>Feature sequence001 2580 1576 gene locus_tag LOCUS_00010 2580 1576 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435695.1 protein_id gnl|my_center|LOCUS_00010 3596 2577 gene locus_tag LOCUS_00020 3596 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4816 3614 gene locus_tag LOCUS_00030 4816 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5661 4954 gene locus_tag LOCUS_00040 5661 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6938 5664 gene locus_tag LOCUS_00050 6938 5664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068300.1 protein_id gnl|my_center|LOCUS_00050 7815 6919 gene locus_tag LOCUS_00060 7815 6919 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206170.1 protein_id gnl|my_center|LOCUS_00060 7935 9509 gene locus_tag LOCUS_00070 7935 9509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 10333 9506 gene locus_tag LOCUS_00080 10333 9506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 11152 10355 gene locus_tag LOCUS_00090 11152 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 12786 11311 gene locus_tag LOCUS_00100 gene glpK 12786 11311 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964631.1 protein_id gnl|my_center|LOCUS_00100 13658 12783 gene locus_tag LOCUS_00110 13658 12783 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948255.1 protein_id gnl|my_center|LOCUS_00110 15583 13655 gene locus_tag LOCUS_00120 15583 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 15691 17844 gene locus_tag LOCUS_00130 15691 17844 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947999.1 protein_id gnl|my_center|LOCUS_00130 17853 20489 gene locus_tag LOCUS_00140 17853 20489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 20553 21674 gene locus_tag LOCUS_00150 20553 21674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 22201 21677 gene locus_tag LOCUS_00160 22201 21677 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947935.1 protein_id gnl|my_center|LOCUS_00160 22779 22198 gene locus_tag LOCUS_00170 22779 22198 CDS product spore maturation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356382.1 protein_id gnl|my_center|LOCUS_00170 22935 23177 gene locus_tag LOCUS_00180 22935 23177 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388120.1 protein_id gnl|my_center|LOCUS_00180 24030 23194 gene locus_tag LOCUS_00190 gene rsmI 24030 23194 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963630.1 protein_id gnl|my_center|LOCUS_00190 24759 24040 gene locus_tag LOCUS_00200 24759 24040 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947927.1 protein_id gnl|my_center|LOCUS_00200 25007 24837 gene locus_tag LOCUS_00210 25007 24837 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888017.1 protein_id gnl|my_center|LOCUS_00210 25936 25061 gene locus_tag LOCUS_00220 25936 25061 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_00220 26921 25929 gene locus_tag LOCUS_00230 26921 25929 CDS product DNA polymerase III subunit delta' C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435878.1 protein_id gnl|my_center|LOCUS_00230 27282 26947 gene locus_tag LOCUS_00240 27282 26947 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_00240 28658 27306 gene locus_tag LOCUS_00250 28658 27306 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963620.1 protein_id gnl|my_center|LOCUS_00250 29869 28709 gene locus_tag LOCUS_00260 29869 28709 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_00260 30177 29887 gene locus_tag LOCUS_00270 30177 29887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 30769 30161 gene locus_tag LOCUS_00280 30769 30161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 31333 30842 gene locus_tag LOCUS_00290 31333 30842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 31752 31342 gene locus_tag LOCUS_00300 31752 31342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 32140 31778 gene locus_tag LOCUS_00310 32140 31778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32564 32154 gene locus_tag LOCUS_00320 32564 32154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 33063 32671 gene locus_tag LOCUS_00330 33063 32671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 33715 33068 gene locus_tag LOCUS_00340 33715 33068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34678 33719 gene locus_tag LOCUS_00350 34678 33719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 36323 34671 gene locus_tag LOCUS_00360 36323 34671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 37009 36320 gene locus_tag LOCUS_00370 37009 36320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 38580 37009 gene locus_tag LOCUS_00380 38580 37009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 39580 38792 gene locus_tag LOCUS_00390 gene cwlD 39580 38792 CDS product N-acetylmuramoyl-L-alanine amidase CwlD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860636.1 protein_id gnl|my_center|LOCUS_00390 40551 39640 gene locus_tag LOCUS_00400 40551 39640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 41131 40553 gene locus_tag LOCUS_00410 41131 40553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence002 <1 965 gene locus_tag LOCUS_00420 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721354.1:NADP-specific glutamate dehydrogenase note possible pseudo, frameshifted 1067 1543 gene locus_tag LOCUS_00430 1067 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 3659 1572 gene locus_tag LOCUS_00440 3659 1572 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459225.1 protein_id gnl|my_center|LOCUS_00440 4963 3656 gene locus_tag LOCUS_00450 4963 3656 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_00450 8596 4967 gene locus_tag LOCUS_00460 8596 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9411 8593 gene locus_tag LOCUS_00470 9411 8593 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860957.1 protein_id gnl|my_center|LOCUS_00470 11893 9428 gene locus_tag LOCUS_00480 11893 9428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 13262 11967 gene locus_tag LOCUS_00490 gene trmFO 13262 11967 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475886.1 protein_id gnl|my_center|LOCUS_00490 15379 13262 gene locus_tag LOCUS_00500 gene topA 15379 13262 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965091.1 protein_id gnl|my_center|LOCUS_00500 16545 15454 gene locus_tag LOCUS_00510 16545 15454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 17153 16545 gene locus_tag LOCUS_00520 17153 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 17680 17213 gene locus_tag LOCUS_00530 gene nrdR 17680 17213 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_00530 17972 17730 gene locus_tag LOCUS_00540 17972 17730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 18223 19929 gene locus_tag LOCUS_00550 18223 19929 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_00550 19945 21156 gene locus_tag LOCUS_00560 19945 21156 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_00560 21861 21181 gene locus_tag LOCUS_00570 21861 21181 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417036.1 protein_id gnl|my_center|LOCUS_00570 22747 21881 gene locus_tag LOCUS_00580 22747 21881 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963680.1 protein_id gnl|my_center|LOCUS_00580 24268 22826 gene locus_tag LOCUS_00590 24268 22826 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002368663.1 protein_id gnl|my_center|LOCUS_00590 25872 24424 gene locus_tag LOCUS_00600 25872 24424 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583098.1 protein_id gnl|my_center|LOCUS_00600 25959 27161 gene locus_tag LOCUS_00610 25959 27161 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861133.1 protein_id gnl|my_center|LOCUS_00610 27221 27646 gene locus_tag LOCUS_00620 27221 27646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 28545 27682 gene locus_tag LOCUS_00630 28545 27682 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870104.1 protein_id gnl|my_center|LOCUS_00630 29338 28532 gene locus_tag LOCUS_00640 29338 28532 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000794285.1 protein_id gnl|my_center|LOCUS_00640 30182 29340 gene locus_tag LOCUS_00650 30182 29340 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_00650 30848 30261 gene locus_tag LOCUS_00660 30848 30261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 31156 31229 gene locus_tag LOCUS_t00010 31156 31229 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 31365 33059 gene locus_tag LOCUS_00670 31365 33059 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964990.1 protein_id gnl|my_center|LOCUS_00670 >Feature sequence003 117 578 gene locus_tag LOCUS_00680 117 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 563 898 gene locus_tag LOCUS_00690 563 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 895 1602 gene locus_tag LOCUS_00700 895 1602 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016327302.1 protein_id gnl|my_center|LOCUS_00700 1799 2539 gene locus_tag LOCUS_00710 1799 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2612 3721 gene locus_tag LOCUS_00720 2612 3721 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390206.1 protein_id gnl|my_center|LOCUS_00720 5249 3810 gene locus_tag LOCUS_00730 5249 3810 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921564.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00730 5393 6775 gene locus_tag LOCUS_00740 5393 6775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 7996 6779 gene locus_tag LOCUS_00750 7996 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 8528 7977 gene locus_tag LOCUS_00760 8528 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 9814 8621 gene locus_tag LOCUS_00770 9814 8621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10867 9839 gene locus_tag LOCUS_00780 10867 9839 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107231.1 protein_id gnl|my_center|LOCUS_00780 11912 10884 gene locus_tag LOCUS_00790 11912 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 12703 12023 gene locus_tag LOCUS_00800 12703 12023 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_186843528.1 protein_id gnl|my_center|LOCUS_00800 13605 12784 gene locus_tag LOCUS_00810 13605 12784 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706548.1 protein_id gnl|my_center|LOCUS_00810 13722 14183 gene locus_tag LOCUS_00820 13722 14183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 14296 15213 gene locus_tag LOCUS_00830 gene trxB 14296 15213 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_00830 16153 15194 gene locus_tag LOCUS_00840 16153 15194 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434938.1 protein_id gnl|my_center|LOCUS_00840 16915 16154 gene locus_tag LOCUS_00850 16915 16154 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_00850 17348 16905 gene locus_tag LOCUS_00860 17348 16905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 18364 17345 gene locus_tag LOCUS_00870 18364 17345 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435926.1 protein_id gnl|my_center|LOCUS_00870 19743 18499 gene locus_tag LOCUS_00880 19743 18499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 20943 19777 gene locus_tag LOCUS_00890 20943 19777 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_00890 21686 20994 gene locus_tag LOCUS_00900 21686 20994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 21979 21740 gene locus_tag LOCUS_00910 21979 21740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 22077 21919 gene locus_tag LOCUS_00920 22077 21919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 22774 22211 gene locus_tag LOCUS_00930 gene pssA 22774 22211 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963995.1 protein_id gnl|my_center|LOCUS_00930 23723 22728 gene locus_tag LOCUS_00940 23723 22728 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_00940 24301 23741 gene locus_tag LOCUS_00950 24301 23741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 26095 24314 gene locus_tag LOCUS_00960 26095 24314 CDS product ferrous iron transporter B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869281.1 protein_id gnl|my_center|LOCUS_00960 26367 26101 gene locus_tag LOCUS_00970 26367 26101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 26587 28701 gene locus_tag LOCUS_00980 26587 28701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257329.1 protein_id gnl|my_center|LOCUS_00980 28726 29319 gene locus_tag LOCUS_00990 28726 29319 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583630.1 protein_id gnl|my_center|LOCUS_00990 29740 29369 gene locus_tag LOCUS_01000 29740 29369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809638.1 protein_id gnl|my_center|LOCUS_01000 30321 29758 gene locus_tag LOCUS_01010 30321 29758 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036623.1 protein_id gnl|my_center|LOCUS_01010 30684 30385 gene locus_tag LOCUS_01020 30684 30385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence004 101 904 gene locus_tag LOCUS_01030 101 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 904 1548 gene locus_tag LOCUS_01040 904 1548 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063820.1 protein_id gnl|my_center|LOCUS_01040 1565 2323 gene locus_tag LOCUS_01050 1565 2323 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165842655.1 protein_id gnl|my_center|LOCUS_01050 2441 2791 gene locus_tag LOCUS_01060 2441 2791 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437587.1 protein_id gnl|my_center|LOCUS_01060 2807 3025 gene locus_tag LOCUS_01070 2807 3025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01070 3027 4874 gene locus_tag LOCUS_01080 3027 4874 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379416.1 protein_id gnl|my_center|LOCUS_01080 5493 4876 gene locus_tag LOCUS_01090 5493 4876 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963951.1 protein_id gnl|my_center|LOCUS_01090 6851 5532 gene locus_tag LOCUS_01100 6851 5532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 7549 6875 gene locus_tag LOCUS_01110 7549 6875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01110 8286 7654 gene locus_tag LOCUS_01120 8286 7654 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393606.1 protein_id gnl|my_center|LOCUS_01120 8463 9551 gene locus_tag LOCUS_01130 8463 9551 CDS product RNA-splicing ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459687.1 protein_id gnl|my_center|LOCUS_01130 11505 9553 gene locus_tag LOCUS_01140 11505 9553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 11622 14708 gene locus_tag LOCUS_01150 gene ebgA 11622 14708 CDS product beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706828.1 protein_id gnl|my_center|LOCUS_01150 14825 15376 gene locus_tag LOCUS_01160 14825 15376 CDS product flavodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966687.1 protein_id gnl|my_center|LOCUS_01160 15424 16257 gene locus_tag LOCUS_01170 15424 16257 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887660.1 protein_id gnl|my_center|LOCUS_01170 17571 16258 gene locus_tag LOCUS_01180 17571 16258 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359094.1 protein_id gnl|my_center|LOCUS_01180 17781 18731 gene locus_tag LOCUS_01190 17781 18731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 18868 20577 gene locus_tag LOCUS_01200 18868 20577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 21047 20622 gene locus_tag LOCUS_01210 21047 20622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 21362 21144 gene locus_tag LOCUS_01220 21362 21144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 21517 21864 gene locus_tag LOCUS_01230 21517 21864 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640956.1 protein_id gnl|my_center|LOCUS_01230 21878 22474 gene locus_tag LOCUS_01240 gene recR 21878 22474 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_01240 22494 23465 gene locus_tag LOCUS_01250 gene prfA 22494 23465 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966168.1 protein_id gnl|my_center|LOCUS_01250 23568 24617 gene locus_tag LOCUS_01260 23568 24617 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947984.1 protein_id gnl|my_center|LOCUS_01260 24684 25124 gene locus_tag LOCUS_01270 24684 25124 CDS product low molecular weight protein arginine phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437844.1 protein_id gnl|my_center|LOCUS_01270 25151 25780 gene locus_tag LOCUS_01280 gene upp 25151 25780 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000517539.1 protein_id gnl|my_center|LOCUS_01280 >Feature sequence005 3425 201 gene locus_tag LOCUS_01290 gene carB 3425 201 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810321.1 protein_id gnl|my_center|LOCUS_01290 4403 3582 gene locus_tag LOCUS_01300 4403 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5406 4531 gene locus_tag LOCUS_01310 5406 4531 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000375198.1 protein_id gnl|my_center|LOCUS_01310 5524 5751 gene locus_tag LOCUS_01320 5524 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6501 5767 gene locus_tag LOCUS_01330 6501 5767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6641 7063 gene locus_tag LOCUS_01340 6641 7063 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413285.1 protein_id gnl|my_center|LOCUS_01340 7149 8312 gene locus_tag LOCUS_01350 7149 8312 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991766.1 protein_id gnl|my_center|LOCUS_01350 8343 8486 gene locus_tag LOCUS_01360 8343 8486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 8621 10444 gene locus_tag LOCUS_01370 8621 10444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10527 11168 gene locus_tag LOCUS_01380 gene lexA 10527 11168 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459777.1 protein_id gnl|my_center|LOCUS_01380 12092 11163 gene locus_tag LOCUS_01390 gene miaA 12092 11163 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_01390 13981 12089 gene locus_tag LOCUS_01400 gene mutL 13981 12089 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965141.1 protein_id gnl|my_center|LOCUS_01400 14186 13959 gene locus_tag LOCUS_01410 14186 13959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 14991 14176 gene locus_tag LOCUS_01420 gene minD 14991 14176 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419057.1 protein_id gnl|my_center|LOCUS_01420 17290 15116 gene locus_tag LOCUS_01430 17290 15116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 17938 17303 gene locus_tag LOCUS_01440 17938 17303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 18793 17939 gene locus_tag LOCUS_01450 gene mreC 18793 17939 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461822.1 protein_id gnl|my_center|LOCUS_01450 19825 18800 gene locus_tag LOCUS_01460 19825 18800 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428483.1 protein_id gnl|my_center|LOCUS_01460 20586 19855 gene locus_tag LOCUS_01470 gene radC 20586 19855 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964554.1 protein_id gnl|my_center|LOCUS_01470 20948 20682 gene locus_tag LOCUS_01480 20948 20682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 21207 21977 gene locus_tag LOCUS_01490 21207 21977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 22721 22089 gene locus_tag LOCUS_01500 22721 22089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 24039 22756 gene locus_tag LOCUS_01510 24039 22756 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769496.1 protein_id gnl|my_center|LOCUS_01510 <24671 24070 gene locus_tag LOCUS_01520 <24671 24070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438208.1:radical SAM protein >Feature sequence006 1118 342 gene locus_tag LOCUS_01530 1118 342 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948946.1 protein_id gnl|my_center|LOCUS_01530 2195 1131 gene locus_tag LOCUS_01540 2195 1131 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948945.1 protein_id gnl|my_center|LOCUS_01540 2706 2260 gene locus_tag LOCUS_01550 2706 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 2849 4153 gene locus_tag LOCUS_01560 2849 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4146 5459 gene locus_tag LOCUS_01570 4146 5459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 5484 5825 gene locus_tag LOCUS_01580 5484 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5898 7088 gene locus_tag LOCUS_01590 5898 7088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7113 8945 gene locus_tag LOCUS_01600 7113 8945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 8935 9960 gene locus_tag LOCUS_01610 gene queA 8935 9960 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861694.1 protein_id gnl|my_center|LOCUS_01610 10025 10150 gene locus_tag LOCUS_01620 10025 10150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01620 10277 11143 gene locus_tag LOCUS_01630 gene tgt 10277 11143 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01630 11173 11595 gene locus_tag LOCUS_01640 11173 11595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 11639 12709 gene locus_tag LOCUS_01650 gene asd 11639 12709 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963351.1 protein_id gnl|my_center|LOCUS_01650 12740 13630 gene locus_tag LOCUS_01660 gene dapA 12740 13630 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391089.1 protein_id gnl|my_center|LOCUS_01660 13685 14443 gene locus_tag LOCUS_01670 gene dapB 13685 14443 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048150.1 protein_id gnl|my_center|LOCUS_01670 15340 14438 gene locus_tag LOCUS_01680 15340 14438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 16815 15412 gene locus_tag LOCUS_01690 gene purF 16815 15412 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084785566.1 protein_id gnl|my_center|LOCUS_01690 16977 18125 gene locus_tag LOCUS_01700 16977 18125 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008667343.1 protein_id gnl|my_center|LOCUS_01700 18690 18157 gene locus_tag LOCUS_01710 18690 18157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 20318 18783 gene locus_tag LOCUS_01720 gene guaA 20318 18783 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048241.1 protein_id gnl|my_center|LOCUS_01720 20502 21407 gene locus_tag LOCUS_01730 20502 21407 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462306.1 protein_id gnl|my_center|LOCUS_01730 21488 22972 gene locus_tag LOCUS_01740 21488 22972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 23589 24059 gene locus_tag LOCUS_01750 23589 24059 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902885.1 protein_id gnl|my_center|LOCUS_01750 >Feature sequence007 1595 453 gene locus_tag LOCUS_01760 1595 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2767 1706 gene locus_tag LOCUS_01770 2767 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 4934 2745 gene locus_tag LOCUS_01780 4934 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 6154 4964 gene locus_tag LOCUS_01790 6154 4964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 7214 6219 gene locus_tag LOCUS_01800 7214 6219 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_01800 7537 7226 gene locus_tag LOCUS_01810 7537 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 9829 7556 gene locus_tag LOCUS_01820 9829 7556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 11008 9848 gene locus_tag LOCUS_01830 11008 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 12153 11005 gene locus_tag LOCUS_01840 12153 11005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 12718 12140 gene locus_tag LOCUS_01850 12718 12140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 13255 12815 gene locus_tag LOCUS_01860 13255 12815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 13699 13424 gene locus_tag LOCUS_01870 13699 13424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 14009 13713 gene locus_tag LOCUS_01880 14009 13713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 15283 14135 gene locus_tag LOCUS_01890 15283 14135 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048538409.1 protein_id gnl|my_center|LOCUS_01890 15667 15341 gene locus_tag LOCUS_01900 15667 15341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 18141 15754 gene locus_tag LOCUS_01910 18141 15754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 18842 18159 gene locus_tag LOCUS_01920 18842 18159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 20171 18873 gene locus_tag LOCUS_01930 20171 18873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01930 20274 21077 gene locus_tag LOCUS_01940 20274 21077 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545351.1 protein_id gnl|my_center|LOCUS_01940 21126 21872 gene locus_tag LOCUS_01950 21126 21872 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072774606.1 protein_id gnl|my_center|LOCUS_01950 <22801 21869 gene locus_tag LOCUS_01960 <22801 21869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941764.1:AMP-binding protein >Feature sequence008 2090 765 gene locus_tag LOCUS_01970 2090 765 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948726.1 protein_id gnl|my_center|LOCUS_01970 2826 2122 gene locus_tag LOCUS_01980 gene rgaR 2826 2122 CDS product two-component system response regulator RgaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432343.1 protein_id gnl|my_center|LOCUS_01980 3001 3714 gene locus_tag LOCUS_01990 3001 3714 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897780.1 protein_id gnl|my_center|LOCUS_01990 3811 3902 gene locus_tag LOCUS_t00020 3811 3902 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4152 4400 gene locus_tag LOCUS_02000 4152 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02000 4400 5329 gene locus_tag LOCUS_02010 4400 5329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02010 5567 5331 gene locus_tag LOCUS_02020 5567 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 6122 5613 gene locus_tag LOCUS_02030 6122 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 7588 6149 gene locus_tag LOCUS_02040 7588 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7976 7764 gene locus_tag LOCUS_02050 7976 7764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02050 9315 8056 gene locus_tag LOCUS_02060 9315 8056 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582759.1 protein_id gnl|my_center|LOCUS_02060 10586 9345 gene locus_tag LOCUS_02070 10586 9345 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202216.1 protein_id gnl|my_center|LOCUS_02070 10834 11754 gene locus_tag LOCUS_02080 10834 11754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 12110 13750 gene locus_tag LOCUS_02090 12110 13750 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_02090 14242 13820 gene locus_tag LOCUS_02100 14242 13820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 15651 14359 gene locus_tag LOCUS_02110 15651 14359 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048156.1 protein_id gnl|my_center|LOCUS_02110 17368 15803 gene locus_tag LOCUS_02120 gene cotA 17368 15803 CDS product outer spore coat copper-dependent laccase CotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243170.1 protein_id gnl|my_center|LOCUS_02120 17529 18143 gene locus_tag LOCUS_02130 17529 18143 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459566.1 protein_id gnl|my_center|LOCUS_02130 18225 18977 gene locus_tag LOCUS_02140 18225 18977 CDS product GH25 family lysozyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000727676.1 protein_id gnl|my_center|LOCUS_02140 20601 19234 gene locus_tag LOCUS_02150 20601 19234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 21691 20567 gene locus_tag LOCUS_02160 21691 20567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 >Feature sequence009 734 1942 gene locus_tag LOCUS_02170 734 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 2041 3768 gene locus_tag LOCUS_02180 2041 3768 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582658.1 protein_id gnl|my_center|LOCUS_02180 4197 3781 gene locus_tag LOCUS_02190 4197 3781 CDS product DUF2752 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728907.1 protein_id gnl|my_center|LOCUS_02190 4575 4201 gene locus_tag LOCUS_02200 4575 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5100 4699 gene locus_tag LOCUS_02210 5100 4699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 6107 5139 gene locus_tag LOCUS_02220 6107 5139 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803779.1 protein_id gnl|my_center|LOCUS_02220 6678 6163 gene locus_tag LOCUS_02230 6678 6163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 7319 6702 gene locus_tag LOCUS_02240 7319 6702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02240 7633 7301 gene locus_tag LOCUS_02250 7633 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02250 8482 7739 gene locus_tag LOCUS_02260 8482 7739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 9334 8483 gene locus_tag LOCUS_02270 9334 8483 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948845.1 protein_id gnl|my_center|LOCUS_02270 9698 9327 gene locus_tag LOCUS_02280 9698 9327 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948844.1 protein_id gnl|my_center|LOCUS_02280 10603 9809 gene locus_tag LOCUS_02290 10603 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02290 11125 10760 gene locus_tag LOCUS_02300 11125 10760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02300 11825 11151 gene locus_tag LOCUS_02310 11825 11151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 12945 11815 gene locus_tag LOCUS_02320 12945 11815 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000237280.1 protein_id gnl|my_center|LOCUS_02320 13433 13795 gene locus_tag LOCUS_02330 13433 13795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 13980 15107 gene locus_tag LOCUS_02340 13980 15107 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891769.1 protein_id gnl|my_center|LOCUS_02340 15116 15709 gene locus_tag LOCUS_02350 15116 15709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 15770 16018 gene locus_tag LOCUS_02360 15770 16018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 16040 16618 gene locus_tag LOCUS_02370 16040 16618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 16615 17253 gene locus_tag LOCUS_02380 16615 17253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 17253 18947 gene locus_tag LOCUS_02390 17253 18947 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_02390 19080 19724 gene locus_tag LOCUS_02400 19080 19724 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391958.1 protein_id gnl|my_center|LOCUS_02400 19721 20743 gene locus_tag LOCUS_02410 19721 20743 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_02410 20801 21400 gene locus_tag LOCUS_02420 20801 21400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence010 4347 931 gene locus_tag LOCUS_02430 4347 931 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963838.1 protein_id gnl|my_center|LOCUS_02430 6097 4367 gene locus_tag LOCUS_02440 6097 4367 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454107.1 protein_id gnl|my_center|LOCUS_02440 9858 6115 gene locus_tag LOCUS_02450 9858 6115 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964962.1 protein_id gnl|my_center|LOCUS_02450 12911 9966 gene locus_tag LOCUS_02460 12911 9966 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414652.1 protein_id gnl|my_center|LOCUS_02460 13062 13733 gene locus_tag LOCUS_02470 13062 13733 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948592.1 protein_id gnl|my_center|LOCUS_02470 13733 14761 gene locus_tag LOCUS_02480 13733 14761 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928176.1 protein_id gnl|my_center|LOCUS_02480 14766 15041 gene locus_tag LOCUS_02490 14766 15041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 15048 15263 gene locus_tag LOCUS_02500 15048 15263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 15293 15601 gene locus_tag LOCUS_02510 15293 15601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 17470 16013 gene locus_tag LOCUS_02520 17470 16013 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 protein_id gnl|my_center|LOCUS_02520 18753 17488 gene locus_tag LOCUS_02530 18753 17488 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790318.1 protein_id gnl|my_center|LOCUS_02530 20230 18863 gene locus_tag LOCUS_02540 gene spoIVA 20230 18863 CDS product stage IV sporulation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392832.1 protein_id gnl|my_center|LOCUS_02540 21065 20463 gene locus_tag LOCUS_02550 gene plsY 21065 20463 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426957.1 protein_id gnl|my_center|LOCUS_02550 21317 21066 gene locus_tag LOCUS_02560 21317 21066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence011 235 1218 gene locus_tag LOCUS_02570 gene hflK 235 1218 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004599754.1 protein_id gnl|my_center|LOCUS_02570 1232 1663 gene locus_tag LOCUS_02580 1232 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02580 1608 1931 gene locus_tag LOCUS_02590 1608 1931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1942 2457 gene locus_tag LOCUS_02600 1942 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2432 3856 gene locus_tag LOCUS_02610 2432 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 4701 3853 gene locus_tag LOCUS_02620 4701 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 7236 4789 gene locus_tag LOCUS_02630 gene lon 7236 4789 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435613.1 protein_id gnl|my_center|LOCUS_02630 7437 8783 gene locus_tag LOCUS_02640 7437 8783 CDS product putative DNA modification/repair radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966615.1 protein_id gnl|my_center|LOCUS_02640 8783 9538 gene locus_tag LOCUS_02650 8783 9538 CDS product TIGR03915 family putative DNA repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109278.1 protein_id gnl|my_center|LOCUS_02650 10317 9829 gene locus_tag LOCUS_02660 10317 9829 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774960.1 protein_id gnl|my_center|LOCUS_02660 11388 10333 gene locus_tag LOCUS_02670 11388 10333 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_02670 12205 11390 gene locus_tag LOCUS_02680 12205 11390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459711.1 protein_id gnl|my_center|LOCUS_02680 13059 12202 gene locus_tag LOCUS_02690 13059 12202 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964157.1 protein_id gnl|my_center|LOCUS_02690 14485 13037 gene locus_tag LOCUS_02700 14485 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 15063 14515 gene locus_tag LOCUS_02710 15063 14515 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418769.1 protein_id gnl|my_center|LOCUS_02710 16330 15266 gene locus_tag LOCUS_02720 16330 15266 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462098.1 protein_id gnl|my_center|LOCUS_02720 17747 16383 gene locus_tag LOCUS_02730 17747 16383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 17895 18896 gene locus_tag LOCUS_02740 17895 18896 CDS product lipoate--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812232.1 protein_id gnl|my_center|LOCUS_02740 19390 18893 gene locus_tag LOCUS_02750 19390 18893 CDS product SEC-C metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434936.1 protein_id gnl|my_center|LOCUS_02750 20192 19392 gene locus_tag LOCUS_02760 20192 19392 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436797.1 protein_id gnl|my_center|LOCUS_02760 20544 20194 gene locus_tag LOCUS_02770 gene rplT 20544 20194 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003222420.1 protein_id gnl|my_center|LOCUS_02770 20757 20560 gene locus_tag LOCUS_02780 gene rpmI 20757 20560 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393258.1 protein_id gnl|my_center|LOCUS_02780 >Feature sequence012 2395 200 gene locus_tag LOCUS_02790 gene gyrA 2395 200 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831812.1 protein_id gnl|my_center|LOCUS_02790 4375 2408 gene locus_tag LOCUS_02800 gene gyrB 4375 2408 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_02800 6383 4413 gene locus_tag LOCUS_02810 6383 4413 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244479.1 protein_id gnl|my_center|LOCUS_02810 7625 6495 gene locus_tag LOCUS_02820 7625 6495 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438072.1 protein_id gnl|my_center|LOCUS_02820 8268 7603 gene locus_tag LOCUS_02830 8268 7603 CDS product TIGR03936 family radical SAM-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460898.1 protein_id gnl|my_center|LOCUS_02830 10108 8258 gene locus_tag LOCUS_02840 10108 8258 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964566.1 protein_id gnl|my_center|LOCUS_02840 10252 10695 gene locus_tag LOCUS_02850 10252 10695 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964324.1 protein_id gnl|my_center|LOCUS_02850 12280 10682 gene locus_tag LOCUS_02860 12280 10682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 13753 12302 gene locus_tag LOCUS_02870 13753 12302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 14638 13775 gene locus_tag LOCUS_02880 14638 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 15570 14650 gene locus_tag LOCUS_02890 gene pfkB 15570 14650 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_02890 15720 15571 gene locus_tag LOCUS_02900 15720 15571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 16467 15733 gene locus_tag LOCUS_02910 16467 15733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 16784 16485 gene locus_tag LOCUS_02920 16784 16485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 17214 16777 gene locus_tag LOCUS_02930 gene ruvX 17214 16777 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_02930 17479 17225 gene locus_tag LOCUS_02940 17479 17225 CDS product IreB family regulatory phosphoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964986.1 protein_id gnl|my_center|LOCUS_02940 18853 17555 gene locus_tag LOCUS_02950 gene mtaB 18853 17555 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454735.1 protein_id gnl|my_center|LOCUS_02950 19173 18931 gene locus_tag LOCUS_02960 19173 18931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence013 820 1086 gene locus_tag LOCUS_02970 820 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1100 1372 gene locus_tag LOCUS_02980 1100 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 1374 2429 gene locus_tag LOCUS_02990 1374 2429 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_02990 2416 2730 gene locus_tag LOCUS_03000 2416 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2736 3554 gene locus_tag LOCUS_03010 2736 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3569 4039 gene locus_tag LOCUS_03020 3569 4039 CDS product S24/S26 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107087.1 protein_id gnl|my_center|LOCUS_03020 4041 4451 gene locus_tag LOCUS_03030 4041 4451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 4989 4456 gene locus_tag LOCUS_03040 4989 4456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6129 5008 gene locus_tag LOCUS_03050 6129 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6301 6933 gene locus_tag LOCUS_03060 6301 6933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 7085 7768 gene locus_tag LOCUS_03070 7085 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8438 9964 gene locus_tag LOCUS_03080 8438 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 10001 13030 gene locus_tag LOCUS_03090 10001 13030 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_03090 13939 13061 gene locus_tag LOCUS_03100 13939 13061 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762705.1 protein_id gnl|my_center|LOCUS_03100 14402 15673 gene locus_tag LOCUS_03110 14402 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 15675 17231 gene locus_tag LOCUS_03120 15675 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 19108 17267 gene locus_tag LOCUS_03130 19108 17267 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582880.