>Feature sequence01 205 133 gene locus_tag LOCUS_t00010 205 133 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2062 578 gene locus_tag LOCUS_00010 2062 578 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_00010 2199 3254 gene locus_tag LOCUS_00020 gene mtnA 2199 3254 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_00020 3251 4216 gene locus_tag LOCUS_00030 3251 4216 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258875.1 protein_id gnl|my_center|LOCUS_00030 4231 5490 gene locus_tag LOCUS_00040 gene ahcY 4231 5490 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_00040 6042 5797 gene locus_tag LOCUS_00050 6042 5797 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_00050 7216 6116 gene locus_tag LOCUS_00060 gene recA 7216 6116 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245789.1 protein_id gnl|my_center|LOCUS_00060 8604 7285 gene locus_tag LOCUS_00070 8604 7285 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_00070 9502 8654 gene locus_tag LOCUS_00080 9502 8654 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_00080 9617 10993 gene locus_tag LOCUS_00090 gene ffh 9617 10993 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_00090 11082 11438 gene locus_tag LOCUS_00100 11082 11438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 11450 11701 gene locus_tag LOCUS_00110 11450 11701 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_00110 11828 12265 gene locus_tag LOCUS_00120 gene rimM 11828 12265 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000170278.1 protein_id gnl|my_center|LOCUS_00120 12268 13362 gene locus_tag LOCUS_00130 gene dprA 12268 13362 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259053.1 protein_id gnl|my_center|LOCUS_00130 13468 15870 gene locus_tag LOCUS_00140 gene topA 13468 15870 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541498.1 protein_id gnl|my_center|LOCUS_00140 15932 17068 gene locus_tag LOCUS_00150 15932 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 17659 17192 gene locus_tag LOCUS_00160 gene greA 17659 17192 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_00160 18833 17679 gene locus_tag LOCUS_00170 18833 17679 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_00170 19736 18930 gene locus_tag LOCUS_00180 19736 18930 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_00180 20688 19729 gene locus_tag LOCUS_00190 gene mvk 20688 19729 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_00190 21567 20698 gene locus_tag LOCUS_00200 21567 20698 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_00200 21642 22436 gene locus_tag LOCUS_00210 21642 22436 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259513.1 protein_id gnl|my_center|LOCUS_00210 22463 24256 gene locus_tag LOCUS_00220 gene lepA 22463 24256 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_00220 24256 25278 gene locus_tag LOCUS_00230 24256 25278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 25275 26426 gene locus_tag LOCUS_00240 25275 26426 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259312.1 protein_id gnl|my_center|LOCUS_00240 26419 27225 gene locus_tag LOCUS_00250 26419 27225 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259313.1 protein_id gnl|my_center|LOCUS_00250 27225 28034 gene locus_tag LOCUS_00260 27225 28034 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259459.1 protein_id gnl|my_center|LOCUS_00260 28110 30227 gene locus_tag LOCUS_00270 28110 30227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30232 35532 gene locus_tag LOCUS_00280 30232 35532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 35529 38219 gene locus_tag LOCUS_00290 35529 38219 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141612405.1 protein_id gnl|my_center|LOCUS_00290 38219 39943 gene locus_tag LOCUS_00300 38219 39943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 39943 40659 gene locus_tag LOCUS_00310 gene cmk 39943 40659 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256860.1 protein_id gnl|my_center|LOCUS_00310 40714 43083 gene locus_tag LOCUS_00320 40714 43083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 43258 47619 gene locus_tag LOCUS_00330 gene rpoC 43258 47619 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256762.1 protein_id gnl|my_center|LOCUS_00330 47731 50178 gene locus_tag LOCUS_00340 gene gyrA 47731 50178 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_00340 50754 50185 gene locus_tag LOCUS_00350 50754 50185 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_00350 51401 50766 gene locus_tag LOCUS_00360 51401 50766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 52273 51422 gene locus_tag LOCUS_00370 52273 51422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 52179 52403 gene locus_tag LOCUS_00380 52179 52403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 52558 53043 gene locus_tag LOCUS_00390 52558 53043 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088110.1 protein_id gnl|my_center|LOCUS_00390 53062 53571 gene locus_tag LOCUS_00400 53062 53571 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_00400 54178 53579 gene locus_tag LOCUS_00410 gene rdgB 54178 53579 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256394.1 protein_id gnl|my_center|LOCUS_00410 54254 54742 gene locus_tag LOCUS_00420 54254 54742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 54848 56656 gene locus_tag LOCUS_00430 gene metG 54848 56656 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259302.1 protein_id gnl|my_center|LOCUS_00430 57222 56653 gene locus_tag LOCUS_00440 57222 56653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 58126 57371 gene locus_tag LOCUS_00450 58126 57371 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044966.1 protein_id gnl|my_center|LOCUS_00450 60103 58241 gene locus_tag LOCUS_00460 gene uvrC 60103 58241 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_00460 60188 61915 gene locus_tag LOCUS_00470 gene mutL 60188 61915 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_00470 62053 62128 gene locus_tag LOCUS_t00020 62053 62128 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 63433 62477 gene locus_tag LOCUS_00480 63433 62477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 63582 65525 gene locus_tag LOCUS_00490 63582 65525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 65597 67273 gene locus_tag LOCUS_00500 gene ettA 65597 67273 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942289.1 protein_id gnl|my_center|LOCUS_00500 67544 67326 gene locus_tag LOCUS_00510 67544 67326 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_00510 69105 67720 gene locus_tag LOCUS_00520 69105 67720 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969771.1 protein_id gnl|my_center|LOCUS_00520 71428 69107 gene locus_tag LOCUS_00530 71428 69107 CDS product bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764496.1 protein_id gnl|my_center|LOCUS_00530 72458 71481 gene locus_tag LOCUS_00540 72458 71481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 72517 73011 gene locus_tag LOCUS_00550 72517 73011 CDS product MJ0936 family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870450.1 protein_id gnl|my_center|LOCUS_00550 73015 73392 gene locus_tag LOCUS_00560 73015 73392 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028411.1 protein_id gnl|my_center|LOCUS_00560 73460 73535 gene locus_tag LOCUS_t00030 73460 73535 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 74441 73701 gene locus_tag LOCUS_00570 74441 73701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 75573 74443 gene locus_tag LOCUS_00580 75573 74443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 76936 75584 gene locus_tag LOCUS_00590 76936 75584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 78709 76952 gene locus_tag LOCUS_00600 78709 76952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 79082 78714 gene locus_tag LOCUS_00610 79082 78714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 79245 79874 gene locus_tag LOCUS_00620 79245 79874 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_00620 80635 79871 gene locus_tag LOCUS_00630 80635 79871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 81648 80644 gene locus_tag LOCUS_00640 81648 80644 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_00640 82307 81729 gene locus_tag LOCUS_00650 gene ruvA 82307 81729 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257302.1 protein_id gnl|my_center|LOCUS_00650 83116 82310 gene locus_tag LOCUS_00660 83116 82310 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256575.1 protein_id gnl|my_center|LOCUS_00660 83619 83113 gene locus_tag LOCUS_00670 gene ruvC 83619 83113 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393204.1 protein_id gnl|my_center|LOCUS_00670 84381 83626 gene locus_tag LOCUS_00680 84381 83626 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_00680 86011 84746 gene locus_tag LOCUS_00690 86011 84746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 88520 86013 gene locus_tag LOCUS_00700 88520 86013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 89390 88530 gene locus_tag LOCUS_00710 89390 88530 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327253.1 protein_id gnl|my_center|LOCUS_00710 90706 89672 gene locus_tag LOCUS_00720 90706 89672 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838116.1 protein_id gnl|my_center|LOCUS_00720 91417 90722 gene locus_tag LOCUS_00730 91417 90722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 91702 93363 gene locus_tag LOCUS_00740 91702 93363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 93498 94466 gene locus_tag LOCUS_00750 93498 94466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 94596 95756 gene locus_tag LOCUS_00760 94596 95756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 95749 96639 gene locus_tag LOCUS_00770 95749 96639 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003569669.1 protein_id gnl|my_center|LOCUS_00770 96734 98179 gene locus_tag LOCUS_00780 96734 98179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 98255 98652 gene locus_tag LOCUS_tm00010 98255 98652 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 100762 98738 gene locus_tag LOCUS_00790 gene ligA 100762 98738 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256150.1 protein_id gnl|my_center|LOCUS_00790 100906 100833 gene locus_tag LOCUS_t00040 100906 100833 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 101358 100957 gene locus_tag LOCUS_00800 101358 100957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 102016 101351 gene locus_tag LOCUS_00810 102016 101351 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392092.1 protein_id gnl|my_center|LOCUS_00810 103887 102013 gene locus_tag LOCUS_00820 103887 102013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00820 104672 103887 gene locus_tag LOCUS_00830 104672 103887 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393001.1 protein_id gnl|my_center|LOCUS_00830 104698 104771 gene locus_tag LOCUS_t00050 104698 104771 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 105648 104833 gene locus_tag LOCUS_00840 105648 104833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 107875 105629 gene locus_tag LOCUS_00850 107875 105629 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437942.1 protein_id gnl|my_center|LOCUS_00850 109964 107868 gene locus_tag LOCUS_00860 109964 107868 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920752.1 protein_id gnl|my_center|LOCUS_00860 110154 112256 gene locus_tag LOCUS_00870 110154 112256 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_00870 112341 112269 gene locus_tag LOCUS_t00060 112341 112269 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 113574 112375 gene locus_tag LOCUS_00880 gene dinB 113574 112375 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_00880 115521 113611 gene locus_tag LOCUS_00890 gene gyrB 115521 113611 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_00890 116526 115540 gene locus_tag LOCUS_00900 116526 115540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 116600 117433 gene locus_tag LOCUS_00910 116600 117433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 118278 117439 gene locus_tag LOCUS_00920 118278 117439 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030050.1 protein_id gnl|my_center|LOCUS_00920 121034 118356 gene locus_tag LOCUS_00930 121034 118356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 121107 121985 gene locus_tag LOCUS_00940 121107 121985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 122027 122491 gene locus_tag LOCUS_00950 gene bcp 122027 122491 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142372.1 protein_id gnl|my_center|LOCUS_00950 122802 122530 gene locus_tag LOCUS_00960 122802 122530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 123000 123335 gene locus_tag LOCUS_00970 123000 123335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 123992 125401 gene locus_tag LOCUS_00980 gene glnA 123992 125401 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496800.1 protein_id gnl|my_center|LOCUS_00980 125449 126111 gene locus_tag LOCUS_00990 125449 126111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 126112 127389 gene locus_tag LOCUS_01000 gene mtaB 126112 127389 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_01000 128095 128391 gene locus_tag LOCUS_01010 128095 128391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 128404 129477 gene locus_tag LOCUS_01020 128404 129477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 129492 130400 gene locus_tag LOCUS_01030 129492 130400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 130437 131189 gene locus_tag LOCUS_01040 130437 131189 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002295258.1 protein_id gnl|my_center|LOCUS_01040 131213 132520 gene locus_tag LOCUS_01050 131213 132520 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001243061.1 protein_id gnl|my_center|LOCUS_01050 132571 134424 gene locus_tag LOCUS_01060 gene typA 132571 134424 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256721.1 protein_id gnl|my_center|LOCUS_01060 135315 134440 gene locus_tag LOCUS_01070 135315 134440 CDS product CBU_1789 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958443.1 protein_id gnl|my_center|LOCUS_01070 135473 137977 gene locus_tag LOCUS_01080 135473 137977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 138084 138893 gene locus_tag LOCUS_01090 138084 138893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 138883 140373 gene locus_tag LOCUS_01100 138883 140373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 141461 140433 gene locus_tag LOCUS_01110 gene fni 141461 140433 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057243.1 protein_id gnl|my_center|LOCUS_01110 141541 141777 gene locus_tag LOCUS_01120 gene acpP 141541 141777 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631656.1 protein_id gnl|my_center|LOCUS_01120 142683 141817 gene locus_tag LOCUS_01130 gene sucD 142683 141817 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256597.1 protein_id gnl|my_center|LOCUS_01130 143825 142680 gene locus_tag LOCUS_01140 gene sucC 143825 142680 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_01140 144965 143916 gene locus_tag LOCUS_01150 144965 143916 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_01150 145525 145001 gene locus_tag LOCUS_01160 145525 145001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 145817 146575 gene locus_tag LOCUS_01170 145817 146575 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394731.1 protein_id gnl|my_center|LOCUS_01170 146603 147160 gene locus_tag LOCUS_01180 gene raiA 146603 147160 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_01180 147230 147853 gene locus_tag LOCUS_01190 gene folE 147230 147853 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258500.1 protein_id gnl|my_center|LOCUS_01190 148209 147850 gene locus_tag LOCUS_01200 gene folB 148209 147850 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227765.1 protein_id gnl|my_center|LOCUS_01200 148249 149652 gene locus_tag LOCUS_01210 148249 149652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence02 29 1278 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttccccacgcatgtgggggtgtacc 1547 1474 gene locus_tag LOCUS_t00070 1547 1474 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1669 2934 gene locus_tag LOCUS_01220 1669 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4191 3013 gene locus_tag LOCUS_01230 4191 3013 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_01230 4342 5172 gene locus_tag LOCUS_01240 4342 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 5247 5993 gene locus_tag LOCUS_01250 5247 5993 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_01250 6175 8001 gene locus_tag LOCUS_01260 6175 8001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680842.1 protein_id gnl|my_center|LOCUS_01260 7985 9814 gene locus_tag LOCUS_01270 7985 9814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666962.1 protein_id gnl|my_center|LOCUS_01270 9826 10608 gene locus_tag LOCUS_01280 9826 10608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10827 11024 gene locus_tag LOCUS_01290 10827 11024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 11121 12386 gene locus_tag LOCUS_01300 11121 12386 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355958.1 protein_id gnl|my_center|LOCUS_01300 12399 13652 gene locus_tag LOCUS_01310 12399 13652 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966601.1 protein_id gnl|my_center|LOCUS_01310 14665 13649 gene locus_tag LOCUS_01320 14665 13649 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256222.1 protein_id gnl|my_center|LOCUS_01320 15741 14662 gene locus_tag LOCUS_01330 15741 14662 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256221.1 protein_id gnl|my_center|LOCUS_01330 16918 15749 gene locus_tag LOCUS_01340 16918 15749 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256219.1 protein_id gnl|my_center|LOCUS_01340 17358 18008 gene locus_tag LOCUS_01350 17358 18008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 18005 19744 gene locus_tag LOCUS_01360 18005 19744 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_01360 20439 19795 gene locus_tag LOCUS_01370 20439 19795 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255949.1 protein_id gnl|my_center|LOCUS_01370 20707 20952 gene locus_tag LOCUS_01380 20707 20952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 21070 22923 gene locus_tag LOCUS_01390 21070 22923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 23086 24726 gene locus_tag LOCUS_01400 23086 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 25437 24766 gene locus_tag LOCUS_01410 25437 24766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 26567 25434 gene locus_tag LOCUS_01420 gene alr 26567 25434 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_01420 26856 27965 gene locus_tag LOCUS_01430 gene tgt 26856 27965 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393196.1 protein_id gnl|my_center|LOCUS_01430 27972 28793 gene locus_tag LOCUS_01440 27972 28793 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729632.1 protein_id gnl|my_center|LOCUS_01440 29865 29059 gene locus_tag LOCUS_01450 29865 29059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 30140 30355 gene locus_tag LOCUS_01460 30140 30355 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869140.1 protein_id gnl|my_center|LOCUS_01460 31566 30415 gene locus_tag LOCUS_01470 31566 30415 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_01470 31680 32567 gene locus_tag LOCUS_01480 31680 32567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 32577 33473 gene locus_tag LOCUS_01490 32577 33473 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529577.1 protein_id gnl|my_center|LOCUS_01490 34803 33493 gene locus_tag LOCUS_01500 34803 33493 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140384.1 protein_id gnl|my_center|LOCUS_01500 35678 34929 gene locus_tag LOCUS_01510 35678 34929 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034350585.1 protein_id gnl|my_center|LOCUS_01510 35876 36958 gene locus_tag LOCUS_01520 gene prfA 35876 36958 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583170.1 protein_id gnl|my_center|LOCUS_01520 36942 37799 gene locus_tag LOCUS_01530 gene prmC 36942 37799 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_01530 37803 38435 gene locus_tag LOCUS_01540 37803 38435 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005084624.1 protein_id gnl|my_center|LOCUS_01540 39461 38547 gene locus_tag LOCUS_01550 39461 38547 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256099.1 protein_id gnl|my_center|LOCUS_01550 40260 39535 gene locus_tag LOCUS_01560 40260 39535 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259632.1 protein_id gnl|my_center|LOCUS_01560 41458 40265 gene locus_tag LOCUS_01570 41458 40265 CDS product DUF3048 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233927.1 protein_id gnl|my_center|LOCUS_01570 45081 41554 gene locus_tag LOCUS_01580 gene metH 45081 41554 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259744.1 protein_id gnl|my_center|LOCUS_01580 45331 45747 gene locus_tag LOCUS_01590 45331 45747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 45751 47118 gene locus_tag LOCUS_01600 gene selA 45751 47118 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_01600 47118 48356 gene locus_tag LOCUS_01610 47118 48356 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902891.1 protein_id gnl|my_center|LOCUS_01610 48358 49392 gene locus_tag LOCUS_01620 gene tsaD 48358 49392 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_01620 49462 49710 gene locus_tag LOCUS_01630 49462 49710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 49757 50173 gene locus_tag LOCUS_01640 49757 50173 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_01640 50412 51911 gene locus_tag LOCUS_01650 50412 51911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 52151 53761 gene locus_tag LOCUS_01660 52151 53761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 55310 53835 gene locus_tag LOCUS_01670 55310 53835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 56932 55358 gene locus_tag LOCUS_01680 56932 55358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 58490 56961 gene locus_tag LOCUS_01690 58490 56961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 58722 58807 gene locus_tag LOCUS_t00080 58722 58807 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 58903 59301 gene locus_tag LOCUS_01700 58903 59301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 59550 59876 gene locus_tag LOCUS_01710 59550 59876 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259720.1 protein_id gnl|my_center|LOCUS_01710 59873 60403 gene locus_tag LOCUS_01720 59873 60403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 60423 61856 gene locus_tag LOCUS_01730 gene proS 60423 61856 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257194.1 protein_id gnl|my_center|LOCUS_01730 61866 62678 gene locus_tag LOCUS_01740 61866 62678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 65152 63080 gene locus_tag LOCUS_01750 65152 63080 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_01750 65953 65189 gene locus_tag LOCUS_01760 65953 65189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 66513 66109 gene locus_tag LOCUS_01770 66513 66109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 68048 66606 gene locus_tag LOCUS_01780 68048 66606 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872805.1 protein_id gnl|my_center|LOCUS_01780 69039 68017 gene locus_tag LOCUS_01790 69039 68017 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203664.1 protein_id gnl|my_center|LOCUS_01790 69978 69052 gene locus_tag LOCUS_01800 gene truB 69978 69052 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258869.1 protein_id gnl|my_center|LOCUS_01800 70967 70011 gene locus_tag LOCUS_01810 70967 70011 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053104374.1 protein_id gnl|my_center|LOCUS_01810 71361 70960 gene locus_tag LOCUS_01820 71361 70960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 73175 71391 gene locus_tag LOCUS_01830 73175 71391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 73524 73264 gene locus_tag LOCUS_01840 73524 73264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 75533 73623 gene locus_tag LOCUS_01850 75533 73623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 75759 77366 gene locus_tag LOCUS_01860 75759 77366 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099261594.1 protein_id gnl|my_center|LOCUS_01860 77388 79637 gene locus_tag LOCUS_01870 77388 79637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 83353 79658 gene locus_tag LOCUS_01880 83353 79658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 83514 85865 gene locus_tag LOCUS_01890 83514 85865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 87680 85893 gene locus_tag LOCUS_01900 gene glmS 87680 85893 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875810.1 protein_id gnl|my_center|LOCUS_01900 87885 88550 gene locus_tag LOCUS_01910 87885 88550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 90110 88554 gene locus_tag LOCUS_01920 90110 88554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 90334 91386 gene locus_tag LOCUS_01930 90334 91386 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459574.1 protein_id gnl|my_center|LOCUS_01930 91749 91949 gene locus_tag LOCUS_01940 91749 91949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 94263 94192 gene locus_tag LOCUS_t00090 94263 94192 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 94488 96362 gene locus_tag LOCUS_01950 94488 96362 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172451083.1 protein_id gnl|my_center|LOCUS_01950 96396 97226 gene locus_tag LOCUS_01960 96396 97226 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_01960 97472 97385 gene locus_tag LOCUS_t00100 97472 97385 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 98175 97534 gene locus_tag LOCUS_01970 98175 97534 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893113.1 protein_id gnl|my_center|LOCUS_01970 99031 98189 gene locus_tag LOCUS_01980 99031 98189 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704177.1 protein_id gnl|my_center|LOCUS_01980 99678 99031 gene locus_tag LOCUS_01990 99678 99031 CDS product ribulose-phosphate 3 epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600622.1 protein_id gnl|my_center|LOCUS_01990 101209 99701 gene locus_tag LOCUS_02000 101209 99701 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389559.1 protein_id gnl|my_center|LOCUS_02000 102070 101264 gene locus_tag LOCUS_02010 gene yidA 102070 101264 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_02010 102888 102073 gene locus_tag LOCUS_02020 gene sgcQ 102888 102073 CDS product BtpA family protein SgcQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118626.1 protein_id gnl|my_center|LOCUS_02020 103842 102955 gene locus_tag LOCUS_02030 gene nagB 103842 102955 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118913.1 protein_id gnl|my_center|LOCUS_02030 104671 103844 gene locus_tag LOCUS_02040 gene frlC 104671 103844 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_02040 105103 106488 gene locus_tag LOCUS_02050 