag LOCUS_22780 5608 4916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 6615 5611 gene locus_tag LOCUS_22790 6615 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 >Feature sequence136 269 30 gene locus_tag LOCUS_22800 269 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1549 404 gene locus_tag LOCUS_22810 gene dinB 1549 404 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937382.1 protein_id gnl|my_center|LOCUS_22810 1650 2465 gene locus_tag LOCUS_22820 1650 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 6925 3224 gene locus_tag LOCUS_22830 gene purL 6925 3224 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767801.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence137 1099 173 gene locus_tag LOCUS_22840 1099 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 3037 1367 gene locus_tag LOCUS_22850 3037 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203591.1 protein_id gnl|my_center|LOCUS_22850 3728 5842 gene locus_tag LOCUS_22860 3728 5842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence138 1564 1842 gene locus_tag LOCUS_22870 1564 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 1839 2216 gene locus_tag LOCUS_22880 1839 2216 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458981.1 protein_id gnl|my_center|LOCUS_22880 3530 2544 gene locus_tag LOCUS_22890 3530 2544 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053082.1 protein_id gnl|my_center|LOCUS_22890 4351 4205 gene locus_tag LOCUS_22900 4351 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 4422 4850 gene locus_tag LOCUS_22910 4422 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22910 6539 4989 gene locus_tag LOCUS_22920 6539 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 >Feature sequence139 <1 510 gene locus_tag LOCUS_22930 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787732.1:LptF/LptG family permease 675 1484 gene locus_tag LOCUS_22940 675 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 1490 3352 gene locus_tag LOCUS_22950 1490 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22950 3355 4401 gene locus_tag LOCUS_22960 3355 4401 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_22960 4482 5456 gene locus_tag LOCUS_22970 4482 5456 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202023.1 protein_id gnl|my_center|LOCUS_22970 >Feature sequence140 357 1247 gene locus_tag LOCUS_22980 357 1247 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_22980 1456 2157 gene locus_tag LOCUS_22990 1456 2157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765150.1 protein_id gnl|my_center|LOCUS_22990 2162 3397 gene locus_tag LOCUS_23000 2162 3397 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_23000 3411 4676 gene locus_tag LOCUS_23010 3411 4676 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784442.1 protein_id gnl|my_center|LOCUS_23010 4704 5822 gene locus_tag LOCUS_23020 4704 5822 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_23020 >Feature sequence141 1091 354 gene locus_tag LOCUS_23030 1091 354 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_23030 1220 2200 gene locus_tag LOCUS_23040 1220 2200 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786511.1 protein_id gnl|my_center|LOCUS_23040 2236 2847 gene locus_tag LOCUS_23050 gene yihA 2236 2847 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765852.1 protein_id gnl|my_center|LOCUS_23050 2921 3859 gene locus_tag LOCUS_23060 2921 3859 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_23060 3969 4619 gene locus_tag LOCUS_23070 3969 4619 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_23070 4743 5339 gene locus_tag LOCUS_23080 gene pth 4743 5339 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_23080 5442 5819 gene locus_tag LOCUS_23090 5442 5819 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785756.1 protein_id gnl|my_center|LOCUS_23090 5849 6391 gene locus_tag LOCUS_23100 5849 6391 CDS product DUF4924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786016.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence142 160 888 gene locus_tag LOCUS_23110 160 888 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_23110 922 1743 gene locus_tag LOCUS_23120 922 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23120 1757 2914 gene locus_tag LOCUS_23130 gene pncB 1757 2914 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203338.1 protein_id gnl|my_center|LOCUS_23130 4043 2922 gene locus_tag LOCUS_23140 4043 2922 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_23140 5043 4096 gene locus_tag LOCUS_23150 5043 4096 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783517.1 protein_id gnl|my_center|LOCUS_23150 5353 6222 gene locus_tag LOCUS_23160 5353 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 >Feature sequence143 <1 606 