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence014 938 1324 gene locus_tag LOCUS_03140 938 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2818 1466 gene locus_tag LOCUS_03150 2818 1466 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582770.1 protein_id gnl|my_center|LOCUS_03150 4582 3023 gene locus_tag LOCUS_03160 4582 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 5556 4594 gene locus_tag LOCUS_03170 5556 4594 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583936.1 protein_id gnl|my_center|LOCUS_03170 6431 5553 gene locus_tag LOCUS_03180 6431 5553 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583937.1 protein_id gnl|my_center|LOCUS_03180 8768 6447 gene locus_tag LOCUS_03190 8768 6447 CDS product DUF5696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583938.1 protein_id gnl|my_center|LOCUS_03190 10836 8761 gene locus_tag LOCUS_03200 10836 8761 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583939.1 protein_id gnl|my_center|LOCUS_03200 11729 10854 gene locus_tag LOCUS_03210 11729 10854 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259690.1 protein_id gnl|my_center|LOCUS_03210 12713 11736 gene locus_tag LOCUS_03220 12713 11736 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583941.1 protein_id gnl|my_center|LOCUS_03220 15766 12731 gene locus_tag LOCUS_03230 15766 12731 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583942.1 protein_id gnl|my_center|LOCUS_03230 17359 15941 gene locus_tag LOCUS_03240 gene murD 17359 15941 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048369.1 protein_id gnl|my_center|LOCUS_03240 17612 18229 gene locus_tag LOCUS_03250 17612 18229 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966126.1 protein_id gnl|my_center|LOCUS_03250 <19284 18259 gene locus_tag LOCUS_03260 <19284 18259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009966541.1:aspartate kinase >Feature sequence015 1159 431 gene locus_tag LOCUS_03270 1159 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1933 1274 gene locus_tag LOCUS_03280 1933 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 2356 2009 gene locus_tag LOCUS_03290 2356 2009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 2659 3858 gene locus_tag LOCUS_03300 2659 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328450.1 protein_id gnl|my_center|LOCUS_03300 3855 4682 gene locus_tag LOCUS_03310 gene ulaE 3855 4682 CDS product L-ribulose-5-phosphate 3-epimerase UlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000949539.1 protein_id gnl|my_center|LOCUS_03310 4687 6081 gene locus_tag LOCUS_03320 4687 6081 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389559.1 protein_id gnl|my_center|LOCUS_03320 6151 6840 gene locus_tag LOCUS_03330 gene araD 6151 6840 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897453.1 protein_id gnl|my_center|LOCUS_03330 6888 7163 gene locus_tag LOCUS_03340 6888 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 9282 7357 gene locus_tag LOCUS_03350 9282 7357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 9918 9319 gene locus_tag LOCUS_03360 9918 9319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 10375 13728 gene locus_tag LOCUS_03370 10375 13728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 14538 13732 gene locus_tag LOCUS_03380 14538 13732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 15873 14695 gene locus_tag LOCUS_03390 15873 14695 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948998.1 protein_id gnl|my_center|LOCUS_03390 16369 15965 gene locus_tag LOCUS_03400 16369 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 16621 18126 gene locus_tag LOCUS_03410 16621 18126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 >Feature sequence016 177 2423 gene locus_tag LOCUS_03420 177 2423 CDS product stage V sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392356.1 protein_id gnl|my_center|LOCUS_03420 2439 3917 gene locus_tag LOCUS_03430 2439 3917 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_03430 3917 5329 gene locus_tag LOCUS_03440 3917 5329 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861626.1 protein_id gnl|my_center|LOCUS_03440 5326 6300 gene locus_tag LOCUS_03450 gene mraY 5326 6300 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358738.1 protein_id gnl|my_center|LOCUS_03450 6324 7457 gene locus_tag LOCUS_03460 gene ftsW 6324 7457 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_03460 7818 7396 gene locus_tag LOCUS_03470 7818 7396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 7956 10598 gene locus_tag LOCUS_03480 gene polA 7956 10598 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964413.1 protein_id gnl|my_center|LOCUS_03480 10612 11214 gene locus_tag LOCUS_03490 gene coaE 10612 11214 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475784.1 protein_id gnl|my_center|LOCUS_03490 11226 12554 gene locus_tag LOCUS_03500 11226 12554 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584145.1 protein_id gnl|my_center|LOCUS_03500 12573 14891 gene locus_tag LOCUS_03510 12573 14891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 15985 14936 gene locus_tag LOCUS_03520 15985 14936 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930784.1 protein_id gnl|my_center|LOCUS_03520 17114 16020 gene locus_tag LOCUS_03530 gene ychF 17114 16020 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427022.1 protein_id gnl|my_center|LOCUS_03530 17240 17935 gene locus_tag LOCUS_03540 17240 17935 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966496.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence017 1456 146 gene locus_tag LOCUS_03550 1456 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2866 1481 gene locus_tag LOCUS_03560 2866 1481 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048439.1 protein_id gnl|my_center|LOCUS_03560 3067 4188 gene locus_tag LOCUS_03570 3067 4188 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938366.1 protein_id gnl|my_center|LOCUS_03570 4276 5814 gene locus_tag LOCUS_03580 4276 5814 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_03580 5811 6896 gene locus_tag LOCUS_03590 5811 6896 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_03590 6893 7831 gene locus_tag LOCUS_03600 6893 7831 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_03600 7906 8244 gene locus_tag LOCUS_03610 7906 8244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 8442 9446 gene locus_tag LOCUS_03620 gene trpS 8442 9446 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165552.1 protein_id gnl|my_center|LOCUS_03620 9446 11434 gene locus_tag LOCUS_03630 gene uvrB 9446 11434 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391795.1 protein_id gnl|my_center|LOCUS_03630 11449 14265 gene locus_tag LOCUS_03640 gene uvrA 11449 14265 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391799.1 protein_id gnl|my_center|LOCUS_03640 14258 16606 gene locus_tag LOCUS_03650 14258 16606 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964222.1 protein_id gnl|my_center|LOCUS_03650 16617 17804 gene locus_tag LOCUS_03660 gene argJ 16617 17804 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_03660 >Feature sequence018 <1 686 gene locus_tag LOCUS_03670 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964575.1:bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK 686 1030 gene locus_tag LOCUS_03680 gene rsfS 686 1030 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546466.1 protein_id gnl|my_center|LOCUS_03680 1192 1833 gene locus_tag LOCUS_03690 1192 1833 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880861.1 protein_id gnl|my_center|LOCUS_03690 2300 1830 gene locus_tag LOCUS_03700 2300 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 2476 4236 gene locus_tag LOCUS_03710 2476 4236 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759749.1 protein_id gnl|my_center|LOCUS_03710 4825 4280 gene locus_tag LOCUS_03720 gene raiA 4825 4280 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966132.1 protein_id gnl|my_center|LOCUS_03720 5120 5929 gene locus_tag LOCUS_03730 5120 5929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03730 5996 6343 gene locus_tag LOCUS_03740 5996 6343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03740 6340 7683 gene locus_tag LOCUS_03750 6340 7683 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103654.1 protein_id gnl|my_center|LOCUS_03750 7701 8681 gene locus_tag LOCUS_03760 7701 8681 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242543.1 protein_id gnl|my_center|LOCUS_03760 8686 9960 gene locus_tag LOCUS_03770 8686 9960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 9964 12156 gene locus_tag LOCUS_03780 9964 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 12256 12438 gene locus_tag LOCUS_03790 12256 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 13543 12440 gene locus_tag LOCUS_03800 13543 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 13631 14548 gene locus_tag LOCUS_03810 13631 14548 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_03810 14842 16155 gene locus_tag LOCUS_03820 14842 16155 CDS product arsenical efflux pump membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723436.1 protein_id gnl|my_center|LOCUS_03820 16240 17733 gene locus_tag LOCUS_03830 gene miaB 16240 17733 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435252.1 protein_id gnl|my_center|LOCUS_03830 17757 18134 gene locus_tag LOCUS_03840 17757 18134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 >Feature sequence019 222 1481 gene locus_tag LOCUS_03850 222 1481 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939821.1 protein_id gnl|my_center|LOCUS_03850 2992 1529 gene locus_tag LOCUS_03860 gene thrC 2992 1529 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964317.1 protein_id gnl|my_center|LOCUS_03860 4384 3041 gene locus_tag LOCUS_03870 4384 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 7162 4421 gene locus_tag LOCUS_03880 gene secA 7162 4421 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221404.1 protein_id gnl|my_center|LOCUS_03880 7464 7168 gene locus_tag LOCUS_03890 7464 7168 CDS product YerC/YecD family TrpR-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393534.1 protein_id gnl|my_center|LOCUS_03890 8110 7532 gene locus_tag LOCUS_03900 gene yfbR 8110 7532 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 protein_id gnl|my_center|LOCUS_03900 9264 8125 gene locus_tag LOCUS_03910 9264 8125 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_03910 10283 9369 gene locus_tag LOCUS_03920 10283 9369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 11294 10329 gene locus_tag LOCUS_03930 11294 10329 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690405.1 protein_id gnl|my_center|LOCUS_03930 12273 11323 gene locus_tag LOCUS_03940 gene prfB 12273 11323 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096001716.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03940 14618 12474 gene locus_tag LOCUS_03950 gene rnr 14618 12474 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948032.1 protein_id gnl|my_center|LOCUS_03950 14937 14683 gene locus_tag LOCUS_03960 14937 14683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 15885 15022 gene locus_tag LOCUS_03970 15885 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 17836 15875 gene locus_tag LOCUS_03980 17836 15875 CDS product bifunctional phosphoglycerate kinase/triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081072.1 protein_id gnl|my_center|LOCUS_03980 18238 17933 gene locus_tag LOCUS_03990 18238 17933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence020 729 1157 gene locus_tag LOCUS_04000 729 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1482 3944 gene locus_tag LOCUS_04010 1482 3944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 3958 5079 gene locus_tag LOCUS_04020 3958 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 6373 5396 gene locus_tag LOCUS_04030 6373 5396 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583289.1 protein_id gnl|my_center|LOCUS_04030 6474 8318 gene locus_tag LOCUS_04040 6474 8318 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658063.1 protein_id gnl|my_center|LOCUS_04040 8378 9121 gene locus_tag LOCUS_04050 8378 9121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 9279 10646 gene locus_tag LOCUS_04060 9279 10646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 10716 13640 gene locus_tag LOCUS_04070 10716 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 14233 13676 gene locus_tag LOCUS_04080 14233 13676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 15743 14490 gene locus_tag LOCUS_04090 15743 14490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 16015 16710 gene locus_tag LOCUS_04100 16015 16710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence021 1860 415 gene locus_tag LOCUS_04110 1860 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2847 1912 gene locus_tag LOCUS_04120 2847 1912 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_04120 3697 2852 gene locus_tag LOCUS_04130 3697 2852 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003389978.1 protein_id gnl|my_center|LOCUS_04130 4169 3723 gene locus_tag LOCUS_04140 gene rpiB 4169 3723 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721856.1 protein_id gnl|my_center|LOCUS_04140 4806 4387 gene locus_tag LOCUS_04150 4806 4387 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722322.1 protein_id gnl|my_center|LOCUS_04150 5637 4888 gene locus_tag LOCUS_04160 5637 4888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5937 5641 gene locus_tag LOCUS_04170 5937 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6109 7431 gene locus_tag LOCUS_04180 6109 7431 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080429.1 protein_id gnl|my_center|LOCUS_04180 7953 7432 gene locus_tag LOCUS_04190 gene nrdG 7953 7432 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810328.1 protein_id gnl|my_center|LOCUS_04190 10291 7937 gene locus_tag LOCUS_04200 10291 7937 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459055.1 protein_id gnl|my_center|LOCUS_04200 12021 10369 gene locus_tag LOCUS_04210 12021 10369 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_04210 13115 12045 gene locus_tag LOCUS_04220 13115 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 14264 13194 gene locus_tag LOCUS_04230 14264 13194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14424 16148 gene locus_tag LOCUS_04240 14424 16148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence022 218 1549 gene locus_tag LOCUS_04250 218 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2796 1621 gene locus_tag LOCUS_04260 2796 1621 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392702.1 protein_id gnl|my_center|LOCUS_04260 3272 2793 gene locus_tag LOCUS_04270 3272 2793 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774673.1 protein_id gnl|my_center|LOCUS_04270 3849 3334 gene locus_tag LOCUS_04280 3849 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3979 4737 gene locus_tag LOCUS_04290 gene hisF 3979 4737 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_04290 5862 4768 gene locus_tag LOCUS_04300 5862 4768 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_04300 6094 6492 gene locus_tag LOCUS_04310 6094 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 6590 7357 gene locus_tag LOCUS_04320 gene pdaB 6590 7357 CDS product polysaccharide deacetylase family sporulation protein PdaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048155.1 protein_id gnl|my_center|LOCUS_04320 7449 8096 gene locus_tag LOCUS_04330 7449 8096 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965678.1 protein_id gnl|my_center|LOCUS_04330 8151 8561 gene locus_tag LOCUS_04340 8151 8561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048265.1 protein_id gnl|my_center|LOCUS_04340 8643 10871 gene locus_tag LOCUS_04350 gene priA 8643 10871 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047882.1 protein_id gnl|my_center|LOCUS_04350 10949 11437 gene locus_tag LOCUS_04360 gene def 10949 11437 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431159.1 protein_id gnl|my_center|LOCUS_04360 11441 12382 gene locus_tag LOCUS_04370 gene fmt 11441 12382 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861609.1 protein_id gnl|my_center|LOCUS_04370 12393 13301 gene locus_tag LOCUS_04380 gene rlmN 12393 13301 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_04380 13229 13411 gene locus_tag LOCUS_04390 13229 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04390 13415 14146 gene locus_tag LOCUS_04400 13415 14146 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_04400 14162 16396 gene locus_tag LOCUS_04410 14162 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 16393 17277 gene locus_tag LOCUS_04420 gene rsgA 16393 17277 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893669.1 protein_id gnl|my_center|LOCUS_04420 >Feature sequence023 1009 1176 gene locus_tag LOCUS_04430 1009 1176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 1325 1675 gene locus_tag LOCUS_04440 1325 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2022 2705 gene locus_tag LOCUS_04450 2022 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2799 3584 gene locus_tag LOCUS_04460 2799 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3816 4337 gene locus_tag LOCUS_04470 3816 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4445 4792 gene locus_tag LOCUS_04480 4445 4792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 5538 7652 gene locus_tag LOCUS_04490 5538 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 7625 8629 gene locus_tag LOCUS_04500 gene mcrC 7625 8629 CDS product 5-methylcytosine-specific restriction endonuclease system specificity protein McrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011922381.1 protein_id gnl|my_center|LOCUS_04500 8926 10407 gene locus_tag LOCUS_04510 8926 10407 CDS product Lsa family ABC-F type ribosomal protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987127.1 protein_id gnl|my_center|LOCUS_04510 10477 10866 gene locus_tag LOCUS_04520 10477 10866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 10899 11669 gene locus_tag LOCUS_04530 gene ygiD 10899 11669 CDS product 4,5-DOPA dioxygenase extradiol inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324092.1 protein_id gnl|my_center|LOCUS_04530 11695 12246 gene locus_tag LOCUS_04540 11695 12246 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017046.1 protein_id gnl|my_center|LOCUS_04540 12271 12786 gene locus_tag LOCUS_04550 12271 12786 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707124.1 protein_id gnl|my_center|LOCUS_04550 13018 13926 gene locus_tag LOCUS_04560 13018 13926 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814967.1 protein_id gnl|my_center|LOCUS_04560 14016 14990 gene locus_tag LOCUS_04570 14016 14990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 16553 15012 gene locus_tag LOCUS_04580 16553 15012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 <17566 16555 gene locus_tag LOCUS_04590 <17566 16555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930970.1:MMPL family transporter >Feature sequence024 1259 2329 gene locus_tag LOCUS_04600 1259 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 2420 2920 gene locus_tag LOCUS_04610 2420 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 3922 2906 gene locus_tag LOCUS_04620 3922 2906 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767104.1 protein_id gnl|my_center|LOCUS_04620 4049 5311 gene locus_tag LOCUS_04630 gene rhaA 4049 5311 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288249.1 protein_id gnl|my_center|LOCUS_04630 5325 7826 gene locus_tag LOCUS_04640 5325 7826 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955702.1 protein_id gnl|my_center|LOCUS_04640 8973 7867 gene locus_tag LOCUS_04650 8973 7867 CDS product DUF2961 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287020.1 protein_id gnl|my_center|LOCUS_04650 9175 9831 gene locus_tag LOCUS_04660 9175 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 9970 11049 gene locus_tag LOCUS_04670 gene gcvT 9970 11049 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398598.1 protein_id gnl|my_center|LOCUS_04670 11078 11452 gene locus_tag LOCUS_04680 11078 11452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 11456 12775 gene locus_tag LOCUS_04690 11456 12775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 12766 14196 gene locus_tag LOCUS_04700 gene gcvPB 12766 14196 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679310.1 protein_id gnl|my_center|LOCUS_04700 14349 15392 gene locus_tag LOCUS_04710 14349 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence025 <1 1210 gene locus_tag LOCUS_04720 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764424.1:flotillin family protein 1585 2772 gene locus_tag LOCUS_04730 1585 2772 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943599.1 protein_id gnl|my_center|LOCUS_04730 2860 5019 gene locus_tag LOCUS_04740 2860 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 5039 5683 gene locus_tag LOCUS_04750 5039 5683 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_04750 5700 6380 gene locus_tag LOCUS_04760 5700 6380 CDS product D-lyxose/D-mannose family sugar isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209520.1 protein_id gnl|my_center|LOCUS_04760 6388 7260 gene locus_tag LOCUS_04770 6388 7260 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_04770 8729 7248 gene locus_tag LOCUS_04780 8729 7248 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099524.1 protein_id gnl|my_center|LOCUS_04780 9081 8827 gene locus_tag LOCUS_04790 9081 8827 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986396.1 protein_id gnl|my_center|LOCUS_04790 9282 10451 gene locus_tag LOCUS_04800 9282 10451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 10461 11348 gene locus_tag LOCUS_04810 10461 11348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 11509 12435 gene locus_tag LOCUS_04820 gene nadA 11509 12435 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870480.1 protein_id gnl|my_center|LOCUS_04820 12467 14083 gene locus_tag LOCUS_04830 gene nadB 12467 14083 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583120.1 protein_id gnl|my_center|LOCUS_04830 14090 14938 gene locus_tag LOCUS_04840 gene nadC 14090 14938 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_04840 15034 16152 gene locus_tag LOCUS_04850 gene spoIID 15034 16152 CDS product stage II sporulation protein D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432452.1 protein_id gnl|my_center|LOCUS_04850 16403 16164 gene locus_tag LOCUS_04860 16403 16164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 16983 16384 gene locus_tag LOCUS_04870 16983 16384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence026 311 1135 gene locus_tag LOCUS_04880 gene rpsB 311 1135 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362578.1 protein_id gnl|my_center|LOCUS_04880 1154 1801 gene locus_tag LOCUS_04890 gene tsf 1154 1801 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460416.1 protein_id gnl|my_center|LOCUS_04890 1858 2586 gene locus_tag LOCUS_04900 gene pyrH 1858 2586 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362575.1 protein_id gnl|my_center|LOCUS_04900 2667 3539 gene locus_tag LOCUS_04910 2667 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 4004 3528 gene locus_tag LOCUS_04920 gene ispF 4004 3528 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871789.1 protein_id gnl|my_center|LOCUS_04920 4465 4016 gene locus_tag LOCUS_04930 gene dut 4465 4016 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016845.1 protein_id gnl|my_center|LOCUS_04930 5356 4475 gene locus_tag LOCUS_04940 5356 4475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6330 5353 gene locus_tag LOCUS_04950 6330 5353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04950 6921 6409 gene locus_tag LOCUS_04960 6921 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04960 7313 6918 gene locus_tag LOCUS_04970 7313 6918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 7550 8830 gene locus_tag LOCUS_04980 7550 8830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8827 9453 gene locus_tag LOCUS_04990 8827 9453 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986882.1 protein_id gnl|my_center|LOCUS_04990 9466 10725 gene locus_tag LOCUS_05000 9466 10725 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986881.1 protein_id gnl|my_center|LOCUS_05000 10729 11463 gene locus_tag LOCUS_05010 10729 11463 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047983.1 protein_id gnl|my_center|LOCUS_05010 11465 12832 gene locus_tag LOCUS_05020 11465 12832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 12833 14056 gene locus_tag LOCUS_05030 12833 14056 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776619.1 protein_id gnl|my_center|LOCUS_05030 14095 15210 gene locus_tag LOCUS_05040 14095 15210 CDS product capsular polysaccharide biosynthesis protein CapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202261.1 protein_id gnl|my_center|LOCUS_05040 15221 16348 gene locus_tag LOCUS_05050 gene cap8G 15221 16348 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence027 1322 111 gene locus_tag LOCUS_05060 1322 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2082 1285 gene locus_tag LOCUS_05070 2082 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 2039 2248 gene locus_tag LOCUS_05080 2039 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2426 2680 gene locus_tag LOCUS_05090 2426 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 3063 2791 gene locus_tag LOCUS_05100 3063 2791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 4474 3047 gene locus_tag LOCUS_05110 4474 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4730 4467 gene locus_tag LOCUS_05120 4730 4467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5526 4642 gene locus_tag LOCUS_05130 5526 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6347 5523 gene locus_tag LOCUS_05140 6347 5523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 7075 6344 gene locus_tag LOCUS_05150 gene cps4B 7075 6344 CDS product capsular polysaccharide biosynthesis protein Cps4B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837624.1 protein_id gnl|my_center|LOCUS_05150 7748 7260 gene locus_tag LOCUS_05160 7748 7260 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068139.1 protein_id gnl|my_center|LOCUS_05160 8805 7816 gene locus_tag LOCUS_05170 8805 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 9164 8982 gene locus_tag LOCUS_05180 9164 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 9989 9201 gene locus_tag LOCUS_05190 9989 9201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 10824 10054 gene locus_tag LOCUS_05200 10824 10054 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_05200 11679 10837 gene locus_tag LOCUS_05210 gene kduI 11679 10837 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423611.1 protein_id gnl|my_center|LOCUS_05210 13318 11696 gene locus_tag LOCUS_05220 13318 11696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 13931 13416 gene locus_tag LOCUS_05230 gene nusG 13931 13416 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810198.1 protein_id gnl|my_center|LOCUS_05230 14677 13946 gene locus_tag LOCUS_05240 14677 13946 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_05240 15497 14709 gene locus_tag LOCUS_05250 15497 14709 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467944.1 protein_id gnl|my_center|LOCUS_05250 16539 15793 gene locus_tag LOCUS_05260 16539 15793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 >Feature sequence028 2095 2217 gene locus_tag LOCUS_05270 2095 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 2214 3182 gene locus_tag LOCUS_05280 2214 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 3194 3451 gene locus_tag LOCUS_05290 3194 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 3448 3657 gene locus_tag LOCUS_05300 3448 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3894 4316 gene locus_tag LOCUS_05310 3894 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 4467 4886 gene locus_tag LOCUS_05320 4467 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5213 5770 gene locus_tag LOCUS_05330 5213 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 5767 6489 gene locus_tag LOCUS_05340 5767 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 6731 6447 gene locus_tag LOCUS_05350 6731 6447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6865 7095 gene locus_tag LOCUS_05360 6865 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 7100 7291 gene locus_tag LOCUS_05370 7100 7291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 7288 8049 gene locus_tag LOCUS_05380 7288 8049 CDS product phage antirepressor Ant inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389859.1 protein_id gnl|my_center|LOCUS_05380 8183 8374 gene locus_tag LOCUS_05390 8183 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 8459 8707 gene locus_tag LOCUS_05400 8459 8707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001246457.1 protein_id gnl|my_center|LOCUS_05400 8709 9320 gene locus_tag LOCUS_05410 8709 9320 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680282.1 protein_id gnl|my_center|LOCUS_05410 9345 9485 gene locus_tag LOCUS_05420 9345 9485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 9478 9660 gene locus_tag LOCUS_05430 9478 9660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 9657 9866 gene locus_tag LOCUS_05440 9657 9866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 9866 10255 gene locus_tag LOCUS_05450 9866 10255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 10233 10535 gene locus_tag LOCUS_05460 10233 10535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 10593 11531 gene locus_tag LOCUS_05470 10593 11531 CDS product YqaJ viral recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398673.1 protein_id gnl|my_center|LOCUS_05470 11546 12373 gene locus_tag LOCUS_05480 gene recT 11546 12373 CDS product recombination protein RecT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166313.1 protein_id gnl|my_center|LOCUS_05480 12370 12789 gene locus_tag LOCUS_05490 12370 12789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 12802 13035 gene locus_tag LOCUS_05500 12802 13035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 13013 13846 gene locus_tag LOCUS_05510 13013 13846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 13773 14597 gene locus_tag LOCUS_05520 13773 14597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 14669 15007 gene locus_tag LOCUS_05530 14669 15007 CDS product DUF1064 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047828.1 protein_id gnl|my_center|LOCUS_05530 15013 15291 gene locus_tag LOCUS_05540 15013 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 15260 15562 gene locus_tag LOCUS_05550 15260 15562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 15566 15844 gene locus_tag LOCUS_05560 15566 15844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 15866 16327 gene locus_tag LOCUS_05570 15866 16327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 16366 16587 gene locus_tag LOCUS_05580 16366 16587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence029 <1 1013 gene locus_tag LOCUS_05590 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272661.1:DUF362 domain-containing protein 1349 2308 gene locus_tag LOCUS_05600 1349 2308 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812740.1 protein_id gnl|my_center|LOCUS_05600 2331 3308 gene locus_tag LOCUS_05610 2331 3308 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002204710.1 protein_id gnl|my_center|LOCUS_05610 3301 4065 gene locus_tag LOCUS_05620 3301 4065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000025760.1 protein_id gnl|my_center|LOCUS_05620 5063 4113 gene locus_tag LOCUS_05630 5063 4113 CDS product 4Fe-4S-binding domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430299.1 protein_id gnl|my_center|LOCUS_05630 6707 5085 gene locus_tag LOCUS_05640 6707 5085 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439500.1 protein_id gnl|my_center|LOCUS_05640 6839 7759 gene locus_tag LOCUS_05650 6839 7759 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439497.1 protein_id gnl|my_center|LOCUS_05650 7776 8114 gene locus_tag LOCUS_05660 7776 8114 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461224.1 protein_id gnl|my_center|LOCUS_05660 8388 9023 gene locus_tag LOCUS_05670 8388 9023 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459534.1 protein_id gnl|my_center|LOCUS_05670 9038 10015 gene locus_tag LOCUS_05680 9038 10015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10139 10585 gene locus_tag LOCUS_05690 10139 10585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 10575 11474 gene locus_tag LOCUS_05700 10575 11474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 11477 13375 gene locus_tag LOCUS_05710 11477 13375 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475586.1 protein_id gnl|my_center|LOCUS_05710 14392 13415 gene locus_tag LOCUS_05720 14392 13415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 14590 14517 gene locus_tag LOCUS_t00030 14590 14517 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15134 15544 gene locus_tag LOCUS_05730 15134 15544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05730 15594 15752 gene locus_tag LOCUS_05740 15594 15752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 15822 16427 gene locus_tag LOCUS_05750 15822 16427 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061603095.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence030 341 712 gene locus_tag LOCUS_05760 341 712 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811011.1 protein_id gnl|my_center|LOCUS_05760 1113 805 gene locus_tag LOCUS_05770 1113 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1480 1187 gene locus_tag LOCUS_05780 1480 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1617 2648 gene locus_tag LOCUS_05790 1617 2648 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096064.1 protein_id gnl|my_center|LOCUS_05790 2695 3390 gene locus_tag LOCUS_05800 2695 3390 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965935.1 protein_id gnl|my_center|LOCUS_05800 3494 4168 gene locus_tag LOCUS_05810 3494 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6016 4196 gene locus_tag LOCUS_05820 6016 4196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 7337 6018 gene locus_tag LOCUS_05830 7337 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 7505 8260 gene locus_tag LOCUS_05840 gene flgF 7505 8260 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557363.1 protein_id gnl|my_center|LOCUS_05840 8272 8982 gene locus_tag LOCUS_05850 gene flgG 8272 8982 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081929.1 protein_id gnl|my_center|LOCUS_05850 9011 9454 gene locus_tag LOCUS_05860 9011 9454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 9470 9757 gene locus_tag LOCUS_05870 9470 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 9772 10281 gene locus_tag LOCUS_05880 9772 10281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 10291 11778 gene locus_tag LOCUS_05890 gene flgK 10291 11778 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392267.1 protein_id gnl|my_center|LOCUS_05890 11813 12736 gene locus_tag LOCUS_05900 gene flgL 11813 12736 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_05900 12751 13356 gene locus_tag LOCUS_05910 12751 13356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 13368 13853 gene locus_tag LOCUS_05920 gene fliW 13368 13853 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965508.1 protein_id gnl|my_center|LOCUS_05920 13825 14031 gene locus_tag LOCUS_05930 13825 14031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 14161 15024 gene locus_tag LOCUS_05940 14161 15024 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987021.1 protein_id gnl|my_center|LOCUS_05940 15093 15947 gene locus_tag LOCUS_05950 gene hag 15093 15947 CDS product flagellin Hag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166847803.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence031 2184 145 gene locus_tag LOCUS_05960 2184 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3444 2335 gene locus_tag LOCUS_05970 gene dnaJ 3444 2335 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392123.1 protein_id gnl|my_center|LOCUS_05970 5410 3557 gene locus_tag LOCUS_05980 gene dnaK 5410 3557 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392122.1 protein_id gnl|my_center|LOCUS_05980 6079 5471 gene locus_tag LOCUS_05990 gene grpE 6079 5471 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964593.1 protein_id gnl|my_center|LOCUS_05990 7169 6120 gene locus_tag LOCUS_06000 gene hrcA 7169 6120 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357960.1 protein_id gnl|my_center|LOCUS_06000 8415 7270 gene locus_tag LOCUS_06010 gene roeA 8415 7270 CDS product diguanylate cyclase RoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082226.1 protein_id gnl|my_center|LOCUS_06010 8767 9165 gene locus_tag LOCUS_06020 8767 9165 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461281.1 protein_id gnl|my_center|LOCUS_06020 9205 9627 gene locus_tag LOCUS_06030 9205 9627 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966974.1 protein_id gnl|my_center|LOCUS_06030 10460 9654 gene locus_tag LOCUS_06040 10460 9654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 11371 10475 gene locus_tag LOCUS_06050 gene pyrD 11371 10475 CDS product dihydroorotate oxidase B catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081057.1 protein_id gnl|my_center|LOCUS_06050 12125 11364 gene locus_tag LOCUS_06060 12125 11364 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048208.1 protein_id gnl|my_center|LOCUS_06060 13039 12122 gene locus_tag LOCUS_06070 gene pyrF 13039 12122 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922551.1 protein_id gnl|my_center|LOCUS_06070 14267 13044 gene locus_tag LOCUS_06080 14267 13044 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_06080 15181 14279 gene locus_tag LOCUS_06090 15181 14279 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768321.1 protein_id gnl|my_center|LOCUS_06090 15717 15184 gene locus_tag LOCUS_06100 gene pyrR 15717 15184 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence032 387 463 gene locus_tag LOCUS_t00040 387 463 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1364 666 gene locus_tag LOCUS_06110 1364 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06110 1784 1458 gene locus_tag LOCUS_06120 1784 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06120 1947 1777 gene locus_tag LOCUS_06130 1947 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 2924 2136 gene locus_tag LOCUS_06140 2924 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3799 3080 gene locus_tag LOCUS_06150 3799 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 4260 5474 gene locus_tag LOCUS_06160 4260 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 6346 5495 gene locus_tag LOCUS_06170 6346 5495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 7273 6407 gene locus_tag LOCUS_06180 7273 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 8508 7270 gene locus_tag LOCUS_06190 8508 7270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 8671 9255 gene locus_tag LOCUS_06200 8671 9255 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948351.1 protein_id gnl|my_center|LOCUS_06200 11053 9290 gene locus_tag LOCUS_06210 11053 9290 CDS product DUF4038 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922209.1 protein_id gnl|my_center|LOCUS_06210 11210 11569 gene locus_tag LOCUS_06220 11210 11569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 11529 12005 gene locus_tag LOCUS_06230 11529 12005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 12107 13303 gene locus_tag LOCUS_06240 12107 13303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 13508 13347 gene locus_tag LOCUS_06250 13508 13347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 14964 13912 gene locus_tag LOCUS_06260 14964 13912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06260 15650 14994 gene locus_tag LOCUS_06270 15650 14994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06270 15915 15673 gene locus_tag LOCUS_06280 15915 15673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence033 1581 760 gene locus_tag LOCUS_06290 1581 760 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976046.1 protein_id gnl|my_center|LOCUS_06290 2460 1606 gene locus_tag LOCUS_06300 2460 1606 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987041.1 protein_id gnl|my_center|LOCUS_06300 3789 2476 gene locus_tag LOCUS_06310 3789 2476 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065074.1 protein_id gnl|my_center|LOCUS_06310 4610 3777 gene locus_tag LOCUS_06320 4610 3777 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986426.1 protein_id gnl|my_center|LOCUS_06320 5641 4661 gene locus_tag LOCUS_06330 5641 4661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 7757 5628 gene locus_tag LOCUS_06340 7757 5628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 7947 7765 gene locus_tag LOCUS_06350 7947 7765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 8100 9224 gene locus_tag LOCUS_06360 gene dacF 8100 9224 CDS product D-alanyl-D-alanine carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398637.1 protein_id gnl|my_center|LOCUS_06360 9259 9960 gene locus_tag LOCUS_06370 9259 9960 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458912.1 protein_id gnl|my_center|LOCUS_06370 10643 9951 gene locus_tag LOCUS_06380 10643 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809375.1 protein_id gnl|my_center|LOCUS_06380 11915 10695 gene locus_tag LOCUS_06390 11915 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 12343 12068 gene locus_tag LOCUS_06400 12343 12068 CDS product YdbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986552.1 protein_id gnl|my_center|LOCUS_06400 12483 13064 gene locus_tag LOCUS_06410 12483 13064 CDS product carbohydrate-binding family 9-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762936.1 protein_id gnl|my_center|LOCUS_06410 14265 13051 gene locus_tag LOCUS_06420 gene pepT 14265 13051 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963798.1 protein_id gnl|my_center|LOCUS_06420 <15847 14268 gene locus_tag LOCUS_06430 <15847 14268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107588.1:DUF4838 domain-containing protein >Feature sequence034 579 367 gene locus_tag LOCUS_06440 579 367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 1202 552 gene locus_tag LOCUS_06450 1202 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06450 1591 1199 gene locus_tag LOCUS_06460 1591 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1821 2219 gene locus_tag LOCUS_06470 1821 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3189 2221 gene locus_tag LOCUS_06480 3189 2221 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965723.1 protein_id gnl|my_center|LOCUS_06480 4267 3170 gene locus_tag LOCUS_06490 4267 3170 CDS product 2-hydroxyglutaryl-CoA dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099516.1 protein_id gnl|my_center|LOCUS_06490 5159 4434 gene locus_tag LOCUS_06500 5159 4434 CDS product acyl-CoA dehydratase activase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048180.