105103 106488 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287925.1 protein_id gnl|my_center|LOCUS_02050 106602 107507 gene locus_tag LOCUS_02060 gene dapA 106602 107507 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389618.1 protein_id gnl|my_center|LOCUS_02060 107553 108647 gene locus_tag LOCUS_02070 107553 108647 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269064.1 protein_id gnl|my_center|LOCUS_02070 108680 109621 gene locus_tag LOCUS_02080 108680 109621 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210028.1 protein_id gnl|my_center|LOCUS_02080 111584 110070 gene locus_tag LOCUS_02090 111584 110070 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877623.1 protein_id gnl|my_center|LOCUS_02090 112073 111645 gene locus_tag LOCUS_02100 112073 111645 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211334279.1 protein_id gnl|my_center|LOCUS_02100 112930 112082 gene locus_tag LOCUS_02110 112930 112082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 113868 112954 gene locus_tag LOCUS_02120 gene frlC 113868 112954 CDS product fructoselysine 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847837.1 protein_id gnl|my_center|LOCUS_02120 114926 113865 gene locus_tag LOCUS_02130 114926 113865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 116702 114930 gene locus_tag LOCUS_02140 116702 114930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 117472 116687 gene locus_tag LOCUS_02150 gene frlD 117472 116687 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853346.1 protein_id gnl|my_center|LOCUS_02150 118281 117490 gene locus_tag LOCUS_02160 gene frlD 118281 117490 CDS product fructoselysine 6-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000853353.1 protein_id gnl|my_center|LOCUS_02160 119012 118278 gene locus_tag LOCUS_02170 119012 118278 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287926.1 protein_id gnl|my_center|LOCUS_02170 119888 119034 gene locus_tag LOCUS_02180 119888 119034 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966765.1 protein_id gnl|my_center|LOCUS_02180 120122 120346 gene locus_tag LOCUS_02190 120122 120346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 121415 120366 gene locus_tag LOCUS_02200 121415 120366 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583631.1 protein_id gnl|my_center|LOCUS_02200 122223 121456 gene locus_tag LOCUS_02210 122223 121456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775244.1 protein_id gnl|my_center|LOCUS_02210 122958 122242 gene locus_tag LOCUS_02220 122958 122242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 123128 122955 gene locus_tag LOCUS_02230 123128 122955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 123308 126859 gene locus_tag LOCUS_02240 123308 126859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 127277 126924 gene locus_tag LOCUS_02250 gene rplT 127277 126924 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256290.1 protein_id gnl|my_center|LOCUS_02250 127603 127367 gene locus_tag LOCUS_02260 127603 127367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 128256 127705 gene locus_tag LOCUS_02270 gene infC 128256 127705 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_02270 128416 128258 gene locus_tag LOCUS_02280 128416 128258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 128528 129757 gene locus_tag LOCUS_02290 128528 129757 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002683951.1 protein_id gnl|my_center|LOCUS_02290 130058 130993 gene locus_tag LOCUS_02300 130058 130993 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129881641.1 protein_id gnl|my_center|LOCUS_02300 131268 133313 gene locus_tag LOCUS_02310 131268 133313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 133858 135498 gene locus_tag LOCUS_02320 133858 135498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 137452 135668 gene locus_tag LOCUS_02330 gene thrS 137452 135668 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_02330 137945 138775 gene locus_tag LOCUS_02340 137945 138775 CDS product formamidopyrimidine-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109283.1 protein_id gnl|my_center|LOCUS_02340 139134 138772 gene locus_tag LOCUS_02350 139134 138772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 140362 139313 gene locus_tag LOCUS_02360 140362 139313 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123092.1 protein_id gnl|my_center|LOCUS_02360 141354 140374 gene locus_tag LOCUS_02370 141354 140374 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_02370 142367 141351 gene locus_tag LOCUS_02380 142367 141351 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_02380 143617 142385 gene locus_tag LOCUS_02390 143617 142385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 144678 143626 gene locus_tag LOCUS_02400 144678 143626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887604.1 protein_id gnl|my_center|LOCUS_02400 146460 144772 gene locus_tag LOCUS_02410 146460 144772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583223.1 protein_id gnl|my_center|LOCUS_02410 146786 146713 gene locus_tag LOCUS_t00110 146786 146713 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 148125 147031 gene locus_tag LOCUS_02420 gene serC 148125 147031 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462039.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence03 1005 214 gene locus_tag LOCUS_02430 1005 214 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_02430 1065 2090 gene locus_tag LOCUS_02440 gene amrS 1065 2090 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_02440 3644 2097 gene locus_tag LOCUS_02450 gene hutH 3644 2097 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256862.1 protein_id gnl|my_center|LOCUS_02450 4180 3668 gene locus_tag LOCUS_02460 4180 3668 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_02460 4683 4357 gene locus_tag LOCUS_02470 4683 4357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5738 4911 gene locus_tag LOCUS_02480 5738 4911 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803744.1 protein_id gnl|my_center|LOCUS_02480 6637 5735 gene locus_tag LOCUS_02490 6637 5735 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803743.1 protein_id gnl|my_center|LOCUS_02490 8003 6690 gene locus_tag LOCUS_02500 8003 6690 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011726997.1 protein_id gnl|my_center|LOCUS_02500 8357 9385 gene locus_tag LOCUS_02510 gene glpX 8357 9385 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632957.1 protein_id gnl|my_center|LOCUS_02510 9477 10547 gene locus_tag LOCUS_02520 gene gmd 9477 10547 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407639.1 protein_id gnl|my_center|LOCUS_02520 10826 13516 gene locus_tag LOCUS_02530 10826 13516 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_02530 15285 13555 gene locus_tag LOCUS_02540 15285 13555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 15392 16000 gene locus_tag LOCUS_02550 15392 16000 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705021.1 protein_id gnl|my_center|LOCUS_02550 16003 16695 gene locus_tag LOCUS_02560 gene rsmI 16003 16695 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_02560 17407 16676 gene locus_tag LOCUS_02570 17407 16676 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_02570 17451 18188 gene locus_tag LOCUS_02580 17451 18188 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001190167.1 protein_id gnl|my_center|LOCUS_02580 19654 18185 gene locus_tag LOCUS_02590 gene rsmF 19654 18185 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927794.1 protein_id gnl|my_center|LOCUS_02590 20475 19651 gene locus_tag LOCUS_02600 20475 19651 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_02600 21292 20480 gene locus_tag LOCUS_02610 21292 20480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 22367 21273 gene locus_tag LOCUS_02620 22367 21273 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_02620 23071 22364 gene locus_tag LOCUS_02630 gene rsmI 23071 22364 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525682.1 protein_id gnl|my_center|LOCUS_02630 23173 24714 gene locus_tag LOCUS_02640 gene murJ 23173 24714 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_02640 24738 25865 gene locus_tag LOCUS_02650 24738 25865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 27294 25942 gene locus_tag LOCUS_02660 gene rimO 27294 25942 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257724.1 protein_id gnl|my_center|LOCUS_02660 28610 27291 gene locus_tag LOCUS_02670 28610 27291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 29229 28687 gene locus_tag LOCUS_02680 gene rplI 29229 28687 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_02680 29413 31068 gene locus_tag LOCUS_02690 29413 31068 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_02690 31077 31487 gene locus_tag LOCUS_02700 gene mce 31077 31487 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_02700 31564 32898 gene locus_tag LOCUS_02710 gene ssnA 31564 32898 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861868.1 protein_id gnl|my_center|LOCUS_02710 32912 33571 gene locus_tag LOCUS_02720 gene npdG 32912 33571 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871024.1 protein_id gnl|my_center|LOCUS_02720 33572 34351 gene locus_tag LOCUS_02730 gene cofE 33572 34351 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_02730 34348 35328 gene locus_tag LOCUS_02740 gene cofD 34348 35328 CDS product 2-phospho-L-lactate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256113.1 protein_id gnl|my_center|LOCUS_02740 35325 35942 gene locus_tag LOCUS_02750 gene cofC 35325 35942 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223625.1 protein_id gnl|my_center|LOCUS_02750 35963 36967 gene locus_tag LOCUS_02760 gene mer 35963 36967 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_02760 36964 37428 gene locus_tag LOCUS_02770 36964 37428 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_02770 37418 38203 gene locus_tag LOCUS_02780 37418 38203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 38200 41109 gene locus_tag LOCUS_02790 38200 41109 CDS product molybdopterin-dependent oxidoreductase Mo/Fe-S-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817476.1 protein_id gnl|my_center|LOCUS_02790 41121 42497 gene locus_tag LOCUS_02800 41121 42497 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393891.1 protein_id gnl|my_center|LOCUS_02800 42497 43285 gene locus_tag LOCUS_02810 42497 43285 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542174.1 protein_id gnl|my_center|LOCUS_02810 43296 44702 gene locus_tag LOCUS_02820 43296 44702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 44699 46915 gene locus_tag LOCUS_02830 gene pucD 44699 46915 CDS product xanthine dehydrogenase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226424.1 protein_id gnl|my_center|LOCUS_02830 46921 47544 gene locus_tag LOCUS_02840 46921 47544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 47785 49626 gene locus_tag LOCUS_02850 gene glmS 47785 49626 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256373.1 protein_id gnl|my_center|LOCUS_02850 49694 50737 gene locus_tag LOCUS_02860 49694 50737 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_02860 50752 51894 gene locus_tag LOCUS_02870 50752 51894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 51897 52616 gene locus_tag LOCUS_02880 51897 52616 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258474.1 protein_id gnl|my_center|LOCUS_02880 52618 53808 gene locus_tag LOCUS_02890 52618 53808 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921052.1 protein_id gnl|my_center|LOCUS_02890 53808 54335 gene locus_tag LOCUS_02900 53808 54335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 54398 55132 gene locus_tag LOCUS_02910 gene tatC 54398 55132 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887452.1 protein_id gnl|my_center|LOCUS_02910 55143 55343 gene locus_tag LOCUS_02920 55143 55343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 55368 55685 gene locus_tag LOCUS_02930 55368 55685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 58172 55698 gene locus_tag LOCUS_02940 58172 55698 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000688713.1 protein_id gnl|my_center|LOCUS_02940 58407 58333 gene locus_tag LOCUS_t00120 58407 58333 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 58870 58544 gene locus_tag LOCUS_02950 58870 58544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 59330 58896 gene locus_tag LOCUS_02960 59330 58896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 60174 59395 gene locus_tag LOCUS_02970 60174 59395 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947174.1 protein_id gnl|my_center|LOCUS_02970 60489 61337 gene locus_tag LOCUS_02980 60489 61337 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_02980 61407 62111 gene locus_tag LOCUS_02990 gene rnc 61407 62111 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_02990 62108 65722 gene locus_tag LOCUS_03000 gene smc 62108 65722 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258775.1 protein_id gnl|my_center|LOCUS_03000 67244 65874 gene locus_tag LOCUS_03010 67244 65874 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256913.1 protein_id gnl|my_center|LOCUS_03010 67532 67257 gene locus_tag LOCUS_03020 gene rpsR 67532 67257 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359407.1 protein_id gnl|my_center|LOCUS_03020 67829 67545 gene locus_tag LOCUS_03030 gene rpsF 67829 67545 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010909032.1 protein_id gnl|my_center|LOCUS_03030 68380 68012 gene locus_tag LOCUS_03040 68380 68012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 68541 68468 gene locus_tag LOCUS_t00130 68541 68468 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 68999 68574 gene locus_tag LOCUS_03050 68999 68574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 70597 69011 gene locus_tag LOCUS_03060 70597 69011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 71165 70773 gene locus_tag LOCUS_03070 71165 70773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 71396 71175 gene locus_tag LOCUS_03080 71396 71175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 72610 71405 gene locus_tag LOCUS_03090 gene ftsZ 72610 71405 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023171980.1 protein_id gnl|my_center|LOCUS_03090 73909 72635 gene locus_tag LOCUS_03100 73909 72635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 74000 74905 gene locus_tag LOCUS_03110 74000 74905 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143624.1 protein_id gnl|my_center|LOCUS_03110 74902 76290 gene locus_tag LOCUS_03120 74902 76290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 79727 76287 gene locus_tag LOCUS_03130 79727 76287 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941263.1 protein_id gnl|my_center|LOCUS_03130 80948 79803 gene locus_tag LOCUS_03140 80948 79803 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_03140 81063 81695 gene locus_tag LOCUS_03150 81063 81695 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_03150 82512 81730 gene locus_tag LOCUS_03160 82512 81730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 82595 83566 gene locus_tag LOCUS_03170 gene pfkA 82595 83566 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_03170 84624 83563 gene locus_tag LOCUS_03180 gene prfB 84624 83563 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_03180 85572 84664 gene locus_tag LOCUS_03190 gene ftsY 85572 84664 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931894.1 protein_id gnl|my_center|LOCUS_03190 86626 85583 gene locus_tag LOCUS_03200 gene rlmN 86626 85583 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258793.1 protein_id gnl|my_center|LOCUS_03200 87416 86619 gene locus_tag LOCUS_03210 87416 86619 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_03210 88046 87441 gene locus_tag LOCUS_03220 gene clpP 88046 87441 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_03220 89573 88158 gene locus_tag LOCUS_03230 89573 88158 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015861.1 protein_id gnl|my_center|LOCUS_03230 89685 89603 gene locus_tag LOCUS_t00140 89685 89603 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 92408 89907 gene locus_tag LOCUS_03240 92408 89907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 94956 92719 gene locus_tag LOCUS_03250 94956 92719 CDS product type B DNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878196.1 protein_id gnl|my_center|LOCUS_03250 95372 94953 gene locus_tag LOCUS_03260 95372 94953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 95950 95384 gene locus_tag LOCUS_03270 95950 95384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 96096 96509 gene locus_tag LOCUS_03280 96096 96509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 97091 98068 gene locus_tag LOCUS_03290 97091 98068 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678705.1 protein_id gnl|my_center|LOCUS_03290 98398 100245 gene locus_tag LOCUS_03300 98398 100245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 100242 101402 gene locus_tag LOCUS_03310 100242 101402 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268410.1 protein_id gnl|my_center|LOCUS_03310 101407 103635 gene locus_tag LOCUS_03320 101407 103635 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_03320 103716 103970 gene locus_tag LOCUS_03330 103716 103970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 104049 104576 gene locus_tag LOCUS_03340 104049 104576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 104600 104932 gene locus_tag LOCUS_03350 104600 104932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 104939 105367 gene locus_tag LOCUS_03360 gene nusB 104939 105367 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_03360 105377 107785 gene locus_tag LOCUS_03370 105377 107785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 107813 109402 gene locus_tag LOCUS_03380 gene pckA 107813 109402 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392169.1 protein_id gnl|my_center|LOCUS_03380 109427 110710 gene locus_tag LOCUS_03390 gene murA 109427 110710 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083644.1 protein_id gnl|my_center|LOCUS_03390 111110 110760 gene locus_tag LOCUS_03400 gene trxA 111110 110760 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258400.1 protein_id gnl|my_center|LOCUS_03400 111586 111188 gene locus_tag LOCUS_03410 111586 111188 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_03410 111700 111772 gene locus_tag LOCUS_t00150 111700 111772 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 112522 111806 gene locus_tag LOCUS_03420 112522 111806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 112837 113292 gene locus_tag LOCUS_03430 112837 113292 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986654.1 protein_id gnl|my_center|LOCUS_03430 113415 113702 gene locus_tag LOCUS_03440 113415 113702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 113899 115299 gene locus_tag LOCUS_03450 113899 115299 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147974.1 protein_id gnl|my_center|LOCUS_03450 115408 117420 gene locus_tag LOCUS_03460 gene tkt 115408 117420 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_03460 117487 117690 gene locus_tag LOCUS_03470 117487 117690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 117693 117962 gene locus_tag LOCUS_03480 117693 117962 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391564.1 protein_id gnl|my_center|LOCUS_03480 118012 119727 gene locus_tag LOCUS_03490 gene ptsP 118012 119727 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000174221.1 protein_id gnl|my_center|LOCUS_03490 120866 119898 gene locus_tag LOCUS_03500 120866 119898 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_03500 122054 120927 gene locus_tag LOCUS_03510 122054 120927 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761753.1 protein_id gnl|my_center|LOCUS_03510 122214 122771 gene locus_tag LOCUS_03520 gene efp 122214 122771 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_03520 122785 123087 gene locus_tag LOCUS_03530 122785 123087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 123221 125077 gene locus_tag LOCUS_03540 gene ftsH 123221 125077 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_03540 126015 125074 gene locus_tag LOCUS_03550 gene miaA 126015 125074 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_03550 126389 126012 gene locus_tag LOCUS_03560 126389 126012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 126517 127674 gene locus_tag LOCUS_03570 126517 127674 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_03570 127685 129667 gene locus_tag LOCUS_03580 127685 129667 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257772.1 protein_id gnl|my_center|LOCUS_03580 129675 131138 gene locus_tag LOCUS_03590 gene glgA 129675 131138 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014570454.1 protein_id gnl|my_center|LOCUS_03590 131138 132700 gene locus_tag LOCUS_03600 gene malQ 131138 132700 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_03600 133406 132687 gene locus_tag LOCUS_03610 133406 132687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 133682 134095 gene locus_tag LOCUS_03620 133682 134095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 134843 134100 gene locus_tag LOCUS_03630 134843 134100 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704857.1 protein_id gnl|my_center|LOCUS_03630 135997 134858 gene locus_tag LOCUS_03640 gene mltG 135997 134858 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257814.1 protein_id gnl|my_center|LOCUS_03640 136425 135994 gene locus_tag LOCUS_03650 gene ruvX 136425 135994 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_03650 136505 138076 gene locus_tag LOCUS_03660 136505 138076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 138126 138857 gene locus_tag LOCUS_03670 138126 138857 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003531608.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence04 <1 739 gene locus_tag LOCUS_03680 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259133.1:glycerol kinase GlpK 814 1158 gene locus_tag LOCUS_03690 814 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1224 1964 gene locus_tag LOCUS_03700 1224 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2025 2834 gene locus_tag LOCUS_03710 2025 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 3143 3547 gene locus_tag LOCUS_03720 3143 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3569 5812 gene locus_tag LOCUS_03730 3569 5812 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986473.1 protein_id gnl|my_center|LOCUS_03730 5809 7719 gene locus_tag LOCUS_03740 5809 7719 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986472.1 protein_id gnl|my_center|LOCUS_03740 7799 8737 gene locus_tag LOCUS_03750 gene pfkB 7799 8737 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392148.1 protein_id gnl|my_center|LOCUS_03750 9266 10315 gene locus_tag LOCUS_03760 9266 10315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 10407 11894 gene locus_tag LOCUS_03770 10407 11894 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151612398.1 protein_id gnl|my_center|LOCUS_03770 11913 12914 gene locus_tag LOCUS_03780 11913 12914 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000137046.1 protein_id gnl|my_center|LOCUS_03780 13088 13465 gene locus_tag LOCUS_03790 13088 13465 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_03790 13492 13734 gene locus_tag LOCUS_03800 13492 13734 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255927.1 protein_id gnl|my_center|LOCUS_03800 13822 14277 gene locus_tag LOCUS_03810 13822 14277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 14267 14683 gene locus_tag LOCUS_03820 14267 14683 CDS product putative zinc-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393704.1 protein_id gnl|my_center|LOCUS_03820 14676 15416 gene locus_tag LOCUS_03830 14676 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 15409 15861 gene locus_tag LOCUS_03840 15409 15861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 15885 16256 gene locus_tag LOCUS_03850 15885 16256 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088514.1 protein_id gnl|my_center|LOCUS_03850 16338 16820 gene locus_tag LOCUS_03860 16338 16820 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015065.1 protein_id gnl|my_center|LOCUS_03860 16821 17342 gene locus_tag LOCUS_03870 16821 17342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 17360 18604 gene locus_tag LOCUS_03880 17360 18604 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755814.1 protein_id gnl|my_center|LOCUS_03880 19944 18739 gene locus_tag LOCUS_03890 19944 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 22376 19941 gene locus_tag LOCUS_03900 22376 19941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 23451 22510 gene locus_tag LOCUS_03910 23451 22510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 25290 23569 gene locus_tag LOCUS_03920 25290 23569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 25604 26452 gene locus_tag LOCUS_03930 25604 26452 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583151.1 protein_id gnl|my_center|LOCUS_03930 27845 26520 gene locus_tag LOCUS_03940 27845 26520 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584016.1 protein_id gnl|my_center|LOCUS_03940 28822 27980 gene locus_tag LOCUS_03950 28822 27980 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057996.1 protein_id gnl|my_center|LOCUS_03950 30244 28949 gene locus_tag LOCUS_03960 30244 28949 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_03960 31855 30326 gene locus_tag LOCUS_03970 31855 30326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 33215 31863 gene locus_tag LOCUS_03980 33215 31863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 33652 33212 gene locus_tag LOCUS_03990 33652 33212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 33833 33639 gene locus_tag LOCUS_04000 33833 33639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 34114 33920 gene locus_tag LOCUS_04010 34114 33920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 36125 34146 gene locus_tag LOCUS_04020 36125 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 37483 36185 gene locus_tag LOCUS_04030 37483 36185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 38282 37470 gene locus_tag LOCUS_04040 38282 37470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 39934 38282 gene locus_tag LOCUS_04050 39934 38282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 40519 40028 gene locus_tag LOCUS_04060 40519 40028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 41394 40708 gene locus_tag LOCUS_04070 41394 40708 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023421.1 protein_id gnl|my_center|LOCUS_04070 41489 42073 gene locus_tag LOCUS_04080 41489 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 42070 43041 gene locus_tag LOCUS_04090 42070 43041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 43197 44345 gene locus_tag LOCUS_04100 43197 44345 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001025067.1 protein_id gnl|my_center|LOCUS_04100 44434 44880 gene locus_tag LOCUS_04110 44434 44880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 