gene locus_tag LOCUS_23170 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107463.1:BamA/TamA family outer membrane protein 610 1524 gene locus_tag LOCUS_23180 610 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 1547 1795 gene locus_tag LOCUS_23190 gene rpsU 1547 1795 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_23190 1864 2742 gene locus_tag LOCUS_23200 gene xerC 1864 2742 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_23200 2762 3058 gene locus_tag LOCUS_23210 gene raiA 2762 3058 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_23210 3163 3236 gene locus_tag LOCUS_t00350 3163 3236 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3256 3339 gene locus_tag LOCUS_t00360 3256 3339 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3346 3419 gene locus_tag LOCUS_t00370 3346 3419 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3428 3500 gene locus_tag LOCUS_t00380 3428 3500 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3570 4754 gene locus_tag LOCUS_23220 gene tuf 3570 4754 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782155.1 protein_id gnl|my_center|LOCUS_23220 4815 4888 gene locus_tag LOCUS_t00390 4815 4888 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 4909 5100 gene locus_tag LOCUS_23230 4909 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 5115 5666 gene locus_tag LOCUS_23240 gene nusG 5115 5666 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_23240 5800 6255 gene locus_tag LOCUS_23250 gene rplK 5800 6255 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791514.1 protein_id gnl|my_center|LOCUS_23250 >Feature sequence144 4542 3394 gene locus_tag LOCUS_23260 4542 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 <6343 4611 gene locus_tag LOCUS_23270 <6343 4611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552911.1:trimeric autotransporter adhesin BpaB >Feature sequence145 69 830 gene locus_tag LOCUS_23280 69 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 879 1718 gene locus_tag LOCUS_23290 879 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 1996 4125 gene locus_tag LOCUS_23300 1996 4125 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_23300 4139 5449 gene locus_tag LOCUS_23310 4139 5449 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759964.1 protein_id gnl|my_center|LOCUS_23310 5885 5439 gene locus_tag LOCUS_23320 5885 5439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 >Feature sequence146 >Feature sequence147 1772 2629 gene locus_tag LOCUS_23330 1772 2629 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403318.1 protein_id gnl|my_center|LOCUS_23330 2760 3599 gene locus_tag LOCUS_23340 2760 3599 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202700.1 protein_id gnl|my_center|LOCUS_23340 3612 4526 gene locus_tag LOCUS_23350 3612 4526 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963714.1 protein_id gnl|my_center|LOCUS_23350 >Feature sequence148 212 793 gene locus_tag LOCUS_23360 212 793 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722329.1 protein_id gnl|my_center|LOCUS_23360 805 2607 gene locus_tag LOCUS_23370 gene nuoF 805 2607 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082447.1 protein_id gnl|my_center|LOCUS_23370 2626 3336 gene locus_tag LOCUS_23380 2626 3336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 3350 3898 gene locus_tag LOCUS_23390 3350 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 3922 5376 gene locus_tag LOCUS_23400 3922 5376 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_23400 5373 5840 gene locus_tag LOCUS_23410 5373 5840 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582503.1 protein_id gnl|my_center|LOCUS_23410 >Feature sequence149 681 1700 gene locus_tag LOCUS_23420 681 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 1732 2724 gene locus_tag LOCUS_23430 1732 2724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 2907 3485 gene locus_tag LOCUS_23440 2907 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 3472 4341 gene locus_tag LOCUS_23450 3472 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 5049 4432 gene locus_tag LOCUS_23460 5049 4432 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_23460 <5907 5148 gene locus_tag LOCUS_23470 <5907 5148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679079.1:MBL fold metallo-hydrolase >Feature sequence150 614 276 gene locus_tag LOCUS_23480 614 276 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009562568.1 protein_id gnl|my_center|LOCUS_23480 972 616 gene locus_tag LOCUS_23490 972 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 1536 2537 gene locus_tag LOCUS_23500 1536 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 2555 4648 gene locus_tag LOCUS_23510 2555 4648 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557282.1 