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06500 5335 6582 gene locus_tag LOCUS_06510 5335 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06510 6549 6860 gene locus_tag LOCUS_06520 6549 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06520 10521 6967 gene locus_tag LOCUS_06530 gene nifJ 10521 6967 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965527.1 protein_id gnl|my_center|LOCUS_06530 11628 10711 gene locus_tag LOCUS_06540 11628 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 12690 11647 gene locus_tag LOCUS_06550 12690 11647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 13017 13370 gene locus_tag LOCUS_06560 13017 13370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06560 13367 14389 gene locus_tag LOCUS_06570 13367 14389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06570 >Feature sequence035 1631 702 gene locus_tag LOCUS_06580 gene rsmH 1631 702 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965431.1 protein_id gnl|my_center|LOCUS_06580 2076 1645 gene locus_tag LOCUS_06590 gene mraZ 2076 1645 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000480800.1 protein_id gnl|my_center|LOCUS_06590 3053 2295 gene locus_tag LOCUS_06600 3053 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06600 3434 3060 gene locus_tag LOCUS_06610 3434 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06610 4436 3450 gene locus_tag LOCUS_06620 gene lgt 4436 3450 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048192.1 protein_id gnl|my_center|LOCUS_06620 5726 4452 gene locus_tag LOCUS_06630 5726 4452 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861628.1 protein_id gnl|my_center|LOCUS_06630 7009 5723 gene locus_tag LOCUS_06640 7009 5723 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454972.1 protein_id gnl|my_center|LOCUS_06640 7952 6993 gene locus_tag LOCUS_06650 7952 6993 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438310.1 protein_id gnl|my_center|LOCUS_06650 8829 7963 gene locus_tag LOCUS_06660 gene truB 8829 7963 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965111.1 protein_id gnl|my_center|LOCUS_06660 9796 8819 gene locus_tag LOCUS_06670 9796 8819 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_06670 10163 9789 gene locus_tag LOCUS_06680 gene rbfA 10163 9789 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986791.1 protein_id gnl|my_center|LOCUS_06680 13158 10165 gene locus_tag LOCUS_06690 13158 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 13441 13148 gene locus_tag LOCUS_06700 13441 13148 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419469.1 protein_id gnl|my_center|LOCUS_06700 14705 13497 gene locus_tag LOCUS_06710 14705 13497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 15186 14725 gene locus_tag LOCUS_06720 15186 14725 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438303.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence036 392 90 gene locus_tag LOCUS_06730 gene fliE 392 90 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460760.1 protein_id gnl|my_center|LOCUS_06730 830 405 gene locus_tag LOCUS_06740 gene flgC 830 405 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392290.1 protein_id gnl|my_center|LOCUS_06740 1224 832 gene locus_tag LOCUS_06750 gene flgB 1224 832 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_06750 2519 1713 gene locus_tag LOCUS_06760 2519 1713 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425096.1 protein_id gnl|my_center|LOCUS_06760 2928 2506 gene locus_tag LOCUS_06770 2928 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5035 2942 gene locus_tag LOCUS_06780 5035 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5579 5013 gene locus_tag LOCUS_06790 5579 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7455 5593 gene locus_tag LOCUS_06800 7455 5593 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963445.1 protein_id gnl|my_center|LOCUS_06800 7825 7472 gene locus_tag LOCUS_06810 7825 7472 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359271.1 protein_id gnl|my_center|LOCUS_06810 8383 7895 gene locus_tag LOCUS_06820 8383 7895 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080666.1 protein_id gnl|my_center|LOCUS_06820 8997 8380 gene locus_tag LOCUS_06830 8997 8380 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006874833.1 protein_id gnl|my_center|LOCUS_06830 9191 9856 gene locus_tag LOCUS_06840 9191 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 9813 10691 gene locus_tag LOCUS_06850 9813 10691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 11996 10749 gene locus_tag LOCUS_06860 11996 10749 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249995.1 protein_id gnl|my_center|LOCUS_06860 12525 12142 gene locus_tag LOCUS_06870 12525 12142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 15220 12608 gene locus_tag LOCUS_06880 15220 12608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence037 236 778 gene locus_tag LOCUS_06890 236 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1250 1666 gene locus_tag LOCUS_06900 1250 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 1591 1914 gene locus_tag LOCUS_06910 1591 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2957 2190 gene locus_tag LOCUS_06920 2957 2190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 3241 2954 gene locus_tag LOCUS_06930 3241 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 4721 3303 gene locus_tag LOCUS_06940 gene murC 4721 3303 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048388.1 protein_id gnl|my_center|LOCUS_06940 4932 7247 gene locus_tag LOCUS_06950 4932 7247 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948591.1 protein_id gnl|my_center|LOCUS_06950 7553 7371 gene locus_tag LOCUS_06960 7553 7371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 8082 9131 gene locus_tag LOCUS_06970 8082 9131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 9128 9694 gene locus_tag LOCUS_06980 9128 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 9691 11136 gene locus_tag LOCUS_06990 9691 11136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 11207 11674 gene locus_tag LOCUS_07000 11207 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 11671 12336 gene locus_tag LOCUS_07010 11671 12336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12320 12973 gene locus_tag LOCUS_07020 12320 12973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 12963 13700 gene locus_tag LOCUS_07030 12963 13700 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399656.1 protein_id gnl|my_center|LOCUS_07030 13703 14443 gene locus_tag LOCUS_07040 gene mobB 13703 14443 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_07040 14440 15093 gene locus_tag LOCUS_07050 14440 15093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence038 2426 1272 gene locus_tag LOCUS_07060 2426 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 2944 2423 gene locus_tag LOCUS_07070 2944 2423 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003043263.1 protein_id gnl|my_center|LOCUS_07070 3790 2960 gene locus_tag LOCUS_07080 3790 2960 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244896.1 protein_id gnl|my_center|LOCUS_07080 5743 3800 gene locus_tag LOCUS_07090 gene thrS 5743 3800 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965659.1 protein_id gnl|my_center|LOCUS_07090 6043 5840 gene locus_tag LOCUS_07100 6043 5840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6230 6006 gene locus_tag LOCUS_07110 6230 6006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 7381 6365 gene locus_tag LOCUS_07120 7381 6365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 9255 7405 gene locus_tag LOCUS_07130 9255 7405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 11795 9243 gene locus_tag LOCUS_07140 11795 9243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 13233 11884 gene locus_tag LOCUS_07150 gene glmM 13233 11884 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963806.1 protein_id gnl|my_center|LOCUS_07150 13989 13258 gene locus_tag LOCUS_07160 gene nagB 13989 13258 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437039.1 protein_id gnl|my_center|LOCUS_07160 14952 14167 gene locus_tag LOCUS_07170 14952 14167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence039 2432 1404 gene locus_tag LOCUS_07180 2432 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 2581 3519 gene locus_tag LOCUS_07190 2581 3519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093836.1 protein_id gnl|my_center|LOCUS_07190 3532 4653 gene locus_tag LOCUS_07200 3532 4653 CDS product SagG family ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986137.1 protein_id gnl|my_center|LOCUS_07200 4650 5798 gene locus_tag LOCUS_07210 4650 5798 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948247.1 protein_id gnl|my_center|LOCUS_07210 6277 5792 gene locus_tag LOCUS_07220 6277 5792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 8344 6362 gene locus_tag LOCUS_07230 8344 6362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 8566 10170 gene locus_tag LOCUS_07240 8566 10170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 10188 10946 gene locus_tag LOCUS_07250 10188 10946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 11262 10990 gene locus_tag LOCUS_07260 11262 10990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 11456 11707 gene locus_tag LOCUS_07270 11456 11707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 11822 13039 gene locus_tag LOCUS_07280 11822 13039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 13497 13147 gene locus_tag LOCUS_07290 13497 13147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 13900 13499 gene locus_tag LOCUS_07300 gene fliS 13900 13499 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272503.1 protein_id gnl|my_center|LOCUS_07300 <15073 13913 gene locus_tag LOCUS_07310 <15073 13913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011987024.1:flagellar filament capping protein FliD >Feature sequence040 188 1132 gene locus_tag LOCUS_07320 gene gpr 188 1132 CDS product GPR endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964587.1 protein_id gnl|my_center|LOCUS_07320 1216 3228 gene locus_tag LOCUS_07330 gene ligA 1216 3228 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861898.1 protein_id gnl|my_center|LOCUS_07330 3297 4745 gene locus_tag LOCUS_07340 gene gltX 3297 4745 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964308.1 protein_id gnl|my_center|LOCUS_07340 4747 6432 gene locus_tag LOCUS_07350 4747 6432 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945515.1 protein_id gnl|my_center|LOCUS_07350 6432 6866 gene locus_tag LOCUS_07360 6432 6866 CDS product Mini-ribonuclease 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357282.1 protein_id gnl|my_center|LOCUS_07360 6856 7596 gene locus_tag LOCUS_07370 gene rlmB 6856 7596 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357423.1 protein_id gnl|my_center|LOCUS_07370 7596 9827 gene locus_tag LOCUS_07380 gene pcrA 7596 9827 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357577.1 protein_id gnl|my_center|LOCUS_07380 9906 11171 gene locus_tag LOCUS_07390 9906 11171 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964253.1 protein_id gnl|my_center|LOCUS_07390 11168 11803 gene locus_tag LOCUS_07400 gene hisG 11168 11803 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_07400 11817 13112 gene locus_tag LOCUS_07410 gene hisD 11817 13112 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949111.1 protein_id gnl|my_center|LOCUS_07410 13090 14154 gene locus_tag LOCUS_07420 gene hisC 13090 14154 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966312.1 protein_id gnl|my_center|LOCUS_07420 14163 14747 gene locus_tag LOCUS_07430 gene hisB 14163 14747 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644682.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence041 273 1241 gene locus_tag LOCUS_07440 273 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1807 1238 gene locus_tag LOCUS_07450 1807 1238 CDS product RNA polymerase sporulation sigma factor SigH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000387193.1 protein_id gnl|my_center|LOCUS_07450 3213 1813 gene locus_tag LOCUS_07460 gene cysS 3213 1813 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584040.1 protein_id gnl|my_center|LOCUS_07460 3922 3188 gene locus_tag LOCUS_07470 gene cysE 3922 3188 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_07470 5197 4295 gene locus_tag LOCUS_07480 5197 4295 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_07480 5291 6037 gene locus_tag LOCUS_07490 5291 6037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 6051 6884 gene locus_tag LOCUS_07500 6051 6884 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888021.1 protein_id gnl|my_center|LOCUS_07500 7630 6881 gene locus_tag LOCUS_07510 7630 6881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 8399 7692 gene locus_tag LOCUS_07520 8399 7692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439005.1 protein_id gnl|my_center|LOCUS_07520 8549 8767 gene locus_tag LOCUS_07530 8549 8767 CDS product DUF378 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220771.1 protein_id gnl|my_center|LOCUS_07530 8848 9042 gene locus_tag LOCUS_07540 8848 9042 CDS product alpha/beta-type small acid-soluble spore protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965662.1 protein_id gnl|my_center|LOCUS_07540 9147 9413 gene locus_tag LOCUS_07550 9147 9413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9776 9417 gene locus_tag LOCUS_07560 9776 9417 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963816.1 protein_id gnl|my_center|LOCUS_07560 10082 9792 gene locus_tag LOCUS_07570 10082 9792 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421359.1 protein_id gnl|my_center|LOCUS_07570 11352 10174 gene locus_tag LOCUS_07580 gene alr 11352 10174 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048315.1 protein_id gnl|my_center|LOCUS_07580 12870 11362 gene locus_tag LOCUS_07590 12870 11362 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_07590 13678 12881 gene locus_tag LOCUS_07600 13678 12881 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357319.1 protein_id gnl|my_center|LOCUS_07600 14523 13675 gene locus_tag LOCUS_07610 14523 13675 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435657.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence042 1332 325 gene locus_tag LOCUS_07620 gene thiI 1332 325 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860948.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07620 2492 1344 gene locus_tag LOCUS_07630 2492 1344 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966255.1 protein_id gnl|my_center|LOCUS_07630 3196 2489 gene locus_tag LOCUS_07640 gene trmD 3196 2489 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438222.1 protein_id gnl|my_center|LOCUS_07640 3710 3186 gene locus_tag LOCUS_07650 gene rimM 3710 3186 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965064.1 protein_id gnl|my_center|LOCUS_07650 4033 3806 gene locus_tag LOCUS_07660 4033 3806 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392483.1 protein_id gnl|my_center|LOCUS_07660 4301 4053 gene locus_tag LOCUS_07670 gene rpsP 4301 4053 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_07670 5662 4334 gene locus_tag LOCUS_07680 gene ffh 5662 4334 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003362591.1 protein_id gnl|my_center|LOCUS_07680 6027 5671 gene locus_tag LOCUS_07690 6027 5671 CDS product YlxM family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460448.1 protein_id gnl|my_center|LOCUS_07690 7029 6118 gene locus_tag LOCUS_07700 7029 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 9518 7026 gene locus_tag LOCUS_07710 9518 7026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 10604 9531 gene locus_tag LOCUS_07720 10604 9531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 10727 11020 gene locus_tag LOCUS_07730 10727 11020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 13850 11061 gene locus_tag LOCUS_07740 gene ileS 13850 11061 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392382.1 protein_id gnl|my_center|LOCUS_07740 14665 14408 gene locus_tag LOCUS_07750 14665 14408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence043 541 3057 gene locus_tag LOCUS_07760 541 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3638 3054 gene locus_tag LOCUS_07770 3638 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 4267 3683 gene locus_tag LOCUS_07780 4267 3683 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860883.1 protein_id gnl|my_center|LOCUS_07780 4460 4248 gene locus_tag LOCUS_07790 4460 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4605 4946 gene locus_tag LOCUS_07800 4605 4946 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461119.1 protein_id gnl|my_center|LOCUS_07800 4939 5391 gene locus_tag LOCUS_07810 4939 5391 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765511.1 protein_id gnl|my_center|LOCUS_07810 6173 5367 gene locus_tag LOCUS_07820 6173 5367 CDS product glycosyltransferase family 8 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049769562.1 protein_id gnl|my_center|LOCUS_07820 8850 6238 gene locus_tag LOCUS_07830 8850 6238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9034 9522 gene locus_tag LOCUS_07840 9034 9522 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_07840 9541 11013 gene locus_tag LOCUS_07850 9541 11013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 11169 11008 gene locus_tag LOCUS_07860 11169 11008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 11262 12254 gene locus_tag LOCUS_07870 11262 12254 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942020.1 protein_id gnl|my_center|LOCUS_07870 12464 12808 gene locus_tag LOCUS_07880 12464 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07880 12904 13683 gene locus_tag LOCUS_07890 12904 13683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07890 >Feature sequence044 731 315 gene locus_tag LOCUS_07900 731 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 2099 837 gene locus_tag LOCUS_07910 2099 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3357 2101 gene locus_tag LOCUS_07920 3357 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3793 3344 gene locus_tag LOCUS_07930 3793 3344 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_07930 4106 5812 gene locus_tag LOCUS_07940 gene dnaX 4106 5812 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963452.1 protein_id gnl|my_center|LOCUS_07940 5825 7447 gene locus_tag LOCUS_07950 5825 7447 CDS product DUF4091 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777117.1 protein_id gnl|my_center|LOCUS_07950 7447 9165 gene locus_tag LOCUS_07960 7447 9165 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965689.1 protein_id gnl|my_center|LOCUS_07960 9158 10876 gene locus_tag LOCUS_07970 9158 10876 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965688.1 protein_id gnl|my_center|LOCUS_07970 10920 11864 gene locus_tag LOCUS_07980 10920 11864 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118362.1 protein_id gnl|my_center|LOCUS_07980 11938 13236 gene locus_tag LOCUS_07990 11938 13236 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948973.1 protein_id gnl|my_center|LOCUS_07990 13463 14023 gene locus_tag LOCUS_08000 13463 14023 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387373.1 protein_id gnl|my_center|LOCUS_08000 14058 14372 gene locus_tag LOCUS_08010 14058 14372 CDS product DUF4180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403459.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence045 <1 1221 gene locus_tag LOCUS_08020 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000745439.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase 1246 2508 gene locus_tag LOCUS_08030 gene purD 1246 2508 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_08030 2840 2505 gene locus_tag LOCUS_08040 2840 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3396 2944 gene locus_tag LOCUS_08050 3396 2944 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048323.1 protein_id gnl|my_center|LOCUS_08050 3545 6193 gene locus_tag LOCUS_08060 gene alaS 3545 6193 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964985.1 protein_id gnl|my_center|LOCUS_08060 6209 6553 gene locus_tag LOCUS_08070 6209 6553 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964599.1 protein_id gnl|my_center|LOCUS_08070 6573 7832 gene locus_tag LOCUS_08080 6573 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 7829 9211 gene locus_tag LOCUS_08090 7829 9211 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120149.1 protein_id gnl|my_center|LOCUS_08090 9221 10039 gene locus_tag LOCUS_08100 9221 10039 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027763.1 protein_id gnl|my_center|LOCUS_08100 10914 10159 gene locus_tag LOCUS_08110 10914 10159 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287046.1 protein_id gnl|my_center|LOCUS_08110 11778 10993 gene locus_tag LOCUS_08120 11778 10993 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578367.1 protein_id gnl|my_center|LOCUS_08120 11943 13001 gene locus_tag LOCUS_08130 11943 13001 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037684.1 protein_id gnl|my_center|LOCUS_08130 13020 13715 gene locus_tag LOCUS_08140 13020 13715 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785272.1 protein_id gnl|my_center|LOCUS_08140 <14379 13712 gene locus_tag LOCUS_08150 <14379 13712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948973.1:M14 family metallopeptidase >Feature sequence046 1164 10 gene locus_tag LOCUS_08160 1164 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1324 2268 gene locus_tag LOCUS_08170 gene pdxA 1324 2268 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047748.1 protein_id gnl|my_center|LOCUS_08170 3024 2320 gene locus_tag LOCUS_08180 3024 2320 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065331.1 protein_id gnl|my_center|LOCUS_08180 3863 3087 gene locus_tag LOCUS_08190 3863 3087 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065332.1 protein_id gnl|my_center|LOCUS_08190 5303 3957 gene locus_tag LOCUS_08200 5303 3957 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392674.1 protein_id gnl|my_center|LOCUS_08200 7330 5354 gene locus_tag LOCUS_08210 gene feoB 7330 5354 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948706.1 protein_id gnl|my_center|LOCUS_08210 7387 8337 gene locus_tag LOCUS_08220 gene prmA 7387 8337 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964596.1 protein_id gnl|my_center|LOCUS_08220 9352 8435 gene locus_tag LOCUS_08230 9352 8435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 10041 9406 gene locus_tag LOCUS_08240 10041 9406 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966375.1 protein_id gnl|my_center|LOCUS_08240 11172 10087 gene locus_tag LOCUS_08250 11172 10087 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356704.1 protein_id gnl|my_center|LOCUS_08250 11773 11246 gene locus_tag LOCUS_08260 11773 11246 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_08260 12521 11775 gene locus_tag LOCUS_08270 12521 11775 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357567.1 protein_id gnl|my_center|LOCUS_08270 13594 12533 gene locus_tag LOCUS_08280 13594 12533 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357407.1 protein_id gnl|my_center|LOCUS_08280 13856 13605 gene locus_tag LOCUS_08290 13856 13605 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420706.1 protein_id gnl|my_center|LOCUS_08290 >Feature sequence047 <1 668 gene locus_tag LOCUS_08300 <1 668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000257804.1:dihydrolipoamide acetyltransferase family protein 683 2047 gene locus_tag LOCUS_08310 gene lpdA 683 2047 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108698.1 protein_id gnl|my_center|LOCUS_08310 2068 4539 gene locus_tag LOCUS_08320 2068 4539 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582808.1 protein_id gnl|my_center|LOCUS_08320 4541 5308 gene locus_tag LOCUS_08330 4541 5308 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476686.1 protein_id gnl|my_center|LOCUS_08330 6087 5356 gene locus_tag LOCUS_08340 6087 5356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6858 6226 gene locus_tag LOCUS_08350 6858 6226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 8612 6960 gene locus_tag LOCUS_08360 8612 6960 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047904.1 protein_id gnl|my_center|LOCUS_08360 9478 8624 gene locus_tag LOCUS_08370 gene rapZ 9478 8624 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963833.1 protein_id gnl|my_center|LOCUS_08370 10446 9508 gene locus_tag LOCUS_08380 gene murB 10446 9508 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048307.1 protein_id gnl|my_center|LOCUS_08380 11413 10451 gene locus_tag LOCUS_08390 gene hprK 11413 10451 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416935.1 protein_id gnl|my_center|LOCUS_08390 12169 11477 gene locus_tag LOCUS_08400 12169 11477 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963644.1 protein_id gnl|my_center|LOCUS_08400 13692 12166 gene locus_tag LOCUS_08410 13692 12166 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963640.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence048 <1 517 gene locus_tag LOCUS_08420 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002295129.1:polysaccharide deacetylase family protein 586 1575 gene locus_tag LOCUS_08430 586 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1572 2117 gene locus_tag LOCUS_08440 1572 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2260 4755 gene locus_tag LOCUS_08450 2260 4755 CDS product calcium-translocating P-type ATPase, PMCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171779427.1 protein_id gnl|my_center|LOCUS_08450 4784 6586 gene locus_tag LOCUS_08460 gene uvrC 4784 6586 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_08460 6586 7308 gene locus_tag LOCUS_08470 6586 7308 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963959.1 protein_id gnl|my_center|LOCUS_08470 8217 7279 gene locus_tag LOCUS_08480 8217 7279 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977679.1 protein_id gnl|my_center|LOCUS_08480 9921 8233 gene locus_tag LOCUS_08490 9921 8233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11619 10027 gene locus_tag LOCUS_08500 gene cls 11619 10027 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966588.1 protein_id gnl|my_center|LOCUS_08500 12667 11603 gene locus_tag LOCUS_08510 12667 11603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 12783 13937 gene locus_tag LOCUS_08520 12783 13937 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070750708.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence049 617 84 gene locus_tag LOCUS_08530 gene mscL 617 84 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08530 1190 636 gene locus_tag LOCUS_08540 1190 636 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766965.1 protein_id gnl|my_center|LOCUS_08540 3234 1237 gene locus_tag LOCUS_08550 3234 1237 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160859024.1 protein_id gnl|my_center|LOCUS_08550 3665 3378 gene locus_tag LOCUS_08560 3665 3378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 3559 6564 gene locus_tag LOCUS_08570 3559 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6647 9619 gene locus_tag LOCUS_08580 6647 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 11074 9632 gene locus_tag LOCUS_08590 11074 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 11189 11575 gene locus_tag LOCUS_08600 11189 11575 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453642.1 protein_id gnl|my_center|LOCUS_08600 11640 12305 gene locus_tag LOCUS_08610 11640 12305 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427851.1 protein_id gnl|my_center|LOCUS_08610 12318 12887 gene locus_tag LOCUS_08620 12318 12887 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802804.1 protein_id gnl|my_center|LOCUS_08620 12884 13456 gene locus_tag LOCUS_08630 12884 13456 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763311.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence050 18 2273 gene locus_tag LOCUS_08640 18 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2273 2776 gene locus_tag LOCUS_08650 2273 2776 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357508.1 protein_id gnl|my_center|LOCUS_08650 2888 11257 gene locus_tag LOCUS_08660 2888 11257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 12525 11254 gene locus_tag LOCUS_08670 12525 11254 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048276.1 protein_id gnl|my_center|LOCUS_08670 12694 13404 gene locus_tag LOCUS_08680 gene ispD 12694 13404 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389752.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence051 295 1062 gene locus_tag LOCUS_08690 295 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08690 1087 1962 gene locus_tag LOCUS_08700 1087 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08700 1964 2113 gene locus_tag LOCUS_08710 1964 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08710 2243 2776 gene locus_tag LOCUS_08720 2243 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08720 2824 3468 gene locus_tag LOCUS_08730 2824 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 4001 3465 gene locus_tag LOCUS_08740 4001 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08740 4625 4011 gene locus_tag LOCUS_08750 4625 4011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08750 4860 5978 gene locus_tag LOCUS_08760 4860 5978 CDS product glycoside hydrolase family 99-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690973.1 protein_id gnl|my_center|LOCUS_08760 6052 7386 gene locus_tag LOCUS_08770 6052 7386 CDS product NADH:flavin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083314.1 protein_id gnl|my_center|LOCUS_08770 7379 8149 gene locus_tag LOCUS_08780 7379 8149 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242402.1 protein_id gnl|my_center|LOCUS_08780 8146 10062 gene locus_tag LOCUS_08790 8146 10062 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083312.1 protein_id gnl|my_center|LOCUS_08790 10040 11053 gene locus_tag LOCUS_08800 10040 11053 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328373.1 protein_id gnl|my_center|LOCUS_08800 11062 11859 gene locus_tag LOCUS_08810 11062 11859 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776860.1 protein_id gnl|my_center|LOCUS_08810 12425 11814 gene locus_tag LOCUS_08820 12425 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 12665 12441 gene locus_tag LOCUS_08830 12665 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 13461 12739 gene locus_tag LOCUS_08840 13461 12739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence052 1540 2373 gene locus_tag LOCUS_08850 1540 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 3037 2378 gene locus_tag LOCUS_08860 3037 2378 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022619212.1 protein_id gnl|my_center|LOCUS_08860 3490 3041 gene locus_tag LOCUS_08870 3490 3041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 5202 3571 gene locus_tag LOCUS_08880 gene gpmI 5202 3571 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973414.1 protein_id gnl|my_center|LOCUS_08880 5375 5884 gene locus_tag LOCUS_08890 5375 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 5897 6448 gene locus_tag LOCUS_08900 5897 6448 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_08900 6459 8363 gene locus_tag LOCUS_08910 6459 8363 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254424.1 protein_id gnl|my_center|LOCUS_08910 8442 9104 gene locus_tag LOCUS_08920 8442 9104 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391621.1 protein_id gnl|my_center|LOCUS_08920 9124 10500 gene locus_tag LOCUS_08930 9124 10500 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_08930 10679 10605 gene locus_tag LOCUS_t00050 10679 10605 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 10767 11474 gene locus_tag LOCUS_08940 10767 11474 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001234935.1 protein_id gnl|my_center|LOCUS_08940 11677 11510 gene locus_tag LOCUS_08950 11677 11510 CDS product zinc-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003387504.1 protein_id gnl|my_center|LOCUS_08950 12246 11851 gene locus_tag LOCUS_08960 12246 11851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 12924 12247 gene locus_tag LOCUS_08970 12924 12247 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963990.1 protein_id gnl|my_center|LOCUS_08970 13038 13250 gene locus_tag LOCUS_08980 13038 13250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 13260 13520 gene locus_tag LOCUS_08990 13260 13520 CDS product spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965971.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence053 229 465 gene locus_tag LOCUS_09000 gene tlp 229 465 CDS product small acid-soluble spore protein Tlp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948709.1 protein_id gnl|my_center|LOCUS_09000 1824 508 gene locus_tag LOCUS_09010 1824 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 3159 1849 gene locus_tag LOCUS_09020 3159 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3933 3220 gene locus_tag LOCUS_09030 3933 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 4113 4844 gene locus_tag LOCUS_09040 4113 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 5202 4870 gene locus_tag LOCUS_09050 5202 4870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6512 5301 gene locus_tag LOCUS_09060 6512 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 7268 6555 gene locus_tag LOCUS_09070 7268 6555 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963607.1 protein_id gnl|my_center|LOCUS_09070 7902 7261 gene locus_tag LOCUS_09080 7902 7261 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000157650.1 protein_id gnl|my_center|LOCUS_09080 8573 8067 gene locus_tag LOCUS_09090 8573 8067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 8907 8695 gene locus_tag LOCUS_09100 8907 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 10113 8947 gene locus_tag LOCUS_09110 10113 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 13315 10106 gene locus_tag LOCUS_09120 13315 10106 CDS product SbcC/MukB-like Walker B domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459255.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence054 2380 1166 gene locus_tag LOCUS_09130 2380 1166 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_09130 3583 2459 gene locus_tag LOCUS_09140 3583 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 3806 5758 gene locus_tag LOCUS_09150 3806 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 6107 7126 gene locus_tag LOCUS_09160 gene pheS 6107 7126 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403382.1 protein_id gnl|my_center|LOCUS_09160 7144 9579 gene locus_tag LOCUS_09170 gene pheT 7144 9579 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965653.1 protein_id gnl|my_center|LOCUS_09170 9584 10522 gene locus_tag LOCUS_09180 9584 10522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 12652 10808 gene locus_tag LOCUS_09190 gene ftsH 12652 10808 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048280.1 protein_id gnl|my_center|LOCUS_09190 12802 13218 gene locus_tag LOCUS_09200 12802 13218 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence055 <1 1213 gene locus_tag LOCUS_09210 <1 1213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393945.1:DNA-directed RNA polymerase subunit beta 1230 4892 gene locus_tag LOCUS_09220 gene rpoC 1230 4892 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048356.1 protein_id gnl|my_center|LOCUS_09220 5013 5426 gene locus_tag LOCUS_09230 gene rpsL 5013 5426 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860632.1 protein_id gnl|my_center|LOCUS_09230 5563 6033 gene locus_tag LOCUS_09240 gene rpsG 5563 6033 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137495.1 protein_id gnl|my_center|LOCUS_09240 6115 8187 gene locus_tag LOCUS_09250 gene fusA 6115 8187 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_09250 8321 9520 gene locus_tag LOCUS_09260 gene tuf 8321 9520 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_09260 9687 9977 gene locus_tag LOCUS_09270 9687 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 10130 10828 gene locus_tag LOCUS_09280 10130 10828 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459569.1 protein_id gnl|my_center|LOCUS_09280 10831 12330 gene locus_tag LOCUS_09290 10831 12330 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943962.1 protein_id gnl|my_center|LOCUS_09290 13039 12311 gene locus_tag LOCUS_09300 13039 12311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 13169 13378 gene locus_tag LOCUS_09310 13169 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence056 381 767 gene locus_tag LOCUS_09320 381 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 961 1116 gene locus_tag LOCUS_09330 961 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1106 1432 gene locus_tag LOCUS_09340 1106 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09340 1434 1658 gene locus_tag LOCUS_09350 1434 1658 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944153.1 protein_id gnl|my_center|LOCUS_09350 2366 1677 gene locus_tag LOCUS_09360 2366 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2772 2482 gene locus_tag LOCUS_09370 2772 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3091 2906 gene locus_tag LOCUS_09380 3091 2906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5569 3107 gene locus_tag LOCUS_09390 5569 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09390 6007 5654 gene locus_tag LOCUS_09400 6007 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 6738 6019 gene locus_tag LOCUS_09410 6738 6019 CDS product DUF421 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964829.1 protein_id gnl|my_center|LOCUS_09410 8109 6880 gene locus_tag LOCUS_09420 8109 6880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 8987 8115 gene locus_tag LOCUS_09430 8987 8115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 9253 8951 gene locus_tag LOCUS_09440 9253 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 9401 9207 gene locus_tag LOCUS_09450 9401 9207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 11358 9406 gene locus_tag LOCUS_09460 11358 9406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 11526 12386 gene locus_tag LOCUS_09470 11526 12386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence057 206 832 gene locus_tag LOCUS_09480 gene safA 206 832 CDS product SafA/ExsA family spore coat assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986322.1 protein_id gnl|my_center|LOCUS_09480 3280 872 gene locus_tag LOCUS_09490 3280 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4092 3376 gene locus_tag LOCUS_09500 4092 3376 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811460.1 protein_id gnl|my_center|LOCUS_09500 5585 4236 gene locus_tag LOCUS_09510 gene asnS 5585 4236 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_09510 9423 5647 gene locus_tag LOCUS_09520 9423 5647 CDS product PolC-type DNA polymerase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541505.1 protein_id gnl|my_center|LOCUS_09520 10497 9427 gene locus_tag LOCUS_09530 gene ispG 10497 9427 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965103.1 protein_id gnl|my_center|LOCUS_09530 11574 10516 gene locus_tag LOCUS_09540 gene rseP 11574 10516 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430605.1 protein_id gnl|my_center|LOCUS_09540 12727 11558 gene locus_tag LOCUS_09550 12727 11558 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_09550 <13476 12740 gene locus_tag LOCUS_09560 <13476 12740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003384675.1:phosphatidate cytidylyltransferase >Feature sequence058 1 2895 gene locus_tag LOCUS_09570 1 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 3092 3265 gene locus_tag LOCUS_09580 3092 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 3365 5209 gene locus_tag LOCUS_09590 3365 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 5450 7630 gene locus_tag LOCUS_09600 5450 7630 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768340.1 protein_id gnl|my_center|LOCUS_09600 7631 8095 gene locus_tag LOCUS_09610 gene dtd 7631 8095 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460350.1 protein_id gnl|my_center|LOCUS_09610 8107 8754 gene locus_tag LOCUS_09620 8107 8754 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454137.1 protein_id gnl|my_center|LOCUS_09620 8751 10139 gene locus_tag LOCUS_09630 8751 10139 CDS product coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361993.1 protein_id gnl|my_center|LOCUS_09630 10808 10134 gene locus_tag LOCUS_09640 10808 10134 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393194.1 protein_id gnl|my_center|LOCUS_09640 12389 10818 gene locus_tag LOCUS_09650 12389 10818 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054550.