45767 45279 gene locus_tag LOCUS_04120 45767 45279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 46903 45896 gene locus_tag LOCUS_04130 46903 45896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140186737.1 protein_id gnl|my_center|LOCUS_04130 47240 46890 gene locus_tag LOCUS_04140 47240 46890 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380304.1 protein_id gnl|my_center|LOCUS_04140 47432 48271 gene locus_tag LOCUS_04150 47432 48271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 49274 48324 gene locus_tag LOCUS_04160 49274 48324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 49499 50086 gene locus_tag LOCUS_04170 49499 50086 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970493.1 protein_id gnl|my_center|LOCUS_04170 50629 50225 gene locus_tag LOCUS_04180 50629 50225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 52880 50655 gene locus_tag LOCUS_04190 52880 50655 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_04190 53022 54287 gene locus_tag LOCUS_04200 53022 54287 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_04200 54295 55941 gene locus_tag LOCUS_04210 gene pgi 54295 55941 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817308.1 protein_id gnl|my_center|LOCUS_04210 55952 57409 gene locus_tag LOCUS_04220 gene glgA 55952 57409 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943869.1 protein_id gnl|my_center|LOCUS_04220 58639 57545 gene locus_tag LOCUS_04230 gene tal 58639 57545 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_04230 61750 58829 gene locus_tag LOCUS_04240 61750 58829 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948276.1 protein_id gnl|my_center|LOCUS_04240 61954 62718 gene locus_tag LOCUS_04250 61954 62718 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_04250 62715 63206 gene locus_tag LOCUS_04260 62715 63206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 63861 63373 gene locus_tag LOCUS_04270 63861 63373 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583739.1 protein_id gnl|my_center|LOCUS_04270 63974 64657 gene locus_tag LOCUS_04280 63974 64657 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258572.1 protein_id gnl|my_center|LOCUS_04280 65800 64715 gene locus_tag LOCUS_04290 65800 64715 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404839.1 protein_id gnl|my_center|LOCUS_04290 66019 65947 gene locus_tag LOCUS_t00160 66019 65947 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 66327 69347 gene locus_tag LOCUS_04300 66327 69347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 70067 73075 gene locus_tag LOCUS_04310 70067 73075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 73324 74985 gene locus_tag LOCUS_04320 73324 74985 CDS product M20 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404493.1 protein_id gnl|my_center|LOCUS_04320 75211 76605 gene locus_tag LOCUS_04330 75211 76605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 76614 77306 gene locus_tag LOCUS_04340 gene gph 76614 77306 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703653.1 protein_id gnl|my_center|LOCUS_04340 78642 77332 gene locus_tag LOCUS_04350 78642 77332 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459673.1 protein_id gnl|my_center|LOCUS_04350 78785 79519 gene locus_tag LOCUS_04360 78785 79519 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_04360 79590 80549 gene locus_tag LOCUS_04370 79590 80549 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_04370 80631 81224 gene locus_tag LOCUS_04380 80631 81224 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109460.1 protein_id gnl|my_center|LOCUS_04380 81221 81847 gene locus_tag LOCUS_04390 81221 81847 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383799.1 protein_id gnl|my_center|LOCUS_04390 81973 83253 gene locus_tag LOCUS_04400 81973 83253 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257707.1 protein_id gnl|my_center|LOCUS_04400 83314 83997 gene locus_tag LOCUS_04410 83314 83997 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_04410 84220 86031 gene locus_tag LOCUS_04420 84220 86031 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017872038.1 protein_id gnl|my_center|LOCUS_04420 86528 86118 gene locus_tag LOCUS_04430 86528 86118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 88381 86528 gene locus_tag LOCUS_04440 88381 86528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 88496 89785 gene locus_tag LOCUS_04450 gene xseA 88496 89785 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965382.1 protein_id gnl|my_center|LOCUS_04450 89766 89999 gene locus_tag LOCUS_04460 gene xseB 89766 89999 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693923.1 protein_id gnl|my_center|LOCUS_04460 90006 90473 gene locus_tag LOCUS_04470 90006 90473 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130996.1 protein_id gnl|my_center|LOCUS_04470 92228 90570 gene locus_tag LOCUS_04480 gene murJ 92228 90570 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_04480 93708 92221 gene locus_tag LOCUS_04490 gene mazG 93708 92221 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391632.1 protein_id gnl|my_center|LOCUS_04490 94250 93858 gene locus_tag LOCUS_04500 gene rpsI 94250 93858 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004254378.1 protein_id gnl|my_center|LOCUS_04500 94692 94264 gene locus_tag LOCUS_04510 gene rplM 94692 94264 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173515.1 protein_id gnl|my_center|LOCUS_04510 95494 94748 gene locus_tag LOCUS_04520 gene truA 95494 94748 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947033.1 protein_id gnl|my_center|LOCUS_04520 95925 95542 gene locus_tag LOCUS_04530 gene rplQ 95925 95542 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258259.1 protein_id gnl|my_center|LOCUS_04530 96876 95932 gene locus_tag LOCUS_04540 96876 95932 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000568988.1 protein_id gnl|my_center|LOCUS_04540 97584 96946 gene locus_tag LOCUS_04550 gene rpsD 97584 96946 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_04550 98013 97609 gene locus_tag LOCUS_04560 gene rpsK 98013 97609 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197937.1 protein_id gnl|my_center|LOCUS_04560 98506 98117 gene locus_tag LOCUS_04570 gene rpsM 98506 98117 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357564.1 protein_id gnl|my_center|LOCUS_04570 99470 98706 gene locus_tag LOCUS_04580 gene map 99470 98706 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_04580 100132 99470 gene locus_tag LOCUS_04590 100132 99470 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258252.1 protein_id gnl|my_center|LOCUS_04590 101471 100140 gene locus_tag LOCUS_04600 gene secY 101471 100140 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_04600 101950 101492 gene locus_tag LOCUS_04610 gene rplO 101950 101492 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723680.1 protein_id gnl|my_center|LOCUS_04610 102162 101950 gene locus_tag LOCUS_04620 gene rpmD 102162 101950 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720933.1 protein_id gnl|my_center|LOCUS_04620 102679 102155 gene locus_tag LOCUS_04630 gene rpsE 102679 102155 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810132.1 protein_id gnl|my_center|LOCUS_04630 103057 102692 gene locus_tag LOCUS_04640 gene rplR 103057 102692 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_04640 103617 103069 gene locus_tag LOCUS_04650 gene rplF 103617 103069 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583360.1 protein_id gnl|my_center|LOCUS_04650 104040 103627 gene locus_tag LOCUS_04660 gene rpsH 104040 103627 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258245.1 protein_id gnl|my_center|LOCUS_04660 104243 104061 gene locus_tag LOCUS_04670 104243 104061 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_04670 104788 104243 gene locus_tag LOCUS_04680 gene rplE 104788 104243 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_04680 105210 104806 gene locus_tag LOCUS_04690 105210 104806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 105603 105232 gene locus_tag LOCUS_04700 gene rplN 105603 105232 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974257.1 protein_id gnl|my_center|LOCUS_04700 105890 105600 gene locus_tag LOCUS_04710 gene rpsQ 105890 105600 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546149.1 protein_id gnl|my_center|LOCUS_04710 106095 105892 gene locus_tag LOCUS_04720 gene rpmC 106095 105892 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_04720 106517 106092 gene locus_tag LOCUS_04730 gene rplP 106517 106092 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_04730 107223 106546 gene locus_tag LOCUS_04740 gene rpsC 107223 106546 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_04740 107592 107251 gene locus_tag LOCUS_04750 gene rplV 107592 107251 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002986651.1 protein_id gnl|my_center|LOCUS_04750 107872 107600 gene locus_tag LOCUS_04760 gene rpsS 107872 107600 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_04760 108743 107904 gene locus_tag LOCUS_04770 gene rplB 108743 107904 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421168.1 protein_id gnl|my_center|LOCUS_04770 109048 108743 gene locus_tag LOCUS_04780 gene rplW 109048 108743 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_04780 109692 109063 gene locus_tag LOCUS_04790 gene rplD 109692 109063 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_04790 110354 109722 gene locus_tag LOCUS_04800 gene rplC 110354 109722 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_04800 110916 110608 gene locus_tag LOCUS_04810 gene rpsJ 110916 110608 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_04810 113087 111015 gene locus_tag LOCUS_04820 gene fusA 113087 111015 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545225.1 protein_id gnl|my_center|LOCUS_04820 113588 113118 gene locus_tag LOCUS_04830 gene rpsG 113588 113118 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_04830 114085 113669 gene locus_tag LOCUS_04840 gene rpsL 114085 113669 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_04840 118141 114224 gene locus_tag LOCUS_04850 118141 114224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 118558 120042 gene locus_tag LOCUS_04860 118558 120042 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_04860 >Feature sequence05 774 2138 gene locus_tag LOCUS_04870 774 2138 CDS product CpXC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257830.1 protein_id gnl|my_center|LOCUS_04870 2779 2135 gene locus_tag LOCUS_04880 2779 2135 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255966.1 protein_id gnl|my_center|LOCUS_04880 2884 3900 gene locus_tag LOCUS_04890 2884 3900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 7039 4268 gene locus_tag LOCUS_04900 7039 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7785 7036 gene locus_tag LOCUS_04910 7785 7036 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 protein_id gnl|my_center|LOCUS_04910 8127 8804 gene locus_tag LOCUS_04920 8127 8804 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392645.1 protein_id gnl|my_center|LOCUS_04920 8804 10231 gene locus_tag LOCUS_04930 8804 10231 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392644.1 protein_id gnl|my_center|LOCUS_04930 10312 11652 gene locus_tag LOCUS_04940 10312 11652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 12384 11716 gene locus_tag LOCUS_04950 12384 11716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 13078 12392 gene locus_tag LOCUS_04960 13078 12392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 13505 14062 gene locus_tag LOCUS_04970 gene frr 13505 14062 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_04970 14066 14782 gene locus_tag LOCUS_04980 14066 14782 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_04980 14782 15588 gene locus_tag LOCUS_04990 14782 15588 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057942.1 protein_id gnl|my_center|LOCUS_04990 17290 15647 gene locus_tag LOCUS_05000 gene pgm 17290 15647 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705434.1 protein_id gnl|my_center|LOCUS_05000 17907 17302 gene locus_tag LOCUS_05010 17907 17302 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770403.1 protein_id gnl|my_center|LOCUS_05010 18762 18022 gene locus_tag LOCUS_05020 18762 18022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 18918 20078 gene locus_tag LOCUS_05030 18918 20078 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404146.1 protein_id gnl|my_center|LOCUS_05030 20086 20694 gene locus_tag LOCUS_05040 20086 20694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 20696 22423 gene locus_tag LOCUS_05050 20696 22423 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258660.1 protein_id gnl|my_center|LOCUS_05050 22410 24980 gene locus_tag LOCUS_05060 22410 24980 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058009.1 protein_id gnl|my_center|LOCUS_05060 25730 24948 gene locus_tag LOCUS_05070 25730 24948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 27175 25742 gene locus_tag LOCUS_05080 27175 25742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 27725 27210 gene locus_tag LOCUS_05090 27725 27210 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228008.1 protein_id gnl|my_center|LOCUS_05090 30335 27801 gene locus_tag LOCUS_05100 gene priA 30335 27801 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259672.1 protein_id gnl|my_center|LOCUS_05100 31327 30335 gene locus_tag LOCUS_05110 31327 30335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 32222 31338 gene locus_tag LOCUS_05120 gene amrB 32222 31338 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_05120 33476 32295 gene locus_tag LOCUS_05130 33476 32295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 33639 34190 gene locus_tag LOCUS_05140 33639 34190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 35420 34200 gene locus_tag LOCUS_05150 35420 34200 CDS product crosslink repair DNA glycosylase YcaQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198466.1 protein_id gnl|my_center|LOCUS_05150 35606 36007 gene locus_tag LOCUS_05160 35606 36007 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_05160 36207 36407 gene locus_tag LOCUS_05170 36207 36407 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_05170 36694 37263 gene locus_tag LOCUS_05180 36694 37263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 37345 37650 gene locus_tag LOCUS_05190 37345 37650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 37851 38303 gene locus_tag LOCUS_05200 37851 38303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 38456 38902 gene locus_tag LOCUS_05210 38456 38902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 39111 39440 gene locus_tag LOCUS_05220 39111 39440 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941509.1 protein_id gnl|my_center|LOCUS_05220 39709 40626 gene locus_tag LOCUS_05230 39709 40626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 40761 41288 gene locus_tag LOCUS_05240 40761 41288 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294661.1 protein_id gnl|my_center|LOCUS_05240 41478 42176 gene locus_tag LOCUS_05250 41478 42176 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279101.1 protein_id gnl|my_center|LOCUS_05250 42464 43687 gene locus_tag LOCUS_05260 42464 43687 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257455.1 protein_id gnl|my_center|LOCUS_05260 44029 44283 gene locus_tag LOCUS_05270 44029 44283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 44453 45268 gene locus_tag LOCUS_05280 44453 45268 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_05280 45381 45752 gene locus_tag LOCUS_05290 45381 45752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 46203 47648 gene locus_tag LOCUS_05300 46203 47648 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682416.1 protein_id gnl|my_center|LOCUS_05300 48919 47759 gene locus_tag LOCUS_05310 48919 47759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 49532 48924 gene locus_tag LOCUS_05320 49532 48924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 49680 51560 gene locus_tag LOCUS_05330 49680 51560 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258301.1 protein_id gnl|my_center|LOCUS_05330 51845 52273 gene locus_tag LOCUS_05340 51845 52273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 52302 52928 gene locus_tag LOCUS_05350 52302 52928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 55491 52990 gene locus_tag LOCUS_05360 55491 52990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 55845 58217 gene locus_tag LOCUS_05370 55845 58217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 58956 58303 gene locus_tag LOCUS_05380 58956 58303 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071471.1 protein_id gnl|my_center|LOCUS_05380 59695 59000 gene locus_tag LOCUS_05390 59695 59000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000849665.1 protein_id gnl|my_center|LOCUS_05390 60175 60104 gene locus_tag LOCUS_t00170 60175 60104 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 61679 60243 gene locus_tag LOCUS_05400 gene gatB 61679 60243 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_05400 63280 61676 gene locus_tag LOCUS_05410 gene gatA 63280 61676 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920797.1 protein_id gnl|my_center|LOCUS_05410 63597 63277 gene locus_tag LOCUS_05420 63597 63277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 63725 65773 gene locus_tag LOCUS_05430 63725 65773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015935.1 protein_id gnl|my_center|LOCUS_05430 65892 66524 gene locus_tag LOCUS_05440 65892 66524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 66548 67012 gene locus_tag LOCUS_05450 66548 67012 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804034.1 protein_id gnl|my_center|LOCUS_05450 67116 68864 gene locus_tag LOCUS_05460 67116 68864 CDS product dynamin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256851.1 protein_id gnl|my_center|LOCUS_05460 68875 69798 gene locus_tag LOCUS_05470 68875 69798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 70669 69938 gene locus_tag LOCUS_05480 gene pyrH 70669 69938 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_05480 71345 70725 gene locus_tag LOCUS_05490 gene tsf 71345 70725 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_05490 72243 71389 gene locus_tag LOCUS_05500 gene rpsB 72243 71389 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640739.1 protein_id gnl|my_center|LOCUS_05500 72378 72259 gene locus_tag LOCUS_05510 72378 72259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 72816 73742 gene locus_tag LOCUS_05520 72816 73742 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_05520 73739 74338 gene locus_tag LOCUS_05530 73739 74338 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_05530 74417 74869 gene locus_tag LOCUS_05540 74417 74869 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909388.1 protein_id gnl|my_center|LOCUS_05540 75338 74871 gene locus_tag LOCUS_05550 gene dtd 75338 74871 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080996.1 protein_id gnl|my_center|LOCUS_05550 75881 75633 gene locus_tag LOCUS_05560 75881 75633 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764857.1 protein_id gnl|my_center|LOCUS_05560 76363 75923 gene locus_tag LOCUS_05570 76363 75923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 76515 77654 gene locus_tag LOCUS_05580 76515 77654 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941112.1 protein_id gnl|my_center|LOCUS_05580 77651 79048 gene locus_tag LOCUS_05590 77651 79048 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_05590 79076 79166 gene locus_tag LOCUS_t00180 79076 79166 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 83642 79371 gene locus_tag LOCUS_05600 83642 79371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 84264 84019 gene locus_tag LOCUS_05610 84264 84019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256705.1 protein_id gnl|my_center|LOCUS_05610 85427 84510 gene locus_tag LOCUS_05620 85427 84510 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026644807.1 protein_id gnl|my_center|LOCUS_05620 86128 85643 gene locus_tag LOCUS_05630 gene rimI 86128 85643 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481582.1 protein_id gnl|my_center|LOCUS_05630 88056 86125 gene locus_tag LOCUS_05640 88056 86125 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256937.1 protein_id gnl|my_center|LOCUS_05640 88217 89296 gene locus_tag LOCUS_05650 88217 89296 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256438.1 protein_id gnl|my_center|LOCUS_05650 89293 90630 gene locus_tag LOCUS_05660 89293 90630 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_05660 91088 92422 gene locus_tag LOCUS_05670 gene dnaA 91088 92422 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_05670 95673 92857 gene locus_tag LOCUS_05680 gene polA 95673 92857 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256248.1 protein_id gnl|my_center|LOCUS_05680 96262 95747 gene locus_tag LOCUS_05690 96262 95747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 96418 97815 gene locus_tag LOCUS_05700 gene lpdA 96418 97815 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034283919.1 protein_id gnl|my_center|LOCUS_05700 98112 98864 gene locus_tag LOCUS_05710 98112 98864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 98861 99475 gene locus_tag LOCUS_05720 98861 99475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 99476 101293 gene locus_tag LOCUS_05730 99476 101293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 101290 101973 gene locus_tag LOCUS_05740 101290 101973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 101987 103684 gene locus_tag LOCUS_05750 101987 103684 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_05750 103686 104741 gene locus_tag LOCUS_05760 103686 104741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 105931 104747 gene locus_tag LOCUS_05770 105931 104747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 106089 107156 gene locus_tag LOCUS_05780 106089 107156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 107397 107469 gene locus_tag LOCUS_t00190 107397 107469 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 107552 107634 gene locus_tag LOCUS_t00200 107552 107634 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 107671 107744 gene locus_tag LOCUS_t00210 107671 107744 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 107790 108995 gene locus_tag LOCUS_05790 gene tuf 107790 108995 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258047.1 protein_id gnl|my_center|LOCUS_05790 109257 109331 gene locus_tag LOCUS_t00220 109257 109331 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 109391 109606 gene locus_tag LOCUS_05800 109391 109606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 109641 110309 gene locus_tag LOCUS_05810 gene nusG 109641 110309 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258049.1 protein_id gnl|my_center|LOCUS_05810 110380 110808 gene locus_tag LOCUS_05820 gene rplK 110380 110808 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056150.1 protein_id gnl|my_center|LOCUS_05820 110864 111586 gene locus_tag LOCUS_05830 gene rplA 110864 111586 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258051.1 protein_id gnl|my_center|LOCUS_05830 111797 112327 gene locus_tag LOCUS_05840 gene rplJ 111797 112327 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904072.1 protein_id gnl|my_center|LOCUS_05840 112397 112777 gene locus_tag LOCUS_05850 gene rplL 112397 112777 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531413.1 protein_id gnl|my_center|LOCUS_05850 113529 112843 gene locus_tag LOCUS_05860 gene lexA 113529 112843 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_05860 113610 113837 gene locus_tag LOCUS_05870 113610 113837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 113874 114770 gene locus_tag LOCUS_05880 113874 114770 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_05880 115812 114829 gene locus_tag LOCUS_05890 115812 114829 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259109.1 protein_id gnl|my_center|LOCUS_05890 116915 115815 gene locus_tag LOCUS_05900 116915 115815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 <117709 116912 gene locus_tag LOCUS_05910 <117709 116912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_196835716.1:adenine-specific methyltransferase EcoRI family protein >Feature sequence06 3 512 gene locus_tag LOCUS_05920 3 512 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065297.1 protein_id gnl|my_center|LOCUS_05920 1202 825 gene locus_tag LOCUS_05930 1202 825 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_05930 1593 1414 gene locus_tag LOCUS_05940 1593 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 3256 1970 gene locus_tag LOCUS_05950 3256 1970 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927136.1 protein_id gnl|my_center|LOCUS_05950 4620 3454 gene locus_tag LOCUS_05960 4620 3454 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257780.1 protein_id gnl|my_center|LOCUS_05960 5660 4647 gene locus_tag LOCUS_05970 5660 4647 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257630.1 protein_id gnl|my_center|LOCUS_05970 6595 5822 gene locus_tag LOCUS_05980 6595 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 6706 7521 gene locus_tag LOCUS_05990 6706 7521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 8339 7719 gene locus_tag LOCUS_06000 8339 7719 CDS product sulfite oxidase-like oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258211.1 protein_id gnl|my_center|LOCUS_06000 9029 8340 gene locus_tag LOCUS_06010 9029 8340 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_06010 10577 9090 gene locus_tag LOCUS_06020 10577 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 12908 10728 gene locus_tag LOCUS_06030 12908 10728 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_06030 14116 12938 gene locus_tag LOCUS_06040 gene chrA 14116 12938 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530105.1 protein_id gnl|my_center|LOCUS_06040 15132 14113 gene locus_tag LOCUS_06050 gene holB 15132 14113 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257799.1 protein_id gnl|my_center|LOCUS_06050 15301 18153 gene locus_tag LOCUS_06060 15301 18153 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104785.1 protein_id gnl|my_center|LOCUS_06060 18568 19890 gene locus_tag LOCUS_06070 18568 19890 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946024.1 protein_id gnl|my_center|LOCUS_06070 19915 20925 gene locus_tag LOCUS_06080 gene galE 19915 20925 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992438.1 protein_id gnl|my_center|LOCUS_06080 21750 21058 gene locus_tag LOCUS_06090 21750 21058 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258849.1 protein_id gnl|my_center|LOCUS_06090 22452 21766 gene locus_tag LOCUS_06100 22452 21766 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228617.1 protein_id gnl|my_center|LOCUS_06100 23716 22466 gene locus_tag LOCUS_06110 23716 22466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 25035 23713 gene locus_tag LOCUS_06120 25035 23713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 25721 25065 gene locus_tag LOCUS_06130 