protein_id gnl|my_center|LOCUS_23510 >Feature sequence151 <1 1210 gene locus_tag LOCUS_23520 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263815.1:SIS domain-containing protein 1226 2491 gene locus_tag LOCUS_23530 1226 2491 CDS product class II D-tagatose-bisphosphate aldolase, non-catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839470.1 protein_id gnl|my_center|LOCUS_23530 2540 3487 gene locus_tag LOCUS_23540 2540 3487 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_23540 3510 4313 gene locus_tag LOCUS_23550 gene fba 3510 4313 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392146.1 protein_id gnl|my_center|LOCUS_23550 4324 5424 gene locus_tag LOCUS_23560 4324 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence152 2256 679 gene locus_tag LOCUS_23570 gene atpA 2256 679 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964545.1 protein_id gnl|my_center|LOCUS_23570 2814 2278 gene locus_tag LOCUS_23580 2814 2278 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761392.1 protein_id gnl|my_center|LOCUS_23580 3320 2826 gene locus_tag LOCUS_23590 gene atpF 3320 2826 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761391.1 protein_id gnl|my_center|LOCUS_23590 3630 3382 gene locus_tag LOCUS_23600 3630 3382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 4802 3666 gene locus_tag LOCUS_23610 gene atpB 4802 3666 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787483.1 protein_id gnl|my_center|LOCUS_23610 5228 4839 gene locus_tag LOCUS_23620 5228 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 5485 5225 gene locus_tag LOCUS_23630 5485 5225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 >Feature sequence153 2901 439 gene locus_tag LOCUS_23640 2901 439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009195517.1 protein_id gnl|my_center|LOCUS_23640 3611 2928 gene locus_tag LOCUS_23650 3611 2928 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787762.1 protein_id gnl|my_center|LOCUS_23650 4681 3911 gene locus_tag LOCUS_23660 4681 3911 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_23660 5236 4691 gene locus_tag LOCUS_23670 5236 4691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 >Feature sequence154 1685 1152 gene locus_tag LOCUS_23680 1685 1152 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814383.1 protein_id gnl|my_center|LOCUS_23680 2299 1913 gene locus_tag LOCUS_23690 2299 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23690 2521 3234 gene locus_tag LOCUS_23700 2521 3234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 4505 3222 gene locus_tag LOCUS_23710 4505 3222 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_23710 <5553 4498 gene locus_tag LOCUS_23720 <5553 4498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964438.1:HAMP domain-containing sensor histidine kinase >Feature sequence155 691 47 gene locus_tag LOCUS_23730 691 47 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_23730 1471 842 gene locus_tag LOCUS_23740 1471 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 2512 1562 gene locus_tag LOCUS_23750 2512 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 4223 2535 gene locus_tag LOCUS_23760 gene ggt 4223 2535 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963831.1 protein_id gnl|my_center|LOCUS_23760 4418 5281 gene locus_tag LOCUS_23770 4418 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 >Feature sequence156 759 4352 gene locus_tag LOCUS_23780 759 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23780 4550 5446 gene locus_tag LOCUS_23790 4550 5446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence157 77 634 gene locus_tag LOCUS_23800 77 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 1510 635 gene locus_tag LOCUS_23810 gene queG 1510 635 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_23810 1906 1589 gene locus_tag LOCUS_23820 1906 1589 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_23820 2387 1959 gene locus_tag LOCUS_23830 2387 1959 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763578.1 protein_id gnl|my_center|LOCUS_23830 3610 2390 gene locus_tag LOCUS_23840 3610 2390 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958175.1 protein_id gnl|my_center|LOCUS_23840 5036 3669 gene locus_tag LOCUS_23850 gene sufD 5036 3669 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_23850 >Feature sequence158 1151 3769 gene locus_tag LOCUS_23860 1151 3769 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_23860 3772 4857 gene locus_tag LOCUS_23870 3772 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 >Feature sequence159 1095 3014 gene locus_tag LOCUS_23880 gene dxs 1095 3014 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_23880 3066 3149 gene locus_tag LOCUS_t00400 3066 3149 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3292 