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence059 93 2027 gene locus_tag LOCUS_09660 93 2027 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393552.1 protein_id gnl|my_center|LOCUS_09660 3342 2059 gene locus_tag LOCUS_09670 3342 2059 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048700.1 protein_id gnl|my_center|LOCUS_09670 4322 3354 gene locus_tag LOCUS_09680 4322 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 5544 4336 gene locus_tag LOCUS_09690 5544 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 6291 5557 gene locus_tag LOCUS_09700 6291 5557 CDS product sugar isomerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930893.1 protein_id gnl|my_center|LOCUS_09700 7204 6284 gene locus_tag LOCUS_09710 7204 6284 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_09710 7600 7301 gene locus_tag LOCUS_09720 7600 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 7731 9746 gene locus_tag LOCUS_09730 7731 9746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 12187 9758 gene locus_tag LOCUS_09740 12187 9758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 13412 12210 gene locus_tag LOCUS_09750 13412 12210 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203512.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence060 4222 2267 gene locus_tag LOCUS_09760 4222 2267 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043943600.1 protein_id gnl|my_center|LOCUS_09760 6014 4215 gene locus_tag LOCUS_09770 6014 4215 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814402.1 protein_id gnl|my_center|LOCUS_09770 6173 7072 gene locus_tag LOCUS_09780 6173 7072 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801609.1 protein_id gnl|my_center|LOCUS_09780 7108 7767 gene locus_tag LOCUS_09790 7108 7767 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_09790 7782 8678 gene locus_tag LOCUS_09800 7782 8678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 8699 9571 gene locus_tag LOCUS_09810 8699 9571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 9646 10413 gene locus_tag LOCUS_09820 9646 10413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 10434 11273 gene locus_tag LOCUS_09830 10434 11273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 11282 12079 gene locus_tag LOCUS_09840 11282 12079 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986648.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence061 1047 97 gene locus_tag LOCUS_09850 1047 97 CDS product siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287908.1 protein_id gnl|my_center|LOCUS_09850 1851 1093 gene locus_tag LOCUS_09860 1851 1093 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948720.1 protein_id gnl|my_center|LOCUS_09860 2834 1848 gene locus_tag LOCUS_09870 gene yclO 2834 1848 CDS product petrobactin ABC transporter permease YclO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246705.1 protein_id gnl|my_center|LOCUS_09870 3810 2827 gene locus_tag LOCUS_09880 gene yclN 3810 2827 CDS product petrobactin ABC transporter permease YclN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234491.1 protein_id gnl|my_center|LOCUS_09880 4024 4704 gene locus_tag LOCUS_09890 4024 4704 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861224.1 protein_id gnl|my_center|LOCUS_09890 4701 5705 gene locus_tag LOCUS_09900 4701 5705 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434897.1 protein_id gnl|my_center|LOCUS_09900 5790 6485 gene locus_tag LOCUS_09910 5790 6485 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438655.1 protein_id gnl|my_center|LOCUS_09910 6482 9079 gene locus_tag LOCUS_09920 6482 9079 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892169.1 protein_id gnl|my_center|LOCUS_09920 9233 10312 gene locus_tag LOCUS_09930 gene recA 9233 10312 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392593.1 protein_id gnl|my_center|LOCUS_09930 10321 10926 gene locus_tag LOCUS_09940 10321 10926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 11014 12336 gene locus_tag LOCUS_09950 gene rimO 11014 12336 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861176.1 protein_id gnl|my_center|LOCUS_09950 12383 12985 gene locus_tag LOCUS_09960 gene pgsA 12383 12985 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence062 369 1391 gene locus_tag LOCUS_09970 369 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 2071 1388 gene locus_tag LOCUS_09980 2071 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420704.1 protein_id gnl|my_center|LOCUS_09980 2240 3595 gene locus_tag LOCUS_09990 gene trkA 2240 3595 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948929.1 protein_id gnl|my_center|LOCUS_09990 3592 5037 gene locus_tag LOCUS_10000 3592 5037 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016814.1 protein_id gnl|my_center|LOCUS_10000 5114 6091 gene locus_tag LOCUS_10010 5114 6091 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358973.1 protein_id gnl|my_center|LOCUS_10010 6093 6650 gene locus_tag LOCUS_10020 6093 6650 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963535.1 protein_id gnl|my_center|LOCUS_10020 6766 9684 gene locus_tag LOCUS_10030 6766 9684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 9751 10281 gene locus_tag LOCUS_10040 9751 10281 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023189990.1 protein_id gnl|my_center|LOCUS_10040 10415 12703 gene locus_tag LOCUS_10050 10415 12703 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680864.1 protein_id gnl|my_center|LOCUS_10050 12706 12933 gene locus_tag LOCUS_10060 12706 12933 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966916.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence063 750 1292 gene locus_tag LOCUS_10070 750 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1504 2388 gene locus_tag LOCUS_10080 gene cdaA 1504 2388 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966360.1 protein_id gnl|my_center|LOCUS_10080 2385 3656 gene locus_tag LOCUS_10090 2385 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3945 3694 gene locus_tag LOCUS_10100 3945 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4872 3982 gene locus_tag LOCUS_10110 4872 3982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10110 5039 6400 gene locus_tag LOCUS_10120 5039 6400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9572 6456 gene locus_tag LOCUS_10130 9572 6456 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476308.1 protein_id gnl|my_center|LOCUS_10130 10725 9559 gene locus_tag LOCUS_10140 10725 9559 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733226.1 protein_id gnl|my_center|LOCUS_10140 11222 10722 gene locus_tag LOCUS_10150 11222 10722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 11629 11270 gene locus_tag LOCUS_10160 11629 11270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 11969 12232 gene locus_tag LOCUS_10170 gene rpsO 11969 12232 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence064 456 770 gene locus_tag LOCUS_10180 gene rpsJ 456 770 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357250.1 protein_id gnl|my_center|LOCUS_10180 843 1472 gene locus_tag LOCUS_10190 gene rplC 843 1472 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393937.1 protein_id gnl|my_center|LOCUS_10190 1493 2125 gene locus_tag LOCUS_10200 gene rplD 1493 2125 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887887.1 protein_id gnl|my_center|LOCUS_10200 2125 2490 gene locus_tag LOCUS_10210 2125 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2505 3341 gene locus_tag LOCUS_10220 gene rplB 2505 3341 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000511583.1 protein_id gnl|my_center|LOCUS_10220 3354 3638 gene locus_tag LOCUS_10230 gene rpsS 3354 3638 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393933.1 protein_id gnl|my_center|LOCUS_10230 3655 4134 gene locus_tag LOCUS_10240 3655 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 4148 4813 gene locus_tag LOCUS_10250 gene rpsC 4148 4813 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003385450.1 protein_id gnl|my_center|LOCUS_10250 4813 5253 gene locus_tag LOCUS_10260 gene rplP 4813 5253 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_10260 5243 5458 gene locus_tag LOCUS_10270 gene rpmC 5243 5458 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879935.1 protein_id gnl|my_center|LOCUS_10270 5482 5739 gene locus_tag LOCUS_10280 gene rpsQ 5482 5739 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_10280 5757 6125 gene locus_tag LOCUS_10290 gene rplN 5757 6125 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459101.1 protein_id gnl|my_center|LOCUS_10290 6139 6483 gene locus_tag LOCUS_10300 gene rplX 6139 6483 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258242.1 protein_id gnl|my_center|LOCUS_10300 6505 7044 gene locus_tag LOCUS_10310 gene rplE 6505 7044 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459103.1 protein_id gnl|my_center|LOCUS_10310 7270 7668 gene locus_tag LOCUS_10320 gene rpsH 7270 7668 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_10320 7725 8270 gene locus_tag LOCUS_10330 gene rplF 7725 8270 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_10330 8291 8659 gene locus_tag LOCUS_10340 gene rplR 8291 8659 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_10340 8679 9179 gene locus_tag LOCUS_10350 gene rpsE 8679 9179 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393920.1 protein_id gnl|my_center|LOCUS_10350 9190 9363 gene locus_tag LOCUS_10360 gene rpmD 9190 9363 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869911.1 protein_id gnl|my_center|LOCUS_10360 9377 9820 gene locus_tag LOCUS_10370 gene rplO 9377 9820 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936637.1 protein_id gnl|my_center|LOCUS_10370 9822 11147 gene locus_tag LOCUS_10380 gene secY 9822 11147 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393917.1 protein_id gnl|my_center|LOCUS_10380 11216 11863 gene locus_tag LOCUS_10390 11216 11863 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence065 <1 769 gene locus_tag LOCUS_10400 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389730.1:replication-associated recombination protein A 1586 792 gene locus_tag LOCUS_10410 1586 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2068 1583 gene locus_tag LOCUS_10420 2068 1583 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000824008.1 protein_id gnl|my_center|LOCUS_10420 4525 3104 gene locus_tag LOCUS_10430 4525 3104 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986917.1 protein_id gnl|my_center|LOCUS_10430 5873 4593 gene locus_tag LOCUS_10440 5873 4593 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083681.1 protein_id gnl|my_center|LOCUS_10440 6099 6347 gene locus_tag LOCUS_10450 6099 6347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 6348 6701 gene locus_tag LOCUS_10460 6348 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7311 6691 gene locus_tag LOCUS_10470 7311 6691 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_10470 8176 7304 gene locus_tag LOCUS_10480 gene ylqF 8176 7304 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000236706.1 protein_id gnl|my_center|LOCUS_10480 10079 8502 gene locus_tag LOCUS_10490 10079 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 12465 10147 gene locus_tag LOCUS_10500 12465 10147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence066 143 601 gene locus_tag LOCUS_10510 143 601 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362455.1 protein_id gnl|my_center|LOCUS_10510 622 1563 gene locus_tag LOCUS_10520 622 1563 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966841.1 protein_id gnl|my_center|LOCUS_10520 1564 2511 gene locus_tag LOCUS_10530 gene fabK 1564 2511 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_10530 2508 3419 gene locus_tag LOCUS_10540 gene fabD 2508 3419 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966838.1 protein_id gnl|my_center|LOCUS_10540 3413 4153 gene locus_tag LOCUS_10550 gene fabG 3413 4153 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_10550 4182 5432 gene locus_tag LOCUS_10560 gene fabF 4182 5432 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966836.1 protein_id gnl|my_center|LOCUS_10560 5422 5853 gene locus_tag LOCUS_10570 gene accB 5422 5853 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930864.1 protein_id gnl|my_center|LOCUS_10570 5865 6275 gene locus_tag LOCUS_10580 gene fabZ 5865 6275 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003699740.1 protein_id gnl|my_center|LOCUS_10580 6291 7619 gene locus_tag LOCUS_10590 6291 7619 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_10590 7639 8490 gene locus_tag LOCUS_10600 gene accD 7639 8490 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905556.1 protein_id gnl|my_center|LOCUS_10600 8601 9284 gene locus_tag LOCUS_10610 8601 9284 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966831.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10610 9492 12161 gene locus_tag LOCUS_10620 gene gyrA 9492 12161 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963336.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence067 2 631 gene locus_tag LOCUS_10630 2 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 600 1685 gene locus_tag LOCUS_10640 gene fliY 600 1685 CDS product flagellar motor switch phosphatase FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231962.1 protein_id gnl|my_center|LOCUS_10640 1688 2014 gene locus_tag LOCUS_10650 1688 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1992 2753 gene locus_tag LOCUS_10660 gene fliP 1992 2753 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245692.1 protein_id gnl|my_center|LOCUS_10660 2758 3024 gene locus_tag LOCUS_10670 gene fliQ 2758 3024 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187355.1 protein_id gnl|my_center|LOCUS_10670 3038 3814 gene locus_tag LOCUS_10680 gene fliR 3038 3814 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392309.1 protein_id gnl|my_center|LOCUS_10680 3811 4893 gene locus_tag LOCUS_10690 gene flhB 3811 4893 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_10690 4893 6932 gene locus_tag LOCUS_10700 gene flhA 4893 6932 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231947.1 protein_id gnl|my_center|LOCUS_10700 6951 8093 gene locus_tag LOCUS_10710 gene flhF 6951 8093 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_10710 8107 8655 gene locus_tag LOCUS_10720 8107 8655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 8642 9385 gene locus_tag LOCUS_10730 8642 9385 CDS product FliA/WhiG family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873529.1 protein_id gnl|my_center|LOCUS_10730 9373 9939 gene locus_tag LOCUS_10740 9373 9939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 10018 11535 gene locus_tag LOCUS_10750 10018 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence068 625 269 gene locus_tag LOCUS_10760 gene tnpB 625 269 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393820.1 protein_id gnl|my_center|LOCUS_10760 933 622 gene locus_tag LOCUS_10770 933 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1055 1276 gene locus_tag LOCUS_10780 1055 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 1334 1696 gene locus_tag LOCUS_10790 1334 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 2332 2814 gene locus_tag LOCUS_10800 2332 2814 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696696.1 protein_id gnl|my_center|LOCUS_10800 2826 3542 gene locus_tag LOCUS_10810 2826 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 3596 3745 gene locus_tag LOCUS_10820 3596 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3852 5669 gene locus_tag LOCUS_10830 3852 5669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5771 6718 gene locus_tag LOCUS_10840 gene spoIIIAA 5771 6718 CDS product stage III sporulation protein AA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438117.1 protein_id gnl|my_center|LOCUS_10840 6727 7260 gene locus_tag LOCUS_10850 6727 7260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 7277 7471 gene locus_tag LOCUS_10860 gene spoIIIAC 7277 7471 CDS product stage III sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358967.1 protein_id gnl|my_center|LOCUS_10860 7485 7874 gene locus_tag LOCUS_10870 gene spoIIIAD 7485 7874 CDS product stage III sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359080.1 protein_id gnl|my_center|LOCUS_10870 7888 8904 gene locus_tag LOCUS_10880 7888 8904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 8901 9440 gene locus_tag LOCUS_10890 8901 9440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 9551 10150 gene locus_tag LOCUS_10900 gene spoIIIAG 9551 10150 CDS product stage III sporulation protein AG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358958.1 protein_id gnl|my_center|LOCUS_10900 10209 10736 gene locus_tag LOCUS_10910 10209 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 10866 11252 gene locus_tag LOCUS_10920 10866 11252 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393032.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence069 1597 116 gene locus_tag LOCUS_10930 1597 116 CDS product DUF1846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357216.1 protein_id gnl|my_center|LOCUS_10930 1791 2471 gene locus_tag LOCUS_10940 1791 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2619 2428 gene locus_tag LOCUS_10950 2619 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 2748 3932 gene locus_tag LOCUS_10960 gene metK 2748 3932 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003432462.1 protein_id gnl|my_center|LOCUS_10960 3929 4642 gene locus_tag LOCUS_10970 3929 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4639 5811 gene locus_tag LOCUS_10980 4639 5811 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065939.1 protein_id gnl|my_center|LOCUS_10980 8153 5808 gene locus_tag LOCUS_10990 8153 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 8923 8222 gene locus_tag LOCUS_11000 8923 8222 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393651.1 protein_id gnl|my_center|LOCUS_11000 9037 9690 gene locus_tag LOCUS_11010 9037 9690 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964931.1 protein_id gnl|my_center|LOCUS_11010 10403 9687 gene locus_tag LOCUS_11020 10403 9687 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531770.1 protein_id gnl|my_center|LOCUS_11020 11344 10400 gene locus_tag LOCUS_11030 11344 10400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence070 1352 1059 gene locus_tag LOCUS_11040 1352 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11040 1763 1368 gene locus_tag LOCUS_11050 1763 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11050 2233 3045 gene locus_tag LOCUS_11060 2233 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3661 3503 gene locus_tag LOCUS_11070 3661 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 3825 3703 gene locus_tag LOCUS_11080 3825 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4342 3932 gene locus_tag LOCUS_11090 4342 3932 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458892.1 protein_id gnl|my_center|LOCUS_11090 5163 4321 gene locus_tag LOCUS_11100 5163 4321 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_11100 5936 5157 gene locus_tag LOCUS_11110 5936 5157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933759.1 protein_id gnl|my_center|LOCUS_11110 6783 5929 gene locus_tag LOCUS_11120 6783 5929 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_11120 6939 7772 gene locus_tag LOCUS_11130 6939 7772 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461116.1 protein_id gnl|my_center|LOCUS_11130 8489 7761 gene locus_tag LOCUS_11140 8489 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 8684 9148 gene locus_tag LOCUS_11150 8684 9148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 10323 9145 gene locus_tag LOCUS_11160 10323 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 11214 10336 gene locus_tag LOCUS_11170 11214 10336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence071 3474 2221 gene locus_tag LOCUS_11180 gene rhaA 3474 2221 CDS product L-rhamnose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003730700.1 protein_id gnl|my_center|LOCUS_11180 3590 3961 gene locus_tag LOCUS_11190 3590 3961 CDS product sensory rhodopsin transducer inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582807.1 protein_id gnl|my_center|LOCUS_11190 3975 4511 gene locus_tag LOCUS_11200 3975 4511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 6135 4819 gene locus_tag LOCUS_11210 gene obgE 6135 4819 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964572.1 protein_id gnl|my_center|LOCUS_11210 6481 6203 gene locus_tag LOCUS_11220 gene rpmA 6481 6203 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095207.1 protein_id gnl|my_center|LOCUS_11220 6833 6486 gene locus_tag LOCUS_11230 6833 6486 CDS product ribosomal-processing cysteine protease Prp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816543.1 protein_id gnl|my_center|LOCUS_11230 7147 6836 gene locus_tag LOCUS_11240 gene rplU 7147 6836 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048023.1 protein_id gnl|my_center|LOCUS_11240 8664 7261 gene locus_tag LOCUS_11250 8664 7261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 9599 8685 gene locus_tag LOCUS_11260 9599 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 10236 9580 gene locus_tag LOCUS_11270 10236 9580 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966054.1 protein_id gnl|my_center|LOCUS_11270 10841 10251 gene locus_tag LOCUS_11280 10841 10251 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032840898.1 protein_id gnl|my_center|LOCUS_11280 <11410 10903 gene locus_tag LOCUS_11290 <11410 10903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869297.1:ATP-binding protein >Feature sequence072 707 399 gene locus_tag LOCUS_11300 707 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2517 922 gene locus_tag LOCUS_11310 2517 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 3085 3003 gene locus_tag LOCUS_t00060 3085 3003 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3402 3136 gene locus_tag LOCUS_11320 3402 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 3517 4023 gene locus_tag LOCUS_11330 3517 4023 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072771878.1 protein_id gnl|my_center|LOCUS_11330 4007 4816 gene locus_tag LOCUS_11340 4007 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 4901 5461 gene locus_tag LOCUS_11350 4901 5461 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814509.1 protein_id gnl|my_center|LOCUS_11350 5814 5458 gene locus_tag LOCUS_11360 5814 5458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 6544 6026 gene locus_tag LOCUS_11370 6544 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11370 6847 7893 gene locus_tag LOCUS_11380 6847 7893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 8888 7938 gene locus_tag LOCUS_11390 8888 7938 CDS product small ribosomal subunit Rsm22 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257997.1 protein_id gnl|my_center|LOCUS_11390 10165 8885 gene locus_tag LOCUS_11400 10165 8885 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027423.1 protein_id gnl|my_center|LOCUS_11400 10278 10937 gene locus_tag LOCUS_11410 10278 10937 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048390.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence073 886 146 gene locus_tag LOCUS_11420 886 146 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583280.1 protein_id gnl|my_center|LOCUS_11420 1206 883 gene locus_tag LOCUS_11430 1206 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 2534 1203 gene locus_tag LOCUS_11440 2534 1203 CDS product [Fe-Fe] hydrogenase large subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583277.1 protein_id gnl|my_center|LOCUS_11440 2989 2561 gene locus_tag LOCUS_11450 2989 2561 CDS product anti-sigma regulatory factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869443.1 protein_id gnl|my_center|LOCUS_11450 3384 2986 gene locus_tag LOCUS_11460 3384 2986 CDS product PucR family transcriptional regulator ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583275.1 protein_id gnl|my_center|LOCUS_11460 5174 3417 gene locus_tag LOCUS_11470 5174 3417 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_11470 6986 5196 gene locus_tag LOCUS_11480 gene nuoF 6986 5196 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 protein_id gnl|my_center|LOCUS_11480 7375 7007 gene locus_tag LOCUS_11490 7375 7007 CDS product (2Fe-2S) ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583283.1 protein_id gnl|my_center|LOCUS_11490 7889 7398 gene locus_tag LOCUS_11500 gene nuoE 7889 7398 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_11500 9370 8054 gene locus_tag LOCUS_11510 9370 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11510 <11202 9377 gene locus_tag LOCUS_11520 <11202 9377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965560.1:helicase-exonuclease AddAB subunit AddA note possible pseudo, internal stop codon >Feature sequence074 1365 379 gene locus_tag LOCUS_11530 1365 379 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582647.1 protein_id gnl|my_center|LOCUS_11530 2900 1377 gene locus_tag LOCUS_11540 2900 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 4044 3010 gene locus_tag LOCUS_11550 4044 3010 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795327.1 protein_id gnl|my_center|LOCUS_11550 4329 4114 gene locus_tag LOCUS_11560 4329 4114 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047972.1 protein_id gnl|my_center|LOCUS_11560 4656 5693 gene locus_tag LOCUS_11570 gene aroF 4656 5693 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_11570 5690 6514 gene locus_tag LOCUS_11580 5690 6514 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964211.1 protein_id gnl|my_center|LOCUS_11580 6515 7567 gene locus_tag LOCUS_11590 gene aroB 6515 7567 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964212.1 protein_id gnl|my_center|LOCUS_11590 7569 8864 gene locus_tag LOCUS_11600 gene aroA 7569 8864 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_11600 8842 9933 gene locus_tag LOCUS_11610 gene aroC 8842 9933 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_11610 9935 11077 gene locus_tag LOCUS_11620 gene pheA 9935 11077 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861347.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence075 259 957 gene locus_tag LOCUS_11630 259 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 977 1360 gene locus_tag LOCUS_11640 977 1360 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_11640 1517 2638 gene locus_tag LOCUS_11650 1517 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2807 3835 gene locus_tag LOCUS_11660 2807 3835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 3929 5002 gene locus_tag LOCUS_11670 3929 5002 CDS product CotS family spore coat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947965.1 protein_id gnl|my_center|LOCUS_11670 5078 6634 gene locus_tag LOCUS_11680 5078 6634 CDS product DUF3794 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947967.1 protein_id gnl|my_center|LOCUS_11680 6875 7147 gene locus_tag LOCUS_11690 6875 7147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 7309 9243 gene locus_tag LOCUS_11700 7309 9243 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048118.1 protein_id gnl|my_center|LOCUS_11700 9387 10331 gene locus_tag LOCUS_11710 9387 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence076 186 851 gene locus_tag LOCUS_11720 186 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2039 885 gene locus_tag LOCUS_11730 2039 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2788 2036 gene locus_tag LOCUS_11740 gene cas6 2788 2036 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837017.1 protein_id gnl|my_center|LOCUS_11740 3841 2798 gene locus_tag LOCUS_11750 gene csm5 3841 2798 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414285.1 protein_id gnl|my_center|LOCUS_11750 4800 3838 gene locus_tag LOCUS_11760 4800 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 5467 4781 gene locus_tag LOCUS_11770 gene csm3 5467 4781 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414292.1 protein_id gnl|my_center|LOCUS_11770 5960 5472 gene locus_tag LOCUS_11780 5960 5472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 7488 5962 gene locus_tag LOCUS_11790 7488 5962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11790 8097 7531 gene locus_tag LOCUS_11800 8097 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 8612 8343 gene locus_tag LOCUS_11810 8612 8343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 <11107 8572 gene locus_tag LOCUS_11820 <11107 8572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123065.1:exo-alpha-sialidase >Feature sequence077 239 1510 gene locus_tag LOCUS_11830 239 1510 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549222.1 protein_id gnl|my_center|LOCUS_11830 1735 2847 gene locus_tag LOCUS_11840 gene ugpC 1735 2847 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966512.1 protein_id gnl|my_center|LOCUS_11840 2984 4114 gene locus_tag LOCUS_11850 2984 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 4111 4935 gene locus_tag LOCUS_11860 gene ftsE 4111 4935 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815584.1 protein_id gnl|my_center|LOCUS_11860 4901 5797 gene locus_tag LOCUS_11870 gene ftsX 4901 5797 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357632.1 protein_id gnl|my_center|LOCUS_11870 5920 7092 gene locus_tag LOCUS_11880 5920 7092 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018305385.1 protein_id gnl|my_center|LOCUS_11880 7172 8536 gene locus_tag LOCUS_11890 7172 8536 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963821.1 protein_id gnl|my_center|LOCUS_11890 8536 9300 gene locus_tag LOCUS_11900 8536 9300 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_11900 9418 9618 gene locus_tag LOCUS_11910 gene cspD 9418 9618 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_11910 9649 10512 gene locus_tag LOCUS_11920 gene hslO 9649 10512 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428049.1 protein_id gnl|my_center|LOCUS_11920 10625 10700 gene locus_tag LOCUS_t00070 10625 10700 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 10706 10782 gene locus_tag LOCUS_t00080 10706 10782 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 10788 10863 gene locus_tag LOCUS_t00090 10788 10863 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10867 10941 gene locus_tag LOCUS_t00100 10867 10941 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 1628 387 gene locus_tag LOCUS_11930 gene clpX 1628 387 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392066.1 protein_id gnl|my_center|LOCUS_11930 2121 1720 gene locus_tag LOCUS_11940 2121 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11940 2304 2131 gene locus_tag LOCUS_11950 2304 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11950 3691 2339 gene locus_tag LOCUS_11960 gene tig 3691 2339 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830810.1 protein_id gnl|my_center|LOCUS_11960 5724 3787 gene locus_tag LOCUS_11970 gene metG 5724 3787 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947939.1 protein_id gnl|my_center|LOCUS_11970 8159 5862 gene locus_tag LOCUS_11980 8159 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 8365 8871 gene locus_tag LOCUS_11990 8365 8871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 8883 9929 gene locus_tag LOCUS_12000 gene wlbA 8883 9929 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_12000 10606 9950 gene locus_tag LOCUS_12010 gene sigK 10606 9950 CDS product RNA polymerase sporulation sigma factor SigK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047887.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence079 270 2942 gene locus_tag LOCUS_12020 270 2942 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476159.1 protein_id gnl|my_center|LOCUS_12020 3984 2926 gene locus_tag LOCUS_12030 3984 2926 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_12030 4930 3971 gene locus_tag LOCUS_12040 4930 3971 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775134.1 protein_id gnl|my_center|LOCUS_12040 6614 4995 gene locus_tag LOCUS_12050 6614 4995 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949020.1 protein_id gnl|my_center|LOCUS_12050 8933 6720 gene locus_tag LOCUS_12060 8933 6720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 10230 9004 gene locus_tag LOCUS_12070 10230 9004 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582488.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence080 243 815 gene locus_tag LOCUS_12080 243 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 837 2228 gene locus_tag LOCUS_12090 837 2228 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861592.1 protein_id gnl|my_center|LOCUS_12090 2239 3339 gene locus_tag LOCUS_12100 2239 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 5739 3340 gene locus_tag LOCUS_12110 5739 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 6970 5852 gene locus_tag LOCUS_12120 6970 5852 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965651.1 protein_id gnl|my_center|LOCUS_12120 7897 7040 gene locus_tag LOCUS_12130 7897 7040 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777129.1 protein_id gnl|my_center|LOCUS_12130 8119 7970 gene locus_tag LOCUS_12140 8119 7970 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064374.1 protein_id gnl|my_center|LOCUS_12140 8247 8954 gene locus_tag LOCUS_12150 8247 8954 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986406.1 protein_id gnl|my_center|LOCUS_12150 9605 9000 gene locus_tag LOCUS_12160 9605 9000 CDS product ElyC/SanA/YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680249.1 protein_id gnl|my_center|LOCUS_12160 10334 9639 gene locus_tag LOCUS_12170 10334 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence081 <1 1537 gene locus_tag LOCUS_12180 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870079.1:flagellar basal-body MS-ring/collar protein FliF 1542 2543 gene locus_tag LOCUS_12190 gene fliG 1542 2543 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231981.1 protein_id gnl|my_center|LOCUS_12190 2536 3231 gene locus_tag LOCUS_12200 2536 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3228 4568 gene locus_tag LOCUS_12210 gene fliI 3228 4568 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_12210 4565 4990 gene locus_tag LOCUS_12220 gene fliJ 4565 4990 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392296.1 protein_id gnl|my_center|LOCUS_12220 5005 5589 gene locus_tag LOCUS_12230 5005 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 5626 6816 gene locus_tag LOCUS_12240 5626 6816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 6828 7217 gene locus_tag LOCUS_12250 6828 7217 CDS product flagellar hook capping FlgD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392298.1 protein_id gnl|my_center|LOCUS_12250 7232 8050 gene locus_tag LOCUS_12260 gene flgG 7232 8050 CDS product flagellar basal body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231968.1 protein_id gnl|my_center|LOCUS_12260 8063 8269 gene locus_tag LOCUS_12270 8063 8269 CDS product flagellar FlbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392301.1 protein_id gnl|my_center|LOCUS_12270 8283 8471 gene locus_tag LOCUS_12280 8283 8471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 8493 9086 gene locus_tag LOCUS_12290 8493 9086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12290 9079 9900 gene locus_tag LOCUS_12300 9079 9900 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_12300 9902 10297 gene locus_tag LOCUS_12310 9902 10297 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546721.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence082 2596 1940 gene locus_tag LOCUS_12320 2596 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3456 2593 gene locus_tag LOCUS_12330 3456 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3637 3840 gene locus_tag LOCUS_12340 3637 3840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 4209 3730 gene locus_tag LOCUS_12350 4209 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4713 4228 gene locus_tag LOCUS_12360 4713 4228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 5271 4810 gene locus_tag LOCUS_12370 5271 4810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 6656 5286 gene locus_tag LOCUS_12380 6656 5286 CDS product alpha-glucosidase/alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582827.1 protein_id gnl|my_center|LOCUS_12380 7723 6659 gene locus_tag LOCUS_12390 7723 6659 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583627.1 protein_id gnl|my_center|LOCUS_12390 9406 7829 gene locus_tag LOCUS_12400 9406 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 <10596 9408 gene locus_tag LOCUS_12410 <10596 9408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108030.1:beta-glucosidase BglX >Feature sequence083 1103 2047 gene locus_tag LOCUS_12420 1103 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2126 3004 gene locus_tag LOCUS_12430 2126 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3028 3528 gene locus_tag LOCUS_12440 3028 3528 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392726.1 protein_id gnl|my_center|LOCUS_12440 4988 3564 gene locus_tag LOCUS_12450 gene hydG 4988 3564 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868901.1 protein_id gnl|my_center|LOCUS_12450 6198 4999 gene locus_tag LOCUS_12460 gene hydF 6198 4999 CDS product [FeFe] hydrogenase H-cluster maturation GTPase HydF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108016.1 protein_id gnl|my_center|LOCUS_12460 7247 6195 gene locus_tag LOCUS_12470 gene hydE 7247 6195 CDS product [FeFe] hydrogenase H-cluster radical SAM maturase HydE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048412.1 protein_id gnl|my_center|LOCUS_12470 7511 7257 gene locus_tag LOCUS_12480 7511 7257 CDS product iron-only hydrogenase system regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868899.1 protein_id gnl|my_center|LOCUS_12480 9772 7715 gene locus_tag LOCUS_12490 9772 7715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence084 292 876 gene locus_tag LOCUS_12500 292 876 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890731.1 protein_id gnl|my_center|LOCUS_12500 939 1421 gene locus_tag LOCUS_12510 939 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 1445 2692 gene locus_tag LOCUS_12520 1445 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3054 4685 gene locus_tag LOCUS_12530 gene metG 3054 4685 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021571.1 protein_id gnl|my_center|LOCUS_12530 4867 5598 gene locus_tag LOCUS_12540 4867 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 6004 5636 gene locus_tag LOCUS_12550 6004 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 6608 5982 gene locus_tag LOCUS_12560 6608 5982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12560 7138 6641 gene locus_tag LOCUS_12570 7138 6641 CDS product GAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047967.1 protein_id gnl|my_center|LOCUS_12570 7827 7144 gene locus_tag LOCUS_12580 7827 7144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258508.1 protein_id gnl|my_center|LOCUS_12580 8917 7832 gene locus_tag LOCUS_12590 8917 7832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 9978 8914 gene locus_tag LOCUS_12600 9978 8914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence085 <1 779 gene locus_tag LOCUS_12610 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011730906.1:3-oxosteroid 1-dehydrogenase 1329 781 gene locus_tag LOCUS_12620 1329 781 CDS product glycerol-3-phosphate responsive antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003361269.1 protein_id gnl|my_center|LOCUS_12620 1680 1339 gene locus_tag LOCUS_12630 1680 1339 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867395.1 protein_id gnl|my_center|LOCUS_12630 2936 1686 gene locus_tag LOCUS_12640 2936 1686 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948740.1 protein_id gnl|my_center|LOCUS_12640 4326 2941 gene locus_tag LOCUS_12650 4326 2941 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948739.1 protein_id gnl|my_center|LOCUS_12650 5309 4464 gene locus_tag LOCUS_12660 5309 4464 CDS product DUF692 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965760.1 protein_id gnl|my_center|LOCUS_12660 5815 5630 gene locus_tag LOCUS_12670 5815 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12670 6274 5846 gene locus_tag LOCUS_12680 6274 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12680 7578 6271 gene locus_tag LOCUS_12690 7578 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12690 8681 7728 gene locus_tag LOCUS_12700 8681 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 9747 8656 gene locus_tag LOCUS_12710 9747 8656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 9919 9653 gene locus_tag LOCUS_12720 9919 9653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_12720 >Feature sequence086 172 783 gene locus_tag LOCUS_12730 172 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 846 1580 gene locus_tag LOCUS_12740 846 1580 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065023.1 protein_id gnl|my_center|LOCUS_12740 2163 3074 gene locus_tag LOCUS_12750 2163 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3257 3985 gene locus_tag LOCUS_12760 3257 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 4014 4442 gene locus_tag LOCUS_12770 4014 4442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 4455 4985 gene locus_tag LOCUS_12780 4455 4985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 6762 5056 gene locus_tag LOCUS_12790 6762 5056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 7122 7424 gene locus_tag LOCUS_12800 7122 7424 CDS product DUF1805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248463.1 protein_id gnl|my_center|LOCUS_12800 7478 7672 gene locus_tag LOCUS_12810 7478 7672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 9798 8077 gene locus_tag LOCUS_12820 9798 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 <10271 9767 gene locus_tag LOCUS_12830 <10271 9767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000840041.1:sigma-70 family RNA polymerase sigma factor >Feature sequence087 157 651 gene locus_tag LOCUS_12840 gene trmL 157 651 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429657.1 protein_id gnl|my_center|LOCUS_12840 669 1607 gene locus_tag LOCUS_12850 669 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 1604 2302 gene locus_tag LOCUS_12860 1604 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2295 3335 gene locus_tag LOCUS_12870 2295 3335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3337 4284 gene locus_tag LOCUS_12880 3337 4284 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_12880 4297 5607 gene locus_tag LOCUS_12890 4297 5607 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784758.1 protein_id gnl|my_center|LOCUS_12890 6466 5609 gene locus_tag LOCUS_12900 6466 5609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 6563 7555 gene locus_tag LOCUS_12910 6563 7555 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784748.1 protein_id gnl|my_center|LOCUS_12910 7647 8657 gene locus_tag LOCUS_12920 gene gapA 7647 8657 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000153502.1 protein_id gnl|my_center|LOCUS_12920 8778 9734 gene locus_tag LOCUS_12930 8778 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence088 519 1472 gene locus_tag LOCUS_12940 519 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12940 2179 1487 gene locus_tag LOCUS_12950 2179 1487 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966136.1 protein_id gnl|my_center|LOCUS_12950 4371 2176 gene locus_tag LOCUS_12960 4371 2176 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434402.1 protein_id gnl|my_center|LOCUS_12960 6339 4543 gene locus_tag LOCUS_12970 gene ftsH 6339 4543 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359327.1 protein_id gnl|my_center|LOCUS_12970 6974 6402 gene locus_tag LOCUS_12980 gene hpt 6974 6402 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817255.1 protein_id gnl|my_center|LOCUS_12980 8358 6964 gene locus_tag LOCUS_12990 gene tilS 8358 6964 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966480.1 protein_id gnl|my_center|LOCUS_12990 9715 8375 gene locus_tag LOCUS_13000 gene dnaB 9715 8375 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420541.1 protein_id gnl|my_center|LOCUS_13000 10172 9726 gene locus_tag LOCUS_13010 gene rplI 10172 9726 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048442.