gene tmk 25721 25065 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_06130 27352 25724 gene locus_tag LOCUS_06140 27352 25724 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_06140 28429 27527 gene locus_tag LOCUS_06150 28429 27527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 29037 28453 gene locus_tag LOCUS_06160 gene pdxT 29037 28453 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_06160 29942 29055 gene locus_tag LOCUS_06170 gene pdxS 29942 29055 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258093.1 protein_id gnl|my_center|LOCUS_06170 30530 30006 gene locus_tag LOCUS_06180 30530 30006 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256097.1 protein_id gnl|my_center|LOCUS_06180 31394 30621 gene locus_tag LOCUS_06190 31394 30621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 32198 31404 gene locus_tag LOCUS_06200 32198 31404 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660412.1 protein_id gnl|my_center|LOCUS_06200 33142 32201 gene locus_tag LOCUS_06210 33142 32201 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256181.1 protein_id gnl|my_center|LOCUS_06210 36779 33480 gene locus_tag LOCUS_06220 36779 33480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 37624 36962 gene locus_tag LOCUS_06230 37624 36962 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256927.1 protein_id gnl|my_center|LOCUS_06230 38342 37608 gene locus_tag LOCUS_06240 38342 37608 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_06240 38439 38364 gene locus_tag LOCUS_t00230 38439 38364 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 38774 38430 gene locus_tag LOCUS_06250 38774 38430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 38964 39887 gene locus_tag LOCUS_06260 38964 39887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 40016 40402 gene locus_tag LOCUS_06270 40016 40402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 40411 40728 gene locus_tag LOCUS_06280 40411 40728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 40730 41371 gene locus_tag LOCUS_06290 40730 41371 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_06290 41371 41598 gene locus_tag LOCUS_06300 41371 41598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 41595 42119 gene locus_tag LOCUS_06310 gene cas4 41595 42119 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_06310 42351 43256 gene locus_tag LOCUS_06320 42351 43256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 43306 44844 gene locus_tag LOCUS_06330 43306 44844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 46153 44846 gene locus_tag LOCUS_06340 46153 44846 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886935.1 protein_id gnl|my_center|LOCUS_06340 47213 46155 gene locus_tag LOCUS_06350 47213 46155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 47364 48521 gene locus_tag LOCUS_06360 47364 48521 CDS product DUF2974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808364.1 protein_id gnl|my_center|LOCUS_06360 48640 48891 gene locus_tag LOCUS_06370 48640 48891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 49477 48914 gene locus_tag LOCUS_06380 49477 48914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 50976 49864 gene locus_tag LOCUS_06390 50976 49864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06390 52263 51088 gene locus_tag LOCUS_06400 52263 51088 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_06400 53359 52271 gene locus_tag LOCUS_06410 53359 52271 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256144.1 protein_id gnl|my_center|LOCUS_06410 54650 53352 gene locus_tag LOCUS_06420 54650 53352 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256145.1 protein_id gnl|my_center|LOCUS_06420 54854 55816 gene locus_tag LOCUS_06430 gene trxB 54854 55816 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880288.1 protein_id gnl|my_center|LOCUS_06430 55869 56615 gene locus_tag LOCUS_06440 55869 56615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 57978 56620 gene locus_tag LOCUS_06450 57978 56620 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965974.1 protein_id gnl|my_center|LOCUS_06450 58611 58045 gene locus_tag LOCUS_06460 58611 58045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 58710 59234 gene locus_tag LOCUS_06470 58710 59234 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065742.1 protein_id gnl|my_center|LOCUS_06470 59250 60221 gene locus_tag LOCUS_06480 59250 60221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 60211 60969 gene locus_tag LOCUS_06490 60211 60969 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858645.1 protein_id gnl|my_center|LOCUS_06490 60997 61572 gene locus_tag LOCUS_06500 60997 61572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 62076 61624 gene locus_tag LOCUS_06510 62076 61624 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027268.1 protein_id gnl|my_center|LOCUS_06510 62361 62080 gene locus_tag LOCUS_06520 62361 62080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 62575 63180 gene locus_tag LOCUS_06530 62575 63180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 63913 65298 gene locus_tag LOCUS_06540 63913 65298 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583619.1 protein_id gnl|my_center|LOCUS_06540 65673 67316 gene locus_tag LOCUS_06550 65673 67316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 67336 68550 gene locus_tag LOCUS_06560 67336 68550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 68725 69075 gene locus_tag LOCUS_06570 gene rplS 68725 69075 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257535.1 protein_id gnl|my_center|LOCUS_06570 69195 69917 gene locus_tag LOCUS_06580 69195 69917 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_06580 69947 70786 gene locus_tag LOCUS_06590 gene murI 69947 70786 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_06590 71325 70795 gene locus_tag LOCUS_06600 71325 70795 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258952.1 protein_id gnl|my_center|LOCUS_06600 71948 71322 gene locus_tag LOCUS_06610 71948 71322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 72369 71932 gene locus_tag LOCUS_06620 72369 71932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 74009 72366 gene locus_tag LOCUS_06630 74009 72366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 74722 74069 gene locus_tag LOCUS_06640 74722 74069 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880253.1 protein_id gnl|my_center|LOCUS_06640 77233 74870 gene locus_tag LOCUS_06650 77233 74870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 78308 77448 gene locus_tag LOCUS_06660 78308 77448 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811761.1 protein_id gnl|my_center|LOCUS_06660 81068 78522 gene locus_tag LOCUS_06670 81068 78522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 82543 81092 gene locus_tag LOCUS_06680 gene glmM 82543 81092 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222643.1 protein_id gnl|my_center|LOCUS_06680 83462 82569 gene locus_tag LOCUS_06690 83462 82569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 83733 84656 gene locus_tag LOCUS_06700 gene msrP 83733 84656 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257868.1 protein_id gnl|my_center|LOCUS_06700 85834 84665 gene locus_tag LOCUS_06710 85834 84665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 86090 85839 gene locus_tag LOCUS_06720 86090 85839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 85977 87110 gene locus_tag LOCUS_06730 85977 87110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 88586 87114 gene locus_tag LOCUS_06740 88586 87114 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256764.1 protein_id gnl|my_center|LOCUS_06740 89274 88588 gene locus_tag LOCUS_06750 89274 88588 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256765.1 protein_id gnl|my_center|LOCUS_06750 89505 89981 gene locus_tag LOCUS_06760 89505 89981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 90081 90482 gene locus_tag LOCUS_06770 90081 90482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 90613 90686 gene locus_tag LOCUS_t00240 90613 90686 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 90762 90836 gene locus_tag LOCUS_t00250 90762 90836 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 91697 90900 gene locus_tag LOCUS_06780 91697 90900 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035329735.1 protein_id gnl|my_center|LOCUS_06780 91836 92735 gene locus_tag LOCUS_06790 91836 92735 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000562954.1 protein_id gnl|my_center|LOCUS_06790 92824 93465 gene locus_tag LOCUS_06800 92824 93465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 95034 93496 gene locus_tag LOCUS_06810 95034 93496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 95153 95539 gene locus_tag LOCUS_06820 95153 95539 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687566.1 protein_id gnl|my_center|LOCUS_06820 95558 96424 gene locus_tag LOCUS_06830 gene ant(6) 95558 96424 CDS product aminoglycoside nucleotidyltransferase ANT(6)-Ia inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294505.1 protein_id gnl|my_center|LOCUS_06830 96478 98136 gene locus_tag LOCUS_06840 gene hutU 96478 98136 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256864.1 protein_id gnl|my_center|LOCUS_06840 98150 98539 gene locus_tag LOCUS_06850 98150 98539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 98526 98891 gene locus_tag LOCUS_06860 98526 98891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 100364 98952 gene locus_tag LOCUS_06870 100364 98952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 100643 100422 gene locus_tag LOCUS_06880 100643 100422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 102575 100746 gene locus_tag LOCUS_06890 102575 100746 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256943.1 protein_id gnl|my_center|LOCUS_06890 102746 103339 gene locus_tag LOCUS_06900 102746 103339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence07 3460 419 gene locus_tag LOCUS_06910 3460 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 3717 5240 gene locus_tag LOCUS_06920 3717 5240 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257250.1 protein_id gnl|my_center|LOCUS_06920 5329 6246 gene locus_tag LOCUS_06930 5329 6246 CDS product aldo/keto reductase family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966649.1 protein_id gnl|my_center|LOCUS_06930 7069 6374 gene locus_tag LOCUS_06940 7069 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 8294 7083 gene locus_tag LOCUS_06950 8294 7083 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809406.1 protein_id gnl|my_center|LOCUS_06950 9055 8291 gene locus_tag LOCUS_06960 9055 8291 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_06960 10540 9065 gene locus_tag LOCUS_06970 10540 9065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 10840 11568 gene locus_tag LOCUS_06980 10840 11568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 11735 14635 gene locus_tag LOCUS_06990 11735 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 14660 15670 gene locus_tag LOCUS_07000 14660 15670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 15712 17535 gene locus_tag LOCUS_07010 15712 17535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 17628 19010 gene locus_tag LOCUS_07020 17628 19010 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256342.1 protein_id gnl|my_center|LOCUS_07020 19050 21575 gene locus_tag LOCUS_07030 gene lon 19050 21575 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255996.1 protein_id gnl|my_center|LOCUS_07030 22050 21577 gene locus_tag LOCUS_07040 22050 21577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 22707 22183 gene locus_tag LOCUS_07050 gene coaD 22707 22183 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459625.1 protein_id gnl|my_center|LOCUS_07050 25187 22707 gene locus_tag LOCUS_07060 gene recG 25187 22707 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_07060 26998 25316 gene locus_tag LOCUS_07070 26998 25316 CDS product DAK2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027130.1 protein_id gnl|my_center|LOCUS_07070 27386 27030 gene locus_tag LOCUS_07080 27386 27030 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583499.1 protein_id gnl|my_center|LOCUS_07080 27512 27697 gene locus_tag LOCUS_07090 gene rpmB 27512 27697 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811837.1 protein_id gnl|my_center|LOCUS_07090 28402 27740 gene locus_tag LOCUS_07100 gene rpe 28402 27740 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_07100 29485 28409 gene locus_tag LOCUS_07110 29485 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 29776 30219 gene locus_tag LOCUS_07120 gene mraZ 29776 30219 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_07120 30219 31169 gene locus_tag LOCUS_07130 gene rsmH 30219 31169 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943702.1 protein_id gnl|my_center|LOCUS_07130 31189 31671 gene locus_tag LOCUS_07140 31189 31671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 31668 33446 gene locus_tag LOCUS_07150 31668 33446 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_07150 33448 34860 gene locus_tag LOCUS_07160 33448 34860 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_07160 34860 35855 gene locus_tag LOCUS_07170 gene mraY 34860 35855 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_07170 35858 37246 gene locus_tag LOCUS_07180 gene murD 35858 37246 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_07180 37228 38472 gene locus_tag LOCUS_07190 gene spoVE 37228 38472 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753520.1 protein_id gnl|my_center|LOCUS_07190 38393 39463 gene locus_tag LOCUS_07200 38393 39463 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256649.1 protein_id gnl|my_center|LOCUS_07200 39480 40001 gene locus_tag LOCUS_07210 39480 40001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 40001 41392 gene locus_tag LOCUS_07220 gene murC 40001 41392 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216457.1 protein_id gnl|my_center|LOCUS_07220 41392 42318 gene locus_tag LOCUS_07230 gene murB 41392 42318 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_07230 42305 43408 gene locus_tag LOCUS_07240 42305 43408 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256645.1 protein_id gnl|my_center|LOCUS_07240 43417 44439 gene locus_tag LOCUS_07250 43417 44439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 44441 45679 gene locus_tag LOCUS_07260 gene ftsA 44441 45679 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_07260 45707 46861 gene locus_tag LOCUS_07270 gene ftsZ 45707 46861 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000888984.1 protein_id gnl|my_center|LOCUS_07270 47553 48011 gene locus_tag LOCUS_07280 gene nrdR 47553 48011 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_07280 48021 50585 gene locus_tag LOCUS_07290 48021 50585 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257621.1 protein_id gnl|my_center|LOCUS_07290 50695 51432 gene locus_tag LOCUS_07300 50695 51432 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223699.1 protein_id gnl|my_center|LOCUS_07300 51434 52087 gene locus_tag LOCUS_07310 51434 52087 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886943.1 protein_id gnl|my_center|LOCUS_07310 53553 52294 gene locus_tag LOCUS_07320 gene obgE 53553 52294 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246161.1 protein_id gnl|my_center|LOCUS_07320 54969 53650 gene locus_tag LOCUS_07330 54969 53650 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_07330 56763 55012 gene locus_tag LOCUS_07340 gene argS 56763 55012 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682282.1 protein_id gnl|my_center|LOCUS_07340 57142 56879 gene locus_tag LOCUS_07350 gene rpsT 57142 56879 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003859343.1 protein_id gnl|my_center|LOCUS_07350 57795 58796 gene locus_tag LOCUS_07360 57795 58796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 59479 58910 gene locus_tag LOCUS_07370 59479 58910 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932037.1 protein_id gnl|my_center|LOCUS_07370 59930 59472 gene locus_tag LOCUS_07380 59930 59472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 61155 59950 gene locus_tag LOCUS_07390 gene recF 61155 59950 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_07390 61664 61155 gene locus_tag LOCUS_07400 gene def 61664 61155 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948295.1 protein_id gnl|my_center|LOCUS_07400 63372 61705 gene locus_tag LOCUS_07410 63372 61705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 65941 63473 gene locus_tag LOCUS_07420 65941 63473 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256922.1 protein_id gnl|my_center|LOCUS_07420 67066 66038 gene locus_tag LOCUS_07430 gene queA 67066 66038 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393197.1 protein_id gnl|my_center|LOCUS_07430 68116 67073 gene locus_tag LOCUS_07440 gene ruvB 68116 67073 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_07440 68276 69244 gene locus_tag LOCUS_07450 68276 69244 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388760.1 protein_id gnl|my_center|LOCUS_07450 71185 69245 gene locus_tag LOCUS_07460 71185 69245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 72121 71186 gene locus_tag LOCUS_07470 72121 71186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 72220 72750 gene locus_tag LOCUS_07480 72220 72750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 72805 73209 gene locus_tag LOCUS_07490 72805 73209 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_07490 73213 74226 gene locus_tag LOCUS_07500 gene meaB 73213 74226 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_07500 74257 75576 gene locus_tag LOCUS_07510 gene aspS 74257 75576 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_07510 75585 76166 gene locus_tag LOCUS_07520 75585 76166 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_07520 76168 77157 gene locus_tag LOCUS_07530 76168 77157 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_07530 77184 78020 gene locus_tag LOCUS_07540 gene mutM 77184 78020 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393340.1 protein_id gnl|my_center|LOCUS_07540 78013 78783 gene locus_tag LOCUS_07550 78013 78783 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679291.1 protein_id gnl|my_center|LOCUS_07550 79839 78823 gene locus_tag LOCUS_07560 79839 78823 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941347.1 protein_id gnl|my_center|LOCUS_07560 80431 79844 gene locus_tag LOCUS_07570 80431 79844 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582483.1 protein_id gnl|my_center|LOCUS_07570 80765 81274 gene locus_tag LOCUS_07580 gene rpiB 80765 81274 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966164.1 protein_id gnl|my_center|LOCUS_07580 81369 82046 gene locus_tag LOCUS_07590 81369 82046 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670138.1 protein_id gnl|my_center|LOCUS_07590 83796 82159 gene locus_tag LOCUS_07600 83796 82159 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020870.1 protein_id gnl|my_center|LOCUS_07600 83859 84596 gene locus_tag LOCUS_07610 83859 84596 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_07610 85417 84605 gene locus_tag LOCUS_07620 85417 84605 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_07620 85511 86512 gene locus_tag LOCUS_07630 85511 86512 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766463.1 protein_id gnl|my_center|LOCUS_07630 86750 86822 gene locus_tag LOCUS_t00260 86750 86822 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 86867 86938 gene locus_tag LOCUS_t00270 86867 86938 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 87530 88105 gene locus_tag LOCUS_07640 87530 88105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 89467 88658 gene locus_tag LOCUS_07650 89467 88658 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082267.1 protein_id gnl|my_center|LOCUS_07650 89543 89749 gene locus_tag LOCUS_07660 gene copP 89543 89749 CDS product copper-binding metallochaperone CopP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000648265.1 protein_id gnl|my_center|LOCUS_07660 89750 92170 gene locus_tag LOCUS_07670 89750 92170 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_07670 >Feature sequence08 2985 1396 gene locus_tag LOCUS_07680 2985 1396 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113972.1 protein_id gnl|my_center|LOCUS_07680 3692 2982 gene locus_tag LOCUS_07690 gene fadR 3692 2982 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005162963.1 protein_id gnl|my_center|LOCUS_07690 3913 4608 gene locus_tag LOCUS_07700 3913 4608 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_07700 4691 4915 gene locus_tag LOCUS_07710 4691 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4930 6117 gene locus_tag LOCUS_07720 4930 6117 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393430.1 protein_id gnl|my_center|LOCUS_07720 8210 6408 gene locus_tag LOCUS_07730 8210 6408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 8834 8744 gene locus_tag LOCUS_t00280 8834 8744 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8940 8855 gene locus_tag LOCUS_t00290 8940 8855 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10939 9041 gene locus_tag LOCUS_07740 10939 9041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 11921 10944 gene locus_tag LOCUS_07750 11921 10944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 13505 11943 gene locus_tag LOCUS_07760 gene guaA 13505 11943 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393595.1 protein_id gnl|my_center|LOCUS_07760 14092 13520 gene locus_tag LOCUS_07770 gene xpt 14092 13520 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888255.1 protein_id gnl|my_center|LOCUS_07770 15036 14236 gene locus_tag LOCUS_07780 15036 14236 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_07780 15227 16411 gene locus_tag LOCUS_07790 15227 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 17997 16486 gene locus_tag LOCUS_07800 17997 16486 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257763.1 protein_id gnl|my_center|LOCUS_07800 18936 17998 gene locus_tag LOCUS_07810 18936 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 20869 18974 gene locus_tag LOCUS_07820 gene selB 20869 18974 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_07820 22067 20874 gene locus_tag LOCUS_07830 22067 20874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 23545 22127 gene locus_tag LOCUS_07840 23545 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 24144 23542 gene locus_tag LOCUS_07850 24144 23542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 25751 24141 gene locus_tag LOCUS_07860 25751 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 27188 25773 gene locus_tag LOCUS_07870 gene hydA 27188 25773 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140243.1 protein_id gnl|my_center|LOCUS_07870 27821 27246 gene locus_tag LOCUS_07880 27821 27246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 29293 27833 gene locus_tag LOCUS_07890 29293 27833 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_07890 30299 29307 gene locus_tag LOCUS_07900 30299 29307 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_07900 31536 30292 gene locus_tag LOCUS_07910 31536 30292 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_07910 32534 31587 gene locus_tag LOCUS_07920 gene arcC 32534 31587 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000240546.1 protein_id gnl|my_center|LOCUS_07920 33950 32565 gene locus_tag LOCUS_07930 33950 32565 CDS product 8-oxoguanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535402.1 protein_id gnl|my_center|LOCUS_07930 34858 33974 gene locus_tag LOCUS_07940 gene folD 34858 33974 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_07940 34916 35563 gene locus_tag LOCUS_07950 gene udk 34916 35563 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257573.1 protein_id gnl|my_center|LOCUS_07950 35538 36101 gene locus_tag LOCUS_07960 35538 36101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 36162 36887 gene locus_tag LOCUS_07970 gene rsmG 36162 36887 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258170.1 protein_id gnl|my_center|LOCUS_07970 36977 37882 gene locus_tag LOCUS_07980 36977 37882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 38210 38797 gene locus_tag LOCUS_07990 gene pth 38210 38797 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730530.1 protein_id gnl|my_center|LOCUS_07990 38781 42209 gene locus_tag LOCUS_08000 gene mfd 38781 42209 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258948.1 protein_id gnl|my_center|LOCUS_08000 42247 43638 gene locus_tag LOCUS_08010 42247 43638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 43635 44471 gene locus_tag LOCUS_08020 gene rsmA 43635 44471 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391600.1 protein_id gnl|my_center|LOCUS_08020 45004 44534 gene locus_tag LOCUS_08030 45004 44534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 45123 45608 gene locus_tag LOCUS_08040 gene mscL 45123 45608 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08040 45648 46493 gene locus_tag LOCUS_08050 45648 46493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 46490 47269 gene locus_tag LOCUS_08060 46490 47269 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000614999.1 protein_id gnl|my_center|LOCUS_08060 47283 48569 gene locus_tag LOCUS_08070 47283 48569 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258527.1 protein_id gnl|my_center|LOCUS_08070 49221 48580 gene locus_tag LOCUS_08080 49221 48580 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_08080 49591 49229 gene locus_tag LOCUS_08090 49591 49229 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393656.1 protein_id gnl|my_center|LOCUS_08090 50877 49588 gene locus_tag LOCUS_08100 50877 49588 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164937423.1 protein_id gnl|my_center|LOCUS_08100 52165 50870 gene locus_tag LOCUS_08110 52165 50870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 52695 52213 gene locus_tag LOCUS_08120 52695 52213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 53821 52721 gene locus_tag LOCUS_08130 53821 52721 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480024.1 protein_id gnl|my_center|LOCUS_08130 55186 53876 gene locus_tag LOCUS_08140 gene rpsA 55186 53876 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258334.1 protein_id gnl|my_center|LOCUS_08140 57468 55342 gene locus_tag LOCUS_08150 57468 55342 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257113.1 protein_id gnl|my_center|LOCUS_08150 57506 57802 gene locus_tag LOCUS_08160 57506 57802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 58040 59311 gene locus_tag LOCUS_08170 gene rho 58040 59311 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256183.1 protein_id gnl|my_center|LOCUS_08170 59339 60433 gene locus_tag LOCUS_08180 59339 60433 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680821.1 protein_id gnl|my_center|LOCUS_08180 60450 60523 gene locus_tag LOCUS_t00300 60450 60523 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 60633 60809 gene locus_tag LOCUS_08190 60633 60809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 61148 