3747 gene locus_tag LOCUS_23890 3292 3747 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759937.1 protein_id gnl|my_center|LOCUS_23890 >Feature sequence160 587 231 gene locus_tag LOCUS_23900 gene folB 587 231 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964579.1 protein_id gnl|my_center|LOCUS_23900 737 2449 gene locus_tag LOCUS_23910 737 2449 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_23910 3731 2484 gene locus_tag LOCUS_23920 3731 2484 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108887.1 protein_id gnl|my_center|LOCUS_23920 <5041 3890 gene locus_tag LOCUS_23930 <5041 3890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791295.1:glucoamylase family protein >Feature sequence161 81 1289 gene locus_tag LOCUS_23940 81 1289 CDS product UDP-N-acetylglucosamine 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202418.1 protein_id gnl|my_center|LOCUS_23940 1564 2349 gene locus_tag LOCUS_23950 gene elyC 1564 2349 CDS product envelope biogenesis factor ElyC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422543.1 protein_id gnl|my_center|LOCUS_23950 2367 3887 gene locus_tag LOCUS_23960 2367 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 >Feature sequence162 274 1191 gene locus_tag LOCUS_23970 274 1191 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_23970 1199 2305 gene locus_tag LOCUS_23980 1199 2305 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785173.1 protein_id gnl|my_center|LOCUS_23980 2772 2626 gene locus_tag LOCUS_23990 2772 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 3488 2955 gene locus_tag LOCUS_24000 3488 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 <5012 3779 gene locus_tag LOCUS_24010 <5012 3779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762539.1:sugar MFS transporter >Feature sequence163 1911 787 gene locus_tag LOCUS_24020 1911 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404922.1 protein_id gnl|my_center|LOCUS_24020 1974 2534 gene locus_tag LOCUS_24030 1974 2534 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962628.1 protein_id gnl|my_center|LOCUS_24030 >Feature sequence164 1394 246 gene locus_tag LOCUS_24040 1394 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1630 2019 gene locus_tag LOCUS_24050 1630 2019 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963859.1 protein_id gnl|my_center|LOCUS_24050 2016 3851 gene locus_tag LOCUS_24060 2016 3851 CDS product M56 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109009.1 protein_id gnl|my_center|LOCUS_24060 >Feature sequence165 <1 1809 gene locus_tag LOCUS_24070 <1 1809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048172.1:glycyl radical protein 2167 3510 gene locus_tag LOCUS_24080 2167 3510 CDS product S28 family serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062695986.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence166 1349 351 gene locus_tag LOCUS_24090 1349 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 2342 1482 gene locus_tag LOCUS_24100 2342 1482 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763945.1 protein_id gnl|my_center|LOCUS_24100 3041 2418 gene locus_tag LOCUS_24110 3041 2418 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016415.1 protein_id gnl|my_center|LOCUS_24110 3306 3974 gene locus_tag LOCUS_24120 3306 3974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 4529 3978 gene locus_tag LOCUS_24130 4529 3978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence167 820 629 gene locus_tag LOCUS_24140 820 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 1812 1219 gene locus_tag LOCUS_24150 1812 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143443.1 protein_id gnl|my_center|LOCUS_24150 1985 1818 gene locus_tag LOCUS_24160 1985 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 3469 2933 gene locus_tag LOCUS_24170 3469 2933 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133957191.1 protein_id gnl|my_center|LOCUS_24170 4364 3600 gene locus_tag LOCUS_24180 4364 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 >Feature sequence168 2061 619 gene locus_tag LOCUS_24190 2061 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 2235 3710 gene locus_tag LOCUS_24200 gene proS 2235 3710 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_24200 3733 4494 gene locus_tag LOCUS_24210 3733 4494 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402843.1 protein_id gnl|my_center|LOCUS_24210 >Feature sequence169 803 1864 gene locus_tag LOCUS_24220 803 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 2196 2124 gene locus_tag LOCUS_t00410 2196 2124 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence170 795 1259 gene locus_tag LOCUS_24230 795 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 1283 1477 gene locus_tag LOCUS_24240 1283 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24240 1502 1771 gene locus_tag LOCUS_24250 1502 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 1761 2366 gene locus_tag LOCUS_24260 1761 2366 CDS product lysine exporter LysO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938535.1 protein_id gnl|my_center|LOCUS_24260 <4451 2379 gene locus_tag LOCUS_24270 <4451 2379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:OmpA family protein >Feature sequence171 3726 1138 gene locus_tag LOCUS_24280 3726 1138 CDS product non-lysosomal glucosylceramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108530.