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence089 <1 800 gene locus_tag LOCUS_13020 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963818.1:YitT family protein 869 1708 gene locus_tag LOCUS_13030 869 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1749 2105 gene locus_tag LOCUS_13040 1749 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 2106 4079 gene locus_tag LOCUS_13050 2106 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 4076 4924 gene locus_tag LOCUS_13060 4076 4924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 5058 4966 gene locus_tag LOCUS_t00110 5058 4966 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5318 5812 gene locus_tag LOCUS_13070 5318 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 5902 6807 gene locus_tag LOCUS_13080 5902 6807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6813 7760 gene locus_tag LOCUS_13090 6813 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 9727 7757 gene locus_tag LOCUS_13100 9727 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 9878 10102 gene locus_tag LOCUS_13110 9878 10102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence090 154 1584 gene locus_tag LOCUS_13120 154 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 2042 1578 gene locus_tag LOCUS_13130 2042 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 2458 2042 gene locus_tag LOCUS_13140 2458 2042 CDS product hemerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814433.1 protein_id gnl|my_center|LOCUS_13140 2759 3907 gene locus_tag LOCUS_13150 2759 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 3926 4252 gene locus_tag LOCUS_13160 3926 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987057.1 protein_id gnl|my_center|LOCUS_13160 5555 4293 gene locus_tag LOCUS_13170 5555 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 5668 5808 gene locus_tag LOCUS_13180 5668 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 6223 5855 gene locus_tag LOCUS_13190 6223 5855 CDS product DUF2512 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966623.1 protein_id gnl|my_center|LOCUS_13190 6451 7098 gene locus_tag LOCUS_13200 6451 7098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 7500 7138 gene locus_tag LOCUS_13210 7500 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 7583 8224 gene locus_tag LOCUS_13220 7583 8224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 8221 8619 gene locus_tag LOCUS_13230 8221 8619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13230 8642 8857 gene locus_tag LOCUS_13240 8642 8857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 8974 8899 gene locus_tag LOCUS_t00120 8974 8899 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 9203 10180 gene locus_tag LOCUS_13250 9203 10180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence091 833 1033 gene locus_tag LOCUS_13260 833 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2925 1051 gene locus_tag LOCUS_13270 2925 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3824 2931 gene locus_tag LOCUS_13280 3824 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 4054 5727 gene locus_tag LOCUS_13290 4054 5727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 5853 6539 gene locus_tag LOCUS_13300 5853 6539 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808611.1 protein_id gnl|my_center|LOCUS_13300 6641 7777 gene locus_tag LOCUS_13310 6641 7777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 7833 9209 gene locus_tag LOCUS_13320 gene fumC 7833 9209 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228523.1 protein_id gnl|my_center|LOCUS_13320 9227 9508 gene locus_tag LOCUS_13330 9227 9508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence092 <1 653 gene locus_tag LOCUS_13340 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836511.1:glutamate formimidoyltransferase 705 905 gene locus_tag LOCUS_13350 705 905 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773685.1 protein_id gnl|my_center|LOCUS_13350 922 1935 gene locus_tag LOCUS_13360 922 1935 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966170.1 protein_id gnl|my_center|LOCUS_13360 1932 2765 gene locus_tag LOCUS_13370 gene prmC 1932 2765 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_13370 4500 2755 gene locus_tag LOCUS_13380 4500 2755 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_13380 4648 5775 gene locus_tag LOCUS_13390 4648 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6982 5759 gene locus_tag LOCUS_13400 gene glpT 6982 5759 CDS product glycerol-3-phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948741.1 protein_id gnl|my_center|LOCUS_13400 7981 6983 gene locus_tag LOCUS_13410 gene nagA 7981 6983 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582637.1 protein_id gnl|my_center|LOCUS_13410 8109 9371 gene locus_tag LOCUS_13420 8109 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 <10033 9349 gene locus_tag LOCUS_13430 <10033 9349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015944146.1:pyridoxamine kinase >Feature sequence093 82 618 gene locus_tag LOCUS_13440 82 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 602 1525 gene locus_tag LOCUS_13450 602 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 1620 2669 gene locus_tag LOCUS_13460 1620 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3153 2854 gene locus_tag LOCUS_13470 3153 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 3387 5153 gene locus_tag LOCUS_13480 3387 5153 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898459.1 protein_id gnl|my_center|LOCUS_13480 5172 5708 gene locus_tag LOCUS_13490 5172 5708 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895862.1 protein_id gnl|my_center|LOCUS_13490 7322 5724 gene locus_tag LOCUS_13500 7322 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 7479 8783 gene locus_tag LOCUS_13510 7479 8783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 8796 9944 gene locus_tag LOCUS_13520 8796 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence094 87 677 gene locus_tag LOCUS_13530 87 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 745 1710 gene locus_tag LOCUS_13540 745 1710 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016741.1 protein_id gnl|my_center|LOCUS_13540 1800 2864 gene locus_tag LOCUS_13550 1800 2864 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895264.1 protein_id gnl|my_center|LOCUS_13550 4391 2853 gene locus_tag LOCUS_13560 4391 2853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 5100 4522 gene locus_tag LOCUS_13570 5100 4522 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890774.1 protein_id gnl|my_center|LOCUS_13570 5839 5255 gene locus_tag LOCUS_13580 5839 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13580 6302 5850 gene locus_tag LOCUS_13590 6302 5850 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861830.1 protein_id gnl|my_center|LOCUS_13590 6553 6840 gene locus_tag LOCUS_13600 gene rpsF 6553 6840 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_13600 6849 7274 gene locus_tag LOCUS_13610 gene ssb 6849 7274 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359348.1 protein_id gnl|my_center|LOCUS_13610 7311 7583 gene locus_tag LOCUS_13620 gene rpsR 7311 7583 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966982.1 protein_id gnl|my_center|LOCUS_13620 7653 7886 gene locus_tag LOCUS_13630 7653 7886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 7888 9885 gene locus_tag LOCUS_13640 7888 9885 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429268.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence095 789 130 gene locus_tag LOCUS_13650 789 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 896 2722 gene locus_tag LOCUS_13660 896 2722 CDS product heparinase II/III-family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201967.1 protein_id gnl|my_center|LOCUS_13660 3137 2703 gene locus_tag LOCUS_13670 3137 2703 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289317.1 protein_id gnl|my_center|LOCUS_13670 3874 3161 gene locus_tag LOCUS_13680 3874 3161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 5019 3889 gene locus_tag LOCUS_13690 5019 3889 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161951924.1 protein_id gnl|my_center|LOCUS_13690 5137 6168 gene locus_tag LOCUS_13700 5137 6168 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545188.1 protein_id gnl|my_center|LOCUS_13700 6171 7907 gene locus_tag LOCUS_13710 6171 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 9700 7904 gene locus_tag LOCUS_13720 9700 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence096 2189 1494 gene locus_tag LOCUS_13730 2189 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13730 2837 2193 gene locus_tag LOCUS_13740 2837 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 4037 3294 gene locus_tag LOCUS_13750 4037 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4294 5352 gene locus_tag LOCUS_13760 4294 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 5380 6891 gene locus_tag LOCUS_13770 5380 6891 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048012.1 protein_id gnl|my_center|LOCUS_13770 6930 7625 gene locus_tag LOCUS_13780 6930 7625 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666310.1 protein_id gnl|my_center|LOCUS_13780 9482 7677 gene locus_tag LOCUS_13790 9482 7677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 >Feature sequence097 662 1471 gene locus_tag LOCUS_13800 gene zupT 662 1471 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_13800 1612 1457 gene locus_tag LOCUS_13810 1612 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2011 1709 gene locus_tag LOCUS_13820 2011 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 3026 1974 gene locus_tag LOCUS_13830 3026 1974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294518.1 protein_id gnl|my_center|LOCUS_13830 4179 3013 gene locus_tag LOCUS_13840 4179 3013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861634.1 protein_id gnl|my_center|LOCUS_13840 5995 4190 gene locus_tag LOCUS_13850 5995 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 7062 6022 gene locus_tag LOCUS_13860 7062 6022 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963501.1 protein_id gnl|my_center|LOCUS_13860 9407 7092 gene locus_tag LOCUS_13870 9407 7092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence098 <1 922 gene locus_tag LOCUS_13880 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584102.1:dihydroxy-acid dehydratase 938 2443 gene locus_tag LOCUS_13890 938 2443 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393738.1 protein_id gnl|my_center|LOCUS_13890 2454 4073 gene locus_tag LOCUS_13900 gene cimA 2454 4073 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966451.1 protein_id gnl|my_center|LOCUS_13900 4036 5304 gene locus_tag LOCUS_13910 gene leuC 4036 5304 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895941.1 protein_id gnl|my_center|LOCUS_13910 5321 5818 gene locus_tag LOCUS_13920 gene leuD 5321 5818 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437092.1 protein_id gnl|my_center|LOCUS_13920 5820 6869 gene locus_tag LOCUS_13930 gene leuB 5820 6869 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966448.1 protein_id gnl|my_center|LOCUS_13930 7496 7104 gene locus_tag LOCUS_13940 7496 7104 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809664.1 protein_id gnl|my_center|LOCUS_13940 8428 7505 gene locus_tag LOCUS_13950 8428 7505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 8585 8510 gene locus_tag LOCUS_t00130 8585 8510 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9215 8667 gene locus_tag LOCUS_13960 9215 8667 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767407.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence099 481 1041 gene locus_tag LOCUS_13970 481 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1308 3554 gene locus_tag LOCUS_13980 1308 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 3576 3758 gene locus_tag LOCUS_13990 3576 3758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 3841 4365 gene locus_tag LOCUS_14000 3841 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 5107 4340 gene locus_tag LOCUS_14010 5107 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 5396 5109 gene locus_tag LOCUS_14020 5396 5109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 5971 5462 gene locus_tag LOCUS_14030 5971 5462 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439611.1 protein_id gnl|my_center|LOCUS_14030 6113 6493 gene locus_tag LOCUS_14040 6113 6493 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047976.1 protein_id gnl|my_center|LOCUS_14040 6490 7347 gene locus_tag LOCUS_14050 6490 7347 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943957.1 protein_id gnl|my_center|LOCUS_14050 7344 7949 gene locus_tag LOCUS_14060 7344 7949 CDS product ABC-2 transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459560.1 protein_id gnl|my_center|LOCUS_14060 7953 8342 gene locus_tag LOCUS_14070 7953 8342 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_14070 8500 9015 gene locus_tag LOCUS_14080 8500 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence100 165 1100 gene locus_tag LOCUS_14090 165 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1247 1681 gene locus_tag LOCUS_14100 1247 1681 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393392.1 protein_id gnl|my_center|LOCUS_14100 1795 3132 gene locus_tag LOCUS_14110 1795 3132 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016728782.1 protein_id gnl|my_center|LOCUS_14110 4497 3100 gene locus_tag LOCUS_14120 gene gatB 4497 3100 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_14120 5276 4494 gene locus_tag LOCUS_14130 5276 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14130 5923 5213 gene locus_tag LOCUS_14140 5923 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14140 6170 5925 gene locus_tag LOCUS_14150 6170 5925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 7000 6293 gene locus_tag LOCUS_14160 7000 6293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 7651 8604 gene locus_tag LOCUS_14170 7651 8604 CDS product discoidin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359839.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence101 1573 605 gene locus_tag LOCUS_14180 1573 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 1681 4293 gene locus_tag LOCUS_14190 1681 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 4869 4375 gene locus_tag LOCUS_14200 4869 4375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 5387 4935 gene locus_tag LOCUS_14210 5387 4935 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164855384.1 protein_id gnl|my_center|LOCUS_14210 6737 5406 gene locus_tag LOCUS_14220 gene hisS 6737 5406 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966027.1 protein_id gnl|my_center|LOCUS_14220 6924 6849 gene locus_tag LOCUS_t00140 6924 6849 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 7513 8805 gene locus_tag LOCUS_14230 7513 8805 CDS product IS30-like element ISSmi1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000163006.1 protein_id gnl|my_center|LOCUS_14230 >Feature sequence102 182 775 gene locus_tag LOCUS_14240 182 775 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183791.1 protein_id gnl|my_center|LOCUS_14240 782 1897 gene locus_tag LOCUS_14250 782 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2988 1894 gene locus_tag LOCUS_14260 2988 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 3711 3007 gene locus_tag LOCUS_14270 3711 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 6147 3727 gene locus_tag LOCUS_14280 6147 3727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 6406 7041 gene locus_tag LOCUS_14290 6406 7041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 7178 7366 gene locus_tag LOCUS_14300 7178 7366 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_14300 7575 8927 gene locus_tag LOCUS_14310 7575 8927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence103 1491 595 gene locus_tag LOCUS_14320 1491 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 3955 1640 gene locus_tag LOCUS_14330 3955 1640 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108570.1 protein_id gnl|my_center|LOCUS_14330 4243 4869 gene locus_tag LOCUS_14340 gene trmB 4243 4869 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266024.1 protein_id gnl|my_center|LOCUS_14340 4891 5235 gene locus_tag LOCUS_14350 4891 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6375 5617 gene locus_tag LOCUS_14360 6375 5617 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964615.1 protein_id gnl|my_center|LOCUS_14360 7084 6380 gene locus_tag LOCUS_14370 7084 6380 CDS product tRNA (adenine(22)-N(1))-methyltransferase TrmK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964614.1 protein_id gnl|my_center|LOCUS_14370 7241 8149 gene locus_tag LOCUS_14380 7241 8149 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986545.1 protein_id gnl|my_center|LOCUS_14380 9004 8189 gene locus_tag LOCUS_14390 9004 8189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 >Feature sequence104 <1 581 gene locus_tag LOCUS_14400 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459735.1:uroporphyrinogen decarboxylase family protein 659 1216 gene locus_tag LOCUS_14410 gene rsmD 659 1216 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_14410 1223 1738 gene locus_tag LOCUS_14420 gene coaD 1223 1738 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965045.1 protein_id gnl|my_center|LOCUS_14420 1740 2312 gene locus_tag LOCUS_14430 1740 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 3094 2309 gene locus_tag LOCUS_14440 3094 2309 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393605.1 protein_id gnl|my_center|LOCUS_14440 4842 3091 gene locus_tag LOCUS_14450 4842 3091 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963614.1 protein_id gnl|my_center|LOCUS_14450 4985 5608 gene locus_tag LOCUS_14460 4985 5608 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393623.1 protein_id gnl|my_center|LOCUS_14460 5620 6498 gene locus_tag LOCUS_14470 5620 6498 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100907.1 protein_id gnl|my_center|LOCUS_14470 6508 8100 gene locus_tag LOCUS_14480 6508 8100 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289289.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence105 443 637 gene locus_tag LOCUS_14490 443 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14490 689 1408 gene locus_tag LOCUS_14500 689 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14500 1549 1815 gene locus_tag LOCUS_14510 1549 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3697 1853 gene locus_tag LOCUS_14520 3697 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14520 4377 4135 gene locus_tag LOCUS_14530 4377 4135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14530 4545 5774 gene locus_tag LOCUS_14540 4545 5774 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_14540 6304 5786 gene locus_tag LOCUS_14550 6304 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 7372 6332 gene locus_tag LOCUS_14560 7372 6332 CDS product 2-dehydropantoate 2-reductase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066908.1 protein_id gnl|my_center|LOCUS_14560 8277 7444 gene locus_tag LOCUS_14570 8277 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 8465 8390 gene locus_tag LOCUS_t00150 8465 8390 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence106 864 2117 gene locus_tag LOCUS_14580 864 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 2238 2600 gene locus_tag LOCUS_14590 2238 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 2993 4669 gene locus_tag LOCUS_14600 2993 4669 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065557.1 protein_id gnl|my_center|LOCUS_14600 4692 6353 gene locus_tag LOCUS_14610 gene ilvB 4692 6353 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966446.1 protein_id gnl|my_center|LOCUS_14610 6368 6886 gene locus_tag LOCUS_14620 gene ilvN 6368 6886 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393740.1 protein_id gnl|my_center|LOCUS_14620 6919 7908 gene locus_tag LOCUS_14630 gene ilvC 6919 7908 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921008.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence107 316 1485 gene locus_tag LOCUS_14640 316 1485 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860647.1 protein_id gnl|my_center|LOCUS_14640 1478 1942 gene locus_tag LOCUS_14650 gene tsaE 1478 1942 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_14650 1930 2625 gene locus_tag LOCUS_14660 gene tsaB 1930 2625 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966124.1 protein_id gnl|my_center|LOCUS_14660 2616 3071 gene locus_tag LOCUS_14670 2616 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 3144 3836 gene locus_tag LOCUS_14680 3144 3836 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_14680 3851 4849 gene locus_tag LOCUS_14690 3851 4849 CDS product GGGtGRT protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965854.1 protein_id gnl|my_center|LOCUS_14690 4880 5752 gene locus_tag LOCUS_14700 gene proB 4880 5752 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723561.1 protein_id gnl|my_center|LOCUS_14700 5730 6995 gene locus_tag LOCUS_14710 5730 6995 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_14710 <8630 7036 gene locus_tag LOCUS_14720 <8630 7036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393212.1:PBP1A family penicillin-binding protein >Feature sequence108 80 628 gene locus_tag LOCUS_14730 80 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 748 1494 gene locus_tag LOCUS_14740 748 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1611 1817 gene locus_tag LOCUS_14750 1611 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1903 2937 gene locus_tag LOCUS_14760 1903 2937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14760 2971 3702 gene locus_tag LOCUS_14770 gene nadE 2971 3702 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437535.1 protein_id gnl|my_center|LOCUS_14770 4497 3703 gene locus_tag LOCUS_14780 4497 3703 CDS product protein-glutamine gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986759.1 protein_id gnl|my_center|LOCUS_14780 5215 4469 gene locus_tag LOCUS_14790 5215 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 5632 5270 gene locus_tag LOCUS_14800 5632 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 6565 5717 gene locus_tag LOCUS_14810 6565 5717 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_14810 6811 7743 gene locus_tag LOCUS_14820 gene cysK 6811 7743 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356610.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence109 177 404 gene locus_tag LOCUS_14830 177 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 423 893 gene locus_tag LOCUS_14840 gene nusB 423 893 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428415.1 protein_id gnl|my_center|LOCUS_14840 886 2085 gene locus_tag LOCUS_14850 gene xseA 886 2085 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415249.1 protein_id gnl|my_center|LOCUS_14850 2078 2305 gene locus_tag LOCUS_14860 2078 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2295 3185 gene locus_tag LOCUS_14870 2295 3185 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888951.1 protein_id gnl|my_center|LOCUS_14870 3201 5087 gene locus_tag LOCUS_14880 gene dxs 3201 5087 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033045549.1 protein_id gnl|my_center|LOCUS_14880 5128 5964 gene locus_tag LOCUS_14890 5128 5964 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393018.1 protein_id gnl|my_center|LOCUS_14890 5983 7674 gene locus_tag LOCUS_14900 gene recN 5983 7674 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896126.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence110 222 773 gene locus_tag LOCUS_14910 222 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 787 3039 gene locus_tag LOCUS_14920 787 3039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_14920 3139 4152 gene locus_tag LOCUS_14930 3139 4152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 4182 5621 gene locus_tag LOCUS_14940 4182 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 6368 5616 gene locus_tag LOCUS_14950 6368 5616 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903557.1 protein_id gnl|my_center|LOCUS_14950 6569 6988 gene locus_tag LOCUS_14960 6569 6988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14960 7593 7021 gene locus_tag LOCUS_14970 7593 7021 CDS product manganese catalase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964647.1 protein_id gnl|my_center|LOCUS_14970 7863 7600 gene locus_tag LOCUS_14980 7863 7600 CDS product spore coat protein CotJB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392904.1 protein_id gnl|my_center|LOCUS_14980 8022 7867 gene locus_tag LOCUS_14990 8022 7867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence111 <1 1443 gene locus_tag LOCUS_15000 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948260.1:ATP-dependent DNA helicase 1573 2961 gene locus_tag LOCUS_15010 1573 2961 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886564.1 protein_id gnl|my_center|LOCUS_15010 2982 3389 gene locus_tag LOCUS_15020 2982 3389 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149793471.1 protein_id gnl|my_center|LOCUS_15020 3404 4801 gene locus_tag LOCUS_15030 gene oadA 3404 4801 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_15030 4857 6083 gene locus_tag LOCUS_15040 4857 6083 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897869.1 protein_id gnl|my_center|LOCUS_15040 6137 6598 gene locus_tag LOCUS_15050 6137 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 6651 7139 gene locus_tag LOCUS_15060 6651 7139 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434191.1 protein_id gnl|my_center|LOCUS_15060 7136 8140 gene locus_tag LOCUS_15070 gene galE 7136 8140 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence112 363 497 gene locus_tag LOCUS_15080 gene rpmH 363 497 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831901.1 protein_id gnl|my_center|LOCUS_15080 539 928 gene locus_tag LOCUS_15090 gene rnpA 539 928 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_15090 1162 2043 gene locus_tag LOCUS_15100 1162 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2043 2717 gene locus_tag LOCUS_15110 2043 2717 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_15110 2717 4099 gene locus_tag LOCUS_15120 gene mnmE 2717 4099 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966994.1 protein_id gnl|my_center|LOCUS_15120 4113 6026 gene locus_tag LOCUS_15130 gene mnmG 4113 6026 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048454.1 protein_id gnl|my_center|LOCUS_15130 6026 6751 gene locus_tag LOCUS_15140 gene rsmG 6026 6751 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549696.1 protein_id gnl|my_center|LOCUS_15140 6855 7820 gene locus_tag LOCUS_15150 gene noc 6855 7820 CDS product nucleoid occlusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429292.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence113 2839 440 gene locus_tag LOCUS_15160 2839 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 3413 3237 gene locus_tag LOCUS_15170 3413 3237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 4078 3473 gene locus_tag LOCUS_15180 4078 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 4858 4280 gene locus_tag LOCUS_15190 4858 4280 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191105.1 protein_id gnl|my_center|LOCUS_15190 5295 4855 gene locus_tag LOCUS_15200 5295 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 6731 5526 gene locus_tag LOCUS_15210 6731 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 7206 7811 gene locus_tag LOCUS_15220 7206 7811 CDS product FMN-dependent NADH-azoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966691.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence114 <1 3267 gene locus_tag LOCUS_15230 <1 3267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048163.1:2-hydroxyacyl-CoA dehydratase 3268 4527 gene locus_tag LOCUS_15240 3268 4527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 4548 6353 gene locus_tag LOCUS_15250 gene lepA 4548 6353 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816487.1 protein_id gnl|my_center|LOCUS_15250 6355 7503 gene locus_tag LOCUS_15260 gene hemW 6355 7503 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454756.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence115 2180 1350 gene locus_tag LOCUS_15270 2180 1350 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475880.1 protein_id gnl|my_center|LOCUS_15270 2387 5125 gene locus_tag LOCUS_15280 2387 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 5137 5862 gene locus_tag LOCUS_15290 5137 5862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 7267 5906 gene locus_tag LOCUS_15300 7267 5906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 8226 7279 gene locus_tag LOCUS_15310 8226 7279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence116 3287 1623 gene locus_tag LOCUS_15320 3287 1623 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000036873.1 protein_id gnl|my_center|LOCUS_15320 4021 3290 gene locus_tag LOCUS_15330 4021 3290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669374.1 protein_id gnl|my_center|LOCUS_15330 4121 4867 gene locus_tag LOCUS_15340 4121 4867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 6839 4851 gene locus_tag LOCUS_15350 6839 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 7945 6845 gene locus_tag LOCUS_15360 7945 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 8158 8083 gene locus_tag LOCUS_t00160 8158 8083 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence117 628 2451 gene locus_tag LOCUS_15370 628 2451 CDS product BatA and WFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121419.1 protein_id gnl|my_center|LOCUS_15370 2435 5227 gene locus_tag LOCUS_15380 2435 5227 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258469.1 protein_id gnl|my_center|LOCUS_15380 5348 6820 gene locus_tag LOCUS_15390 5348 6820 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860945.1 protein_id gnl|my_center|LOCUS_15390 6864 8273 gene locus_tag LOCUS_15400 6864 8273 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479097.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence118 683 895 gene locus_tag LOCUS_15410 683 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1051 2178 gene locus_tag LOCUS_15420 1051 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 2425 4026 gene locus_tag LOCUS_15430 2425 4026 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287286.1 protein_id gnl|my_center|LOCUS_15430 4130 4573 gene locus_tag LOCUS_15440 4130 4573 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_15440 4566 5258 gene locus_tag LOCUS_15450 4566 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15450 5297 5866 gene locus_tag LOCUS_15460 5297 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 7019 5838 gene locus_tag LOCUS_15470 7019 5838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 8209 7034 gene locus_tag LOCUS_15480 8209 7034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence119 90 3344 gene locus_tag LOCUS_15490 90 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 3446 4129 gene locus_tag LOCUS_15500 3446 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 4236 5015 gene locus_tag LOCUS_15510 4236 5015 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 protein_id gnl|my_center|LOCUS_15510 5050 5985 gene locus_tag LOCUS_15520 5050 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 6245 6015 gene locus_tag LOCUS_15530 6245 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 6492 6310 gene locus_tag LOCUS_15540 6492 6310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 7404 6508 gene locus_tag LOCUS_15550 7404 6508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 7855 7418 gene locus_tag LOCUS_15560 7855 7418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 8160 7855 gene locus_tag LOCUS_15570 8160 7855 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116156.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence120 965 264 gene locus_tag LOCUS_15580 965 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 2094 985 gene locus_tag LOCUS_15590 2094 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 3235 2072 gene locus_tag LOCUS_15600 3235 2072 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425444.1 protein_id gnl|my_center|LOCUS_15600 4697 3303 gene locus_tag LOCUS_15610 4697 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 6145 4694 gene locus_tag LOCUS_15620 6145 4694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 6861 6160 gene locus_tag LOCUS_15630 6861 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 7809 6862 gene locus_tag LOCUS_15640 7809 6862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057313.1 protein_id gnl|my_center|LOCUS_15640 >Feature sequence121 1884 940 gene locus_tag LOCUS_15650 1884 940 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963590.1 protein_id gnl|my_center|LOCUS_15650 2087 4615 gene locus_tag LOCUS_15660 2087 4615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 4626 5558 gene locus_tag LOCUS_15670 4626 5558 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256857.1 protein_id gnl|my_center|LOCUS_15670 5548 6402 gene locus_tag LOCUS_15680 5548 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 6415 6903 gene locus_tag LOCUS_15690 6415 6903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 7581 6937 gene locus_tag LOCUS_15700 7581 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence122 767 2140 gene locus_tag LOCUS_15710 767 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 2403 3092 gene locus_tag LOCUS_15720 2403 3092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 3156 4103 gene locus_tag LOCUS_15730 3156 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 4957 4100 gene locus_tag LOCUS_15740 4957 4100 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760939.1 protein_id gnl|my_center|LOCUS_15740 5212 6870 gene locus_tag LOCUS_15750 5212 6870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 7134 6853 gene locus_tag LOCUS_15760 7134 6853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 7661 7140 gene locus_tag LOCUS_15770 7661 7140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence123 2659 1718 gene locus_tag LOCUS_15780 gene ligD 2659 1718 CDS product non-homologous end-joining DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879221.1 protein_id gnl|my_center|LOCUS_15780 3194 2661 gene locus_tag LOCUS_15790 3194 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15790 3431 3204 gene locus_tag LOCUS_15800 3431 3204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15800 4262 3537 gene locus_tag LOCUS_15810 gene spoIIR 4262 3537 CDS product stage II sporulation protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425996.1 protein_id gnl|my_center|LOCUS_15810 5033 4359 gene locus_tag LOCUS_15820 5033 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 5891 5058 gene locus_tag LOCUS_15830 gene murI 5891 5058 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_15830 6950 5892 gene locus_tag LOCUS_15840 6950 5892 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966178.1 protein_id gnl|my_center|LOCUS_15840 7888 7391 gene locus_tag LOCUS_15850 7888 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence124 566 144 gene locus_tag LOCUS_15860 566 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 2083 563 gene locus_tag LOCUS_15870 2083 563 CDS product DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363706.1 protein_id gnl|my_center|LOCUS_15870 2450 2112 gene locus_tag LOCUS_15880 2450 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 2694 2617 gene locus_tag LOCUS_t00170 2694 2617 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2825 2749 gene locus_tag LOCUS_t00180 2825 2749 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2985 3752 gene locus_tag LOCUS_15890 gene proC 2985 3752 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_15890 3760 4761 gene locus_tag LOCUS_15900 3760 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 4767 6029 gene locus_tag LOCUS_15910 4767 6029 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_15910 6035 7249 gene locus_tag LOCUS_15920 gene dacF 6035 7249 CDS product serine-type D-Ala-D-Ala carboxypeptidase DacF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831985.1 protein_id gnl|my_center|LOCUS_15920 7267 7506 gene locus_tag LOCUS_15930 7267 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 7811 7635 gene locus_tag LOCUS_15940 7811 7635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence125 22 1548 gene locus_tag LOCUS_15950 22 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 1671 3500 gene locus_tag LOCUS_15960 1671 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 4323 5393 gene locus_tag LOCUS_15970 4323 5393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 5707 6738 gene locus_tag LOCUS_15980 5707 6738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 7141 6998 gene locus_tag LOCUS_15990 7141 6998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence126 680 829 gene locus_tag LOCUS_16000 680 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1306 1833 gene locus_tag LOCUS_16010 1306 1833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 1835 2188 gene locus_tag LOCUS_16020 1835 2188 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_16020 2233 2391 gene locus_tag LOCUS_16030 2233 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 2388 2663 gene locus_tag LOCUS_16040 2388 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 2727 3323 gene locus_tag LOCUS_16050 2727 3323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 3339 3926 gene locus_tag LOCUS_16060 3339 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 4013 4678 gene locus_tag LOCUS_16070 4013 4678 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970384.1 protein_id gnl|my_center|LOCUS_16070 4685 5788 gene locus_tag LOCUS_16080 4685 5788 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125082658.1 protein_id gnl|my_center|LOCUS_16080 6149 5958 gene locus_tag LOCUS_16090 6149 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 6380 7150 gene locus_tag LOCUS_16100 6380 7150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 7527 7336 gene locus_tag LOCUS_16110 7527 7336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence127 209 520 gene locus_tag LOCUS_16120 209 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 533 2500 gene locus_tag LOCUS_16130 533 2500 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986938.1 protein_id gnl|my_center|LOCUS_16130 2503 2976 gene locus_tag LOCUS_16140 2503 2976 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_16140 2988 3593 gene locus_tag LOCUS_16150 2988 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 3590 4555 gene locus_tag LOCUS_16160 3590 4555 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439726.1 protein_id gnl|my_center|LOCUS_16160 4548 4856 gene locus_tag LOCUS_16170 4548 4856 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422665.1 protein_id gnl|my_center|LOCUS_16170 4870 6636 gene locus_tag LOCUS_16180 4870 6636 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426762.1 protein_id gnl|my_center|LOCUS_16180 6636 7607 gene locus_tag LOCUS_16190 6636 7607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16190 >Feature sequence128 385 567 gene locus_tag LOCUS_16200 385 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1074 628 gene locus_tag LOCUS_16210 1074 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 1192 2499 gene locus_tag LOCUS_16220 1192 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 2503 3693 gene locus_tag LOCUS_16230 2503 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 3859 3653 gene locus_tag LOCUS_16240 3859 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 4191 4015 gene locus_tag LOCUS_16250 4191 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 4606 4824 gene locus_tag LOCUS_16260 4606 4824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 4878 5183 gene locus_tag LOCUS_16270 4878 5183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 5202 6215 gene locus_tag LOCUS_16280 5202 6215 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966091.1 protein_id gnl|my_center|LOCUS_16280 6810 6286 gene locus_tag LOCUS_16290 6810 6286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 7336 6848 gene locus_tag LOCUS_16300 7336 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence129 2016 130 gene locus_tag LOCUS_16310 gene htpG 2016 130 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435963.1 protein_id gnl|my_center|LOCUS_16310 2536 3267 gene locus_tag LOCUS_16320 2536 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3283 4032 gene locus_tag LOCUS_16330 3283 4032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 4109 4957 gene locus_tag LOCUS_16340 gene pdaA 4109 4957 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244439.1 protein_id gnl|my_center|LOCUS_16340 4964 5209 gene locus_tag LOCUS_16350 4964 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 5221 6411 gene locus_tag LOCUS_16360 gene yqfD 5221 6411 CDS product sporulation protein YqfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392129.1 protein_id gnl|my_center|LOCUS_16360 6404 7384 gene locus_tag LOCUS_16370 6404 7384 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence130 1913 1827 gene locus_tag LOCUS_t00190 1913 1827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4329 1954 gene locus_tag LOCUS_16380 4329 1954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 4933 4340 gene locus_tag LOCUS_16390 4933 4340 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_16390 5601 4921 gene locus_tag LOCUS_16400 gene cmk 5601 4921 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015703.1 protein_id gnl|my_center|LOCUS_16400 6038 5622 gene locus_tag LOCUS_16410 6038 5622 CDS product HutP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392857.1 protein_id gnl|my_center|LOCUS_16410 6823 6107 gene locus_tag LOCUS_16420 6823 6107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 6873 7040 gene locus_tag LOCUS_16430 6873 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence131 <1 942 gene locus_tag LOCUS_16440 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002286007.1:helix-turn-helix domain-containing protein 1271 3172 gene locus_tag LOCUS_16450 1271 3172 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880698.1 protein_id gnl|my_center|LOCUS_16450 3300 4286 gene locus_tag LOCUS_16460 3300 4286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148691226.1 protein_id gnl|my_center|LOCUS_16460 4289 5140 gene locus_tag LOCUS_16470 4289 5140 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980619.1 protein_id gnl|my_center|LOCUS_16470 5198 6178 gene locus_tag LOCUS_16480 5198 6178 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_16480 6179 7207 gene locus_tag LOCUS_16490 6179 7207 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583525.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence132 1827 727 gene locus_tag LOCUS_16500 1827 727 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_16500 4148 1998 gene locus_tag LOCUS_16510 gene feoB 4148 1998 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439379.1 protein_id gnl|my_center|LOCUS_16510 4398 4159 gene locus_tag LOCUS_16520 4398 4159 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460459.1 protein_id gnl|my_center|LOCUS_16520 4501 4935 gene locus_tag LOCUS_16530 4501 4935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 5069 5626 gene locus_tag LOCUS_16540 gene efp 5069 5626 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965394.1 protein_id gnl|my_center|LOCUS_16540 5671 6138 gene locus_tag LOCUS_16550 5671 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428343.1 protein_id gnl|my_center|LOCUS_16550 6460 6194 gene locus_tag LOCUS_16560 6460 6194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 6753 6553 gene locus_tag LOCUS_16570 6753 6553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 6816 7259 gene locus_tag LOCUS_16580 6816 7259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence133 1180 158 gene locus_tag LOCUS_16590 1180 158 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966142.1 protein_id gnl|my_center|LOCUS_16590 2370 1267 gene locus_tag LOCUS_16600 2370 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 2564 2373 gene locus_tag LOCUS_16610 2564 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 3303 2578 gene locus_tag LOCUS_16620 3303 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 4067 3315 gene locus_tag LOCUS_16630 4067 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 5236 4064 gene locus_tag LOCUS_16640 5236 4064 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261282.1 protein_id gnl|my_center|LOCUS_16640 6895 5339 gene locus_tag LOCUS_16650 6895 5339 CDS product putative ABC exporter domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460116.1 protein_id gnl|my_center|LOCUS_16650 <7507 6897 gene locus_tag LOCUS_16660 <7507 6897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460117.1:ABC transporter ATP-binding protein >Feature sequence134 1566 466 gene locus_tag LOCUS_16670 1566 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 2654 1569 gene locus_tag LOCUS_16680 2654 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 2795 4744 gene locus_tag LOCUS_16690 2795 4744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 4754 5548 gene locus_tag LOCUS_16700 4754 5548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 5634 7268 gene locus_tag LOCUS_16710 5634 7268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence135 1354 1932 gene locus_tag LOCUS_16720 1354 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 1935 2933 gene locus_tag LOCUS_16730 1935 2933 CDS product nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294378.1 protein_id gnl|my_center|LOCUS_16730 3009 5861 gene locus_tag LOCUS_16740 3009 5861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence136 132 1367 gene locus_tag LOCUS_16750 gene eno 132 1367 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_16750 4149 1405 gene locus_tag LOCUS_16760 4149 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 5431 4154 gene locus_tag LOCUS_16770 gene lysA 5431 4154 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020771.1 protein_id gnl|my_center|LOCUS_16770 6099 5518 gene locus_tag LOCUS_16780 gene yihA 6099 5518 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891775.1 protein_id gnl|my_center|LOCUS_16780 6268 7065 gene locus_tag LOCUS_16790 6268 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence137 262 1299 gene locus_tag LOCUS_16800 262 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1318 3036 gene locus_tag LOCUS_16810 1318 3036 CDS product glycoside hydrolase family 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971639.1 protein_id gnl|my_center|LOCUS_16810 3131 5389 gene locus_tag LOCUS_16820 3131 5389 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813559.1 protein_id gnl|my_center|LOCUS_16820 5406 5894 gene locus_tag LOCUS_16830 5406 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 5927 6253 gene locus_tag LOCUS_16840 5927 6253 CDS product cyclic-di-AMP receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384432.1 protein_id gnl|my_center|LOCUS_16840 6629 6285 gene locus_tag LOCUS_16850 6629 6285 CDS product NINE protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014023068.1 protein_id gnl|my_center|LOCUS_16850 6994 6815 gene locus_tag LOCUS_16860 6994 6815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence138 537 734 gene locus_tag LOCUS_16870 gene rpmE 537 734 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896340.1 protein_id gnl|my_center|LOCUS_16870 2589 799 gene locus_tag LOCUS_16880 2589 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 2698 2988 gene locus_tag LOCUS_16890 2698 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 3036 3428 gene locus_tag LOCUS_16900 3036 3428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3562 3831 gene locus_tag LOCUS_16910 3562 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 3852 4331 gene locus_tag LOCUS_16920 3852 4331 CDS product S1 domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000021451.1 protein_id gnl|my_center|LOCUS_16920 4315 5424 gene locus_tag LOCUS_16930 4315 5424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 5461 6975 gene locus_tag LOCUS_16940 5461 6975 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392657.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence139 1034 348 gene locus_tag LOCUS_16950 1034 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1776 1078 gene locus_tag LOCUS_16960 1776 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 1934 3394 gene locus_tag LOCUS_16970 1934 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3975 3391 gene locus_tag LOCUS_16980 3975 3391 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023565.1 protein_id gnl|my_center|LOCUS_16980 4215 5192 gene locus_tag LOCUS_16990 4215 5192 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811776.1 protein_id gnl|my_center|LOCUS_16990 5275 6138 gene locus_tag LOCUS_17000 5275 6138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811777.1 protein_id gnl|my_center|LOCUS_17000 6131 6925 gene locus_tag LOCUS_17010 6131 6925 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811779.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence140 196 690 gene locus_tag LOCUS_17020 196 690 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000351160.1 protein_id gnl|my_center|LOCUS_17020 1449 667 gene locus_tag LOCUS_17030 1449 667 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938184.1 protein_id gnl|my_center|LOCUS_17030 2647 1571 gene locus_tag LOCUS_17040 2647 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 2849 3904 gene locus_tag LOCUS_17050 2849 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3907 4599 gene locus_tag LOCUS_17060 3907 4599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 4650 5117 gene locus_tag LOCUS_17070 4650 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 5191 6330 gene locus_tag LOCUS_17080 5191 6330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence141 652 92 gene locus_tag LOCUS_17090 652 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 916 671 gene locus_tag LOCUS_17100 916 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1291 1917 gene locus_tag LOCUS_17110 1291 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3831 2572 gene locus_tag LOCUS_17120 3831 2572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 5169 4306 gene locus_tag LOCUS_17130 gene ispE 5169 4306 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_17130 5513 5241 gene locus_tag LOCUS_17140 5513 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 5695 7041 gene locus_tag LOCUS_17150 gene ypeB 5695 7041 CDS product germination protein YpeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947975.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence142 512 261 gene locus_tag LOCUS_17160 512 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 3350 519 gene locus_tag LOCUS_17170 3350 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 5992 3362 gene locus_tag LOCUS_17180 5992 3362 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861890.1 protein_id gnl|my_center|LOCUS_17180 6642 6052 gene locus_tag LOCUS_17190 6642 6052 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358764.1 protein_id gnl|my_center|LOCUS_17190 7004 6639 gene locus_tag LOCUS_17200 7004 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence143 2492 954 gene locus_tag LOCUS_17210 2492 954 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393762.1 protein_id gnl|my_center|LOCUS_17210 5497 2582 gene locus_tag LOCUS_17220 5497 2582 CDS product alpha-L-rhamnosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080411.1 protein_id gnl|my_center|LOCUS_17220 6628 5591 gene locus_tag LOCUS_17230 6628 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 6796 6635 gene locus_tag LOCUS_17240 6796 6635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 >Feature sequence144 270 1217 gene locus_tag LOCUS_17250 270 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1986 1492 gene locus_tag LOCUS_17260 1986 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 2232 3497 gene locus_tag LOCUS_17270 2232 3497 CDS product DUF1576 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367092.1 protein_id gnl|my_center|LOCUS_17270 3490 3834 gene locus_tag LOCUS_17280 3490 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 3986 4606 gene locus_tag LOCUS_17290 3986 4606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17290 4675 5031 gene locus_tag LOCUS_17300 4675 5031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 5880 5089 gene locus_tag LOCUS_17310 5880 5089 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681896.1 protein_id gnl|my_center|LOCUS_17310 <6912 5881 gene locus_tag LOCUS_17320 <6912 5881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583069.1:pyridoxal phosphate-dependent aminotransferase family protein >Feature sequence145 159 875 gene locus_tag LOCUS_17330 159 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 880 2163 gene locus_tag LOCUS_17340 880 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3329 2196 gene locus_tag LOCUS_17350 3329 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4552 3326 gene locus_tag LOCUS_17360 4552 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 5248 4577 gene locus_tag LOCUS_17370 5248 4577 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_17370 6426 5263 gene locus_tag LOCUS_17380 6426 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence146 <1 1835 gene locus_tag LOCUS_17390 <1 1835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068610434.1:carbohydrate-binding protein 1868 2380 gene locus_tag LOCUS_17400 1868 2380 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459551.1 protein_id gnl|my_center|LOCUS_17400 2409 3611 gene locus_tag LOCUS_17410 2409 3611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 3719 6034 gene locus_tag LOCUS_17420 3719 6034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6145 6771 gene locus_tag LOCUS_17430 6145 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence147 38 1567 gene locus_tag LOCUS_17440 38 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101598.1 protein_id gnl|my_center|LOCUS_17440 1661 2326 gene locus_tag LOCUS_17450 1661 2326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 2572 4392 gene locus_tag LOCUS_17460 2572 4392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 4468 5139 gene locus_tag LOCUS_17470 4468 5139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 5168 5980 gene locus_tag LOCUS_17480 5168 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 >Feature sequence148 31 1206 gene locus_tag LOCUS_17490 31 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1200 1880 gene locus_tag LOCUS_17500 1200 1880 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584046.1 protein_id gnl|my_center|LOCUS_17500 2727 1870 gene locus_tag LOCUS_17510 gene speB 2727 1870 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_17510 3569 2721 gene locus_tag LOCUS_17520 gene speE 3569 2721 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_17520 5014 3569 gene locus_tag LOCUS_17530 5014 3569 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808143.1 protein_id gnl|my_center|LOCUS_17530 5842 5033 gene locus_tag LOCUS_17540 gene speD 5842 5033 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316303.1 protein_id gnl|my_center|LOCUS_17540 6032 6343 gene locus_tag LOCUS_17550 gene trxA 6032 6343 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329897.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence149 3428 2460 gene locus_tag LOCUS_17560 3428 2460 CDS product 3'-5' exoribonuclease YhaM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965559.1 protein_id gnl|my_center|LOCUS_17560 4640 3486 gene locus_tag LOCUS_17570 gene deoB 4640 3486 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046079.1 protein_id gnl|my_center|LOCUS_17570 5372 4659 gene locus_tag LOCUS_17580 5372 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 6269 5376 gene locus_tag LOCUS_17590 gene era 6269 5376 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047995.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence150 642 875 gene locus_tag LOCUS_17600 642 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 910 1737 gene locus_tag LOCUS_17610 910 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 1815 2765 gene locus_tag LOCUS_17620 gene argC 1815 2765 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118924.1 protein_id gnl|my_center|LOCUS_17620 2781 3674 gene locus_tag LOCUS_17630 gene argB 2781 3674 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393771.1 protein_id gnl|my_center|LOCUS_17630 3686 4870 gene locus_tag LOCUS_17640 3686 4870 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393770.1 protein_id gnl|my_center|LOCUS_17640 4890 5828 gene locus_tag LOCUS_17650 gene argF 4890 5828 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_17650 5806 6291 gene locus_tag LOCUS_17660 5806 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence151 867 3281 gene locus_tag LOCUS_17670 867 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 3286 4335 gene locus_tag LOCUS_17680 3286 4335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17680 5301 4363 gene locus_tag LOCUS_17690 5301 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 5444 6295 gene locus_tag LOCUS_17700 5444 6295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 >Feature sequence152 924 319 gene locus_tag LOCUS_17710 924 319 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000109982.1 protein_id gnl|my_center|LOCUS_17710 1043 3850 gene locus_tag LOCUS_17720 1043 3850 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_17720 3864 4058 gene locus_tag LOCUS_17730 3864 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 4078 4293 gene locus_tag LOCUS_17740 4078 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 4999 4295 gene locus_tag LOCUS_17750 gene lipA 4999 4295 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393263.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17750 5814 5164 gene locus_tag LOCUS_17760 gene lipB 5814 5164 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144397.1 protein_id gnl|my_center|LOCUS_17760 5982 6308 gene locus_tag LOCUS_17770 5982 6308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17770 >Feature sequence153 <1 525 gene locus_tag LOCUS_17780 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181491.1:FN3 and LamG domain-containing metallophosphoesterase family protein 532 744 gene locus_tag LOCUS_17790 532 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 828 2177 gene locus_tag LOCUS_17800 gene scfB 828 2177 CDS product thioether cross-link-forming SCIFF peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861666.1 protein_id gnl|my_center|LOCUS_17800 2461 2180 gene locus_tag LOCUS_17810 2461 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2655 4436 gene locus_tag LOCUS_17820 gene dnaG 2655 4436 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964611.1 protein_id gnl|my_center|LOCUS_17820 4433 5656 gene locus_tag LOCUS_17830 gene rpoD 4433 5656 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358052.1 protein_id gnl|my_center|LOCUS_17830 6367 5711 gene locus_tag LOCUS_17840 6367 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence154 3138 2353 gene locus_tag LOCUS_17850 3138 2353 CDS product histidinol-phosphatase HisJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897350.1 protein_id gnl|my_center|LOCUS_17850 5807 3144 gene locus_tag LOCUS_17860 5807 3144 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377094.1 protein_id gnl|my_center|LOCUS_17860 <6469 5841 gene locus_tag LOCUS_17870 <6469 5841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048264.1:tyrosine--tRNA ligase >Feature sequence155 360 106 gene locus_tag LOCUS_17880 360 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 2010 559 gene locus_tag LOCUS_17890 2010 559 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582721.1 protein_id gnl|my_center|LOCUS_17890 4064 2355 gene locus_tag LOCUS_17900 4064 2355 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089525910.1 protein_id gnl|my_center|LOCUS_17900 5127 4222 gene locus_tag LOCUS_17910 5127 4222 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_17910 6055 5141 gene locus_tag LOCUS_17920 6055 5141 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence156 875 270 gene locus_tag LOCUS_17930 875 270 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963542.1 protein_id gnl|my_center|LOCUS_17930 1266 856 gene locus_tag LOCUS_17940 1266 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 1995 1504 gene locus_tag LOCUS_17950 1995 1504 CDS product amidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986320.1 protein_id gnl|my_center|LOCUS_17950 2767 2069 gene locus_tag LOCUS_17960 2767 2069 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433947.1 protein_id gnl|my_center|LOCUS_17960 3565 2864 gene locus_tag LOCUS_17970 3565 2864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 4263 3571 gene locus_tag LOCUS_17980 4263 3571 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 protein_id gnl|my_center|LOCUS_17980 5201 4260 gene locus_tag LOCUS_17990 5201 4260 CDS product deoxyribodipyrimidine photo-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582848.1 protein_id gnl|my_center|LOCUS_17990 6045 5224 gene locus_tag LOCUS_18000 6045 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 >Feature sequence157 387 1796 gene locus_tag LOCUS_18010 387 1796 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815222.1 protein_id gnl|my_center|LOCUS_18010 1793 2422 gene locus_tag LOCUS_18020 gene nth 1793 2422 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_18020 3063 2401 gene locus_tag LOCUS_18030 3063 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 3523 3323 gene locus_tag LOCUS_18040 gene rpmB 3523 3323 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395976.1 protein_id gnl|my_center|LOCUS_18040 5680 3629 gene locus_tag LOCUS_18050 gene recG 5680 3629 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454871.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence158 1367 411 gene locus_tag LOCUS_18060 1367 411 CDS product N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963507.1 protein_id gnl|my_center|LOCUS_18060 3113 1437 gene locus_tag LOCUS_18070 3113 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 4428 3106 gene locus_tag LOCUS_18080 4428 3106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 5844 4447 gene locus_tag LOCUS_18090 5844 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 <6346 5837 gene locus_tag LOCUS_18100 <6346 5837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121425.1:N-acetylmuramic acid 6-phosphate etherase >Feature sequence159 78 1808 gene locus_tag LOCUS_18110 78 1808 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965410.1 protein_id gnl|my_center|LOCUS_18110 4200 1792 gene locus_tag LOCUS_18120 4200 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 4716 4246 gene locus_tag LOCUS_18130 4716 4246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 5975 4812 gene locus_tag LOCUS_18140 5975 4812 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941722.1 protein_id gnl|my_center|LOCUS_18140 >Feature sequence160 407 93 gene locus_tag LOCUS_18150 407 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 1203 502 gene locus_tag LOCUS_18160 1203 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18160 1539 1231 gene locus_tag LOCUS_18170 1539 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 2082 1585 gene locus_tag LOCUS_18180 2082 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_18180 3061 2087 gene locus_tag LOCUS_18190 3061 2087 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908873.1 protein_id gnl|my_center|LOCUS_18190 4236 3058 gene locus_tag LOCUS_18200 4236 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 4951 4241 gene locus_tag LOCUS_18210 4951 4241 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868491.1 protein_id gnl|my_center|LOCUS_18210 5694 4957 gene locus_tag LOCUS_18220 5694 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 >Feature sequence161 <1 917 gene locus_tag LOCUS_18230 <1 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000284917.1:aspartate--ammonia ligase 928 3030 gene locus_tag LOCUS_18240 928 3030 CDS product glutamine synthetase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812354.1 protein_id gnl|my_center|LOCUS_18240 3046 4473 gene locus_tag LOCUS_18250 gene purB 3046 4473 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986778.1 protein_id gnl|my_center|LOCUS_18250 4491 5093 gene locus_tag LOCUS_18260 gene hisH 4491 5093 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_18260 5098 5883 gene locus_tag LOCUS_18270 gene hisF 5098 5883 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence162 <1 2304 gene locus_tag LOCUS_18280 <1 2304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966492.1:transcription-repair coupling factor 2438 3664 gene locus_tag LOCUS_18290 2438 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 3762 5570 gene locus_tag LOCUS_18300 3762 5570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 >Feature sequence163 305 1897 gene locus_tag LOCUS_18310 305 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 1916 2134 gene locus_tag LOCUS_18320 1916 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 2183 3475 gene locus_tag LOCUS_18330 2183 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 3502 5028 gene locus_tag LOCUS_18340 3502 5028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 5046 5918 gene locus_tag LOCUS_18350 5046 5918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence164 3177 1798 gene locus_tag LOCUS_18360 3177 1798 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048370.1 protein_id gnl|my_center|LOCUS_18360 3428 3189 gene locus_tag LOCUS_18370 gene rpoZ 3428 3189 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965026.1 protein_id gnl|my_center|LOCUS_18370 4043 3447 gene locus_tag LOCUS_18380 gene gmk 4043 3447 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460557.1 protein_id gnl|my_center|LOCUS_18380 4312 4040 gene locus_tag LOCUS_18390 4312 4040 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388626.1 protein_id gnl|my_center|LOCUS_18390 5210 4329 gene locus_tag LOCUS_18400 5210 4329 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388628.1 protein_id gnl|my_center|LOCUS_18400 6034 5300 gene locus_tag LOCUS_18410 6034 5300 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048001.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence165 389 1165 gene locus_tag LOCUS_18420 389 1165 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944383.1 protein_id gnl|my_center|LOCUS_18420 1362 1643 gene locus_tag LOCUS_18430 1362 1643 CDS product stage V sporulation protein S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965123.1 protein_id gnl|my_center|LOCUS_18430 3303 1708 gene locus_tag LOCUS_18440 gene rny 3303 1708 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812942.1 protein_id gnl|my_center|LOCUS_18440 4480 3641 gene locus_tag LOCUS_18450 gene folD 4480 3641 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722487.1 protein_id gnl|my_center|LOCUS_18450 6147 4486 gene locus_tag LOCUS_18460 6147 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 >Feature sequence166 3 803 gene locus_tag LOCUS_18470 3 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 822 1649 gene locus_tag LOCUS_18480 gene whiA 822 1649 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357358.1 protein_id gnl|my_center|LOCUS_18480 1764 2108 gene locus_tag LOCUS_18490 gene spoIIAA 1764 2108 CDS product anti-sigma F factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965605.1 protein_id gnl|my_center|LOCUS_18490 2105 2551 gene locus_tag LOCUS_18500 gene spoIIAB 2105 2551 CDS product anti-sigma F factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418415.1 protein_id gnl|my_center|LOCUS_18500 2551 3312 gene locus_tag LOCUS_18510 gene sigF 2551 3312 CDS product RNA polymerase sporulation sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860953.1 protein_id gnl|my_center|LOCUS_18510 3392 3823 gene locus_tag LOCUS_18520 gene spoVAC 3392 3823 CDS product stage V sporulation protein AC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403642.1 protein_id gnl|my_center|LOCUS_18520 3829 4839 gene locus_tag LOCUS_18530 gene spoVAD 3829 4839 CDS product stage V sporulation protein AD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403641.1 protein_id gnl|my_center|LOCUS_18530 4855 5226 gene locus_tag LOCUS_18540 gene spoVAE 4855 5226 CDS product stage V sporulation protein AE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403640.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence167 462 1988 gene locus_tag LOCUS_18550 462 1988 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363938.1 protein_id gnl|my_center|LOCUS_18550 2255 1989 gene locus_tag LOCUS_18560 2255 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 3494 2376 gene locus_tag LOCUS_18570 3494 2376 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897664.1 protein_id gnl|my_center|LOCUS_18570 3966 5153 gene locus_tag LOCUS_18580 3966 5153 CDS product anaerobic nitric oxide reductase flavorubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948785.1 protein_id gnl|my_center|LOCUS_18580 5240 5959 gene locus_tag LOCUS_18590 5240 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence168 <1 807 gene locus_tag LOCUS_18600 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003438990.1:deoxyribonuclease IV 858 2045 gene locus_tag LOCUS_18610 858 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 4324 2102 gene locus_tag LOCUS_18620 4324 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 4573 5490 gene locus_tag LOCUS_18630 4573 5490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence169 183 815 gene locus_tag LOCUS_18640 183 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 1608 985 gene locus_tag LOCUS_18650 1608 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 1779 2405 gene locus_tag LOCUS_18660 1779 2405 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470279.1 protein_id gnl|my_center|LOCUS_18660 2402 3175 gene locus_tag LOCUS_18670 gene fetB 2402 3175 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082840.1 protein_id gnl|my_center|LOCUS_18670 3415 3176 gene locus_tag LOCUS_18680 3415 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 4708 3458 gene locus_tag LOCUS_18690 4708 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 5515 4712 gene locus_tag LOCUS_18700 5515 4712 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388831.1 protein_id gnl|my_center|LOCUS_18700 >Feature sequence170 341 709 gene locus_tag LOCUS_18710 341 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18710 776 1171 gene locus_tag LOCUS_18720 776 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 1444 2829 gene locus_tag LOCUS_18730 1444 2829 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966223.1 protein_id gnl|my_center|LOCUS_18730 2831 3466 gene locus_tag LOCUS_18740 2831 3466 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_18740 3582 3749 gene locus_tag LOCUS_18750 3582 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 3777 3947 gene locus_tag LOCUS_18760 3777 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 3957 5420 gene locus_tag LOCUS_18770 3957 5420 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000797436.1 protein_id gnl|my_center|LOCUS_18770 >Feature sequence171 <1 1776 gene locus_tag LOCUS_18780 <1 1776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011674247.1:glycoside hydrolase family 3 C-terminal domain-containing protein 1853 3655 gene locus_tag LOCUS_18790 gene pepF 1853 3655 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003393.1 protein_id gnl|my_center|LOCUS_18790 3671 5758 gene locus_tag LOCUS_18800 3671 5758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 >Feature sequence172 1902 493 gene locus_tag LOCUS_18810 1902 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 2837 1929 gene locus_tag LOCUS_18820 2837 1929 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_18820 5107 2828 gene locus_tag LOCUS_18830 5107 2828 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836409.1 protein_id gnl|my_center|LOCUS_18830 5702 5175 gene locus_tag LOCUS_18840 5702 5175 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813074.1 protein_id gnl|my_center|LOCUS_18840 >Feature sequence173 3062 1797 gene locus_tag LOCUS_18850 3062 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3921 3130 gene locus_tag LOCUS_18860 3921 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 4478 3933 gene locus_tag LOCUS_18870 4478 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 5283 4459 gene locus_tag LOCUS_18880 5283 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 >Feature sequence174 131 206 gene locus_tag LOCUS_t00200 131 206 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1188 271 gene locus_tag LOCUS_18890 1188 271 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674286.1 protein_id gnl|my_center|LOCUS_18890 1325 2170 gene locus_tag LOCUS_18900 1325 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 2245 2916 gene locus_tag LOCUS_18910 2245 2916 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_18910 2940 3470 gene locus_tag LOCUS_18920 2940 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 4901 3459 gene locus_tag LOCUS_18930 gene gndA 4901 3459 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_18930 <5855 4908 gene locus_tag LOCUS_18940 <5855 4908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880620.1:AMP-binding protein >Feature sequence175 310 2220 gene locus_tag LOCUS_18950 310 2220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 2343 3956 gene locus_tag LOCUS_18960 2343 3956 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108686.1 protein_id gnl|my_center|LOCUS_18960 4779 3985 gene locus_tag LOCUS_18970 4779 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 5661 4801 gene locus_tag LOCUS_18980 5661 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 >Feature sequence176 <1 507 gene locus_tag LOCUS_18990 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706144.1:GAF domain-containing protein 504 1700 gene locus_tag LOCUS_19000 504 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 1817 2017 gene locus_tag LOCUS_19010 1817 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 2032 2577 gene locus_tag LOCUS_19020 2032 2577 CDS product DUF4256 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258319.1 protein_id gnl|my_center|LOCUS_19020 5266 2696 gene locus_tag LOCUS_19030 5266 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence177 217 1482 gene locus_tag LOCUS_19040 217 1482 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435270.1 protein_id gnl|my_center|LOCUS_19040 1538 2962 gene locus_tag LOCUS_19050 1538 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 2952 3644 gene locus_tag LOCUS_19060 2952 3644 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009893687.1 protein_id gnl|my_center|LOCUS_19060 3696 4295 gene locus_tag LOCUS_19070 3696 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 4318 4701 gene locus_tag LOCUS_19080 4318 4701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 4722 5381 gene locus_tag LOCUS_19090 4722 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 5479 5554 gene locus_tag LOCUS_t00210 5479 5554 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence178 29 324 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatctatccccacgcggggacggtaat 683 1960 gene locus_tag LOCUS_19100 gene serS 683 1960 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948259.1 protein_id gnl|my_center|LOCUS_19100 4443 1978 gene locus_tag LOCUS_19110 4443 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4682 5533 gene locus_tag LOCUS_19120 4682 5533 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460667.1 protein_id gnl|my_center|LOCUS_19120 >Feature sequence179 1427 66 gene locus_tag LOCUS_19130 1427 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1790 1587 gene locus_tag LOCUS_19140 1790 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 3145 1802 gene locus_tag LOCUS_19150 3145 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 3440 3243 gene locus_tag LOCUS_19160 3440 3243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 4393 3677 gene locus_tag LOCUS_19170 4393 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 <5667 4393 gene locus_tag LOCUS_19180 <5667 4393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015670.1:ATP/GTP-binding protein >Feature sequence180 <1 618 gene locus_tag LOCUS_19190 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545758.1:radical SAM protein 877 650 gene locus_tag LOCUS_19200 877 650 CDS product heavy-metal-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703288.1 protein_id gnl|my_center|LOCUS_19200 2753 900 gene locus_tag LOCUS_19210 2753 900 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476588.1 protein_id gnl|my_center|LOCUS_19210 3084 2797 gene locus_tag LOCUS_19220 3084 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 3235 4095 gene locus_tag LOCUS_19230 3235 4095 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437125.1 protein_id gnl|my_center|LOCUS_19230 5208 4096 gene locus_tag LOCUS_19240 5208 4096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 >Feature sequence181 420 109 gene locus_tag LOCUS_19250 420 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19250 771 424 gene locus_tag LOCUS_19260 771 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19260 1577 771 gene locus_tag LOCUS_19270 1577 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 2121 1600 gene locus_tag LOCUS_19280 2121 1600 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583959.1 protein_id gnl|my_center|LOCUS_19280 3179 2118 gene locus_tag LOCUS_19290 gene ruvB 3179 2118 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426579.1 protein_id gnl|my_center|LOCUS_19290 3794 3192 gene locus_tag LOCUS_19300 gene ruvA 3794 3192 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048089.1 protein_id gnl|my_center|LOCUS_19300 4336 3851 gene locus_tag LOCUS_19310 gene ruvC 4336 3851 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861695.1 protein_id gnl|my_center|LOCUS_19310 5091 4348 gene locus_tag LOCUS_19320 5091 4348 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966200.1 protein_id gnl|my_center|LOCUS_19320 5460 5533 gene locus_tag LOCUS_t00220 5460 5533 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence182 441 1814 gene locus_tag LOCUS_19330 441 1814 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808375.1 protein_id gnl|my_center|LOCUS_19330 1941 3770 gene locus_tag LOCUS_19340 1941 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 3958 5205 gene locus_tag LOCUS_19350 3958 5205 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence183 <1 3250 gene locus_tag LOCUS_19360 <1 3250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459235.1:RecQ family ATP-dependent DNA helicase 3361 4176 gene locus_tag LOCUS_19370 gene rhaR 3361 4176 CDS product HTH-type transcriptional activator RhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099334.1 protein_id gnl|my_center|LOCUS_19370 4798 4178 gene locus_tag LOCUS_19380 4798 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 >Feature sequence184 1880 3580 gene locus_tag LOCUS_19390 1880 3580 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000008577.1 protein_id gnl|my_center|LOCUS_19390 3577 4611 gene locus_tag LOCUS_19400 3577 4611 CDS product low specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966690.1 protein_id gnl|my_center|LOCUS_19400 5376 4612 gene locus_tag LOCUS_19410 5376 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 >Feature sequence185 2799 2257 gene locus_tag LOCUS_19420 2799 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 2926 3669 gene locus_tag LOCUS_19430 2926 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 3642 4079 gene locus_tag LOCUS_19440 3642 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 4317 4126 gene locus_tag LOCUS_19450 4317 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 4619 5206 gene locus_tag LOCUS_19460 4619 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 >Feature sequence186 1926 5303 gene locus_tag LOCUS_19470 1926 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 >Feature sequence187 714 163 gene locus_tag LOCUS_19480 714 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 719 925 gene locus_tag LOCUS_19490 719 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 1456 1271 gene locus_tag LOCUS_19500 1456 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 1858 2424 gene locus_tag LOCUS_19510 1858 2424 CDS product GrpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263641.1 protein_id gnl|my_center|LOCUS_19510 2817 3167 gene locus_tag LOCUS_19520 2817 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 3193 3669 gene locus_tag LOCUS_19530 3193 3669 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382331.1 protein_id gnl|my_center|LOCUS_19530 3736 4659 gene locus_tag LOCUS_19540 3736 4659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 4691 5155 gene locus_tag LOCUS_19550 4691 5155 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016851.1 protein_id gnl|my_center|LOCUS_19550 >Feature sequence188 34 387 gene locus_tag LOCUS_19560 34 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19560 387 677 gene locus_tag LOCUS_19570 387 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_19570 738 986 gene locus_tag LOCUS_19580 738 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 1067 2992 gene locus_tag LOCUS_19590 1067 2992 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455018.1 protein_id gnl|my_center|LOCUS_19590 3069 4235 gene locus_tag LOCUS_19600 3069 4235 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018307263.1 protein_id gnl|my_center|LOCUS_19600 5002 4232 gene locus_tag LOCUS_19610 5002 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 >Feature sequence189 1921 182 gene locus_tag LOCUS_19620 1921 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 2002 2448 gene locus_tag LOCUS_19630 2002 2448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 2524 2748 gene locus_tag LOCUS_19640 2524 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 3094 3630 gene locus_tag LOCUS_19650 gene pyrR 3094 3630 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358722.1 protein_id gnl|my_center|LOCUS_19650 3651 5072 gene locus_tag LOCUS_19660 3651 5072 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002990245.1 protein_id gnl|my_center|LOCUS_19660 >Feature sequence190 750 1823 gene locus_tag LOCUS_19670 gene uxuA 750 1823 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082566.1 protein_id gnl|my_center|LOCUS_19670 1849 2607 gene locus_tag LOCUS_19680 1849 2607 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087915427.1 protein_id gnl|my_center|LOCUS_19680 2621 3475 gene locus_tag LOCUS_19690 2621 3475 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015208.1 protein_id gnl|my_center|LOCUS_19690 3481 4167 gene locus_tag LOCUS_19700 3481 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19700 4186 4662 gene locus_tag LOCUS_19710 4186 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 >Feature sequence191 395 1090 gene locus_tag LOCUS_19720 395 1090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 1102 2091 gene locus_tag LOCUS_19730 1102 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 2104 2931 gene locus_tag LOCUS_19740 2104 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 3021 3902 gene locus_tag LOCUS_19750 gene dpsA 3021 3902 CDS product dipicolinate synthase subunit DpsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392578.1 protein_id gnl|my_center|LOCUS_19750 3902 4477 gene locus_tag LOCUS_19760 3902 4477 CDS product dipicolinate synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460384.1 protein_id gnl|my_center|LOCUS_19760 >Feature sequence192 982 227 gene locus_tag LOCUS_19770 982 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1904 975 gene locus_tag LOCUS_19780 1904 975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582702.1 protein_id gnl|my_center|LOCUS_19780 3177 1909 gene locus_tag LOCUS_19790 3177 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 4109 3174 gene locus_tag LOCUS_19800 4109 3174 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000058142.1 protein_id gnl|my_center|LOCUS_19800 5105 4248 gene locus_tag LOCUS_19810 5105 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 >Feature sequence193 883 194 gene locus_tag LOCUS_19820 883 194 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047881.1 protein_id gnl|my_center|LOCUS_19820 1516 884 gene locus_tag LOCUS_19830 1516 884 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890722.1 protein_id gnl|my_center|LOCUS_19830 2549 1599 gene locus_tag LOCUS_19840 2549 1599 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949041.1 protein_id gnl|my_center|LOCUS_19840 3063 2533 gene locus_tag LOCUS_19850 gene lspA 3063 2533 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000549207.1 protein_id gnl|my_center|LOCUS_19850 4682 3081 gene locus_tag LOCUS_19860 4682 3081 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence194 1268 879 gene locus_tag LOCUS_19870 1268 879 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964225.1 protein_id gnl|my_center|LOCUS_19870 3460 1280 gene locus_tag LOCUS_19880 3460 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 4715 3588 gene locus_tag LOCUS_19890 4715 3588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 >Feature sequence195 1338 529 gene locus_tag LOCUS_19900 1338 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 2918 1335 gene locus_tag LOCUS_19910 2918 1335 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203736.1 protein_id gnl|my_center|LOCUS_19910 4268 2925 gene locus_tag LOCUS_19920 gene xylB 4268 2925 CDS product xylulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170324985.1 protein_id gnl|my_center|LOCUS_19920 4746 4591 gene locus_tag LOCUS_19930 4746 4591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence196 2563 422 gene locus_tag LOCUS_19940 2563 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 <5021 2644 gene locus_tag LOCUS_19950 <5021 2644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965142.1:DNA mismatch repair protein MutS >Feature sequence197 241 1746 gene locus_tag LOCUS_19960 241 1746 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272361.1 protein_id gnl|my_center|LOCUS_19960 1788 2288 gene locus_tag LOCUS_19970 gene greA 1788 2288 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966474.1 protein_id gnl|my_center|LOCUS_19970 2288 3790 gene locus_tag LOCUS_19980 gene lysS 2288 3790 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242743.1 protein_id gnl|my_center|LOCUS_19980 3796 4719 gene locus_tag LOCUS_19990 3796 4719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 >Feature sequence198 1982 870 gene locus_tag LOCUS_20000 1982 870 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435617.1 protein_id gnl|my_center|LOCUS_20000 3648 2026 gene locus_tag LOCUS_20010 3648 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 3922 4773 gene locus_tag LOCUS_20020 3922 4773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence199 1397 48 gene locus_tag LOCUS_20030 1397 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 1482 2726 gene locus_tag LOCUS_20040 1482 2726 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_20040 3220 2723 gene locus_tag LOCUS_20050 3220 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 3326 3829 gene locus_tag LOCUS_20060 3326 3829 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478802.1 protein_id gnl|my_center|LOCUS_20060 4071 3826 gene locus_tag LOCUS_20070 4071 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 <4952 4061 gene locus_tag LOCUS_20080 <4952 4061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963608.1:DNA polymerase IV >Feature sequence200 1150 596 gene locus_tag LOCUS_20090 1150 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 1474 1548 gene locus_tag LOCUS_t00230 1474 1548 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1714 2382 gene locus_tag LOCUS_20100 1714 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 2545 3498 gene locus_tag LOCUS_20110 2545 3498 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271954.1 protein_id gnl|my_center|LOCUS_20110 3553 4632 gene locus_tag LOCUS_20120 3553 4632 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987044.1 protein_id gnl|my_center|LOCUS_20120 4770 4694 gene locus_tag LOCUS_t00240 4770 4694 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence201 231 1205 gene locus_tag LOCUS_20130 231 1205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 3160 1250 gene locus_tag LOCUS_20140 3160 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 3653 3153 gene locus_tag LOCUS_20150 3653 3153 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816021.1 protein_id gnl|my_center|LOCUS_20150 3839 4138 gene locus_tag LOCUS_20160 3839 4138 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034585320.1 protein_id gnl|my_center|LOCUS_20160 <4924 4135 gene locus_tag LOCUS_20170 <4924 4135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861254.1:thioredoxin domain-containing protein >Feature sequence202 2667 889 gene locus_tag LOCUS_20180 gene aspS 2667 889 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048075.1 protein_id gnl|my_center|LOCUS_20180 <4830 2711 gene locus_tag LOCUS_20190 <4830 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860930.1:endonuclease MutS2 >Feature sequence203 890 189 gene locus_tag LOCUS_20200 890 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 1903 1028 gene locus_tag LOCUS_20210 1903 1028 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837886.1 protein_id gnl|my_center|LOCUS_20210 2241 2083 gene locus_tag LOCUS_20220 2241 2083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 2719 2228 gene locus_tag LOCUS_20230 2719 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 2906 4219 gene locus_tag LOCUS_20240 2906 4219 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022296.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence204 437 925 gene locus_tag LOCUS_20250 437 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20250 937 1668 gene locus_tag LOCUS_20260 937 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20260 3037 1820 gene locus_tag LOCUS_20270 3037 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 3798 3124 gene locus_tag LOCUS_20280 3798 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 4595 3912 gene locus_tag LOCUS_20290 4595 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 >Feature sequence205 1372 68 gene locus_tag LOCUS_20300 1372 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 1497 4097 gene locus_tag LOCUS_20310 1497 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 >Feature sequence206 1500 1838 gene locus_tag LOCUS_20320 1500 1838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 1844 3022 gene locus_tag LOCUS_20330 1844 3022 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987056.1 protein_id gnl|my_center|LOCUS_20330 3118 3429 gene locus_tag LOCUS_20340 3118 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 3639 4382 gene locus_tag LOCUS_20350 3639 4382 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391836.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20350 >Feature sequence207 1231 233 gene locus_tag LOCUS_20360 1231 233 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948181.1 protein_id gnl|my_center|LOCUS_20360 1344 2042 gene locus_tag LOCUS_20370 1344 2042 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454770.1 protein_id gnl|my_center|LOCUS_20370 2047 2670 gene locus_tag LOCUS_20380 2047 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20380 3317 2895 gene locus_tag LOCUS_20390 3317 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20390 3617 3384 gene locus_tag LOCUS_20400 3617 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 4095 4020 gene locus_tag LOCUS_t00250 4095 4020 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4327 4142 gene locus_tag LOCUS_20410 4327 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence208 166 2628 gene locus_tag LOCUS_20420 gene spoIIE 166 2628 CDS product stage II sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048377.1 protein_id gnl|my_center|LOCUS_20420 2674 3135 gene locus_tag LOCUS_20430 2674 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 4392 3142 gene locus_tag LOCUS_20440 gene larA 4392 3142 CDS product nickel-dependent lactate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860456.1 protein_id gnl|my_center|LOCUS_20440 >Feature sequence209 220 744 gene locus_tag LOCUS_20450 gene dcd 220 744 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_20450 2198 741 gene locus_tag LOCUS_20460 2198 741 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949007.1 protein_id gnl|my_center|LOCUS_20460 4114 2309 gene locus_tag LOCUS_20470 gene fucI 4114 2309 CDS product L-fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779363.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence210 767 36 gene locus_tag LOCUS_20480 767 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 2203 764 gene locus_tag LOCUS_20490 2203 764 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681807.1 protein_id gnl|my_center|LOCUS_20490 2831 2304 gene locus_tag LOCUS_20500 2831 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20500 2995 2843 gene locus_tag LOCUS_20510 2995 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3139 3678 gene locus_tag LOCUS_20520 3139 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20520 3762 3887 gene locus_tag LOCUS_20530 3762 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20530 4056 3901 gene locus_tag LOCUS_20540 4056 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 <4652 4105 gene locus_tag LOCUS_20550 <4652 4105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682387.1:FprA family A-type flavoprotein >Feature sequence211 <1 978 gene locus_tag LOCUS_20560 <1 978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808454.1:CapA family protein 1024 1578 gene locus_tag LOCUS_20570 1024 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 2413 1556 gene locus_tag LOCUS_20580 2413 1556 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_20580 2489 2797 gene locus_tag LOCUS_20590 2489 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20590 2797 3162 gene locus_tag LOCUS_20600 2797 3162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 3178 3501 gene locus_tag LOCUS_20610 3178 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 >Feature sequence212 <1 1293 gene locus_tag LOCUS_20620 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123065.1:exo-alpha-sialidase 2160 1297 gene locus_tag LOCUS_20630 2160 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 2338 3567 gene locus_tag LOCUS_20640 2338 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 3682 4038 gene locus_tag LOCUS_20650 3682 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 4035 4568 gene locus_tag LOCUS_20660 4035 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 >Feature sequence213 388 143 gene locus_tag LOCUS_20670 388 143 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254102.1 protein_id gnl|my_center|LOCUS_20670 1047 385 gene locus_tag LOCUS_20680 1047 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 1156 1596 gene locus_tag LOCUS_20690 gene tadA 1156 1596 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931378.1 protein_id gnl|my_center|LOCUS_20690 3106 1574 gene locus_tag LOCUS_20700 3106 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20700 4180 3110 gene locus_tag LOCUS_20710 4180 3110 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816491.1 protein_id gnl|my_center|LOCUS_20710 4322 4248 gene locus_tag LOCUS_t00260 4322 4248 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 4415 4340 gene locus_tag LOCUS_t00270 4415 4340 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence214 2795 1566 gene locus_tag LOCUS_20720 2795 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2934 4193 gene locus_tag LOCUS_20730 2934 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 >Feature sequence215 787 2670 gene locus_tag LOCUS_20740 787 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20740 3507 2647 gene locus_tag LOCUS_20750 3507 2647 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234240.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence216 2929 1301 gene locus_tag LOCUS_20760 2929 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 3669 2941 gene locus_tag LOCUS_20770 3669 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 >Feature sequence217 415 2271 gene locus_tag LOCUS_20780 415 2271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20780 3512 2253 gene locus_tag LOCUS_20790 3512 2253 CDS product UDPGP type 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884735.1 protein_id gnl|my_center|LOCUS_20790 >Feature sequence218 76 267 gene locus_tag LOCUS_20800 76 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 302 469 gene locus_tag LOCUS_20810 302 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 559 696 gene locus_tag LOCUS_20820 559 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20820 757 1560 gene locus_tag LOCUS_20830 757 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20830 2191 1475 gene locus_tag LOCUS_20840 2191 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20840 3708 2206 gene locus_tag LOCUS_20850 3708 2206 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392806.1 protein_id gnl|my_center|LOCUS_20850 <4551 3699 gene locus_tag LOCUS_20860 <4551 3699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582452.1:glutamine amidotransferase family protein >Feature sequence219 159 2099 gene locus_tag LOCUS_20870 159 2099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 2450 2238 gene locus_tag LOCUS_20880 2450 2238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 3714 2425 gene locus_tag LOCUS_20890 3714 2425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 3959 4450 gene locus_tag LOCUS_20900 3959 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_20900 >Feature sequence220 1180 107 gene locus_tag LOCUS_20910 1180 107 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000087103.1 protein_id gnl|my_center|LOCUS_20910 2043 1177 gene locus_tag LOCUS_20920 gene aroE 2043 1177 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544907.1 protein_id gnl|my_center|LOCUS_20920 2578 2048 gene locus_tag LOCUS_20930 2578 2048 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000524903.1 protein_id gnl|my_center|LOCUS_20930 3018 2584 gene locus_tag LOCUS_20940 gene aroQ 3018 2584 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964217.1 protein_id gnl|my_center|LOCUS_20940 3554 3015 gene locus_tag LOCUS_20950 3554 3015 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439413.1 protein_id gnl|my_center|LOCUS_20950 4379 3639 gene locus_tag LOCUS_20960 4379 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 >Feature sequence221 <1 682 gene locus_tag LOCUS_20970 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005810397.1:serpin family protein 3849 712 gene locus_tag LOCUS_20980 3849 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence222 2972 513 gene locus_tag LOCUS_20990 gene clpC 2972 513 CDS product ATP-dependent protease ATP-binding subunit ClpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971183.1 protein_id gnl|my_center|LOCUS_20990 4019 2988 gene locus_tag LOCUS_21000 4019 2988 CDS product protein arginine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050828.1 protein_id gnl|my_center|LOCUS_21000 >Feature sequence223 748 2310 gene locus_tag LOCUS_21010 748 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 3316 2456 gene locus_tag LOCUS_21020 3316 2456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 >Feature sequence224 1 936 gene locus_tag LOCUS_21030 1 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 965 2056 gene locus_tag LOCUS_21040 965 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 2164 2238 gene locus_tag LOCUS_t00280 2164 2238 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3601 2279 gene locus_tag LOCUS_21050 3601 2279 CDS product SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328014.1 protein_id gnl|my_center|LOCUS_21050 <4424 3631 gene locus_tag LOCUS_21060 <4424 3631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005903470.1:aspartate--ammonia ligase >Feature sequence225 22 780 gene locus_tag LOCUS_21070 22 780 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_21070 837 1628 gene locus_tag LOCUS_21080 837 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 1810 2076 gene locus_tag LOCUS_21090 1810 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 2191 2988 gene locus_tag LOCUS_21100 2191 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence226 2156 498 gene locus_tag LOCUS_21110 2156 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 3560 2262 gene locus_tag LOCUS_21120 3560 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 3838 4197 gene locus_tag LOCUS_21130 3838 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 >Feature sequence227 1338 670 gene locus_tag LOCUS_21140 1338 670 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459567.1 protein_id gnl|my_center|LOCUS_21140 1673 2623 gene locus_tag LOCUS_21150 1673 2623 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_21150 2634 3875 gene locus_tag LOCUS_21160 2634 3875 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459866.1 protein_id gnl|my_center|LOCUS_21160 <4390 3872 gene locus_tag LOCUS_21170 <4390 3872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965885.1:FAD-dependent oxidoreductase >Feature sequence228 1431 439 gene locus_tag LOCUS_21180 1431 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 1733 2419 gene locus_tag LOCUS_21190 1733 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 4097 2442 gene locus_tag LOCUS_21200 4097 2442 CDS product 5'-nucleotidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903241.1 protein_id gnl|my_center|LOCUS_21200 >Feature sequence229 948 70 gene locus_tag LOCUS_21210 gene rsmA 948 70 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892086.1 protein_id gnl|my_center|LOCUS_21210 2063 1008 gene locus_tag LOCUS_21220 2063 1008 CDS product 3D domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768275.1 protein_id gnl|my_center|LOCUS_21220 2965 2204 gene locus_tag LOCUS_21230 2965 2204 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_21230 3844 2978 gene locus_tag LOCUS_21240 3844 2978 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_21240 >Feature sequence230 <1 709 gene locus_tag LOCUS_21250 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723769.1:DNA topoisomerase (ATP-hydrolyzing) subunit B note possible pseudo, internal stop codon 878 1837 gene locus_tag LOCUS_21260 878 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_21260 2002 2763 gene locus_tag LOCUS_21270 2002 2763 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_21270 2805 3659 gene locus_tag LOCUS_21280 2805 3659 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048450.1 protein_id gnl|my_center|LOCUS_21280 3699 4199 gene locus_tag LOCUS_21290 3699 4199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence231 <1 969 gene locus_tag LOCUS_21300 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480910.1:sodium ion-translocating decarboxylase subunit beta 1249 1407 gene locus_tag LOCUS_21310 1249 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 1977 1435 gene locus_tag LOCUS_21320 1977 1435 CDS product NADH peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419930.1 protein_id gnl|my_center|LOCUS_21320 2291 2133 gene locus_tag LOCUS_21330 2291 2133 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064374.1 protein_id gnl|my_center|LOCUS_21330 2735 2319 gene locus_tag LOCUS_21340 2735 2319 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904077.1 protein_id gnl|my_center|LOCUS_21340 3764 2877 gene locus_tag LOCUS_21350 3764 2877 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015848914.1 protein_id gnl|my_center|LOCUS_21350 <4301 3767 gene locus_tag LOCUS_21360 <4301 3767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202319769.1:formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme >Feature sequence232 <1 2250 gene locus_tag LOCUS_21370 <1 2250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_104808669.1:glycosyl hydrolase family 28 protein 2414 4117 gene locus_tag LOCUS_21380 2414 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 >Feature sequence233 1599 763 gene locus_tag LOCUS_21390 gene dapF 1599 763 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768322.1 protein_id gnl|my_center|LOCUS_21390 2975 1650 gene locus_tag LOCUS_21400 gene glnA 2975 1650 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393265.1 protein_id gnl|my_center|LOCUS_21400 3132 4115 gene locus_tag LOCUS_21410 gene dusB 3132 4115 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_21410 >Feature sequence234 1566 1384 gene locus_tag LOCUS_21420 gene rpmF 1566 1384 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_21420 2862 1669 gene locus_tag LOCUS_21430 2862 1669 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023514.1 protein_id gnl|my_center|LOCUS_21430 3870 2881 gene locus_tag LOCUS_21440 gene pta 3870 2881 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023515.1 protein_id gnl|my_center|LOCUS_21440 >Feature sequence235 1315 794 gene locus_tag LOCUS_21450 gene rplQ 1315 794 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357477.1 protein_id gnl|my_center|LOCUS_21450 2294 1338 gene locus_tag LOCUS_21460 2294 1338 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810110.1 protein_id gnl|my_center|LOCUS_21460 2947 2321 gene locus_tag LOCUS_21470 gene rpsD 2947 2321 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_21470 3364 2966 gene locus_tag LOCUS_21480 gene rpsK 3364 2966 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401717.1 protein_id gnl|my_center|LOCUS_21480 3752 3384 gene locus_tag LOCUS_21490 gene rpsM 3752 3384 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810116.1 protein_id gnl|my_center|LOCUS_21490 >Feature sequence236 649 266 gene locus_tag LOCUS_21500 649 266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 3299 741 gene locus_tag LOCUS_21510 3299 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 4042 3398 gene locus_tag LOCUS_21520 4042 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21520 >Feature sequence237 <1 777 gene locus_tag LOCUS_21530 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965301.1:indolepyruvate ferredoxin oxidoreductase subunit alpha 774 1364 gene locus_tag LOCUS_21540 774 1364 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965300.1 protein_id gnl|my_center|LOCUS_21540 1365 2666 gene locus_tag LOCUS_21550 1365 2666 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931806.1 protein_id gnl|my_center|LOCUS_21550 1923 2017 gene locus_tag LOCUS_t00290 1923 2017 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2679 3110 gene locus_tag LOCUS_21560 2679 3110 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_21560 4002 3073 gene locus_tag LOCUS_21570 4002 3073 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964578.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence238 1201 353 gene locus_tag LOCUS_21580 1201 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 1887 1198 gene locus_tag LOCUS_21590 1887 1198 CDS product YhbD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890722.1 protein_id gnl|my_center|LOCUS_21590 2064 2681 gene locus_tag LOCUS_21600 2064 2681 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903437.1 protein_id gnl|my_center|LOCUS_21600 2681 4057 gene locus_tag LOCUS_21610 gene rlmD 2681 4057 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105059.1 protein_id gnl|my_center|LOCUS_21610 >Feature sequence239 73 783 gene locus_tag LOCUS_21620 73 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 936 2291 gene locus_tag LOCUS_21630 936 2291 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861729.1 protein_id gnl|my_center|LOCUS_21630 3510 2320 gene locus_tag LOCUS_21640 3510 2320 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948371.1 protein_id gnl|my_center|LOCUS_21640 >Feature sequence240 545 1804 gene locus_tag LOCUS_21650 545 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 2694 1927 gene locus_tag LOCUS_21660 2694 1927 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247598.1 protein_id gnl|my_center|LOCUS_21660 >Feature sequence241 1280 117 gene locus_tag LOCUS_21670 gene ftsZ 1280 117 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386373.1 protein_id gnl|my_center|LOCUS_21670 2608 1340 gene locus_tag LOCUS_21680 2608 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21680 3077 2733 gene locus_tag LOCUS_21690 3077 2733 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358761.1 protein_id gnl|my_center|LOCUS_21690 3932 3156 gene locus_tag LOCUS_21700 3932 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence242 603 328 gene locus_tag LOCUS_21710 603 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 1161 610 gene locus_tag LOCUS_21720 1161 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 1674 1411 gene locus_tag LOCUS_21730 1674 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 3634 1766 gene locus_tag LOCUS_21740 3634 1766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 3912 4115 gene locus_tag LOCUS_21750 3912 4115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 >Feature sequence243 <1 2191 gene locus_tag LOCUS_21760 <1 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948832.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 2382 2230 gene locus_tag LOCUS_21770 2382 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 2488 3780 gene locus_tag LOCUS_21780 2488 3780 CDS product glycoside hydrolase family 18 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966034.1 protein_id gnl|my_center|LOCUS_21780 >Feature sequence244 3079 2462 gene locus_tag LOCUS_21790 3079 2462 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898085.1 protein_id gnl|my_center|LOCUS_21790 3280 3861 gene locus_tag LOCUS_21800 3280 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 >Feature sequence245 <1 1730 gene locus_tag LOCUS_21810 <1 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943996.1:phosphoenolpyruvate carboxykinase (GTP) 1837 2556 gene locus_tag LOCUS_21820 1837 2556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 3462 2596 gene locus_tag LOCUS_21830 3462 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 3609 3893 gene locus_tag LOCUS_21840 3609 3893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 >Feature sequence246 3774 3553 gene locus_tag LOCUS_21850 3774 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence247 <1 993 gene locus_tag LOCUS_21860 <1 993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966554.1:leucine-rich repeat domain-containing protein 1073 1426 gene locus_tag LOCUS_21870 1073 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 3208 1418 gene locus_tag LOCUS_21880 3208 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 3865 3212 gene locus_tag LOCUS_21890 3865 3212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 >Feature sequence248 <1 763 gene locus_tag LOCUS_21900 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003357496.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD 756 1094 gene locus_tag LOCUS_21910 756 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 1396 1887 gene locus_tag LOCUS_21920 1396 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1927 2394 gene locus_tag LOCUS_21930 1927 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 2417 3952 gene locus_tag LOCUS_21940 2417 3952 CDS product phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454621.1 protein_id gnl|my_center|LOCUS_21940 >Feature sequence249 37 717 gene locus_tag LOCUS_21950 gene sfsA 37 717 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461735.1 protein_id gnl|my_center|LOCUS_21950 739 1536 gene locus_tag LOCUS_21960 739 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1601 3928 gene locus_tag LOCUS_21970 1601 3928 CDS product glycoside hydrolase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082096.1 protein_id gnl|my_center|LOCUS_21970 >Feature sequence250 72 329 gene locus_tag LOCUS_21980 gene spoIIID 72 329 CDS product sporulation transcriptional regulator SpoIIID inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356559.1 protein_id gnl|my_center|LOCUS_21980 1724 330 gene locus_tag LOCUS_21990 1724 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 2188 2694 gene locus_tag LOCUS_22000 2188 2694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 2691 3371 gene locus_tag LOCUS_22010 2691 3371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 3368 3706 gene locus_tag LOCUS_22020 3368 3706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 >Feature sequence251 417 112 gene locus_tag LOCUS_22030 417 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 1105 404 gene locus_tag LOCUS_22040 1105 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 1677 1114 gene locus_tag LOCUS_22050 1677 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 1771 1643 gene locus_tag LOCUS_22060 1771 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 1797 2312 gene locus_tag LOCUS_22070 1797 2312 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964672.1 protein_id gnl|my_center|LOCUS_22070 >Feature sequence252 497 6 gene locus_tag LOCUS_22080 gene infC 497 6 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973215.1 protein_id gnl|my_center|LOCUS_22080 761 1189 gene locus_tag LOCUS_22090 761 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943965.1 protein_id gnl|my_center|LOCUS_22090 3088 1349 gene locus_tag LOCUS_22100 3088 1349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583012.1 protein_id gnl|my_center|LOCUS_22100 <3973 3085 gene locus_tag LOCUS_22110 <3973 3085 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965689.1:ABC transporter ATP-binding protein >Feature sequence253 1188 460 gene locus_tag LOCUS_22120 gene moeB 1188 460 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070541.1 protein_id gnl|my_center|LOCUS_22120 1406 1768 gene locus_tag LOCUS_22130 1406 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 1758 3536 gene locus_tag LOCUS_22140 1758 3536 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022903.1 protein_id gnl|my_center|LOCUS_22140 3538 3789 gene locus_tag LOCUS_22150 3538 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 >Feature sequence254 2240 1143 gene locus_tag LOCUS_22160 gene dnaN 2240 1143 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420481.1 protein_id gnl|my_center|LOCUS_22160 3828 2515 gene locus_tag LOCUS_22170 gene dnaA 3828 2515 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963330.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence255 746 285 gene locus_tag LOCUS_22180 gene ytfJ 746 285 CDS product GerW family sporulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460223.1 protein_id gnl|my_center|LOCUS_22180 1225 752 gene locus_tag LOCUS_22190 1225 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 1356 2084 gene locus_tag LOCUS_22200 1356 2084 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_22200 >Feature sequence256 790 167 gene locus_tag LOCUS_22210 790 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 1251 793 gene locus_tag LOCUS_22220 1251 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 2455 1232 gene locus_tag LOCUS_22230 2455 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 <3837 2575 gene locus_tag LOCUS_22240 <3837 2575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013390176.1:family 20 glycosylhydrolase >Feature sequence257 274 774 gene locus_tag LOCUS_22250 274 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 841 1449 gene locus_tag LOCUS_22260 841 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 1502 1936 gene locus_tag LOCUS_22270 1502 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2203 2619 gene locus_tag LOCUS_22280 2203 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22280 2748 3323 gene locus_tag LOCUS_22290 2748 3323 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000363049.1 protein_id gnl|my_center|LOCUS_22290 3711 3304 gene locus_tag LOCUS_22300 3711 3304 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_22300 >Feature sequence258 1048 353 gene locus_tag LOCUS_22310 gene cap8B 1048 353 CDS product type 8 capsular polysaccharide synthesis protein Cap8B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037332.1 protein_id gnl|my_center|LOCUS_22310 1739 1035 gene locus_tag LOCUS_22320 1739 1035 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393128.1 protein_id gnl|my_center|LOCUS_22320 3388 1856 gene locus_tag LOCUS_22330 3388 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 >Feature sequence259 2562 49 gene locus_tag LOCUS_22340 2562 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 3536 2559 gene locus_tag LOCUS_22350 3536 2559 CDS product alpha-L-fucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675004.1 protein_id gnl|my_center|LOCUS_22350 >Feature sequence260 644 84 gene locus_tag LOCUS_22360 644 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 1900 662 gene locus_tag LOCUS_22370 gene glyA 1900 662 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981400.1 protein_id gnl|my_center|LOCUS_22370 2027 3019 gene locus_tag LOCUS_22380 2027 3019 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_22380 >Feature sequence261 1189 332 gene locus_tag LOCUS_22390 1189 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 2077 1214 gene locus_tag LOCUS_22400 2077 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2237 2983 gene locus_tag LOCUS_22410 gene sleB 2237 2983 CDS product spore cortex-lytic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398991.1 protein_id gnl|my_center|LOCUS_22410 3485 2985 gene locus_tag LOCUS_22420 3485 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22420 >Feature sequence262 480 358 gene locus_tag LOCUS_22430 480 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 854 651 gene locus_tag LOCUS_22440 854 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1108 854 gene locus_tag LOCUS_22450 1108 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1742 1155 gene locus_tag LOCUS_22460 1742 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22460 2263 1682 gene locus_tag LOCUS_22470 2263 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22470 3386 2478 gene locus_tag LOCUS_22480 3386 2478 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047778.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22480 >Feature sequence263 1034 75 gene locus_tag LOCUS_22490 gene msrB 1034 75 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002672271.1 protein_id gnl|my_center|LOCUS_22490 1980 1048 gene locus_tag LOCUS_22500 1980 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_22500 2819 2157 gene locus_tag LOCUS_22510 2819 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 3550 2855 gene locus_tag LOCUS_22520 3550 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 >Feature sequence264 51 2639 gene locus_tag LOCUS_22530 gene adhE 51 2639 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861762.1 protein_id gnl|my_center|LOCUS_22530 2793 3587 gene locus_tag LOCUS_22540 2793 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 >Feature sequence265 3 158 gene locus_tag LOCUS_22550 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 321 3428 gene locus_tag LOCUS_22560 321 3428 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582581.1 protein_id gnl|my_center|LOCUS_22560 >Feature sequence266 1322 333 gene locus_tag LOCUS_22570 1322 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 1998 1552 gene locus_tag LOCUS_22580 1998 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 2240 2007 gene locus_tag LOCUS_22590 2240 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 2965 2363 gene locus_tag LOCUS_22600 2965 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 3238 2984 gene locus_tag LOCUS_22610 3238 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 >Feature sequence267 2317 443 gene locus_tag LOCUS_22620 2317 443 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928975.1 protein_id gnl|my_center|LOCUS_22620 2518 3063 gene locus_tag LOCUS_22630 2518 3063 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943299.1 protein_id gnl|my_center|LOCUS_22630 3157 3315 gene locus_tag LOCUS_22640 3157 3315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence268 684 1169 gene locus_tag LOCUS_22650 gene nuoE 684 1169 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_22650 1166 1408 gene locus_tag LOCUS_22660 1166 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22660 1463 2923 gene locus_tag LOCUS_22670 gene nuoF 1463 2923 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066666688.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22670 >Feature sequence269 775 2481 gene locus_tag LOCUS_22680 775 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 >Feature sequence270 1950 358 gene locus_tag LOCUS_22690 1950 358 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251419.1 protein_id gnl|my_center|LOCUS_22690 2116 2619 gene locus_tag LOCUS_22700 2116 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 2620 3102 gene locus_tag LOCUS_22710 2620 3102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 >Feature sequence271 <1 824 gene locus_tag LOCUS_22720 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399687.1:DNA repair protein RadA 840 1394 gene locus_tag LOCUS_22730 840 1394 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987052.1 protein_id gnl|my_center|LOCUS_22730 2194 1373 gene locus_tag LOCUS_22740 2194 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 2648 2172 gene locus_tag LOCUS_22750 2648 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 3136 2648 gene locus_tag LOCUS_22760 3136 2648 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393966.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence272 <1 691 gene locus_tag LOCUS_22770 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003424711.1:sporulation transcription factor Spo0A 1457 696 gene locus_tag LOCUS_22780 gene spo0A 1457 696 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001293867.1 protein_id gnl|my_center|LOCUS_22780 2341 1475 gene locus_tag LOCUS_22790 gene spo0A 2341 1475 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965371.1 protein_id gnl|my_center|LOCUS_22790 3156 2359 gene locus_tag LOCUS_22800 gene spo0A 3156 2359 CDS product sporulation transcription factor Spo0A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358896.1 protein_id gnl|my_center|LOCUS_22800 >Feature sequence273 <1 557 gene locus_tag LOCUS_22810 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966109.1:DEAD/DEAH box helicase family protein note possible pseudo, frameshifted 635 2086 gene locus_tag LOCUS_22820 635 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22820 2243 2746 gene locus_tag LOCUS_22830 gene purE 2243 2746 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147124.1 protein_id gnl|my_center|LOCUS_22830 >Feature sequence274 1344 373 gene locus_tag LOCUS_22840 1344 373 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948969.1 protein_id gnl|my_center|LOCUS_22840 1545 2579 gene locus_tag LOCUS_22850 1545 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 2759 2619 gene locus_tag LOCUS_22860 2759 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 >Feature sequence275 845 99 gene locus_tag LOCUS_22870 845 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 3169 827 gene locus_tag LOCUS_22880 3169 827 CDS product glycoside hydrolase family 95 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303191.1 protein_id gnl|my_center|LOCUS_22880 >Feature sequence276 122 1078 gene locus_tag LOCUS_22890 122 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 1686 1279 gene locus_tag LOCUS_22900 1686 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 3157 2285 gene locus_tag LOCUS_22910 3157 2285 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence277 161 397 gene locus_tag LOCUS_22920 161 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 418 789 gene locus_tag LOCUS_22930 418 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22930 808 1485 gene locus_tag LOCUS_22940 808 1485 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966155.1 protein_id gnl|my_center|LOCUS_22940 1549 1821 gene locus_tag LOCUS_22950 gene atpE 1549 1821 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902609.1 protein_id gnl|my_center|LOCUS_22950 1873 2427 gene locus_tag LOCUS_22960 1873 2427 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258897.1 protein_id gnl|my_center|LOCUS_22960 2415 2957 gene locus_tag LOCUS_22970 gene atpH 2415 2957 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403676.1 protein_id gnl|my_center|LOCUS_22970 2951 3154 gene locus_tag LOCUS_22980 2951 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_22980 >Feature sequence278 1302 1922 gene locus_tag LOCUS_22990 1302 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 3249 1963 gene locus_tag LOCUS_23000 3249 1963 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118023.1 protein_id gnl|my_center|LOCUS_23000 >Feature sequence279 1771 275 gene locus_tag LOCUS_23010 1771 275 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121559.1 protein_id gnl|my_center|LOCUS_23010 2004 1759 gene locus_tag LOCUS_23020 2004 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2801 2001 gene locus_tag LOCUS_23030 2801 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 >Feature sequence280 >Feature sequence281 292 924 gene locus_tag LOCUS_23040 292 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23040 953 2185 gene locus_tag LOCUS_23050 953 2185 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392748.1 protein_id gnl|my_center|LOCUS_23050 <3318 2231 gene locus_tag LOCUS_23060 <3318 2231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480140.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence282 >Feature sequence283 1297 194 gene locus_tag LOCUS_23070 1297 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 >Feature sequence284 1567 239 gene locus_tag LOCUS_23080 1567 239 CDS product DUF5716 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459253.1 protein_id gnl|my_center|LOCUS_23080 2190 1708 gene locus_tag LOCUS_23090 2190 1708 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459578.1 protein_id gnl|my_center|LOCUS_23090 >Feature sequence285 684 358 gene locus_tag LOCUS_23100 684 358 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643453.1 protein_id gnl|my_center|LOCUS_23100 897 2738 gene locus_tag LOCUS_23110 897 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence286 855 118 gene locus_tag LOCUS_23120 gene sigI 855 118 CDS product RNA polymerase sigma factor SigI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245855.1 protein_id gnl|my_center|LOCUS_23120 1004 1780 gene locus_tag LOCUS_23130 1004 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 1906 2604 gene locus_tag LOCUS_23140 1906 2604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 >Feature sequence287 27 914 gene locus_tag LOCUS_23150 27 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 1739 933 gene locus_tag LOCUS_23160 1739 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 3049 1739 gene locus_tag LOCUS_23170 3049 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 >Feature sequence288 41 613 gene locus_tag LOCUS_23180 gene hisIE 41 613 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861249.1 protein_id gnl|my_center|LOCUS_23180 756 1040 gene locus_tag LOCUS_23190 756 1040 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357350.1 protein_id gnl|my_center|LOCUS_23190 1068 2690 gene locus_tag LOCUS_23200 gene groL 1068 2690 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965990.1 protein_id gnl|my_center|LOCUS_23200 >Feature sequence289 2087 1218 gene locus_tag LOCUS_23210 gene atpG 2087 1218 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393856.1 protein_id gnl|my_center|LOCUS_23210 <3155 2100 gene locus_tag LOCUS_23220 <3155 2100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003356056.1:F0F1 ATP synthase subunit alpha >Feature sequence290 <1 511 gene locus_tag LOCUS_23230 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461677.1:hydratase 513 1133 gene locus_tag LOCUS_23240 513 1133 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048399.1 protein_id gnl|my_center|LOCUS_23240 1152 2516 gene locus_tag LOCUS_23250 gene uxaC 1152 2516 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245001.1 protein_id gnl|my_center|LOCUS_23250 2823 2557 gene locus_tag LOCUS_23260 2823 2557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 >Feature sequence291 889 1704 gene locus_tag LOCUS_23270 889 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 2381 1764 gene locus_tag LOCUS_23280 2381 1764 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000862963.1 protein_id gnl|my_center|LOCUS_23280 2768 2514 gene locus_tag LOCUS_23290 2768 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23290 >Feature sequence292 1191 232 gene locus_tag LOCUS_23300 gene pdaA 1191 232 CDS product delta-lactam-biosynthetic de-N-acetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897898.1 protein_id gnl|my_center|LOCUS_23300 1340 2008 gene locus_tag LOCUS_23310 1340 2008 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665989.1 protein_id gnl|my_center|LOCUS_23310 >Feature sequence293 2094 2246 gene locus_tag LOCUS_23320 2094 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 3002 2283 gene locus_tag LOCUS_23330 3002 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23330 >Feature sequence294 803 78 gene locus_tag LOCUS_23340 803 78 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017071.1 protein_id gnl|my_center|LOCUS_23340 1413 853 gene locus_tag LOCUS_23350 gene frr 1413 853 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965096.1 protein_id gnl|my_center|LOCUS_23350 <3063 1499 gene locus_tag LOCUS_23360 <3063 1499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389334.1:glycoside hydrolase family 20 zincin-like fold domain-containing protein >Feature sequence295 3 911 gene locus_tag LOCUS_23370 3 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23370 >Feature sequence296 1014 70 gene locus_tag LOCUS_23380 1014 70 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_23380 2102 1113 gene locus_tag LOCUS_23390 2102 1113 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643925.1 protein_id gnl|my_center|LOCUS_23390 <3028 2104 gene locus_tag LOCUS_23400 <3028 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase >Feature sequence297 1454 393 gene locus_tag LOCUS_23410 1454 393 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243004.1 protein_id gnl|my_center|LOCUS_23410 1611 3002 gene locus_tag LOCUS_23420 1611 3002 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802003.1 protein_id gnl|my_center|LOCUS_23420 >Feature sequence298 2406 1750 gene locus_tag LOCUS_23430 2406 1750 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420839.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence299 1711 335 gene locus_tag LOCUS_23440 1711 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23440 <3011 1795 gene locus_tag LOCUS_23450 <3011 1795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861675.1:UDP-glucose/GDP-mannose dehydrogenase family protein >Feature sequence300 255 1352 gene locus_tag LOCUS_23460 255 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 1446 2543 gene locus_tag LOCUS_23470 1446 2543 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_23470 >Feature sequence301 <1 1059 gene locus_tag LOCUS_23480 <1 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989911.1:Gfo/Idh/MocA family oxidoreductase 1074 1796 gene locus_tag LOCUS_23490 1074 1796 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989910.1 protein_id gnl|my_center|LOCUS_23490 1796 2104 gene locus_tag LOCUS_23500 1796 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 >Feature sequence302 1609 719 gene locus_tag LOCUS_23510 1609 719 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243523.1 protein_id gnl|my_center|LOCUS_23510 2243 1740 gene locus_tag LOCUS_23520 2243 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence303 135 407 gene locus_tag LOCUS_23530 135 407 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871082.1 protein_id gnl|my_center|LOCUS_23530 443 1804 gene locus_tag LOCUS_23540 443 1804 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_23540 1933 2301 gene locus_tag LOCUS_23550 1933 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 >Feature sequence304 24 1217 gene locus_tag LOCUS_23560 24 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 2197 1421 gene locus_tag LOCUS_23570 2197 1421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002899767.1 protein_id gnl|my_center|LOCUS_23570 <2886 2194 gene locus_tag LOCUS_23580 <2886 2194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837346.1:ABC transporter ATP-binding protein >Feature sequence305 2707 230 gene locus_tag LOCUS_23590 2707 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence306 1651 1196 gene locus_tag LOCUS_23600 1651 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2625 1666 gene locus_tag LOCUS_23610 2625 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 >Feature sequence307 >Feature sequence308 381 1001 gene locus_tag LOCUS_23620 381 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23620 1068 1631 gene locus_tag LOCUS_23630 1068 1631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 1796 2122 gene locus_tag LOCUS_23640 1796 2122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 >Feature sequence309 164 484 gene locus_tag LOCUS_23650 164 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 906 481 gene locus_tag LOCUS_23660 906 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 >Feature sequence310 2529 370 gene locus_tag LOCUS_23670 2529 370 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_23670 >Feature sequence311 234 755 gene locus_tag LOCUS_23680 234 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23680 748 2532 gene locus_tag LOCUS_23690 748 2532 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681271.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence312 1262 1071 gene locus_tag LOCUS_23700 1262 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1262 1414 gene locus_tag LOCUS_23710 1262 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_23710 1550 1684 gene locus_tag LOCUS_23720 1550 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 1918 2430 gene locus_tag LOCUS_23730 1918 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 >Feature sequence313 605 381 gene locus_tag LOCUS_23740 605 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23740 792 598 gene locus_tag LOCUS_23750 792 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 1583 873 gene locus_tag LOCUS_23760 1583 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2574 1663 gene locus_tag LOCUS_23770 2574 1663 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000817566.1 protein_id gnl|my_center|LOCUS_23770 >Feature sequence314 <1 1324 gene locus_tag LOCUS_23780 <1 1324 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083241703.1:DNA internalization-related competence protein ComEC/Rec2 1460 2329 gene locus_tag LOCUS_23790 1460 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 >Feature sequence315 1214 261 gene locus_tag LOCUS_23800 gene metA 1214 261 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462040.1 protein_id gnl|my_center|LOCUS_23800 1696 1313 gene locus_tag LOCUS_23810 1696 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 2050 1727 gene locus_tag LOCUS_23820 2050 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 >Feature sequence316 132 2600 gene locus_tag LOCUS_23830 132 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 >Feature sequence317 239 991 gene locus_tag LOCUS_23840 239 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1121 2443 gene locus_tag LOCUS_23850 1121 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 2751 2575 gene locus_tag LOCUS_23860 2751 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence318 1122 121 gene locus_tag LOCUS_23870 gene trpD 1122 121 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_23870 1687 1115 gene locus_tag LOCUS_23880 1687 1115 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966439.1 protein_id gnl|my_center|LOCUS_23880 <2744 1684 gene locus_tag LOCUS_23890 <2744 1684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966440.1:anthranilate synthase component I >Feature sequence319 <1 1733 gene locus_tag LOCUS_23900 <1 1733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965596.1:GTPase HflX 1730 2356 gene locus_tag LOCUS_23910 1730 2356 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357796.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence320 1758 46 gene locus_tag LOCUS_23920 gene proS 1758 46 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000814310.1 protein_id gnl|my_center|LOCUS_23920 <2692 2131 gene locus_tag LOCUS_23930 <2692 2131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047993.1:pyruvate, phosphate dikinase >Feature sequence321 47 2017 gene locus_tag LOCUS_23940 47 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 >Feature sequence322 156 647 gene locus_tag LOCUS_23950 156 647 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809864.1 protein_id gnl|my_center|LOCUS_23950 640 1605 gene locus_tag LOCUS_23960 640 1605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 1749 1952 gene locus_tag LOCUS_23970 1749 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1995 2489 gene locus_tag LOCUS_23980 1995 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_23980 >Feature sequence323 730 1701 gene locus_tag LOCUS_23990 730 1701 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583252.1 protein_id gnl|my_center|LOCUS_23990 1884 2537 gene locus_tag LOCUS_24000 1884 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 >Feature sequence324 <1 868 gene locus_tag LOCUS_24010 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000391706.1:glucokinase 871 1608 gene locus_tag LOCUS_24020 gene truA 871 1608 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_24020 <2563 1598 gene locus_tag LOCUS_24030 <2563 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016043.1:galactokinase >Feature sequence325 <2540 1956 gene locus_tag LOCUS_24040 <2540 1956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986205.1:magnesium transporter >Feature sequence326 482 733 gene locus_tag LOCUS_24050 482 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 1278 754 gene locus_tag LOCUS_24060 1278 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 >Feature sequence327 32 577 gene locus_tag LOCUS_24070 gene fapR 32 577 CDS product transcription factor FapR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419115.1 protein_id gnl|my_center|LOCUS_24070 594 1586 gene locus_tag LOCUS_24080 gene plsX 594 1586 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965053.1 protein_id gnl|my_center|LOCUS_24080 1655 1879 gene locus_tag LOCUS_24090 gene acpP 1655 1879 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000753030.1 protein_id gnl|my_center|LOCUS_24090 >Feature sequence328 33 209 gene locus_tag LOCUS_24100 33 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 1320 349 gene locus_tag LOCUS_24110 1320 349 CDS product DUF4846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903242.1 protein_id gnl|my_center|LOCUS_24110 2284 1322 gene locus_tag LOCUS_24120 2284 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 >Feature sequence329 414 1496 gene locus_tag LOCUS_24130 414 1496 CDS product endospore germination permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392970.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence330 756 127 gene locus_tag LOCUS_24140 756 127 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_24140 2140 770 gene locus_tag LOCUS_24150 2140 770 CDS product methanol--corrinoid methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392723.1 protein_id gnl|my_center|LOCUS_24150 >Feature sequence331 195 725 gene locus_tag LOCUS_24160 gene pgsA 195 725 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_24160 802 1653 gene locus_tag LOCUS_24170 802 1653 CDS product DUF5685 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963968.1 protein_id gnl|my_center|LOCUS_24170 1646 2245 gene locus_tag LOCUS_24180 1646 2245 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398976.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence332 <1 595 gene locus_tag LOCUS_24190 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496786.1:sugar phosphate isomerase/epimerase 1998 631 gene locus_tag LOCUS_24200 1998 631 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029494943.1 protein_id gnl|my_center|LOCUS_24200 >Feature sequence333 1556 189 gene locus_tag LOCUS_24210 1556 189 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814295.1 protein_id gnl|my_center|LOCUS_24210 1928 1569 gene locus_tag LOCUS_24220 1928 1569 CDS product DUF2200 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970036.1 protein_id gnl|my_center|LOCUS_24220 >Feature sequence334 1489 605 gene locus_tag LOCUS_24230 1489 605 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_24230 >Feature sequence335 >Feature sequence336 421 2079 gene locus_tag LOCUS_24240 421 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 2076 2360 gene locus_tag LOCUS_24250 2076 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence337 1223 60 gene locus_tag LOCUS_24260 gene nagZ 1223 60 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813606.1 protein_id gnl|my_center|LOCUS_24260 1542 1808 gene locus_tag LOCUS_24270 1542 1808 CDS product CD3324 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942661.1 protein_id gnl|my_center|LOCUS_24270 2311 1835 gene locus_tag LOCUS_24280 2311 1835 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053897.1 protein_id gnl|my_center|LOCUS_24280 >Feature sequence338 1730 1110 gene locus_tag LOCUS_24290 1730 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 2098 1976 gene locus_tag LOCUS_24300 2098 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 >Feature sequence339 145 900 gene locus_tag LOCUS_24310 145 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24310 >Feature sequence340 >Feature sequence341 51 779 gene locus_tag LOCUS_24320 51 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 843 2312 gene locus_tag LOCUS_24330 843 2312 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_24330 >Feature sequence342 <1 2041 gene locus_tag LOCUS_24340 <1 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986787.1:polyribonucleotide nucleotidyltransferase >Feature sequence343 2130 43 gene locus_tag LOCUS_24350 2130 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24350 >Feature sequence344 551 1360 gene locus_tag LOCUS_24360 551 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 <2319 1405 gene locus_tag LOCUS_24370 <2319 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120973.1:galactose mutarotase >Feature sequence345 423 560 gene locus_tag LOCUS_24380 423 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24380 759 1649 gene locus_tag LOCUS_24390 759 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 >Feature sequence346 1961 1701 gene locus_tag LOCUS_24400 1961 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2233 1979 gene locus_tag LOCUS_24410 2233 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 >Feature sequence347 436 1212 gene locus_tag LOCUS_24420 436 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 1229 1426 gene locus_tag LOCUS_24430 1229 1426 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965947.1 protein_id gnl|my_center|LOCUS_24430 <2296 1418 gene locus_tag LOCUS_24440 <2296 1418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245342.1:metallophosphoesterase >Feature sequence348 <1 531 gene locus_tag LOCUS_24450 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792014.1:pseudouridine synthase 528 1664 gene locus_tag LOCUS_24460 528 1664 CDS product class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944494.1 protein_id gnl|my_center|LOCUS_24460 1751 2026 gene locus_tag LOCUS_24470 1751 2026 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814866.1 protein_id gnl|my_center|LOCUS_24470 >Feature sequence349 1319 228 gene locus_tag LOCUS_24480 1319 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 2110 1319 gene locus_tag LOCUS_24490 2110 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 >Feature sequence350 998 702 gene locus_tag LOCUS_24500 998 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24500 1187 1032 gene locus_tag LOCUS_24510 1187 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 2022 1270 gene locus_tag LOCUS_24520 2022 1270 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086384.1 protein_id gnl|my_center|LOCUS_24520 2184 2023 gene locus_tag LOCUS_24530 2184 2023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence351 73 1134 gene locus_tag LOCUS_24540 gene nifS 73 1134 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986887.1 protein_id gnl|my_center|LOCUS_24540 1138 1596 gene locus_tag LOCUS_24550 gene nifU 1138 1596 CDS product Fe-S cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438275.1 protein_id gnl|my_center|LOCUS_24550 >Feature sequence352 210 2210 gene locus_tag LOCUS_24560 210 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 >Feature sequence353 567 220 gene locus_tag LOCUS_24570 567 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 1470 583 gene locus_tag LOCUS_24580 1470 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 >Feature sequence354 1133 372 gene locus_tag LOCUS_24590 1133 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 1587 1162 gene locus_tag LOCUS_24600 1587 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1739 2008 gene locus_tag LOCUS_24610 1739 2008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 2023 2217 gene locus_tag LOCUS_24620 2023 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 >Feature sequence355 1998 1549 gene locus_tag LOCUS_24630 1998 1549 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003395139.1 protein_id gnl|my_center|LOCUS_24630 >Feature sequence356 2 298 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq attaccgtccccgcgtggggatagattgcgac 682 518 gene locus_tag LOCUS_24640 682 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 1729 887 gene locus_tag LOCUS_24650 1729 887 CDS product glycoside hydrolase family 43 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108031.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_24650 2037 1729 gene locus_tag LOCUS_24660 2037 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 >Feature sequence357 281 622 gene locus_tag LOCUS_24670 281 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24670 1713 697 gene locus_tag LOCUS_24680 1713 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24680 >Feature sequence358 701 462 gene locus_tag LOCUS_24690 701 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 1605 715 gene locus_tag LOCUS_24700 1605 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 >Feature sequence359 996 418 gene locus_tag LOCUS_24710 996 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24710 1248 1093 gene locus_tag LOCUS_24720 1248 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 <2154 1229 gene locus_tag LOCUS_24730 <2154 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964729.1:AmmeMemoRadiSam system protein A >Feature sequence360 <1 595 gene locus_tag LOCUS_24740 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421448.1:ribose-phosphate pyrophosphokinase 607 1209 gene locus_tag LOCUS_24750 gene pth 607 1209 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048384.1 protein_id gnl|my_center|LOCUS_24750 >Feature sequence361 >Feature sequence362 >Feature sequence363 24 467 gene locus_tag LOCUS_24760 24 467 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811150.1 protein_id gnl|my_center|LOCUS_24760 477 1724 gene locus_tag LOCUS_24770 477 1724 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986281.1 protein_id gnl|my_center|LOCUS_24770 >Feature sequence364 1361 30 gene locus_tag LOCUS_24780 1361 30 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 <2071 1358 gene locus_tag LOCUS_24790 <2071 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009897167.1:AraC family transcriptional regulator >Feature sequence365 <1 1012 gene locus_tag LOCUS_24800 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584051.1:dipeptide ABC transporter ATP-binding protein 1012 1404 gene locus_tag LOCUS_24810 1012 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 1388 1852 gene locus_tag LOCUS_24820 1388 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 >Feature sequence366 <2046 1225 gene locus_tag LOCUS_24830 <2046 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921690.1:acetylxylan esterase >Feature sequence367 178 1422 gene locus_tag LOCUS_24840 178 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 >Feature sequence368 193 1350 gene locus_tag LOCUS_24850 193 1350 CDS product serine-pyruvate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081619.1 protein_id gnl|my_center|LOCUS_24850 >Feature sequence369 1203 982 gene locus_tag LOCUS_24860 1203 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24860 <2030 1217 gene locus_tag LOCUS_24870 <2030 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107230.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence370 >Feature sequence371 1639 983 gene locus_tag LOCUS_24880 1639 983 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891221.1 protein_id gnl|my_center|LOCUS_24880 1997 1656 gene locus_tag LOCUS_24890 1997 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence372 722 405 gene locus_tag LOCUS_24900 722 405 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044286901.1 protein_id gnl|my_center|LOCUS_24900 1064 927 gene locus_tag LOCUS_24910 1064 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 1990 1061 gene locus_tag LOCUS_24920 1990 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 >Feature sequence373 >Feature sequence374 14 1033 gene locus_tag LOCUS_24930 gene iolG 14 1033 CDS product inositol 2-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001101686.1 protein_id gnl|my_center|LOCUS_24930 >Feature sequence375 1054 275 gene locus_tag LOCUS_24940 1054 275 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545170.1 protein_id gnl|my_center|LOCUS_24940 1205 1855 gene locus_tag LOCUS_24950 1205 1855 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869499.1 protein_id gnl|my_center|LOCUS_24950 >Feature sequence376 <1 1119 gene locus_tag LOCUS_24960 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009892066.1:peptidylprolyl isomerase 1713 1162 gene locus_tag LOCUS_24970 gene spoVT 1713 1162 CDS product stage V sporulation protein T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391631.1 protein_id gnl|my_center|LOCUS_24970 >Feature sequence377 125 247 gene locus_tag LOCUS_24980 125 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 377 1279 gene locus_tag LOCUS_24990 gene spoIIGA 377 1279 CDS product sigma-E processing peptidase SpoIIGA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170291042.1 protein_id gnl|my_center|LOCUS_24990 >Feature sequence378 940 365 gene locus_tag LOCUS_25000 940 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 1165 941 gene locus_tag LOCUS_25010 1165 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 1851 1165 gene locus_tag LOCUS_25020 1851 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 >Feature sequence379 227 1426 gene locus_tag LOCUS_25030 227 1426 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763773.1 protein_id gnl|my_center|LOCUS_25030 1510 1854 gene locus_tag LOCUS_25040 1510 1854 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832217.1 protein_id gnl|my_center|LOCUS_25040 >Feature sequence380 336 1370 gene locus_tag LOCUS_25050 gene metN 336 1370 CDS product methionine ABC transporter ATP-binding protein MetN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000594006.1 protein_id gnl|my_center|LOCUS_25050 >Feature sequence381 997 80 gene locus_tag LOCUS_25060 997 80 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969646.1 protein_id gnl|my_center|LOCUS_25060 1417 1707 gene locus_tag LOCUS_25070 1417 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25070 >Feature sequence382 1123 191 gene locus_tag LOCUS_25080 1123 191 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_25080 1923 1138 gene locus_tag LOCUS_25090 1923 1138 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775210.1 protein_id gnl|my_center|LOCUS_25090 >Feature sequence383 1734 238 gene locus_tag LOCUS_25100 1734 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 >Feature sequence384 548 237 gene locus_tag LOCUS_25110 548 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810433.1 protein_id gnl|my_center|LOCUS_25110 1798 554 gene locus_tag LOCUS_25120 1798 554 CDS product PocR ligand-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198760.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence385 276 425 gene locus_tag LOCUS_25130 gene rpmG 276 425 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810204.1 protein_id gnl|my_center|LOCUS_25130 441 674 gene locus_tag LOCUS_25140 441 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 691 1230 gene locus_tag LOCUS_25150 gene nusG 691 1230 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357696.1 protein_id gnl|my_center|LOCUS_25150 1262 1687 gene locus_tag LOCUS_25160 gene rplK 1262 1687 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357261.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence386 699 1790 gene locus_tag LOCUS_25170 699 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence387 664 1662 gene locus_tag LOCUS_25180 664 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 >Feature sequence388 <1871 524 gene locus_tag LOCUS_25190 <1871 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011068161.1:DUF5696 domain-containing protein >Feature sequence389 >Feature sequence390 1 459 gene locus_tag LOCUS_25200 1 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 579 1820 gene locus_tag LOCUS_25210 579 1820 CDS product serpin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810397.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence391 1644 373 gene locus_tag LOCUS_25220 1644 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 >Feature sequence392 564 7 gene locus_tag LOCUS_25230 564 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 1818 565 gene locus_tag LOCUS_25240 1818 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence393 <1 830 gene locus_tag LOCUS_25250 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965310.1:radical SAM protein 823 1455 gene locus_tag LOCUS_25260 823 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 >Feature sequence394 1188 580 gene locus_tag LOCUS_25270 1188 580 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460050.1 protein_id gnl|my_center|LOCUS_25270 1551 1192 gene locus_tag LOCUS_25280 1551 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 >Feature sequence395 82 1071 gene locus_tag LOCUS_25290 82 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 1678 1193 gene locus_tag LOCUS_25300 1678 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 >Feature sequence396 >Feature sequence397 1009 782 gene locus_tag LOCUS_25310 1009 782 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_25310 <1763 972 gene locus_tag LOCUS_25320 <1763 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986402.1:carbamoyltransferase HypF >Feature sequence398 265 1629 gene locus_tag LOCUS_25330 265 1629 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807856.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence399 1354 329 gene locus_tag LOCUS_25340 1354 329 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582802.1 protein_id gnl|my_center|LOCUS_25340 1644 1414 gene locus_tag LOCUS_25350 1644 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 >Feature sequence400 1687 122 gene locus_tag LOCUS_25360 1687 122 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461107.1 protein_id gnl|my_center|LOCUS_25360 >Feature sequence401 16 471 gene locus_tag LOCUS_25370 16 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 1008 517 gene locus_tag LOCUS_25380 1008 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25380 >Feature sequence402 <1 571 gene locus_tag LOCUS_25390 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963507.1:N-acetylglucosamine kinase <1699 610 gene locus_tag LOCUS_25400 <1699 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227576.1:alpha-L-rhamnosidase >Feature sequence403 151 339 gene locus_tag LOCUS_25410 151 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 351 1049 gene locus_tag LOCUS_25420 351 1049 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071301.1 protein_id gnl|my_center|LOCUS_25420 >Feature sequence404 1254 196 gene locus_tag LOCUS_25430 1254 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 >Feature sequence405 764 108 gene locus_tag LOCUS_25440 764 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25440 1505 846 gene locus_tag LOCUS_25450 1505 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25450 >Feature sequence406 311 634 gene locus_tag LOCUS_25460 311 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 782 1606 gene locus_tag LOCUS_25470 782 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence407 1196 42 gene locus_tag LOCUS_25480 1196 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence408 <1 624 gene locus_tag LOCUS_25490 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393834.1:ABC transporter ATP-binding protein 1124 651 gene locus_tag LOCUS_25500 1124 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 <1629 1117 gene locus_tag LOCUS_25510 <1629 1117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003425850.1:F0F1 ATP synthase subunit beta >Feature sequence409 155 1435 gene locus_tag LOCUS_25520 155 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 >Feature sequence410 1098 691 gene locus_tag LOCUS_25530 1098 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1520 1119 gene locus_tag LOCUS_25540 1520 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 >Feature sequence411 1349 69 gene locus_tag LOCUS_25550 1349 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 >Feature sequence412 1395 238 gene locus_tag LOCUS_25560 1395 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence413 20 763 gene locus_tag LOCUS_25570 20 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 811 1062 gene locus_tag LOCUS_25580 811 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 >Feature sequence414 1092 1493 gene locus_tag LOCUS_25590 1092 1493 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943560.1 protein_id gnl|my_center|LOCUS_25590 >Feature sequence415 >Feature sequence416 <1575 400 gene locus_tag LOCUS_25600 <1575 400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480140.1:D-alanyl-D-alanine carboxypeptidase family protein >Feature sequence417 310 1029 gene locus_tag LOCUS_25610 310 1029 CDS product trehalose utilization protein ThuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731916.1 protein_id gnl|my_center|LOCUS_25610 >Feature sequence418 1446 109 gene locus_tag LOCUS_25620 1446 109 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence419 <1 785 gene locus_tag LOCUS_25630 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860963.1:MFS transporter >Feature sequence420 1199 213 gene locus_tag LOCUS_25640 1199 213 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964789.1 protein_id gnl|my_center|LOCUS_25640 >Feature sequence421 795 721 gene locus_tag LOCUS_t00300 795 721 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence422 506 1351 gene locus_tag LOCUS_25650 506 1351 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948948.1 protein_id gnl|my_center|LOCUS_25650 >Feature sequence423 331 858 gene locus_tag LOCUS_25660 331 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660