60738 gene locus_tag LOCUS_08200 61148 60738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 62312 61281 gene locus_tag LOCUS_08210 62312 61281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 62950 62534 gene locus_tag LOCUS_08220 62950 62534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 63062 63772 gene locus_tag LOCUS_08230 63062 63772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 63946 64779 gene locus_tag LOCUS_08240 63946 64779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 64797 65870 gene locus_tag LOCUS_08250 64797 65870 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971182.1 protein_id gnl|my_center|LOCUS_08250 65872 66561 gene locus_tag LOCUS_08260 65872 66561 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_08260 67853 66558 gene locus_tag LOCUS_08270 gene miaB 67853 66558 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258276.1 protein_id gnl|my_center|LOCUS_08270 67981 68310 gene locus_tag LOCUS_08280 67981 68310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 70389 68362 gene locus_tag LOCUS_08290 70389 68362 CDS product immune inhibitor A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257484.1 protein_id gnl|my_center|LOCUS_08290 70854 70480 gene locus_tag LOCUS_08300 70854 70480 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837198.1 protein_id gnl|my_center|LOCUS_08300 71322 70858 gene locus_tag LOCUS_08310 71322 70858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 71426 72712 gene locus_tag LOCUS_08320 71426 72712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 72885 73511 gene locus_tag LOCUS_08330 72885 73511 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_08330 73502 74278 gene locus_tag LOCUS_08340 73502 74278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 74952 74275 gene locus_tag LOCUS_08350 74952 74275 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729623.1 protein_id gnl|my_center|LOCUS_08350 75119 75742 gene locus_tag LOCUS_08360 75119 75742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 77252 75801 gene locus_tag LOCUS_08370 77252 75801 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034349591.1 protein_id gnl|my_center|LOCUS_08370 77390 77485 gene locus_tag LOCUS_t00310 77390 77485 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 77696 78946 gene locus_tag LOCUS_08380 77696 78946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 78936 79379 gene locus_tag LOCUS_08390 gene rnhA 78936 79379 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087954.1 protein_id gnl|my_center|LOCUS_08390 79491 80936 gene locus_tag LOCUS_08400 79491 80936 CDS product bifunctional class I SAM-dependent methyltransferase/glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929103.1 protein_id gnl|my_center|LOCUS_08400 82937 80937 gene locus_tag LOCUS_08410 82937 80937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 >Feature sequence09 2645 1968 gene locus_tag LOCUS_08420 gene hypB 2645 1968 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545559.1 protein_id gnl|my_center|LOCUS_08420 2994 2629 gene locus_tag LOCUS_08430 gene hypA 2994 2629 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941042.1 protein_id gnl|my_center|LOCUS_08430 3802 3035 gene locus_tag LOCUS_08440 gene fdhD 3802 3035 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546799.1 protein_id gnl|my_center|LOCUS_08440 3912 4538 gene locus_tag LOCUS_08450 3912 4538 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_08450 7343 4581 gene locus_tag LOCUS_08460 gene fdhF 7343 4581 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 protein_id gnl|my_center|LOCUS_08460 8235 7396 gene locus_tag LOCUS_08470 gene focA 8235 7396 CDS product formate transporter FocA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263633.1 protein_id gnl|my_center|LOCUS_08470 9883 8264 gene locus_tag LOCUS_08480 gene nuoF 9883 8264 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082918.1 protein_id gnl|my_center|LOCUS_08480 10372 9893 gene locus_tag LOCUS_08490 gene nuoE 10372 9893 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_08490 12183 10399 gene locus_tag LOCUS_08500 gene nuoF 12183 10399 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583284.1 protein_id gnl|my_center|LOCUS_08500 12603 12235 gene locus_tag LOCUS_08510 12603 12235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082448.1 protein_id gnl|my_center|LOCUS_08510 13159 12614 gene locus_tag LOCUS_08520 13159 12614 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869297.1 protein_id gnl|my_center|LOCUS_08520 13674 13156 gene locus_tag LOCUS_08530 gene nuoE 13674 13156 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766748.1 protein_id gnl|my_center|LOCUS_08530 14513 13797 gene locus_tag LOCUS_08540 14513 13797 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_08540 14874 14524 gene locus_tag LOCUS_08550 14874 14524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 15847 14888 gene locus_tag LOCUS_08560 15847 14888 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583276.1 protein_id gnl|my_center|LOCUS_08560 16230 15856 gene locus_tag LOCUS_08570 16230 15856 CDS product DRTGG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869442.1 protein_id gnl|my_center|LOCUS_08570 16321 17604 gene locus_tag LOCUS_08580 gene hisS 16321 17604 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000431277.1 protein_id gnl|my_center|LOCUS_08580 17624 17696 gene locus_tag LOCUS_t00320 17624 17696 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 18152 21301 gene locus_tag LOCUS_08590 gene ileS 18152 21301 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228416.1 protein_id gnl|my_center|LOCUS_08590 21317 21841 gene locus_tag LOCUS_08600 gene lspA 21317 21841 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392387.1 protein_id gnl|my_center|LOCUS_08600 21855 22781 gene locus_tag LOCUS_08610 21855 22781 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256790.1 protein_id gnl|my_center|LOCUS_08610 22784 23830 gene locus_tag LOCUS_08620 gene ltaE 22784 23830 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705678.1 protein_id gnl|my_center|LOCUS_08620 24106 26028 gene locus_tag LOCUS_08630 24106 26028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 26117 27487 gene locus_tag LOCUS_08640 26117 27487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 27754 27509 gene locus_tag LOCUS_08650 27754 27509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 28878 27889 gene locus_tag LOCUS_08660 28878 27889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 29707 28889 gene locus_tag LOCUS_08670 29707 28889 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939671.1 protein_id gnl|my_center|LOCUS_08670 30767 29742 gene locus_tag LOCUS_08680 30767 29742 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_08680 31732 30764 gene locus_tag LOCUS_08690 31732 30764 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940765.1 protein_id gnl|my_center|LOCUS_08690 32168 31725 gene locus_tag LOCUS_08700 32168 31725 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940766.1 protein_id gnl|my_center|LOCUS_08700 32650 32168 gene locus_tag LOCUS_08710 32650 32168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 34632 32746 gene locus_tag LOCUS_08720 34632 32746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 35262 34648 gene locus_tag LOCUS_08730 35262 34648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08730 35771 35259 gene locus_tag LOCUS_08740 35771 35259 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366911.1 protein_id gnl|my_center|LOCUS_08740 37666 35780 gene locus_tag LOCUS_08750 37666 35780 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249027.1 protein_id gnl|my_center|LOCUS_08750 40736 38019 gene locus_tag LOCUS_08760 40736 38019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 46072 40733 gene locus_tag LOCUS_08770 46072 40733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 46432 46100 gene locus_tag LOCUS_08780 46432 46100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 47679 46495 gene locus_tag LOCUS_08790 47679 46495 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_08790 49617 47686 gene locus_tag LOCUS_08800 49617 47686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 51033 49621 gene locus_tag LOCUS_08810 51033 49621 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_08810 51256 52431 gene locus_tag LOCUS_08820 51256 52431 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392408.1 protein_id gnl|my_center|LOCUS_08820 52438 53775 gene locus_tag LOCUS_08830 gene hflX 52438 53775 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256344.1 protein_id gnl|my_center|LOCUS_08830 54005 53820 gene locus_tag LOCUS_08840 gene rpmF 54005 53820 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719763.1 protein_id gnl|my_center|LOCUS_08840 54631 54233 gene locus_tag LOCUS_08850 54631 54233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 55737 54667 gene locus_tag LOCUS_08860 55737 54667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 56360 55875 gene locus_tag LOCUS_08870 56360 55875 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097923.1 protein_id gnl|my_center|LOCUS_08870 57285 56377 gene locus_tag LOCUS_08880 57285 56377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 59215 57347 gene locus_tag LOCUS_08890 59215 57347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 61477 59492 gene locus_tag LOCUS_08900 61477 59492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 62710 61487 gene locus_tag LOCUS_08910 62710 61487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 64255 62822 gene locus_tag LOCUS_08920 64255 62822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 69747 64453 gene locus_tag LOCUS_08930 69747 64453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 <71268 69885 gene locus_tag LOCUS_08940 <71268 69885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027999870.1:tandem-95 repeat protein >Feature sequence10 64 645 gene locus_tag LOCUS_08950 64 645 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966613.1 protein_id gnl|my_center|LOCUS_08950 793 1122 gene locus_tag LOCUS_08960 793 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 1095 1301 gene locus_tag LOCUS_08970 1095 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1298 2020 gene locus_tag LOCUS_08980 1298 2020 CDS product EFR1 family ferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795042.1 protein_id gnl|my_center|LOCUS_08980 2178 2390 gene locus_tag LOCUS_08990 2178 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435950.1 protein_id gnl|my_center|LOCUS_08990 3179 2568 gene locus_tag LOCUS_09000 3179 2568 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_09000 4104 3223 gene locus_tag LOCUS_09010 4104 3223 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_09010 4358 4783 gene locus_tag LOCUS_09020 4358 4783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 5706 4942 gene locus_tag LOCUS_09030 gene heR 5706 4942 CDS product heliorhodopsin HeR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013296133.1 protein_id gnl|my_center|LOCUS_09030 6010 7092 gene locus_tag LOCUS_09040 6010 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 7125 8990 gene locus_tag LOCUS_09050 7125 8990 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926897.1 protein_id gnl|my_center|LOCUS_09050 9993 9163 gene locus_tag LOCUS_09060 9993 9163 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256114.1 protein_id gnl|my_center|LOCUS_09060 10458 10033 gene locus_tag LOCUS_09070 10458 10033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 11566 10532 gene locus_tag LOCUS_09080 11566 10532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 12615 11566 gene locus_tag LOCUS_09090 12615 11566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 13472 12612 gene locus_tag LOCUS_09100 13472 12612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 13601 14182 gene locus_tag LOCUS_09110 13601 14182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 14848 14216 gene locus_tag LOCUS_09120 14848 14216 CDS product DUF4013 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023211.1 protein_id gnl|my_center|LOCUS_09120 15183 14917 gene locus_tag LOCUS_09130 15183 14917 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_09130 15521 15186 gene locus_tag LOCUS_09140 15521 15186 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631989.1 protein_id gnl|my_center|LOCUS_09140 16036 15590 gene locus_tag LOCUS_09150 16036 15590 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530173.1 protein_id gnl|my_center|LOCUS_09150 16614 16033 gene locus_tag LOCUS_09160 gene yjjX 16614 16033 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_09160 17185 16631 gene locus_tag LOCUS_09170 gene dcd 17185 16631 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192666.1 protein_id gnl|my_center|LOCUS_09170 18802 17258 gene locus_tag LOCUS_09180 18802 17258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 19040 19420 gene locus_tag LOCUS_09190 19040 19420 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_09190 19439 19816 gene locus_tag LOCUS_09200 19439 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256894.1 protein_id gnl|my_center|LOCUS_09200 19968 20732 gene locus_tag LOCUS_09210 gene trmD 19968 20732 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000687330.1 protein_id gnl|my_center|LOCUS_09210 20743 22038 gene locus_tag LOCUS_09220 20743 22038 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867389.1 protein_id gnl|my_center|LOCUS_09220 22128 23162 gene locus_tag LOCUS_09230 22128 23162 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_09230 23271 24830 gene locus_tag LOCUS_09240 23271 24830 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_09240 24842 26119 gene locus_tag LOCUS_09250 24842 26119 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256434.1 protein_id gnl|my_center|LOCUS_09250 26119 27396 gene locus_tag LOCUS_09260 26119 27396 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259763.1 protein_id gnl|my_center|LOCUS_09260 27756 28673 gene locus_tag LOCUS_09270 27756 28673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024245.1 protein_id gnl|my_center|LOCUS_09270 28657 29865 gene locus_tag LOCUS_09280 28657 29865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_09280 29862 31100 gene locus_tag LOCUS_09290 29862 31100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990698.1 protein_id gnl|my_center|LOCUS_09290 31237 32334 gene locus_tag LOCUS_09300 31237 32334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 32331 32546 gene locus_tag LOCUS_09310 32331 32546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 32645 32887 gene locus_tag LOCUS_09320 32645 32887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 32939 34324 gene locus_tag LOCUS_09330 gene noeA 32939 34324 CDS product nodulation protein NoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967406.1 protein_id gnl|my_center|LOCUS_09330 34386 35966 gene locus_tag LOCUS_09340 34386 35966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 36168 36785 gene locus_tag LOCUS_09350 36168 36785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 36810 37862 gene locus_tag LOCUS_09360 gene queG 36810 37862 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397385.1 protein_id gnl|my_center|LOCUS_09360 37986 39005 gene locus_tag LOCUS_09370 gene dusB 37986 39005 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619224.1 protein_id gnl|my_center|LOCUS_09370 39053 40369 gene locus_tag LOCUS_09380 39053 40369 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964893.1 protein_id gnl|my_center|LOCUS_09380 40494 41555 gene locus_tag LOCUS_09390 40494 41555 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090946.1 protein_id gnl|my_center|LOCUS_09390 43948 41711 gene locus_tag LOCUS_09400 gene pnp 43948 41711 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257913.1 protein_id gnl|my_center|LOCUS_09400 44417 44145 gene locus_tag LOCUS_09410 gene rpsO 44417 44145 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852579.1 protein_id gnl|my_center|LOCUS_09410 45202 44717 gene locus_tag LOCUS_09420 45202 44717 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948533.1 protein_id gnl|my_center|LOCUS_09420 45409 47901 gene locus_tag LOCUS_09430 45409 47901 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_09430 48930 47953 gene locus_tag LOCUS_09440 48930 47953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 50027 49398 gene locus_tag LOCUS_09450 50027 49398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 50130 50669 gene locus_tag LOCUS_09460 50130 50669 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071067.1 protein_id gnl|my_center|LOCUS_09460 50874 52256 gene locus_tag LOCUS_09470 50874 52256 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_09470 52261 52965 gene locus_tag LOCUS_09480 52261 52965 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_09480 52962 54194 gene locus_tag LOCUS_09490 52962 54194 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257055.1 protein_id gnl|my_center|LOCUS_09490 55746 54553 gene locus_tag LOCUS_09500 55746 54553 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_09500 57853 55925 gene locus_tag LOCUS_09510 57853 55925 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705499.1 protein_id gnl|my_center|LOCUS_09510 59293 57866 gene locus_tag LOCUS_09520 59293 57866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 59873 61303 gene locus_tag LOCUS_09530 59873 61303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 61979 62281 gene locus_tag LOCUS_09540 61979 62281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 62278 63345 gene locus_tag LOCUS_09550 62278 63345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 63342 63929 gene locus_tag LOCUS_09560 63342 63929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 63945 64898 gene locus_tag LOCUS_09570 63945 64898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 64905 65684 gene locus_tag LOCUS_09580 64905 65684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 65700 65900 gene locus_tag LOCUS_09590 65700 65900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 66227 66556 gene locus_tag LOCUS_09600 66227 66556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 67904 67560 gene locus_tag LOCUS_09610 67904 67560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 68842 68006 gene locus_tag LOCUS_09620 68842 68006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence11 4394 3777 gene locus_tag LOCUS_09630 4394 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 6534 5323 gene locus_tag LOCUS_09640 6534 5323 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_09640 7524 6628 gene locus_tag LOCUS_09650 7524 6628 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_09650 7927 10035 gene locus_tag LOCUS_09660 7927 10035 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259750.1 protein_id gnl|my_center|LOCUS_09660 10127 10906 gene locus_tag LOCUS_09670 10127 10906 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230236.1 protein_id gnl|my_center|LOCUS_09670 10922 11935 gene locus_tag LOCUS_09680 10922 11935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 12910 11936 gene locus_tag LOCUS_09690 gene hemW 12910 11936 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_09690 13390 14352 gene locus_tag LOCUS_09700 13390 14352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 15310 14366 gene locus_tag LOCUS_09710 gene trxB 15310 14366 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_09710 16659 15307 gene locus_tag LOCUS_09720 16659 15307 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029123.1 protein_id gnl|my_center|LOCUS_09720 16758 18134 gene locus_tag LOCUS_09730 16758 18134 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257952.1 protein_id gnl|my_center|LOCUS_09730 18154 19044 gene locus_tag LOCUS_09740 18154 19044 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393875.1 protein_id gnl|my_center|LOCUS_09740 19041 19631 gene locus_tag LOCUS_09750 19041 19631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 19685 20137 gene locus_tag LOCUS_09760 19685 20137 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392728.1 protein_id gnl|my_center|LOCUS_09760 20140 22260 gene locus_tag LOCUS_09770 20140 22260 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_09770 22285 22746 gene locus_tag LOCUS_09780 22285 22746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 22739 23560 gene locus_tag LOCUS_09790 22739 23560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 23622 24548 gene locus_tag LOCUS_09800 gene argF 23622 24548 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_09800 24550 25752 gene locus_tag LOCUS_09810 gene rocD 24550 25752 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398015.1 protein_id gnl|my_center|LOCUS_09810 25766 27208 gene locus_tag LOCUS_09820 gene pyk 25766 27208 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143313.1 protein_id gnl|my_center|LOCUS_09820 27588 28583 gene locus_tag LOCUS_09830 27588 28583 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010774220.1 protein_id gnl|my_center|LOCUS_09830 29761 28718 gene locus_tag LOCUS_09840 29761 28718 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256159.1 protein_id gnl|my_center|LOCUS_09840 31586 29754 gene locus_tag LOCUS_09850 31586 29754 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256158.1 protein_id gnl|my_center|LOCUS_09850 32289 31612 gene locus_tag LOCUS_09860 32289 31612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 32598 34352 gene locus_tag LOCUS_09870 32598 34352 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_09870 34356 36161 gene locus_tag LOCUS_09880 34356 36161 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257644.1 protein_id gnl|my_center|LOCUS_09880 36416 36799 gene locus_tag LOCUS_09890 gene gcvH 36416 36799 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005069578.1 protein_id gnl|my_center|LOCUS_09890 36805 38160 gene locus_tag LOCUS_09900 gene gcvPA 36805 38160 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_09900 38153 39607 gene locus_tag LOCUS_09910 gene gcvPB 38153 39607 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_09910 40412 39651 gene locus_tag LOCUS_09920 gene xth 40412 39651 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875851.1 protein_id gnl|my_center|LOCUS_09920 40545 41888 gene locus_tag LOCUS_09930 40545 41888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 41998 41914 gene locus_tag LOCUS_t00330 41998 41914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42061 43074 gene locus_tag LOCUS_09940 gene plsX 42061 43074 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173767.1 protein_id gnl|my_center|LOCUS_09940 43071 43790 gene locus_tag LOCUS_09950 43071 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 44538 43795 gene locus_tag LOCUS_09960 44538 43795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 45128 44538 gene locus_tag LOCUS_09970 gene scpB 45128 44538 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259764.1 protein_id gnl|my_center|LOCUS_09970 45205 46161 gene locus_tag LOCUS_09980 45205 46161 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_09980 46158 46640 gene locus_tag LOCUS_09990 46158 46640 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964330.1 protein_id gnl|my_center|LOCUS_09990 46647 47228 gene locus_tag LOCUS_10000 gene rsmD 46647 47228 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986836.1 protein_id gnl|my_center|LOCUS_10000 47707 47201 gene locus_tag LOCUS_10010 47707 47201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 48947 47775 gene locus_tag LOCUS_10020 48947 47775 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931942.1 protein_id gnl|my_center|LOCUS_10020 50207 48978 gene locus_tag LOCUS_10030 50207 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 50443 51645 gene locus_tag LOCUS_10040 gene rpoD 50443 51645 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054935954.1 protein_id gnl|my_center|LOCUS_10040 51701 52573 gene locus_tag LOCUS_10050 51701 52573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 52575 53024 gene locus_tag LOCUS_10060 gene ndk 52575 53024 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723912.1 protein_id gnl|my_center|LOCUS_10060 53021 53758 gene locus_tag LOCUS_10070 53021 53758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 53810 56359 gene locus_tag LOCUS_10080 53810 56359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 59329 56486 gene locus_tag LOCUS_10090 gene ppdK 59329 56486 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_10090 60219 59680 gene locus_tag LOCUS_10100 60219 59680 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_10100 60988 60227 gene locus_tag LOCUS_10110 60988 60227 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_10110 62490 60985 gene locus_tag LOCUS_10120 62490 60985 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258188.1 protein_id gnl|my_center|LOCUS_10120 63031 62474 gene locus_tag LOCUS_10130 gene hpt 63031 62474 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007452004.1 protein_id gnl|my_center|LOCUS_10130 63614 63042 gene locus_tag LOCUS_10140 63614 63042 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405033.1 protein_id gnl|my_center|LOCUS_10140 64167 63688 gene locus_tag LOCUS_10150 64167 63688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 64451 64191 gene locus_tag LOCUS_10160 gene rpmA 64451 64191 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943850.1 protein_id gnl|my_center|LOCUS_10160 64775 64458 gene locus_tag LOCUS_10170 gene rplU 64775 64458 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460896.1 protein_id gnl|my_center|LOCUS_10170 65107 65179 gene locus_tag LOCUS_t00340 65107 65179 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence12 1976 24 gene locus_tag LOCUS_10180 1976 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3019 2015 gene locus_tag LOCUS_10190 3019 2015 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_10190 6756 3157 gene locus_tag LOCUS_10200 gene nifJ 6756 3157 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_10200 7545 6967 gene locus_tag LOCUS_10210 7545 6967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 8508 7567 gene locus_tag LOCUS_10220 8508 7567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9239 8583 gene locus_tag LOCUS_10230 9239 8583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 9551 9354 gene locus_tag LOCUS_10240 9551 9354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10540 12642 gene locus_tag LOCUS_10250 gene uvrB 10540 12642 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256952.1 protein_id gnl|my_center|LOCUS_10250 12945 12646 gene locus_tag LOCUS_10260 12945 12646 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_10260 14111 12972 gene locus_tag LOCUS_10270 14111 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 15201 14125 gene locus_tag LOCUS_10280 gene rseP 15201 14125 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938164.1 protein_id gnl|my_center|LOCUS_10280 15335 18130 gene locus_tag LOCUS_10290 15335 18130 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257493.1 protein_id gnl|my_center|LOCUS_10290 18346 19971 gene