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence172 1743 76 gene locus_tag LOCUS_24290 1743 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 <4336 1813 gene locus_tag LOCUS_24300 <4336 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein >Feature sequence173 1922 888 gene locus_tag LOCUS_24310 gene gutB 1922 888 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_24310 2315 2932 gene locus_tag LOCUS_24320 2315 2932 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783748.1 protein_id gnl|my_center|LOCUS_24320 2937 3479 gene locus_tag LOCUS_24330 2937 3479 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence174 2096 702 gene locus_tag LOCUS_24340 2096 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 3030 2131 gene locus_tag LOCUS_24350 3030 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 4114 3173 gene locus_tag LOCUS_24360 gene ppk2 4114 3173 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086042.1 protein_id gnl|my_center|LOCUS_24360 >Feature sequence175 4042 680 gene locus_tag LOCUS_24370 4042 680 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065207.1 protein_id gnl|my_center|LOCUS_24370 >Feature sequence176 <1 670 gene locus_tag LOCUS_24380 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964438.1:HAMP domain-containing sensor histidine kinase 663 1946 gene locus_tag LOCUS_24390 663 1946 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761719.1 protein_id gnl|my_center|LOCUS_24390 2647 1934 gene locus_tag LOCUS_24400 2647 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2992 4110 gene locus_tag LOCUS_24410 2992 4110 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_24410 >Feature sequence177 <1 738 gene locus_tag LOCUS_24420 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794868.1:creatininase family protein 960 1304 gene locus_tag LOCUS_24430 960 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 2316 1228 gene locus_tag LOCUS_24440 2316 1228 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_24440 4049 2622 gene locus_tag LOCUS_24450 4049 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence178 723 2186 gene locus_tag LOCUS_24460 723 2186 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798159.1 protein_id gnl|my_center|LOCUS_24460 <4137 2425 gene locus_tag LOCUS_24470 <4137 2425 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039185.1:beta-galactosidase GalB >Feature sequence179 3330 790 gene locus_tag LOCUS_24480 3330 790 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_24480 <3995 3327 gene locus_tag LOCUS_24490 <3995 3327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228378.1:DUF1156 domain-containing protein >Feature sequence180 2558 3739 gene locus_tag LOCUS_24500 2558 3739 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194770.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence181 542 27 gene locus_tag LOCUS_24510 542 27 CDS product prolyl-tRNA synthetase associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949067.1 protein_id gnl|my_center|LOCUS_24510 674 748 gene locus_tag LOCUS_t00420 674 748 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1213 2202 gene locus_tag LOCUS_24520 gene trxB 1213 2202 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785383.1 protein_id gnl|my_center|LOCUS_24520 3599 2352 gene locus_tag LOCUS_24530 3599 2352 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_24530 >Feature sequence182 1695 235 gene locus_tag LOCUS_24540 1695 235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 2960 1824 gene locus_tag LOCUS_24550 2960 1824 CDS product glycan-binding surface protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796119.1 protein_id gnl|my_center|LOCUS_24550 <3636 2987 gene locus_tag LOCUS_24560 <3636 2987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032840505.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence183 1031 3244 gene locus_tag LOCUS_24570 1031 3244 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202161.1 protein_id gnl|my_center|LOCUS_24570 >Feature sequence184 1612 494 gene locus_tag LOCUS_24580 1612 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 2843 1650 gene locus_tag LOCUS_24590 2843 1650 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337437.1 protein_id gnl|my_center|LOCUS_24590 >Feature sequence185 1402 38 gene locus_tag LOCUS_24600 1402 38 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_24600 1882 1598 gene locus_tag LOCUS_24610 1882 1598 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582457.1 protein_id gnl|my_center|LOCUS_24610 2545 1961 gene locus_tag LOCUS_24620 2545 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 <3386 2694 gene locus_tag LOCUS_24630 <3386 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975234.1:response regulator >Feature sequence186 1267 242 gene locus_tag LOCUS_24640 1267 242 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207603918.1 protein_id gnl|my_center|LOCUS_24640 2529 1264 gene locus_tag LOCUS_24650 gene ablA 2529 1264 CDS product lysine 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902971.1 protein_id gnl|my_center|LOCUS_24650 >Feature sequence187 <2970 2158 gene locus_tag LOCUS_24660 <2970 2158 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156276303.1:citrate/2-methylcitrate synthase >Feature sequence188 102 509 gene locus_tag LOCUS_24670 102 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 506 2752 gene locus_tag LOCUS_24680 506 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 >Feature sequence189 1054 308 gene locus_tag LOCUS_24690 1054 308 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048090.1 protein_id gnl|my_center|LOCUS_24690 1338 2705 gene locus_tag LOCUS_24700 gene miaB 1338 2705 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783584.1 protein_id gnl|my_center|LOCUS_24700 >Feature sequence190 <1 598 gene locus_tag LOCUS_24710 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072067041.1:Tex family protein 712 2031 gene locus_tag LOCUS_24720 712 2031 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922199.1 protein_id gnl|my_center|LOCUS_24720 >Feature sequence191 >Feature sequence192 <2680 13 gene locus_tag LOCUS_24730 <2680 13 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108336.1:glycoside hydrolase family 78 protein >Feature sequence193 >Feature sequence194 160 960 gene locus_tag LOCUS_24740 gene trpC 160 960 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202962.1 protein_id gnl|my_center|LOCUS_24740 957 1592 gene locus_tag LOCUS_24750 957 1592 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202963.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence195 924 2264 gene locus_tag LOCUS_24760 924 2264 CDS product glycoside hydrolase family 140 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582791.1 protein_id gnl|my_center|LOCUS_24760 >Feature sequence196 86 2341 gene locus_tag LOCUS_24770 86 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence197 <2010 1310 gene locus_tag LOCUS_24780 <2010 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092159.1:PhzF family phenazine biosynthesis protein >Feature sequence198 <1 597 gene locus_tag LOCUS_24790 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963172.1:U32 family peptidase 607 1503 gene locus_tag LOCUS_24800 607 1503 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_24800 >Feature sequence199 266 1021 gene locus_tag LOCUS_24810 266 1021 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099545.1 protein_id gnl|my_center|LOCUS_24810 >Feature sequence200 2 784 gene locus_tag LOCUS_24820 2 784 CDS product DeoR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098886.1 protein_id gnl|my_center|LOCUS_24820 1049 1912 gene locus_tag LOCUS_24830 1049 1912 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225772.1 protein_id gnl|my_center|LOCUS_24830 >Feature sequence201 399 1196 gene locus_tag LOCUS_24840 399 1196 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000406170.1 protein_id gnl|my_center|LOCUS_24840 >Feature sequence202 1908 1549 gene locus_tag LOCUS_24850 1908 1549 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963368.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence203 601 792 gene locus_tag LOCUS_24860 601 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 <1936 1010 gene locus_tag LOCUS_24870 <1936 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036277.1:glycoside hydrolase family 30 protein >Feature sequence204 <1880 849 gene locus_tag LOCUS_24880 <1880 849 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000397283.1:acyl-CoA dehydrogenase >Feature sequence205 <1 645 gene locus_tag LOCUS_24890 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109107.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence206 132 842 gene locus_tag LOCUS_24900 132 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 1353 859 gene locus_tag LOCUS_24910 1353 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 >Feature sequence207