locus_tag LOCUS_10300 18346 19971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 20058 20891 gene locus_tag LOCUS_10310 20058 20891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 21079 23952 gene locus_tag LOCUS_10320 21079 23952 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262972.1 protein_id gnl|my_center|LOCUS_10320 23949 24596 gene locus_tag LOCUS_10330 23949 24596 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973145.1 protein_id gnl|my_center|LOCUS_10330 24617 25285 gene locus_tag LOCUS_10340 24617 25285 CDS product NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774859.1 protein_id gnl|my_center|LOCUS_10340 25408 26835 gene locus_tag LOCUS_10350 gene gltX 25408 26835 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356788.1 protein_id gnl|my_center|LOCUS_10350 26913 29060 gene locus_tag LOCUS_10360 26913 29060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 29094 30128 gene locus_tag LOCUS_10370 29094 30128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 30200 31135 gene locus_tag LOCUS_10380 30200 31135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 31171 32130 gene locus_tag LOCUS_10390 31171 32130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 33365 32139 gene locus_tag LOCUS_10400 gene tilS 33365 32139 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342513.1 protein_id gnl|my_center|LOCUS_10400 33408 33545 gene locus_tag LOCUS_10410 33408 33545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 33648 34712 gene locus_tag LOCUS_10420 33648 34712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 34787 35674 gene locus_tag LOCUS_10430 gene cdaA 34787 35674 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003131542.1 protein_id gnl|my_center|LOCUS_10430 35671 36894 gene locus_tag LOCUS_10440 35671 36894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 36933 38312 gene locus_tag LOCUS_10450 gene der 36933 38312 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258958.1 protein_id gnl|my_center|LOCUS_10450 38365 38961 gene locus_tag LOCUS_10460 gene lepB 38365 38961 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_10460 39084 39329 gene locus_tag LOCUS_10470 39084 39329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 39494 40570 gene locus_tag LOCUS_10480 39494 40570 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393965.1 protein_id gnl|my_center|LOCUS_10480 40587 41987 gene locus_tag LOCUS_10490 gene cysS 40587 41987 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257711.1 protein_id gnl|my_center|LOCUS_10490 41991 42728 gene locus_tag LOCUS_10500 gene rlmB 41991 42728 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257938.1 protein_id gnl|my_center|LOCUS_10500 43146 42838 gene locus_tag LOCUS_10510 43146 42838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 43684 43151 gene locus_tag LOCUS_10520 43684 43151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 44952 43681 gene locus_tag LOCUS_10530 gene serS 44952 43681 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256350.1 protein_id gnl|my_center|LOCUS_10530 45156 45692 gene locus_tag LOCUS_10540 45156 45692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 46156 47154 gene locus_tag LOCUS_10550 46156 47154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 47243 48277 gene locus_tag LOCUS_10560 47243 48277 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804410.1 protein_id gnl|my_center|LOCUS_10560 48426 49037 gene locus_tag LOCUS_10570 48426 49037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 49052 49843 gene locus_tag LOCUS_10580 49052 49843 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_10580 49840 51054 gene locus_tag LOCUS_10590 49840 51054 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762511.1 protein_id gnl|my_center|LOCUS_10590 51824 51084 gene locus_tag LOCUS_10600 51824 51084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 52753 51839 gene locus_tag LOCUS_10610 52753 51839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 53693 52788 gene locus_tag LOCUS_10620 53693 52788 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_10620 55507 53873 gene locus_tag LOCUS_10630 gene groL 55507 53873 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258594.1 protein_id gnl|my_center|LOCUS_10630 55826 55533 gene locus_tag LOCUS_10640 gene groES 55826 55533 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917306.1 protein_id gnl|my_center|LOCUS_10640 57283 55967 gene locus_tag LOCUS_10650 57283 55967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 58602 57286 gene locus_tag LOCUS_10660 58602 57286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 58798 59235 gene locus_tag LOCUS_10670 58798 59235 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081451.1 protein_id gnl|my_center|LOCUS_10670 59953 59336 gene locus_tag LOCUS_10680 59953 59336 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440414.1 protein_id gnl|my_center|LOCUS_10680 60305 61384 gene locus_tag LOCUS_10690 60305 61384 CDS product YbhN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022231.1 protein_id gnl|my_center|LOCUS_10690 61493 62329 gene locus_tag LOCUS_10700 gene proC 61493 62329 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_10700 62838 65753 gene locus_tag LOCUS_10710 gene uvrA 62838 65753 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence13 66 139 gene locus_tag LOCUS_t00350 66 139 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 697 1782 gene locus_tag LOCUS_10720 697 1782 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776144.1 protein_id gnl|my_center|LOCUS_10720 1967 3064 gene locus_tag LOCUS_10730 1967 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 4801 3080 gene locus_tag LOCUS_10740 gene recJ 4801 3080 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257020.1 protein_id gnl|my_center|LOCUS_10740 4936 5904 gene locus_tag LOCUS_10750 4936 5904 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975675.1 protein_id gnl|my_center|LOCUS_10750 6868 5990 gene locus_tag LOCUS_10760 6868 5990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 8086 7124 gene locus_tag LOCUS_10770 8086 7124 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815232.1 protein_id gnl|my_center|LOCUS_10770 9189 8083 gene locus_tag LOCUS_10780 9189 8083 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393885.1 protein_id gnl|my_center|LOCUS_10780 10189 9176 gene locus_tag LOCUS_10790 10189 9176 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_10790 11614 10196 gene locus_tag LOCUS_10800 11614 10196 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963376.1 protein_id gnl|my_center|LOCUS_10800 12629 11616 gene locus_tag LOCUS_10810 12629 11616 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000096185.1 protein_id gnl|my_center|LOCUS_10810 13071 12670 gene locus_tag LOCUS_10820 13071 12670 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939916.1 protein_id gnl|my_center|LOCUS_10820 13481 13164 gene locus_tag LOCUS_10830 13481 13164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 13713 14177 gene locus_tag LOCUS_10840 gene greA 13713 14177 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475971.1 protein_id gnl|my_center|LOCUS_10840 14245 15771 gene locus_tag LOCUS_10850 gene lysS 14245 15771 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809769.1 protein_id gnl|my_center|LOCUS_10850 15846 16454 gene locus_tag LOCUS_10860 15846 16454 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_10860 16451 17347 gene locus_tag LOCUS_10870 16451 17347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 18638 17409 gene locus_tag LOCUS_10880 gene metK 18638 17409 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_10880 19132 20028 gene locus_tag LOCUS_10890 19132 20028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 20133 21122 gene locus_tag LOCUS_10900 20133 21122 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_10900 21122 22147 gene locus_tag LOCUS_10910 21122 22147 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_10910 22213 24273 gene locus_tag LOCUS_10920 22213 24273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 24412 25476 gene locus_tag LOCUS_10930 24412 25476 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081437.1 protein_id gnl|my_center|LOCUS_10930 25487 26530 gene locus_tag LOCUS_10940 25487 26530 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081440.1 protein_id gnl|my_center|LOCUS_10940 26614 27588 gene locus_tag LOCUS_10950 26614 27588 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058188.1 protein_id gnl|my_center|LOCUS_10950 28452 27637 gene locus_tag LOCUS_10960 28452 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 29383 28463 gene locus_tag LOCUS_10970 29383 28463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 30268 29396 gene locus_tag LOCUS_10980 30268 29396 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_10980 31053 30265 gene locus_tag LOCUS_10990 31053 30265 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_10990 31936 31064 gene locus_tag LOCUS_11000 31936 31064 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_11000 32298 31933 gene locus_tag LOCUS_11010 32298 31933 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082322.1 protein_id gnl|my_center|LOCUS_11010 32540 33055 gene locus_tag LOCUS_11020 32540 33055 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634034.1 protein_id gnl|my_center|LOCUS_11020 34360 33134 gene locus_tag LOCUS_11030 gene pepT 34360 33134 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948200.1 protein_id gnl|my_center|LOCUS_11030 34507 35343 gene locus_tag LOCUS_11040 34507 35343 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_11040 36370 35348 gene locus_tag LOCUS_11050 36370 35348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 37210 36377 gene locus_tag LOCUS_11060 37210 36377 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118674.1 protein_id gnl|my_center|LOCUS_11060 37841 37377 gene locus_tag LOCUS_11070 37841 37377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 38153 39793 gene locus_tag LOCUS_11080 38153 39793 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_11080 39990 40805 gene locus_tag LOCUS_11090 39990 40805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 41136 40825 gene locus_tag LOCUS_11100 41136 40825 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896874.1 protein_id gnl|my_center|LOCUS_11100 41277 42257 gene locus_tag LOCUS_11110 41277 42257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 42266 43129 gene locus_tag LOCUS_11120 gene folP 42266 43129 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025985130.1 protein_id gnl|my_center|LOCUS_11120 44375 43137 gene locus_tag LOCUS_11130 44375 43137 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_11130 45760 44405 gene locus_tag LOCUS_11140 45760 44405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 47835 45937 gene locus_tag LOCUS_11150 gene dnaK 47835 45937 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258113.1 protein_id gnl|my_center|LOCUS_11150 48201 47941 gene locus_tag LOCUS_11160 48201 47941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 48324 48536 gene locus_tag LOCUS_11170 48324 48536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 50398 48560 gene locus_tag LOCUS_11180 50398 48560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 51673 50420 gene locus_tag LOCUS_11190 51673 50420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 52622 51816 gene locus_tag LOCUS_11200 52622 51816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 53329 52790 gene locus_tag LOCUS_11210 53329 52790 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869337.1 protein_id gnl|my_center|LOCUS_11210 54116 53331 gene locus_tag LOCUS_11220 54116 53331 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420710.1 protein_id gnl|my_center|LOCUS_11220 55242 54118 gene locus_tag LOCUS_11230 55242 54118 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869339.1 protein_id gnl|my_center|LOCUS_11230 55495 55232 gene locus_tag LOCUS_11240 55495 55232 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_11240 55664 56872 gene locus_tag LOCUS_11250 55664 56872 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228352.1 protein_id gnl|my_center|LOCUS_11250 57793 56879 gene locus_tag LOCUS_11260 57793 56879 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256264.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence14 848 444 gene locus_tag LOCUS_11270 848 444 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_11270 1003 1614 gene locus_tag LOCUS_11280 1003 1614 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805063.1 protein_id gnl|my_center|LOCUS_11280 1614 1964 gene locus_tag LOCUS_11290 1614 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 2122 2283 gene locus_tag LOCUS_11300 2122 2283 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_11300 2399 3508 gene locus_tag LOCUS_11310 2399 3508 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259287.1 protein_id gnl|my_center|LOCUS_11310 4238 3567 gene locus_tag LOCUS_11320 4238 3567 CDS product TIGR01906 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881332.1 protein_id gnl|my_center|LOCUS_11320 5824 4235 gene locus_tag LOCUS_11330 5824 4235 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_11330 5988 5916 gene locus_tag LOCUS_t00360 5988 5916 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7160 6045 gene locus_tag LOCUS_11340 gene rodA 7160 6045 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392081.1 protein_id gnl|my_center|LOCUS_11340 7837 7166 gene locus_tag LOCUS_11350 7837 7166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 9925 7850 gene locus_tag LOCUS_11360 gene mrdA 9925 7850 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649850.1 protein_id gnl|my_center|LOCUS_11360 10425 9922 gene locus_tag LOCUS_11370 10425 9922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 11297 10434 gene locus_tag LOCUS_11380 11297 10434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 12386 11310 gene locus_tag LOCUS_11390 12386 11310 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_11390 12704 13405 gene locus_tag LOCUS_11400 12704 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 13676 13413 gene locus_tag LOCUS_11410 13676 13413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 14431 13682 gene locus_tag LOCUS_11420 14431 13682 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_11420 15215 14421 gene locus_tag LOCUS_11430 gene pgeF 15215 14421 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940760.1 protein_id gnl|my_center|LOCUS_11430 16237 15212 gene locus_tag LOCUS_11440 16237 15212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 17366 16290 gene locus_tag LOCUS_11450 17366 16290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 17873 17424 gene locus_tag LOCUS_11460 gene smpB 17873 17424 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_11460 18603 17971 gene locus_tag LOCUS_11470 18603 17971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 18668 19255 gene locus_tag LOCUS_11480 18668 19255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 19370 20215 gene locus_tag LOCUS_11490 19370 20215 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976234.1 protein_id gnl|my_center|LOCUS_11490 20655 20347 gene locus_tag LOCUS_11500 20655 20347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 20723 21415 gene locus_tag LOCUS_11510 20723 21415 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680560.1 protein_id gnl|my_center|LOCUS_11510 22116 21412 gene locus_tag LOCUS_11520 gene radC 22116 21412 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259440.1 protein_id gnl|my_center|LOCUS_11520 22186 22605 gene locus_tag LOCUS_11530 22186 22605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 22602 26429 gene locus_tag LOCUS_11540 22602 26429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 28148 26415 gene locus_tag LOCUS_11550 28148 26415 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259439.1 protein_id gnl|my_center|LOCUS_11550 28331 29179 gene locus_tag LOCUS_11560 28331 29179 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256060.1 protein_id gnl|my_center|LOCUS_11560 29189 29980 gene locus_tag LOCUS_11570 29189 29980 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393993.1 protein_id gnl|my_center|LOCUS_11570 29985 30854 gene locus_tag LOCUS_11580 29985 30854 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_11580 30847 32439 gene locus_tag LOCUS_11590 30847 32439 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_11590 32500 33351 gene locus_tag LOCUS_11600 32500 33351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 33420 34085 gene locus_tag LOCUS_11610 33420 34085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 34890 34171 gene locus_tag LOCUS_11620 34890 34171 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_11620 35436 34909 gene locus_tag LOCUS_11630 35436 34909 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_11630 37059 35440 gene locus_tag LOCUS_11640 37059 35440 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_11640 37425 37201 gene locus_tag LOCUS_11650 37425 37201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 37596 38660 gene locus_tag LOCUS_11660 37596 38660 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_11660 38799 39560 gene locus_tag LOCUS_11670 38799 39560 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257858.1 protein_id gnl|my_center|LOCUS_11670 39557 39988 gene locus_tag LOCUS_11680 39557 39988 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257857.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11680 40007 40888 gene locus_tag LOCUS_11690 gene mtnP 40007 40888 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_11690 40948 43497 gene locus_tag LOCUS_11700 40948 43497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 44716 43502 gene locus_tag LOCUS_11710 gene tyrS 44716 43502 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081488.1 protein_id gnl|my_center|LOCUS_11710 45911 44874 gene locus_tag LOCUS_11720 gene lgt 45911 44874 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257228.1 protein_id gnl|my_center|LOCUS_11720 46550 45930 gene locus_tag LOCUS_11730 46550 45930 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_11730 48872 46569 gene locus_tag LOCUS_11740 48872 46569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 50883 48934 gene locus_tag LOCUS_11750 50883 48934 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_11750 51451 50912 gene locus_tag LOCUS_11760 51451 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 52164 51466 gene locus_tag LOCUS_11770 52164 51466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 53053 52217 gene locus_tag LOCUS_11780 53053 52217 CDS product purine nucleoside phosphorylase I, inosine and guanosine-specific inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230447.1 protein_id gnl|my_center|LOCUS_11780 53673 53461 gene locus_tag LOCUS_11790 53673 53461 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078819.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence15 153 959 gene locus_tag LOCUS_11800 153 959 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256708.1 protein_id gnl|my_center|LOCUS_11800 977 1951 gene locus_tag LOCUS_11810 977 1951 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_11810 1929 2711 gene locus_tag LOCUS_11820 1929 2711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064578.1 protein_id gnl|my_center|LOCUS_11820 2716 3504 gene locus_tag LOCUS_11830 2716 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3582 5480 gene locus_tag LOCUS_11840 3582 5480 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948279.1 protein_id gnl|my_center|LOCUS_11840 5477 6733 gene locus_tag LOCUS_11850 5477 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 6754 9084 gene locus_tag LOCUS_11860 6754 9084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 9186 9608 gene locus_tag LOCUS_11870 9186 9608 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358712.1 protein_id gnl|my_center|LOCUS_11870 10126 10758 gene locus_tag LOCUS_11880 10126 10758 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_11880 12183 11176 gene locus_tag LOCUS_11890 12183 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 12836 12198 gene locus_tag LOCUS_11900 12836 12198 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_11900 13453 13241 gene locus_tag LOCUS_11910 13453 13241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 13611 14507 gene locus_tag LOCUS_11920 gene metF 13611 14507 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949153.1 protein_id gnl|my_center|LOCUS_11920 16397 14661 gene locus_tag LOCUS_11930 16397 14661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 18398 16626 gene locus_tag LOCUS_11940 18398 16626 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942518.1 protein_id gnl|my_center|LOCUS_11940 19531 18422 gene locus_tag LOCUS_11950 19531 18422 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311935.1 protein_id gnl|my_center|LOCUS_11950 20879 19683 gene locus_tag LOCUS_11960 20879 19683 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_11960 21335 21790 gene locus_tag LOCUS_11970 21335 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 21787 22845 gene locus_tag LOCUS_11980 21787 22845 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_11980 24367 22859 gene locus_tag LOCUS_11990 24367 22859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 25158 26345 gene locus_tag LOCUS_12000 25158 26345 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_12000 26489 26408 gene locus_tag LOCUS_t00370 26489 26408 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 27348 26542 gene locus_tag LOCUS_12010 27348 26542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 27700 28770 gene locus_tag LOCUS_12020 gene ychF 27700 28770 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_12020 29978 28857 gene locus_tag LOCUS_12030 29978 28857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 31011 30187 gene locus_tag LOCUS_12040 gene surE 31011 30187 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_12040 31646 31128 gene locus_tag LOCUS_12050 31646 31128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 32074 31646 gene locus_tag LOCUS_12060 32074 31646 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404135.1 protein_id gnl|my_center|LOCUS_12060 33305 32079 gene locus_tag LOCUS_12070 33305 32079 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783932.1 protein_id gnl|my_center|LOCUS_12070 33499 34209 gene locus_tag LOCUS_12080 33499 34209 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_12080 34212 35630 gene locus_tag LOCUS_12090 34212 35630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 35825 36511 gene locus_tag LOCUS_12100 gene phoU 35825 36511 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_12100 36653 37387 gene locus_tag LOCUS_12110 gene tmk 36653 37387 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_12110 37384 38097 gene locus_tag LOCUS_12120 gene tmk 37384 38097 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979593.1 protein_id gnl|my_center|LOCUS_12120 38155 39192 gene locus_tag LOCUS_12130 38155 39192 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870305.1 protein_id gnl|my_center|LOCUS_12130 40506 39472 gene locus_tag LOCUS_12140 gene corA 40506 39472 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000821727.1 protein_id gnl|my_center|LOCUS_12140 41609 40587 gene locus_tag LOCUS_12150 41609 40587 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921459.1 protein_id gnl|my_center|LOCUS_12150 41646 42488 gene locus_tag LOCUS_12160 41646 42488 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021200.1 protein_id gnl|my_center|LOCUS_12160 42472 43254 gene locus_tag LOCUS_12170 42472 43254 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776098.1 protein_id gnl|my_center|LOCUS_12170 43256 43837 gene locus_tag LOCUS_12180 gene rfbC 43256 43837 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807148.1 protein_id gnl|my_center|LOCUS_12180 43837 44919 gene locus_tag LOCUS_12190 gene rfbB 43837 44919 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771402.1 protein_id gnl|my_center|LOCUS_12190 44922 45797 gene locus_tag LOCUS_12200 gene rfbA 44922 45797 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857508.1 protein_id gnl|my_center|LOCUS_12200 45794 46678 gene locus_tag LOCUS_12210 gene rfbD 45794 46678 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771401.1 protein_id gnl|my_center|LOCUS_12210 46747 49323 gene locus_tag LOCUS_12220 46747 49323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 49389 50774 gene locus_tag LOCUS_12230 49389 50774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 <53685 50788 gene locus_tag LOCUS_12240 <53685 50788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385087.1:rhamnan synthesis F family protein >Feature sequence16 519 1160 gene locus_tag LOCUS_12250 519 1160 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_12250 2128 1325 gene locus_tag LOCUS_12260 2128 1325 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018701913.1 protein_id gnl|my_center|LOCUS_12260 3160 2216 gene locus_tag LOCUS_12270 3160 2216 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023517.1 protein_id gnl|my_center|LOCUS_12270 4788 3475 gene locus_tag LOCUS_12280 4788 3475 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546283.1 protein_id gnl|my_center|LOCUS_12280 5836 4886 gene locus_tag LOCUS_12290 5836 4886 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039247.1 protein_id gnl|my_center|LOCUS_12290 6720 5833 gene locus_tag LOCUS_12300 6720 5833 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_12300 7434 6733 gene locus_tag LOCUS_12310 7434 6733 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002894681.1 protein_id gnl|my_center|LOCUS_12310 8152 7427 gene locus_tag LOCUS_12320 8152 7427 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085709.1 protein_id gnl|my_center|LOCUS_12320 8453 8208 gene locus_tag LOCUS_12330 8453 8208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 8808 8587 gene locus_tag LOCUS_12340 8808 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 10528 8801 gene locus_tag LOCUS_12350 10528 8801 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_12350 11484 10555 gene locus_tag LOCUS_12360 gene iolN 11484 10555 CDS product 3-dehydro-scyllo-inosose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083262.1 protein_id gnl|my_center|LOCUS_12360 12449 11535 gene locus_tag LOCUS_12370 12449 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876595.1 protein_id gnl|my_center|LOCUS_12370 12836 12474 gene locus_tag LOCUS_12380 12836 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 13151 13819 gene locus_tag LOCUS_12390 gene bluB 13151 13819 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846372.1 protein_id gnl|my_center|LOCUS_12390 13821 14285 gene locus_tag LOCUS_12400 13821 14285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 14287 15186 gene locus_tag LOCUS_12410 14287 15186 CDS product CoA transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811552.1 protein_id gnl|my_center|LOCUS_12410 15188 15952 gene locus_tag LOCUS_12420 15188 15952 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223751.1 protein_id gnl|my_center|LOCUS_12420 15975 16160 gene locus_tag LOCUS_12430 15975 16160 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002559159.1 protein_id gnl|my_center|LOCUS_12430 16208 17494 gene locus_tag LOCUS_12440 16208 17494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 17504 18376 gene locus_tag LOCUS_12450 17504 18376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 18373 19008 gene locus_tag LOCUS_12460 18373 19008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12460 19115 20164 gene locus_tag LOCUS_12470 19115 20164 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970710.1 protein_id gnl|my_center|LOCUS_12470 20508 21887 gene locus_tag LOCUS_12480 20508 21887 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392338.1 protein_id gnl|my_center|LOCUS_12480 22013 22573 gene locus_tag LOCUS_12490 22013 22573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 22606 23745 gene locus_tag LOCUS_12500 22606 23745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 25769 24090 gene locus_tag LOCUS_12510 25769 24090 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878960.1 protein_id gnl|my_center|LOCUS_12510 26999 26043 gene locus_tag LOCUS_12520 26999 26043 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918169.1 protein_id gnl|my_center|LOCUS_12520 27984 27001 gene locus_tag LOCUS_12530 27984 27001 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016362.1 protein_id gnl|my_center|LOCUS_12530 28887 28000 gene locus_tag LOCUS_12540 28887 28000 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_12540 29836 28880 gene locus_tag LOCUS_12550 29836 28880 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016361.1 protein_id gnl|my_center|LOCUS_12550 31706 30033 gene locus_tag LOCUS_12560 31706 30033 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065721.1 protein_id gnl|my_center|LOCUS_12560 32601 31816 gene locus_tag LOCUS_12570 32601 31816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 32917 33810 gene locus_tag LOCUS_12580 32917 33810 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257188.1 protein_id gnl|my_center|LOCUS_12580 35573 34563 gene locus_tag LOCUS_12590 35573 34563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 35916 36431 gene locus_tag LOCUS_12600 gene rfaH 35916 36431 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_12600 36569 37699 gene locus_tag LOCUS_12610 36569 37699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 37985 38434 gene locus_tag LOCUS_12620 37985 38434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12620 38418 39878 gene locus_tag LOCUS_12630 38418 39878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 39894 40748 gene locus_tag LOCUS_12640 39894 40748 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963402.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence17 1984 221 gene locus_tag LOCUS_12650 1984 221 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888050.1 protein_id gnl|my_center|LOCUS_12650 2883 2095 gene locus_tag LOCUS_12660 2883 2095 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005679031.1 protein_id gnl|my_center|LOCUS_12660 3544 2900 gene locus_tag LOCUS_12670 3544 2900 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_12670 3762 3562 gene locus_tag LOCUS_12680 3762 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 5022 3766 gene locus_tag LOCUS_12690 gene hutI 5022 3766 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256863.1 protein_id gnl|my_center|LOCUS_12690 6450 5056 gene locus_tag LOCUS_12700 6450 5056 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259685.1 protein_id gnl|my_center|LOCUS_12700 7136 6447 gene locus_tag LOCUS_12710 7136 6447 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259684.1 protein_id gnl|my_center|LOCUS_12710 9410 7584 gene locus_tag LOCUS_12720 9410 7584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 9434 9613 gene locus_tag LOCUS_12730 9434 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 9712 12102 gene locus_tag LOCUS_12740 9712 12102 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660626.1 protein_id gnl|my_center|LOCUS_12740 13087 12299 gene locus_tag LOCUS_12750 13087 12299 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545486.1 protein_id gnl|my_center|LOCUS_12750 14052 13084 gene locus_tag LOCUS_12760 14052 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 15288 14482 gene locus_tag LOCUS_12770 15288 14482 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_12770 16059 15295 gene locus_tag LOCUS_12780 16059 15295 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257740.1 protein_id gnl|my_center|LOCUS_12780 17054 16074 gene locus_tag LOCUS_12790 17054 16074 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143765.1 protein_id gnl|my_center|LOCUS_12790 17731 17051 gene locus_tag LOCUS_12800 17731 17051 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461004.1 protein_id gnl|my_center|LOCUS_12800 19348 17732 gene locus_tag LOCUS_12810 19348 17732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 20226 19351 gene locus_tag LOCUS_12820 20226 19351 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_12820 21473 20226 gene locus_tag LOCUS_12830 21473 20226 CDS product N-acylneuraminate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029924.1 protein_id gnl|my_center|LOCUS_12830 22294 21467 gene locus_tag LOCUS_12840 22294 21467 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_12840 23348 22356 gene locus_tag LOCUS_12850 23348 22356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 24358 23348 gene locus_tag LOCUS_12860 24358 23348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 25294 24362 gene locus_tag LOCUS_12870 25294 24362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 26980 25298 gene locus_tag LOCUS_12880 26980 25298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 27639 26995 gene locus_tag LOCUS_12890 27639 26995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 28745 27636 gene locus_tag LOCUS_12900 28745 27636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 29823 28756 gene locus_tag LOCUS_12910 29823 28756 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015754.1 protein_id gnl|my_center|LOCUS_12910 30756 29836 gene locus_tag LOCUS_12920 gene rfbD 30756 29836 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899993.1 protein_id gnl|my_center|LOCUS_12920 31760 30753 gene locus_tag LOCUS_12930 gene pseB 31760 30753 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097864.1 protein_id gnl|my_center|LOCUS_12930 32633 31785 gene locus_tag LOCUS_12940 32633 31785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 34273 32630 gene locus_tag LOCUS_12950 34273 32630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_112147230.1 protein_id gnl|my_center|LOCUS_12950 <35238 34276 gene locus_tag LOCUS_12960 <35238 34276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257973.1:ABC transporter ATP-binding protein >Feature sequence18 748 323 gene locus_tag LOCUS_12970 748 323 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868008.1 protein_id gnl|my_center|LOCUS_12970 1089 745 gene locus_tag LOCUS_12980 1089 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2646 1102 gene locus_tag LOCUS_12990 2646 1102 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_12990 5505 3142 gene locus_tag LOCUS_13000 5505 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 5586 6626 gene locus_tag LOCUS_13010 5586 6626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 6739 7776 gene locus_tag LOCUS_13020 gene hrcA 6739 7776 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_13020 7813 8373 gene locus_tag LOCUS_13030 gene grpE 7813 8373 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_13030 8382 10271 gene locus_tag LOCUS_13040 gene dnaK 8382 10271 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257940.1 protein_id gnl|my_center|LOCUS_13040 10352 11485 gene locus_tag LOCUS_13050 gene dnaJ 10352 11485 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257939.1 protein_id gnl|my_center|LOCUS_13050 11478 12398 gene locus_tag LOCUS_13060 11478 12398 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_13060 12509 13159 gene locus_tag LOCUS_13070 12509 13159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 13987 13169 gene locus_tag LOCUS_13080 13987 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 14749 14030 gene locus_tag LOCUS_13090 14749 14030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 16314 14959 gene locus_tag LOCUS_13100 16314 14959 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479718.1 protein_id gnl|my_center|LOCUS_13100 18577 16682 gene locus_tag LOCUS_13110 18577 16682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 18918 22934 gene locus_tag LOCUS_13120 18918 22934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 22951 23724 gene locus_tag LOCUS_13130 gene surE 22951 23724 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_13130 24509 24976 gene locus_tag LOCUS_13140 24509 24976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 24984 25919 gene locus_tag LOCUS_13150 24984 25919 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233703.1 protein_id gnl|my_center|LOCUS_13150 25909 27489 gene locus_tag LOCUS_13160 25909 27489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 28380 27637 gene locus_tag LOCUS_13170 28380 27637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 28807 29403 gene locus_tag LOCUS_13180 28807 29403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 29652 32180 gene locus_tag LOCUS_13190 gene gyrA 29652 32180 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 protein_id gnl|my_center|LOCUS_13190 32908 32156 gene locus_tag LOCUS_13200 32908 32156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 34463 32919 gene locus_tag LOCUS_13210 34463 32919 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence19 579 25 gene locus_tag LOCUS_13220 579 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 3123 874 gene locus_tag LOCUS_13230 3123 874 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023776.1 protein_id gnl|my_center|LOCUS_13230 3305 3880 gene locus_tag LOCUS_13240 3305 3880 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_13240 4051 6447 gene locus_tag LOCUS_13250 4051 6447 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582697.1 protein_id gnl|my_center|LOCUS_13250 7195 6491 gene locus_tag LOCUS_13260 7195 6491 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061211.1 protein_id gnl|my_center|LOCUS_13260 7803 7228 gene locus_tag LOCUS_13270 7803 7228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 8374 8658 gene locus_tag LOCUS_13280 8374 8658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065696.1 protein_id gnl|my_center|LOCUS_13280 10050 8788 gene locus_tag LOCUS_13290 10050 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 10916 10062 gene locus_tag LOCUS_13300 gene panB 10916 10062 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356105.1 protein_id gnl|my_center|LOCUS_13300 11267 12460 gene locus_tag LOCUS_13310 11267 12460 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_13310 12639 14099 gene locus_tag LOCUS_13320 12639 14099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 14209 16275 gene locus_tag LOCUS_13330 14209 16275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 17150 16293 gene locus_tag LOCUS_13340 gene zupT 17150 16293 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856259.1 protein_id gnl|my_center|LOCUS_13340 17607 17251 gene locus_tag LOCUS_13350 17607 17251 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_13350 17853 20318 gene locus_tag LOCUS_13360 17853 20318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 22001 20808 gene locus_tag LOCUS_13370 22001 20808 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963566.1 protein_id gnl|my_center|LOCUS_13370 23257 22010 gene locus_tag LOCUS_13380 23257 22010 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966214.1 protein_id gnl|my_center|LOCUS_13380 24206 23262 gene locus_tag LOCUS_13390 24206 23262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_13390 25277 24378 gene locus_tag LOCUS_13400 25277 24378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 26275 25415 gene locus_tag LOCUS_13410 26275 25415 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289459.1 protein_id gnl|my_center|LOCUS_13410 26725 26354 gene locus_tag LOCUS_13420 26725 26354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 26892 28226 gene locus_tag LOCUS_13430 26892 28226 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582561.1 protein_id gnl|my_center|LOCUS_13430 29080 28298 gene locus_tag LOCUS_13440 29080 28298 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000173325.1 protein_id gnl|my_center|LOCUS_13440 30108 29077 gene locus_tag LOCUS_13450 30108 29077 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392937.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence20 122 1582 gene locus_tag LOCUS_13460 122 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2283 1639 gene locus_tag LOCUS_13470 2283 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 2413 2757 gene locus_tag LOCUS_13480 2413 2757 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680926.1 protein_id gnl|my_center|LOCUS_13480 2797 3702 gene locus_tag LOCUS_13490 2797 3702 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028329.1 protein_id gnl|my_center|LOCUS_13490 3801 5306 gene locus_tag LOCUS_13500 3801 5306 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817435.1 protein_id gnl|my_center|LOCUS_13500 5341 6921 gene locus_tag LOCUS_13510 5341 6921 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_13510 6918 7733 gene locus_tag LOCUS_13520 6918 7733 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546330.1 protein_id gnl|my_center|LOCUS_13520 7807 8922 gene locus_tag LOCUS_13530 7807 8922 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048235.1 protein_id gnl|my_center|LOCUS_13530 11233 9167 gene locus_tag LOCUS_13540 gene fusA 11233 9167 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_13540 12169 11678 gene locus_tag LOCUS_13550 12169 11678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 12108 12314 gene locus_tag LOCUS_13560 12108 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 13222 12377 gene locus_tag LOCUS_13570 13222 12377 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259006.1 protein_id gnl|my_center|LOCUS_13570 13315 13884 gene locus_tag LOCUS_13580 13315 13884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 14520 13975 gene locus_tag LOCUS_13590 14520 13975 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_109032714.1 protein_id gnl|my_center|LOCUS_13590 17171 14517 gene locus_tag LOCUS_13600 17171 14517 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942226.1 protein_id gnl|my_center|LOCUS_13600 18681 17209 gene locus_tag LOCUS_13610 18681 17209 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258467.1 protein_id gnl|my_center|LOCUS_13610 18853 19875 gene locus_tag LOCUS_13620 18853 19875 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889319.1 protein_id gnl|my_center|LOCUS_13620 19912 20415 gene locus_tag LOCUS_13630 19912 20415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 20448 21302 gene locus_tag LOCUS_13640 20448 21302 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259647.1 protein_id gnl|my_center|LOCUS_13640 21318 22052 gene locus_tag LOCUS_13650 21318 22052 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_13650 22247 23143 gene locus_tag LOCUS_13660 gene ppk2 22247 23143 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705561.1 protein_id gnl|my_center|LOCUS_13660 23977 23150 gene locus_tag LOCUS_13670 23977 23150 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_13670 24818 25084 gene locus_tag LOCUS_13680 24818 25084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 25081 25896 gene locus_tag LOCUS_13690 25081 25896 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869876.1 protein_id gnl|my_center|LOCUS_13690 25893 26489 gene locus_tag LOCUS_13700 25893 26489 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_13700 27178 26543 gene locus_tag LOCUS_13710 27178 26543 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678895.1 protein_id gnl|my_center|LOCUS_13710 27412 27855 gene locus_tag LOCUS_13720 27412 27855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence21 323 1912 gene locus_tag LOCUS_13730 323 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 1922 3061 gene locus_tag LOCUS_13740 1922 3061 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167408.1 protein_id gnl|my_center|LOCUS_13740 3058 4155 gene locus_tag LOCUS_13750 3058 4155 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942154.1 protein_id gnl|my_center|LOCUS_13750 4158 5147 gene locus_tag LOCUS_13760 4158 5147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5144 6139 gene locus_tag LOCUS_13770 5144 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 6164 6994 gene locus_tag LOCUS_13780 6164 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 7377 8675 gene locus_tag LOCUS_13790 7377 8675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9012 8815 gene locus_tag LOCUS_13800 9012 8815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 10035 10988 gene locus_tag LOCUS_13810 10035 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 10985 12229 gene locus_tag LOCUS_13820 10985 12229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 12219 13553 gene locus_tag LOCUS_13830 12219 13553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 13571 14707 gene locus_tag LOCUS_13840 13571 14707 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120966.1 protein_id gnl|my_center|LOCUS_13840 14707 15612 gene locus_tag LOCUS_13850 14707 15612 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_13850 15709 16647 gene locus_tag LOCUS_13860 15709 16647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 16737 18107 gene locus_tag LOCUS_13870 16737 18107 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257994.1 protein_id gnl|my_center|LOCUS_13870 18330 19097 gene locus_tag LOCUS_13880 18330 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 19386 19171 gene locus_tag LOCUS_13890 19386 19171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 19642 20124 gene locus_tag LOCUS_13900 19642 20124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 20112 20825 gene locus_tag LOCUS_13910 20112 20825 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812818.1 protein_id gnl|my_center|LOCUS_13910 20822 21259 gene locus_tag LOCUS_13920 20822 21259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 21249 22835 gene locus_tag LOCUS_13930 21249 22835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 22836 23831 gene locus_tag LOCUS_13940 22836 23831 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808328.1 protein_id gnl|my_center|LOCUS_13940 24038 24748 gene locus_tag LOCUS_13950 24038 24748 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808326.1 protein_id gnl|my_center|LOCUS_13950 24752 25897 gene locus_tag LOCUS_13960 24752 25897 CDS product DegT/DnrJ/EryC1/StrS aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533116.1 protein_id gnl|my_center|LOCUS_13960 25954 26712 gene locus_tag LOCUS_13970 25954 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence22 1014 2498 gene locus_tag LOCUS_13980 1014 2498 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870282.1 protein_id gnl|my_center|LOCUS_13980 2500 3777 gene locus_tag LOCUS_13990 2500 3777 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_13990 3786 4157 gene locus_tag LOCUS_14000 3786 4157 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964634.1 protein_id gnl|my_center|LOCUS_14000 4421 4164 gene locus_tag LOCUS_14010 4421 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5836 5006 gene locus_tag LOCUS_14020 gene deoC 5836 5006 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256596.1 protein_id gnl|my_center|LOCUS_14020 6510 5857 gene locus_tag LOCUS_14030 6510 5857 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251082.1 protein_id gnl|my_center|LOCUS_14030 6854 6528 gene locus_tag LOCUS_14040 6854 6528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 7401 6901 gene locus_tag LOCUS_14050 7401 6901 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722355.1 protein_id gnl|my_center|LOCUS_14050 8334 7552 gene locus_tag LOCUS_14060 8334 7552 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002360115.1 protein_id gnl|my_center|LOCUS_14060 8583 9557 gene locus_tag LOCUS_14070 gene mvaD 8583 9557 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101527.1 protein_id gnl|my_center|LOCUS_14070 10886 9732 gene locus_tag LOCUS_14080 10886 9732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 11362 12891 gene locus_tag LOCUS_14090 11362 12891 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_14090 12888 14393 gene locus_tag LOCUS_14100 12888 14393 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_14100 14469 15911 gene locus_tag LOCUS_14110 14469 15911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14110 16924 16313 gene locus_tag LOCUS_14120 16924 16313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 18272 16989 gene locus_tag LOCUS_14130 gene eno 18272 16989 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105084.1 protein_id gnl|my_center|LOCUS_14130 20027 18780 gene locus_tag LOCUS_14140 20027 18780 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393148.1 protein_id gnl|my_center|LOCUS_14140 21296 20316 gene locus_tag LOCUS_14150 gene argF 21296 20316 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_14150 22289 21336 gene locus_tag LOCUS_14160 gene pyrB 22289 21336 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_14160 22632 23678 gene locus_tag LOCUS_14170 22632 23678 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228820.1 protein_id gnl|my_center|LOCUS_14170 23687 24214 gene locus_tag LOCUS_14180 23687 24214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 25020 24292 gene locus_tag LOCUS_14190 25020 24292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence23 <1 535 gene locus_tag LOCUS_14200 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963502.1:ABC transporter permease subunit 545 1729 gene locus_tag LOCUS_14210 545 1729 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963503.1 protein_id gnl|my_center|LOCUS_14210 1732 2754 gene locus_tag LOCUS_14220 1732 2754 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294518.1 protein_id gnl|my_center|LOCUS_14220 2759 3022 gene locus_tag LOCUS_14230 2759 3022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 3176 3595 gene locus_tag LOCUS_14240 3176 3595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 3785 3857 gene locus_tag LOCUS_t00380 3785 3857 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3959 5317 gene locus_tag LOCUS_14250 gene glmU 3959 5317 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391623.1 protein_id gnl|my_center|LOCUS_14250 5307 6593 gene locus_tag LOCUS_14260 5307 6593 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258059.1 protein_id gnl|my_center|LOCUS_14260 6574 6981 gene locus_tag LOCUS_14270 6574 6981 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964852.1 protein_id gnl|my_center|LOCUS_14270 7013 7771 gene locus_tag LOCUS_14280 gene recO 7013 7771 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392138.1 protein_id gnl|my_center|LOCUS_14280 8218 9552 gene locus_tag LOCUS_14290 8218 9552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 9782 12793 gene locus_tag LOCUS_14300 9782 12793 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725349.1 protein_id gnl|my_center|LOCUS_14300 13792 12839 gene locus_tag LOCUS_14310 13792 12839 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_14310 14778 13912 gene locus_tag LOCUS_14320 14778 13912 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052303786.1 protein_id gnl|my_center|LOCUS_14320 15281 14802 gene locus_tag LOCUS_14330 15281 14802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 15501 15827 gene locus_tag LOCUS_14340 15501 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 15852 16475 gene locus_tag LOCUS_14350 gene upp 15852 16475 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_14350 17685 16621 gene locus_tag LOCUS_14360 gene mutY 17685 16621 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056920.1 protein_id gnl|my_center|LOCUS_14360 17987 17685 gene locus_tag LOCUS_14370 17987 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 18647 17994 gene locus_tag LOCUS_14380 18647 17994 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence24 312 1862 gene locus_tag LOCUS_14390 312 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 2092 1805 gene locus_tag LOCUS_14400 2092 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 2223 2759 gene locus_tag LOCUS_14410 2223 2759 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016362025.1 protein_id gnl|my_center|LOCUS_14410 2847 3521 gene locus_tag LOCUS_14420 2847 3521 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140834349.1 protein_id gnl|my_center|LOCUS_14420 4133 3582 gene locus_tag LOCUS_14430 4133 3582 CDS product type-5 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173217.1 protein_id gnl|my_center|LOCUS_14430 4071 4331 gene locus_tag LOCUS_14440 4071 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 5747 4458 gene locus_tag LOCUS_14450 gene eno 5747 4458 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259639.1 protein_id gnl|my_center|LOCUS_14450 7451 5814 gene locus_tag LOCUS_14460 7451 5814 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393886.1 protein_id gnl|my_center|LOCUS_14460 8275 7565 gene locus_tag LOCUS_14470 8275 7565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 8695 9381 gene locus_tag LOCUS_14480 8695 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 9521 10432 gene locus_tag LOCUS_14490 gene fmt 9521 10432 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940806.1 protein_id gnl|my_center|LOCUS_14490 13023 10456 gene locus_tag LOCUS_14500 gene mutS 13023 10456 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_14500 15762 13033 gene locus_tag LOCUS_14510 gene alaS 15762 13033 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259677.1 protein_id gnl|my_center|LOCUS_14510 15953 16132 gene locus_tag LOCUS_14520 15953 16132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 17039 16431 gene locus_tag LOCUS_14530 gene recR 17039 16431 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_14530 17390 17046 gene locus_tag LOCUS_14540 17390 17046 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000984482.1 protein_id gnl|my_center|LOCUS_14540 19017 17392 gene locus_tag LOCUS_14550 gene dnaX 19017 17392 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660459.1 protein_id gnl|my_center|LOCUS_14550 19541 19029 gene locus_tag LOCUS_14560 19541 19029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence25 1513 641 gene locus_tag LOCUS_14570 1513 641 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_14570 1720 2505 gene locus_tag LOCUS_14580 1720 2505 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941610.1 protein_id gnl|my_center|LOCUS_14580 3742 2519 gene locus_tag LOCUS_14590 3742 2519 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061304.1 protein_id gnl|my_center|LOCUS_14590 4923 3910 gene locus_tag LOCUS_14600 gene holA 4923 3910 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258281.1 protein_id gnl|my_center|LOCUS_14600 5373 4933 gene locus_tag LOCUS_14610 5373 4933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 6871 5462 gene locus_tag LOCUS_14620 gene radA 6871 5462 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927834.1 protein_id gnl|my_center|LOCUS_14620 9437 6876 gene locus_tag LOCUS_14630 9437 6876 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258333.1 protein_id gnl|my_center|LOCUS_14630 10883 9891 gene locus_tag LOCUS_14640 10883 9891 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765598.1 protein_id gnl|my_center|LOCUS_14640 12147 10951 gene locus_tag LOCUS_14650 12147 10951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 12448 12164 gene locus_tag LOCUS_14660 12448 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 12805 12524 gene locus_tag LOCUS_14670 12805 12524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 13402 12827 gene locus_tag LOCUS_14680 13402 12827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 13983 13441 gene locus_tag LOCUS_14690 13983 13441 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000709539.1 protein_id gnl|my_center|LOCUS_14690 15069 13996 gene locus_tag LOCUS_14700 15069 13996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 15226 15651 gene locus_tag LOCUS_14710 15226 15651 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_14710 16764 15787 gene locus_tag LOCUS_14720 16764 15787 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122178.1 protein_id gnl|my_center|LOCUS_14720 18077 16764 gene locus_tag LOCUS_14730 18077 16764 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257976.1 protein_id gnl|my_center|LOCUS_14730 18742 18107 gene locus_tag LOCUS_14740 18742 18107 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_14740 >Feature sequence26 2230 68 gene locus_tag LOCUS_14750 2230 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2918 2253 gene locus_tag LOCUS_14760 2918 2253 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_14760 3913 2996 gene locus_tag LOCUS_14770 gene rnz 3913 2996 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086661.1 protein_id gnl|my_center|LOCUS_14770 4141 3944 gene locus_tag LOCUS_14780 4141 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 4684 4328 gene locus_tag LOCUS_14790 4684 4328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5272 5925 gene locus_tag LOCUS_14800 5272 5925 CDS product RecX family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257010.1 protein_id gnl|my_center|LOCUS_14800 5938 7512 gene locus_tag LOCUS_14810 gene rny 5938 7512 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_14810 8303 7656 gene locus_tag LOCUS_14820 8303 7656 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000871221.1 protein_id gnl|my_center|LOCUS_14820 9472 8315 gene locus_tag LOCUS_14830 gene mdtG 9472 8315 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075040.1 protein_id gnl|my_center|LOCUS_14830 10589 9474 gene locus_tag LOCUS_14840 10589 9474 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867997.1 protein_id gnl|my_center|LOCUS_14840 10936 11886 gene locus_tag LOCUS_14850 gene cysK 10936 11886 CDS product O-acetylserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899275.1 protein_id gnl|my_center|LOCUS_14850 11873 12655 gene locus_tag LOCUS_14860 gene cysE 11873 12655 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225749.1 protein_id gnl|my_center|LOCUS_14860 13019 12693 gene locus_tag LOCUS_14870 13019 12693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 14362 13016 gene locus_tag LOCUS_14880 14362 13016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 15442 14408 gene locus_tag LOCUS_14890 15442 14408 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811663.1 protein_id gnl|my_center|LOCUS_14890 16556 15444 gene locus_tag LOCUS_14900 16556 15444 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963539.1 protein_id gnl|my_center|LOCUS_14900 17605 16547 gene locus_tag LOCUS_14910 17605 16547 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459800.1 protein_id gnl|my_center|LOCUS_14910 17974 17624 gene locus_tag LOCUS_14920 17974 17624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 18133 18255 gene locus_tag LOCUS_14930 18133 18255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 18446 18518 gene locus_tag LOCUS_t00390 18446 18518 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 18665 18738 gene locus_tag LOCUS_t00400 18665 18738 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence27 2 373 gene locus_tag LOCUS_14940 2 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 373 1935 gene locus_tag LOCUS_14950 373 1935 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109491.1 protein_id gnl|my_center|LOCUS_14950 2135 4609 gene locus_tag LOCUS_14960 2135 4609 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256961.1 protein_id gnl|my_center|LOCUS_14960 5503 4742 gene locus_tag LOCUS_14970 5503 4742 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406424.1 protein_id gnl|my_center|LOCUS_14970 6094 5627 gene locus_tag LOCUS_14980 gene msrA 6094 5627 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_14980 6513 6091 gene locus_tag LOCUS_14990 gene msrB 6513 6091 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144322.1 protein_id gnl|my_center|LOCUS_14990 7618 6641 gene locus_tag LOCUS_15000 7618 6641 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583478.1 protein_id gnl|my_center|LOCUS_15000 8023 7952 gene locus_tag LOCUS_t00410 8023 7952 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8087 9112 gene locus_tag LOCUS_15010 gene xerC 8087 9112 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_15010 9198 11915 gene locus_tag LOCUS_15020 gene cas3 9198 11915 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116440412.1 protein_id gnl|my_center|LOCUS_15020 11916 13502 gene locus_tag LOCUS_15030 gene casA 11916 13502 CDS product type I-E CRISPR-associated protein Cse1/CasA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229116.1 protein_id gnl|my_center|LOCUS_15030 13503 14045 gene locus_tag LOCUS_15040 13503 14045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 14059 15174 gene locus_tag LOCUS_15050 gene cas7e 14059 15174 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_15050 15212 15820 gene locus_tag LOCUS_15060 gene cas5e 15212 15820 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_15060 15822 16454 gene locus_tag LOCUS_15070 gene cas6e 15822 16454 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_15070 16505 17431 gene locus_tag LOCUS_15080 gene cas1e 16505 17431 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_15080 17391 17681 gene locus_tag LOCUS_15090 17391 17681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 17705 >18019 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttccccacgcatgtgggggtgtacc >Feature sequence28 190 441 gene locus_tag LOCUS_15100 gene infA 190 441 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284370.1 protein_id gnl|my_center|LOCUS_15100 514 1488 gene locus_tag LOCUS_15110 514 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 1734 1543 gene locus_tag LOCUS_15120 1734 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3117 1795 gene locus_tag LOCUS_15130 3117 1795 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037914.1 protein_id gnl|my_center|LOCUS_15130 3224 4375 gene locus_tag LOCUS_15140 3224 4375 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080165.1 protein_id gnl|my_center|LOCUS_15140 4330 5208 gene locus_tag LOCUS_15150 4330 5208 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259067.1 protein_id gnl|my_center|LOCUS_15150 5284 5865 gene locus_tag LOCUS_15160 5284 5865 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_15160 5886 6218 gene locus_tag LOCUS_15170 5886 6218 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036963.1 protein_id gnl|my_center|LOCUS_15170 6741 6262 gene locus_tag LOCUS_15180 6741 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 7787 6738 gene locus_tag LOCUS_15190 7787 6738 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229774.1 protein_id gnl|my_center|LOCUS_15190 9484 7787 gene locus_tag LOCUS_15200 9484 7787 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487169.1 protein_id gnl|my_center|LOCUS_15200 10557 9490 gene locus_tag LOCUS_15210 10557 9490 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487181.1 protein_id gnl|my_center|LOCUS_15210 11222 10554 gene locus_tag LOCUS_15220 11222 10554 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258927.1 protein_id gnl|my_center|LOCUS_15220 11523 13595 gene locus_tag LOCUS_15230 11523 13595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 13623 14597 gene locus_tag LOCUS_15240 gene arnC 13623 14597 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112880.1 protein_id gnl|my_center|LOCUS_15240 14594 15343 gene locus_tag LOCUS_15250 14594 15343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence29 113 1054 gene locus_tag LOCUS_15260 113 1054 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_15260 1047 1577 gene locus_tag LOCUS_15270 1047 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 1586 3322 gene locus_tag LOCUS_15280 gene recN 1586 3322 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_15280 3407 4660 gene locus_tag LOCUS_15290 3407 4660 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674820.1 protein_id gnl|my_center|LOCUS_15290 5344 4706 gene locus_tag LOCUS_15300 5344 4706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 6369 5542 gene locus_tag LOCUS_15310 6369 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 7753 6503 gene locus_tag LOCUS_15320 7753 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 7897 7823 gene locus_tag LOCUS_t00420 7897 7823 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10607 8253 gene locus_tag LOCUS_15330 10607 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 12008 10872 gene locus_tag LOCUS_15340 gene dnaN 12008 10872 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258498.1 protein_id gnl|my_center|LOCUS_15340 12230 13462 gene locus_tag LOCUS_15350 12230 13462 CDS product 3-phenylpropionate MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370308.1 protein_id gnl|my_center|LOCUS_15350 13505 13993 gene locus_tag LOCUS_15360 13505 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 14140 14988 gene locus_tag LOCUS_15370 14140 14988 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003266758.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence30 <1 949 gene locus_tag LOCUS_15380 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259270.1:sodium ion-translocating decarboxylase subunit beta 1765 1070 gene locus_tag LOCUS_15390 1765 1070 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814304.1 protein_id gnl|my_center|LOCUS_15390 2078 2641 gene locus_tag LOCUS_15400 2078 2641 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_15400 2698 4065 gene locus_tag LOCUS_15410 gene dnaB 2698 4065 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391682.1 protein_id gnl|my_center|LOCUS_15410 4077 4757 gene locus_tag LOCUS_15420 4077 4757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 4750 6096 gene locus_tag LOCUS_15430 4750 6096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 6333 8504 gene locus_tag LOCUS_15440 gene glgP 6333 8504 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_15440 8529 9071 gene locus_tag LOCUS_15450 8529 9071 CDS product DUF2179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395815.1 protein_id gnl|my_center|LOCUS_15450 9093 9761 gene locus_tag LOCUS_15460 9093 9761 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245030.1 protein_id gnl|my_center|LOCUS_15460 9946 10959 gene locus_tag LOCUS_15470 9946 10959 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141745.1 protein_id gnl|my_center|LOCUS_15470 10928 11347 gene locus_tag LOCUS_15480 10928 11347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 13003 11408 gene locus_tag LOCUS_15490 13003 11408 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258202.1 protein_id gnl|my_center|LOCUS_15490 13150 13233 gene locus_tag LOCUS_t00430 13150 13233 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13375 14274 gene locus_tag LOCUS_15500 13375 14274 CDS product site-specific tyrosine recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994886.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence31 1617 289 gene locus_tag LOCUS_15510 1617 289 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257589.1 protein_id gnl|my_center|LOCUS_15510 1834 3168 gene locus_tag LOCUS_15520 1834 3168 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920957.1 protein_id gnl|my_center|LOCUS_15520 3267 4313 gene locus_tag LOCUS_15530 gene gap 3267 4313 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_15530 4401 5576 gene locus_tag LOCUS_15540 4401 5576 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258675.1 protein_id gnl|my_center|LOCUS_15540 5963 6646 gene locus_tag LOCUS_15550 5963 6646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 6775 7452 gene locus_tag LOCUS_15560 6775 7452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 8048 9310 gene locus_tag LOCUS_15570 8048 9310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 9451 10212 gene locus_tag LOCUS_15580 gene tpiA 9451 10212 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391808.1 protein_id gnl|my_center|LOCUS_15580 10583 11614 gene locus_tag LOCUS_15590 gene pheS 10583 11614 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence32 524 2215 gene locus_tag LOCUS_15600 524 2215 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256420.1 protein_id gnl|my_center|LOCUS_15600 2464 4176 gene locus_tag LOCUS_15610 2464 4176 CDS product nucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763594.1 protein_id gnl|my_center|LOCUS_15610 5477 4260 gene locus_tag LOCUS_15620 5477 4260 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211249054.1 protein_id gnl|my_center|LOCUS_15620 8630 5508 gene locus_tag LOCUS_15630 8630 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 8896 9453 gene locus_tag LOCUS_15640 8896 9453 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814921.1 protein_id gnl|my_center|LOCUS_15640 9496 9753 gene locus_tag LOCUS_15650 9496 9753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 10001 9744 gene locus_tag LOCUS_15660 10001 9744 CDS product mycoredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257693.1 protein_id gnl|my_center|LOCUS_15660 10548 10072 gene locus_tag LOCUS_15670 10548 10072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 10978 10643 gene locus_tag LOCUS_15680 10978 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 11760 11068 gene locus_tag LOCUS_15690 11760 11068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence33 999 238 gene locus_tag LOCUS_15700 999 238 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865221.1 protein_id gnl|my_center|LOCUS_15700 1159 1728 gene locus_tag LOCUS_15710 1159 1728 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001090717.1 protein_id gnl|my_center|LOCUS_15710 2014 2343 gene locus_tag LOCUS_15720 2014 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 2343 4505 gene locus_tag LOCUS_15730 2343 4505 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256757.1 protein_id gnl|my_center|LOCUS_15730 5613 4522 gene locus_tag LOCUS_15740 5613 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 6036 6845 gene locus_tag LOCUS_15750 6036 6845 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877333.1 protein_id gnl|my_center|LOCUS_15750 6933 7829 gene locus_tag LOCUS_15760 gene pstC 6933 7829 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000150748.1 protein_id gnl|my_center|LOCUS_15760 7843 8778 gene locus_tag LOCUS_15770 gene pstA 7843 8778 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877336.1 protein_id gnl|my_center|LOCUS_15770 8775 9542 gene locus_tag LOCUS_15780 gene pstB 8775 9542 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962535.1 protein_id gnl|my_center|LOCUS_15780 10538 9633 gene locus_tag LOCUS_15790 10538 9633 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530904.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence34 4164 3142 gene locus_tag LOCUS_15800 4164 3142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257444.1 protein_id gnl|my_center|LOCUS_15800 4273 5757 gene locus_tag LOCUS_15810 4273 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 7265 5850 gene locus_tag LOCUS_15820 7265 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 10498 7412 gene locus_tag LOCUS_15830 10498 7412 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069680713.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence35 <1 1064 gene locus_tag LOCUS_15840 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211981.1:dTDP-4-amino-4,6-dideoxygalactose transaminase 2226 1228 gene locus_tag LOCUS_15850 2226 1228 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615893.1 protein_id gnl|my_center|LOCUS_15850 2567 2226 gene locus_tag LOCUS_15860 2567 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3664 2663 gene locus_tag LOCUS_15870 3664 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 4007 3666 gene locus_tag LOCUS_15880 4007 3666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 4501 9648 gene locus_tag LOCUS_15890 4501 9648 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256600.1 protein_id gnl|my_center|LOCUS_15890 10408 10299 gene locus_tag LOCUS_r00010 10408 10299 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence36 234 1757 gene locus_tag LOCUS_15900 gene gguA 234 1757 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257794.1 protein_id gnl|my_center|LOCUS_15900 1769 2986 gene locus_tag LOCUS_15910 gene gguB 1769 2986 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_15910 3432 4382 gene locus_tag LOCUS_15920 3432 4382 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143763.1 protein_id gnl|my_center|LOCUS_15920 4504 4893 gene locus_tag LOCUS_15930 4504 4893 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869552.1 protein_id gnl|my_center|LOCUS_15930 4906 7038 gene locus_tag LOCUS_15940 4906 7038 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_15940 7035 7232 gene locus_tag LOCUS_15950 gene thiS 7035 7232 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869550.1 protein_id gnl|my_center|LOCUS_15950 7235 7921 gene locus_tag LOCUS_15960 7235 7921 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986474.1 protein_id gnl|my_center|LOCUS_15960 8510 9397 gene locus_tag LOCUS_15970 8510 9397 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence37 948 475 gene locus_tag LOCUS_15980 948 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 1168 1953 gene locus_tag LOCUS_15990 gene sufC 1168 1953 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_15990 1968 3380 gene locus_tag LOCUS_16000 gene sufB 1968 3380 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888737.1 protein_id gnl|my_center|LOCUS_16000 3389 4711 gene locus_tag LOCUS_16010 gene sufD 3389 4711 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173864.1 protein_id gnl|my_center|LOCUS_16010 4734 5033 gene locus_tag LOCUS_16020 4734 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 5691 5044 gene locus_tag LOCUS_16030 5691 5044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 6500 5700 gene locus_tag LOCUS_16040 6500 5700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 7781 6702 gene locus_tag LOCUS_16050 gene hypE 7781 6702 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948173.1 protein_id gnl|my_center|LOCUS_16050 8875 7778 gene locus_tag LOCUS_16060 gene hypD 8875 7778 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258618.1 protein_id gnl|my_center|LOCUS_16060 9135 8872 gene locus_tag LOCUS_16070 9135 8872 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893644.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence38 <1 2344 gene locus_tag LOCUS_16080 <1 2344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920774.1:response regulator 2356 2706 gene locus_tag LOCUS_16090 2356 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2699 3856 gene locus_tag LOCUS_16100 2699 3856 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203082.1 protein_id gnl|my_center|LOCUS_16100 4318 4247 gene locus_tag LOCUS_t00440 4318 4247 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 6059 4377 gene locus_tag LOCUS_16110 6059 4377 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_16110 7405 6212 gene locus_tag LOCUS_16120 7405 6212 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682387.1 protein_id gnl|my_center|LOCUS_16120 8364 7414 gene locus_tag LOCUS_16130 gene fba 8364 7414 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_16130 <9494 8480 gene locus_tag LOCUS_16140 <9494 8480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000512781.1:glycosyltransferase family 1 protein >Feature sequence39 1923 1003 gene locus_tag LOCUS_16150 1923 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 2873 1926 gene locus_tag LOCUS_16160 gene moaA 2873 1926 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986479.1 protein_id gnl|my_center|LOCUS_16160 3357 2866 gene locus_tag LOCUS_16170 gene moaC 3357 2866 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093030.1 protein_id gnl|my_center|LOCUS_16170 5264 3348 gene locus_tag LOCUS_16180 5264 3348 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965320.1 protein_id gnl|my_center|LOCUS_16180 6476 5268 gene locus_tag LOCUS_16190 6476 5268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 7484 6564 gene locus_tag LOCUS_16200 7484 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence40 <1 855 gene locus_tag LOCUS_16210 <1 855 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000259550.1:L-glutamate gamma-semialdehyde dehydrogenase 879 1136 gene locus_tag LOCUS_16220 879 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 1138 2040 gene locus_tag LOCUS_16230 1138 2040 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084060.1 protein_id gnl|my_center|LOCUS_16230 2042 2806 gene locus_tag LOCUS_16240 2042 2806 CDS product CoA-transferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035619.1 protein_id gnl|my_center|LOCUS_16240 2806 3834 gene locus_tag LOCUS_16250 2806 3834 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_16250 5546 3885 gene locus_tag LOCUS_16260 5546 3885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 5658 7019 gene locus_tag LOCUS_16270 5658 7019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 8142 7171 gene locus_tag LOCUS_16280 8142 7171 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198121.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence41 965 1465 gene locus_tag LOCUS_16290 965 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 1483 1773 gene locus_tag LOCUS_16300 1483 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 1773 2882 gene locus_tag LOCUS_16310 1773 2882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3164 4018 gene locus_tag LOCUS_16320 3164 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 4081 7638 gene locus_tag LOCUS_16330 4081 7638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence42 848 3415 gene locus_tag LOCUS_16340 gene clpB 848 3415 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258977.1 protein_id gnl|my_center|LOCUS_16340 5072 3489 gene locus_tag LOCUS_16350 5072 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence43 547 1512 gene locus_tag LOCUS_16360 547 1512 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256941.1 protein_id gnl|my_center|LOCUS_16360 2738 1572 gene locus_tag LOCUS_16370 2738 1572 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143816.1 protein_id gnl|my_center|LOCUS_16370 3770 2865 gene locus_tag LOCUS_16380 3770 2865 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000409743.1 protein_id gnl|my_center|LOCUS_16380 4893 3898 gene locus_tag LOCUS_16390 4893 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 5134 5994 gene locus_tag LOCUS_16400 5134 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 5987 6865 gene locus_tag LOCUS_16410 5987 6865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 6983 7195 gene locus_tag LOCUS_16420 6983 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence44 2522 690 gene locus_tag LOCUS_16430 2522 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 2992 2516 gene locus_tag LOCUS_16440 gene folK 2992 2516 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_16440 4035 3001 gene locus_tag LOCUS_16450 4035 3001 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869258.1 protein_id gnl|my_center|LOCUS_16450 4804 4082 gene locus_tag LOCUS_16460 4804 4082 CDS product SCO1664 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257528.1 protein_id gnl|my_center|LOCUS_16460 5340 4813 gene locus_tag LOCUS_16470 5340 4813 CDS product DUF3090 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226500.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence45 815 261 gene locus_tag LOCUS_16480 815 261 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_16480 1058 2062 gene locus_tag LOCUS_16490 1058 2062 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285058.1 protein_id gnl|my_center|LOCUS_16490 2046 2888 gene locus_tag LOCUS_16500 2046 2888 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582436.1 protein_id gnl|my_center|LOCUS_16500 2893 3777 gene locus_tag LOCUS_16510 2893 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 3777 4328 gene locus_tag LOCUS_16520 3777 4328 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037783.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence46 1925 1485 gene locus_tag LOCUS_16530 1925 1485 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673332.1 protein_id gnl|my_center|LOCUS_16530 2577 2050 gene locus_tag LOCUS_16540 2577 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence47 784 251 gene locus_tag LOCUS_16550 784 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 2278 896 gene locus_tag LOCUS_16560 2278 896 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259342.1 protein_id gnl|my_center|LOCUS_16560 2411 2485 gene locus_tag LOCUS_t00450 2411 2485 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence48 265 606 gene locus_tag LOCUS_16570 265 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 680 1123 gene locus_tag LOCUS_16580 680 1123 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869593.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence49 840 169 gene locus_tag LOCUS_16590 840 169 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986483.1 protein_id gnl|my_center|LOCUS_16590 1523 837 gene locus_tag LOCUS_16600 1523 837 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546597.1 protein_id gnl|my_center|LOCUS_16600 2452 1634 gene locus_tag LOCUS_16610 2452 1634 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986485.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence50 2317 752 gene locus_tag LOCUS_16620 2317 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence51