>Feature sequence01 210 2291 gene locus_tag LOCUS_00010 210 2291 CDS product peptidase M13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390147.1 protein_id gnl|my_center|LOCUS_00010 2929 2417 gene locus_tag LOCUS_00020 2929 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 5268 3436 gene locus_tag LOCUS_00030 5268 3436 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414654.1 protein_id gnl|my_center|LOCUS_00030 6869 5457 gene locus_tag LOCUS_00040 6869 5457 CDS product PIF1 family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068808.1 protein_id gnl|my_center|LOCUS_00040 7693 6992 gene locus_tag LOCUS_00050 gene orn 7693 6992 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994424.1 protein_id gnl|my_center|LOCUS_00050 9469 7976 gene locus_tag LOCUS_00060 gene guaB 9469 7976 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114891.1 protein_id gnl|my_center|LOCUS_00060 10976 9606 gene locus_tag LOCUS_00070 10976 9606 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814864.1 protein_id gnl|my_center|LOCUS_00070 11728 10973 gene locus_tag LOCUS_00080 11728 10973 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814862.1 protein_id gnl|my_center|LOCUS_00080 12306 12878 gene locus_tag LOCUS_00090 12306 12878 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068849.1 protein_id gnl|my_center|LOCUS_00090 13019 13095 gene locus_tag LOCUS_t00010 13019 13095 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14387 13560 gene locus_tag LOCUS_00100 14387 13560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14974 15558 gene locus_tag LOCUS_00110 14974 15558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 16086 15682 gene locus_tag LOCUS_00120 16086 15682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 16278 17039 gene locus_tag LOCUS_00130 16278 17039 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148770277.1 protein_id gnl|my_center|LOCUS_00130 18118 17126 gene locus_tag LOCUS_00140 18118 17126 CDS product AGE family epimerase/isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054321935.1 protein_id gnl|my_center|LOCUS_00140 18167 18409 gene locus_tag LOCUS_00150 18167 18409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 18764 18976 gene locus_tag LOCUS_00160 gene rpmE 18764 18976 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814855.1 protein_id gnl|my_center|LOCUS_00160 19150 20241 gene locus_tag LOCUS_00170 gene prfA 19150 20241 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052437.1 protein_id gnl|my_center|LOCUS_00170 20304 21236 gene locus_tag LOCUS_00180 gene prmC 20304 21236 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055663.1 protein_id gnl|my_center|LOCUS_00180 21451 23127 gene locus_tag LOCUS_00190 gene ettA 21451 23127 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814786.1 protein_id gnl|my_center|LOCUS_00190 23332 24243 gene locus_tag LOCUS_00200 23332 24243 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068793.1 protein_id gnl|my_center|LOCUS_00200 24932 24417 gene locus_tag LOCUS_00210 24932 24417 CDS product DUF3180 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814779.1 protein_id gnl|my_center|LOCUS_00210 25972 24929 gene locus_tag LOCUS_00220 25972 24929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 28091 25992 gene locus_tag LOCUS_00230 gene ftsH 28091 25992 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068789.1 protein_id gnl|my_center|LOCUS_00230 28651 28088 gene locus_tag LOCUS_00240 gene hpt 28651 28088 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816281.1 protein_id gnl|my_center|LOCUS_00240 29771 28638 gene locus_tag LOCUS_00250 gene tilS 29771 28638 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390178.1 protein_id gnl|my_center|LOCUS_00250 31252 29780 gene locus_tag LOCUS_00260 31252 29780 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390179.1 protein_id gnl|my_center|LOCUS_00260 32887 31256 gene locus_tag LOCUS_00270 32887 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814762.1 protein_id gnl|my_center|LOCUS_00270 33774 32884 gene locus_tag LOCUS_00280 33774 32884 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582910.1 protein_id gnl|my_center|LOCUS_00280 35196 33970 gene locus_tag LOCUS_00290 35196 33970 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814758.1 protein_id gnl|my_center|LOCUS_00290 36716 35196 gene locus_tag LOCUS_00300 36716 35196 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390181.1 protein_id gnl|my_center|LOCUS_00300 37095 36841 gene locus_tag LOCUS_00310 37095 36841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 37135 37734 gene locus_tag LOCUS_00320 37135 37734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 37736 38014 gene locus_tag LOCUS_00330 37736 38014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 38285 38467 gene locus_tag LOCUS_00340 38285 38467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 38519 39700 gene locus_tag LOCUS_00350 38519 39700 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262601.1 protein_id gnl|my_center|LOCUS_00350 39917 40099 gene locus_tag LOCUS_00360 39917 40099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 40414 40986 gene locus_tag LOCUS_00370 40414 40986 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029832.1 protein_id gnl|my_center|LOCUS_00370 41122 41634 gene locus_tag LOCUS_00380 41122 41634 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002309892.1 protein_id gnl|my_center|LOCUS_00380 41701 42180 gene locus_tag LOCUS_00390 41701 42180 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837431.1 protein_id gnl|my_center|LOCUS_00390 43347 42304 gene locus_tag LOCUS_00400 43347 42304 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210120.1 protein_id gnl|my_center|LOCUS_00400 43835 43763 gene locus_tag LOCUS_t00020 43835 43763 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 44797 43946 gene locus_tag LOCUS_00410 gene trmB 44797 43946 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068780.1 protein_id gnl|my_center|LOCUS_00410 44998 46008 gene locus_tag LOCUS_00420 gene galE 44998 46008 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068781.1 protein_id gnl|my_center|LOCUS_00420 46156 46896 gene locus_tag LOCUS_00430 46156 46896 CDS product DUF4190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819800.1 protein_id gnl|my_center|LOCUS_00430 47540 47067 gene locus_tag LOCUS_00440 47540 47067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 48399 47695 gene locus_tag LOCUS_00450 48399 47695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 49221 48538 gene locus_tag LOCUS_00460 49221 48538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49892 49218 gene locus_tag LOCUS_00470 49892 49218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 53867 50052 gene locus_tag LOCUS_00480 53867 50052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 55188 54100 gene locus_tag LOCUS_00490 gene chvE 55188 54100 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085992.1 protein_id gnl|my_center|LOCUS_00490 56497 55274 gene locus_tag LOCUS_00500 gene gguB 56497 55274 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068800.1 protein_id gnl|my_center|LOCUS_00500 58145 56595 gene locus_tag LOCUS_00510 gene gguA 58145 56595 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287995.1 protein_id gnl|my_center|LOCUS_00510 59308 58631 gene locus_tag LOCUS_00520 59308 58631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 59531 60085 gene locus_tag LOCUS_00530 59531 60085 CDS product gluconokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112729.1 protein_id gnl|my_center|LOCUS_00530 60249 61577 gene locus_tag LOCUS_00540 60249 61577 CDS product gluconate:H+ symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118196.1 protein_id gnl|my_center|LOCUS_00540 61636 62511 gene locus_tag LOCUS_00550 gene gnd 61636 62511 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118197.1 protein_id gnl|my_center|LOCUS_00550 62618 62692 gene locus_tag LOCUS_t00030 62618 62692 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 62743 62818 gene locus_tag LOCUS_t00040 62743 62818 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 64073 62925 gene locus_tag LOCUS_00560 64073 62925 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110336.1 protein_id gnl|my_center|LOCUS_00560 64615 64076 gene locus_tag LOCUS_00570 64615 64076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 64941 65186 gene locus_tag LOCUS_00580 64941 65186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 65183 66781 gene locus_tag LOCUS_00590 65183 66781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 66792 67016 gene locus_tag LOCUS_00600 66792 67016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 67013 67333 gene locus_tag LOCUS_00610 67013 67333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 67333 67650 gene locus_tag LOCUS_00620 67333 67650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 67643 67906 gene locus_tag LOCUS_00630 67643 67906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 68022 68300 gene locus_tag LOCUS_00640 68022 68300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 69559 68372 gene locus_tag LOCUS_00650 69559 68372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 70642 70079 gene locus_tag LOCUS_00660 70642 70079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 71027 71557 gene locus_tag LOCUS_00670 71027 71557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 72065 72415 gene locus_tag LOCUS_00680 72065 72415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 72519 72785 gene locus_tag LOCUS_00690 72519 72785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 73051 72854 gene locus_tag LOCUS_00700 73051 72854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 73707 73195 gene locus_tag LOCUS_00710 73707 73195 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112487.1 protein_id gnl|my_center|LOCUS_00710 74410 73736 gene locus_tag LOCUS_00720 74410 73736 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818243.1 protein_id gnl|my_center|LOCUS_00720 75339 74464 gene locus_tag LOCUS_00730 75339 74464 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390190.1 protein_id gnl|my_center|LOCUS_00730 75617 76240 gene locus_tag LOCUS_00740 75617 76240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 76301 78412 gene locus_tag LOCUS_00750 76301 78412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 78669 79082 gene locus_tag LOCUS_00760 78669 79082 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052358.1 protein_id gnl|my_center|LOCUS_00760 80407 79337 gene locus_tag LOCUS_00770 80407 79337 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052357.1 protein_id gnl|my_center|LOCUS_00770 81358 80603 gene locus_tag LOCUS_00780 81358 80603 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994837.1 protein_id gnl|my_center|LOCUS_00780 82439 81693 gene locus_tag LOCUS_00790 82439 81693 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390193.1 protein_id gnl|my_center|LOCUS_00790 82989 84164 gene locus_tag LOCUS_00800 gene serC 82989 84164 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390194.1 protein_id gnl|my_center|LOCUS_00800 85734 84286 gene locus_tag LOCUS_00810 gene manA 85734 84286 CDS product mannose-6-phosphate isomerase, class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975786.1 protein_id gnl|my_center|LOCUS_00810 85843 86097 gene locus_tag LOCUS_00820 85843 86097 CDS product DUF2530 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052350.1 protein_id gnl|my_center|LOCUS_00820 87362 86229 gene locus_tag LOCUS_00830 87362 86229 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055303.1 protein_id gnl|my_center|LOCUS_00830 87588 88259 gene locus_tag LOCUS_00840 gene phoU 87588 88259 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363821.1 protein_id gnl|my_center|LOCUS_00840 89246 88500 gene locus_tag LOCUS_00850 89246 88500 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112459.1 protein_id gnl|my_center|LOCUS_00850 90334 89348 gene locus_tag LOCUS_00860 gene menA 90334 89348 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068774.1 protein_id gnl|my_center|LOCUS_00860 92114 90516 gene locus_tag LOCUS_00870 gene lysS 92114 90516 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115592.1 protein_id gnl|my_center|LOCUS_00870 92388 92462 gene locus_tag LOCUS_t00050 92388 92462 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 92638 93762 gene locus_tag LOCUS_00880 92638 93762 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476486.1 protein_id gnl|my_center|LOCUS_00880 94889 93897 gene locus_tag LOCUS_00890 94889 93897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 95407 95276 gene locus_tag LOCUS_00900 95407 95276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 95558 95373 gene locus_tag LOCUS_00910 95558 95373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 95736 95560 gene locus_tag LOCUS_00920 95736 95560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 96247 95729 gene locus_tag LOCUS_00930 96247 95729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 97145 96258 gene locus_tag LOCUS_00940 97145 96258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 97772 97164 gene locus_tag LOCUS_00950 97772 97164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 98119 97772 gene locus_tag LOCUS_00960 98119 97772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 98222 98434 gene locus_tag LOCUS_00970 98222 98434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 98701 99921 gene locus_tag LOCUS_00980 98701 99921 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390199.1 protein_id gnl|my_center|LOCUS_00980 100308 102314 gene locus_tag LOCUS_00990 100308 102314 CDS product DUF4037 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390200.1 protein_id gnl|my_center|LOCUS_00990 102464 103162 gene locus_tag LOCUS_01000 102464 103162 CDS product DUF4125 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814656.1 protein_id gnl|my_center|LOCUS_01000 103367 104848 gene locus_tag LOCUS_01010 103367 104848 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068773.1 protein_id gnl|my_center|LOCUS_01010 105423 104923 gene locus_tag LOCUS_01020 105423 104923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 107279 105501 gene locus_tag LOCUS_01030 107279 105501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 107445 108839 gene locus_tag LOCUS_01040 107445 108839 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068770.1 protein_id gnl|my_center|LOCUS_01040 108826 109521 gene locus_tag LOCUS_01050 108826 109521 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814649.1 protein_id gnl|my_center|LOCUS_01050 110217 109612 gene locus_tag LOCUS_01060 110217 109612 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363467.1 protein_id gnl|my_center|LOCUS_01060 111254 110388 gene locus_tag LOCUS_01070 111254 110388 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005073373.1 protein_id gnl|my_center|LOCUS_01070 112896 111469 gene locus_tag LOCUS_01080 112896 111469 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206265.1 protein_id gnl|my_center|LOCUS_01080 114399 112900 gene locus_tag LOCUS_01090 114399 112900 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_01090 115652 114603 gene locus_tag LOCUS_01100 115652 114603 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390764.1 protein_id gnl|my_center|LOCUS_01100 116082 116852 gene locus_tag LOCUS_01110 116082 116852 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674351.1 protein_id gnl|my_center|LOCUS_01110 116830 118062 gene locus_tag LOCUS_01120 116830 118062 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674350.1 protein_id gnl|my_center|LOCUS_01120 118154 118837 gene locus_tag LOCUS_01130 118154 118837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003578461.1 protein_id gnl|my_center|LOCUS_01130 120753 119008 gene locus_tag LOCUS_01140 gene spxB 120753 119008 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101179.1 protein_id gnl|my_center|LOCUS_01140 121250 121167 gene locus_tag LOCUS_t00060 121250 121167 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 122664 121378 gene locus_tag LOCUS_01150 gene serS 122664 121378 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052327.1 protein_id gnl|my_center|LOCUS_01150 123269 124372 gene locus_tag LOCUS_01160 123269 124372 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143567.1 protein_id gnl|my_center|LOCUS_01160 124663 126339 gene locus_tag LOCUS_01170 gene pgm 124663 126339 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814621.1 protein_id gnl|my_center|LOCUS_01170 126569 127726 gene locus_tag LOCUS_01180 126569 127726 CDS product ribonuclease H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390211.1 protein_id gnl|my_center|LOCUS_01180 127898 128596 gene locus_tag LOCUS_01190 gene rpiA 127898 128596 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814612.1 protein_id gnl|my_center|LOCUS_01190 129638 129090 gene locus_tag LOCUS_01200 129638 129090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052313.1 protein_id gnl|my_center|LOCUS_01200 129809 131242 gene locus_tag LOCUS_01210 gene radA 129809 131242 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390212.1 protein_id gnl|my_center|LOCUS_01210 132660 131419 gene locus_tag LOCUS_01220 132660 131419 CDS product riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003823255.1 protein_id gnl|my_center|LOCUS_01220 133992 132925 gene locus_tag LOCUS_01230 133992 132925 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068748.1 protein_id gnl|my_center|LOCUS_01230 134596 133982 gene locus_tag LOCUS_01240 134596 133982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 134742 134554 gene locus_tag LOCUS_01250 134742 134554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 136752 134956 gene locus_tag LOCUS_01260 136752 134956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 137108 136749 gene locus_tag LOCUS_01270 137108 136749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 137369 137187 gene locus_tag LOCUS_01280 137369 137187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 139206 138070 gene locus_tag LOCUS_01290 gene nusA 139206 138070 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815687.1 protein_id gnl|my_center|LOCUS_01290 139369 140280 gene locus_tag LOCUS_01300 139369 140280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822756.1 protein_id gnl|my_center|LOCUS_01300 141552 140431 gene locus_tag LOCUS_01310 141552 140431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 141807 141721 gene locus_tag LOCUS_t00070 141807 141721 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 142868 142062 gene locus_tag LOCUS_01320 142868 142062 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055304.1 protein_id gnl|my_center|LOCUS_01320 145471 143291 gene locus_tag LOCUS_01330 145471 143291 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068744.1 protein_id gnl|my_center|LOCUS_01330 146478 145666 gene locus_tag LOCUS_01340 146478 145666 CDS product tRNA pseudouridine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022173241.1 protein_id gnl|my_center|LOCUS_01340 147792 147151 gene locus_tag LOCUS_01350 gene rplQ 147792 147151 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819143.1 protein_id gnl|my_center|LOCUS_01350 148940 147945 gene locus_tag LOCUS_01360 148940 147945 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814583.1 protein_id gnl|my_center|LOCUS_01360 149416 149018 gene locus_tag LOCUS_01370 gene rpsK 149416 149018 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829907.1 protein_id gnl|my_center|LOCUS_01370 149898 149521 gene locus_tag LOCUS_01380 gene rpsM 149898 149521 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808138.1 protein_id gnl|my_center|LOCUS_01380 150394 150176 gene locus_tag LOCUS_01390 gene infA 150394 150176 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808114.1 protein_id gnl|my_center|LOCUS_01390 152114 150612 gene locus_tag LOCUS_01400 152114 150612 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814403.1 protein_id gnl|my_center|LOCUS_01400 153235 152210 gene locus_tag LOCUS_01410 153235 152210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032736338.1 protein_id gnl|my_center|LOCUS_01410 153992 153387 gene locus_tag LOCUS_01420 153992 153387 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055906.1 protein_id gnl|my_center|LOCUS_01420 159309 154327 gene locus_tag LOCUS_01430 159309 154327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 160511 159501 gene locus_tag LOCUS_01440 160511 159501 CDS product class C sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390308.1 protein_id gnl|my_center|LOCUS_01440 163268 160833 gene locus_tag LOCUS_01450 163268 160833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 165426 163642 gene locus_tag LOCUS_01460 165426 163642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 166426 165818 gene locus_tag LOCUS_01470 166426 165818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 167635 166616 gene locus_tag LOCUS_01480 167635 166616 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01480 167904 167647 gene locus_tag LOCUS_01490 167904 167647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 168278 167901 gene locus_tag LOCUS_01500 168278 167901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 169007 168465 gene locus_tag LOCUS_01510 169007 168465 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114385.1 protein_id gnl|my_center|LOCUS_01510 170617 169253 gene locus_tag LOCUS_01520 gene secY 170617 169253 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815673.1 protein_id gnl|my_center|LOCUS_01520 171459 170989 gene locus_tag LOCUS_01530 gene rplO 171459 170989 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814543.1 protein_id gnl|my_center|LOCUS_01530 171647 171462 gene locus_tag LOCUS_01540 gene rpmD 171647 171462 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053043.1 protein_id gnl|my_center|LOCUS_01540 172405 171647 gene locus_tag LOCUS_01550 gene rpsE 172405 171647 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815670.1 protein_id gnl|my_center|LOCUS_01550 172773 172402 gene locus_tag LOCUS_01560 gene rplR 172773 172402 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814538.1 protein_id gnl|my_center|LOCUS_01560 173315 172776 gene locus_tag LOCUS_01570 gene rplF 173315 172776 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814536.1 protein_id gnl|my_center|LOCUS_01570 173730 173332 gene locus_tag LOCUS_01580 gene rpsH 173730 173332 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829896.1 protein_id gnl|my_center|LOCUS_01580 174001 173816 gene locus_tag LOCUS_01590 174001 173816 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114370.1 protein_id gnl|my_center|LOCUS_01590 174575 174003 gene locus_tag LOCUS_01600 gene rplE 174575 174003 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814525.1 protein_id gnl|my_center|LOCUS_01600 174907 174572 gene locus_tag LOCUS_01610 gene rplX 174907 174572 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814523.1 protein_id gnl|my_center|LOCUS_01610 175277 174909 gene locus_tag LOCUS_01620 gene rplN 175277 174909 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114366.1 protein_id gnl|my_center|LOCUS_01620 175656 175390 gene locus_tag LOCUS_01630 gene rpsQ 175656 175390 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114365.1 protein_id gnl|my_center|LOCUS_01630 175925 175659 gene locus_tag LOCUS_01640 gene rpmC 175925 175659 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105502.1 protein_id gnl|my_center|LOCUS_01640 176344 175925 gene locus_tag LOCUS_01650 gene rplP 176344 175925 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114362.1 protein_id gnl|my_center|LOCUS_01650 177161 176349 gene locus_tag LOCUS_01660 gene rpsC 177161 176349 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053036.1 protein_id gnl|my_center|LOCUS_01660 177520 177161 gene locus_tag LOCUS_01670 gene rplV 177520 177161 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053035.1 protein_id gnl|my_center|LOCUS_01670 177820 177542 gene locus_tag LOCUS_01680 gene rpsS 177820 177542 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814508.1 protein_id gnl|my_center|LOCUS_01680 178666 177836 gene locus_tag LOCUS_01690 gene rplB 178666 177836 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114355.1 protein_id gnl|my_center|LOCUS_01690 178996 178700 gene locus_tag LOCUS_01700 gene rplW 178996 178700 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053033.1 protein_id gnl|my_center|LOCUS_01700 179691 179002 gene locus_tag LOCUS_01710 gene rplD 179691 179002 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815665.1 protein_id gnl|my_center|LOCUS_01710 180350 179697 gene locus_tag LOCUS_01720 gene rplC 180350 179697 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814493.1 protein_id gnl|my_center|LOCUS_01720 180675 180367 gene locus_tag LOCUS_01730 gene rpsJ 180675 180367 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827292.1 protein_id gnl|my_center|LOCUS_01730 181090 180770 gene locus_tag LOCUS_01740 181090 180770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 184054 181307 gene locus_tag LOCUS_01750 gene adhE 184054 181307 CDS product bifunctional acetaldehyde-CoA/alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068742.1 protein_id gnl|my_center|LOCUS_01750 185142 184651 gene locus_tag LOCUS_01760 gene rpsI 185142 184651 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829868.1 protein_id gnl|my_center|LOCUS_01760 185612 185163 gene locus_tag LOCUS_01770 gene rplM 185612 185163 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053026.1 protein_id gnl|my_center|LOCUS_01770 187911 185827 gene locus_tag LOCUS_01780 gene malQ 187911 185827 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390229.1 protein_id gnl|my_center|LOCUS_01780 189040 188198 gene locus_tag LOCUS_01790 189040 188198 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390230.1 protein_id gnl|my_center|LOCUS_01790 189733 189080 gene locus_tag LOCUS_01800 189733 189080 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053023.1 protein_id gnl|my_center|LOCUS_01800 190663 189743 gene locus_tag LOCUS_01810 190663 189743 CDS product D-2-hydroxyacid dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390126.1 protein_id gnl|my_center|LOCUS_01810 190671 190865 gene locus_tag LOCUS_01820 190671 190865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 191113 190883 gene locus_tag LOCUS_01830 191113 190883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 191066 191701 gene locus_tag LOCUS_01840 191066 191701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 191733 192173 gene locus_tag LOCUS_01850 191733 192173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 193634 192333 gene locus_tag LOCUS_01860 193634 192333 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815644.1 protein_id gnl|my_center|LOCUS_01860 194850 193834 gene locus_tag LOCUS_01870 194850 193834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 195574 194933 gene locus_tag LOCUS_01880 195574 194933 CDS product DUF4391 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389601.1 protein_id gnl|my_center|LOCUS_01880 196012 195925 gene locus_tag LOCUS_t00080 196012 195925 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 196207 197493 gene locus_tag LOCUS_01890 gene dinB 196207 197493 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390232.1 protein_id gnl|my_center|LOCUS_01890 198739 197600 gene locus_tag LOCUS_01900 gene dapC 198739 197600 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390233.1 protein_id gnl|my_center|LOCUS_01900 199199 198873 gene locus_tag LOCUS_01910 199199 198873 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814463.1 protein_id gnl|my_center|LOCUS_01910 200843 199326 gene locus_tag LOCUS_01920 200843 199326 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053015.1 protein_id gnl|my_center|LOCUS_01920 202053 201175 gene locus_tag LOCUS_01930 202053 201175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 203428 202199 gene locus_tag LOCUS_01940 203428 202199 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390234.1 protein_id gnl|my_center|LOCUS_01940 203669 203502 gene locus_tag LOCUS_01950 gene rpmG 203669 203502 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100510685.1 protein_id gnl|my_center|LOCUS_01950 203789 203715 gene locus_tag LOCUS_t00090 203789 203715 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 203865 203793 gene locus_tag LOCUS_t00100 203865 203793 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 203948 203866 gene locus_tag LOCUS_t00110 203948 203866 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 204225 204803 gene locus_tag LOCUS_01960 204225 204803 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405517.1 protein_id gnl|my_center|LOCUS_01960 204924 205625 gene locus_tag LOCUS_01970 204924 205625 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898703.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 206898 205906 gene locus_tag LOCUS_01980 gene nrdF 206898 205906 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390262.1 protein_id gnl|my_center|LOCUS_01980 209263 207077 gene locus_tag LOCUS_01990 gene nrdE 209263 207077 CDS product class 1b ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054636.1 protein_id gnl|my_center|LOCUS_01990 209912 209424 gene locus_tag LOCUS_02000 gene nrdI 209912 209424 CDS product class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783041.1 protein_id gnl|my_center|LOCUS_02000 211285 210188 gene locus_tag LOCUS_02010 gene hisC 211285 210188 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138644.1 protein_id gnl|my_center|LOCUS_02010 211429 211659 gene locus_tag LOCUS_02020 211429 211659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 211669 212895 gene locus_tag LOCUS_02030 211669 212895 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094666698.1 protein_id gnl|my_center|LOCUS_02030 216936 212926 gene locus_tag LOCUS_02040 216936 212926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 218019 216994 gene locus_tag LOCUS_02050 218019 216994 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742066.1 protein_id gnl|my_center|LOCUS_02050 218475 218182 gene locus_tag LOCUS_02060 gene groES 218475 218182 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814450.1 protein_id gnl|my_center|LOCUS_02060 220426 218702 gene locus_tag LOCUS_02070 220426 218702 CDS product glycoside hydrolase family 15 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000676943.1 protein_id gnl|my_center|LOCUS_02070 221892 220714 gene locus_tag LOCUS_02080 221892 220714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814448.1 protein_id gnl|my_center|LOCUS_02080 222826 222164 gene locus_tag LOCUS_02090 222826 222164 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053783.1 protein_id gnl|my_center|LOCUS_02090 223065 223655 gene locus_tag LOCUS_02100 223065 223655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 223751 223948 gene locus_tag LOCUS_02110 223751 223948 CDS product evolved beta-galactosidase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815625.1 protein_id gnl|my_center|LOCUS_02110 224289 224930 gene locus_tag LOCUS_02120 224289 224930 CDS product SAF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057269.1 protein_id gnl|my_center|LOCUS_02120 225053 225580 gene locus_tag LOCUS_02130 gene mscL 225053 225580 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052477.1 protein_id gnl|my_center|LOCUS_02130 225764 225561 gene locus_tag LOCUS_02140 225764 225561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 229417 225761 gene locus_tag LOCUS_02150 229417 225761 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390239.1 protein_id gnl|my_center|LOCUS_02150 231068 229425 gene locus_tag LOCUS_02160 231068 229425 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390240.1 protein_id gnl|my_center|LOCUS_02160 231908 231525 gene locus_tag LOCUS_02170 gene rplL 231908 231525 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053002.1 protein_id gnl|my_center|LOCUS_02170 232539 232018 gene locus_tag LOCUS_02180 gene rplJ 232539 232018 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112001.1 protein_id gnl|my_center|LOCUS_02180 >Feature sequence02 142 2397 gene locus_tag LOCUS_02190 142 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143321.1 protein_id gnl|my_center|LOCUS_02190 3863 2565 gene locus_tag LOCUS_02200 3863 2565 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812582.1 protein_id gnl|my_center|LOCUS_02200 5064 4303 gene locus_tag LOCUS_02210 5064 4303 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053237.1 protein_id gnl|my_center|LOCUS_02210 5229 6011 gene locus_tag LOCUS_02220 5229 6011 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053236.1 protein_id gnl|my_center|LOCUS_02220 7141 6158 gene locus_tag LOCUS_02230 7141 6158 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053235.1 protein_id gnl|my_center|LOCUS_02230 7600 8226 gene locus_tag LOCUS_02240 7600 8226 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389733.1 protein_id gnl|my_center|LOCUS_02240 8238 10748 gene locus_tag LOCUS_02250 8238 10748 CDS product energy-coupling factor transporter ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054001.1 protein_id gnl|my_center|LOCUS_02250 11062 12291 gene locus_tag LOCUS_02260 11062 12291 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165379839.1 protein_id gnl|my_center|LOCUS_02260 12288 13028 gene locus_tag LOCUS_02270 12288 13028 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296462.1 protein_id gnl|my_center|LOCUS_02270 14126 13203 gene locus_tag LOCUS_02280 14126 13203 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729575.1 protein_id gnl|my_center|LOCUS_02280 14561 15850 gene locus_tag LOCUS_02290 gene efmA 14561 15850 CDS product multidrug efflux MFS transporter EfmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002291207.1 protein_id gnl|my_center|LOCUS_02290 18675 16078 gene locus_tag LOCUS_02300 18675 16078 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067907.1 protein_id gnl|my_center|LOCUS_02300 18815 19846 gene locus_tag LOCUS_02310 18815 19846 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053195.1 protein_id gnl|my_center|LOCUS_02310 21061 19874 gene locus_tag LOCUS_02320 21061 19874 CDS product DUF3027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389721.1 protein_id gnl|my_center|LOCUS_02320 21498 21109 gene locus_tag LOCUS_02330 21498 21109 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812533.1 protein_id gnl|my_center|LOCUS_02330 23857 21635 gene locus_tag LOCUS_02340 23857 21635 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055645.1 protein_id gnl|my_center|LOCUS_02340 24600 23854 gene locus_tag LOCUS_02350 24600 23854 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053191.1 protein_id gnl|my_center|LOCUS_02350 25939 24842 gene locus_tag LOCUS_02360 25939 24842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 26126 26416 gene locus_tag LOCUS_02370 26126 26416 CDS product WXG100 family type VII secretion target inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812525.1 protein_id gnl|my_center|LOCUS_02370 28123 26507 gene locus_tag LOCUS_02380 gene groL 28123 26507 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812522.1 protein_id gnl|my_center|LOCUS_02380 28452 28667 gene locus_tag LOCUS_02390 28452 28667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 28660 29964 gene locus_tag LOCUS_02400 28660 29964 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188815.1 protein_id gnl|my_center|LOCUS_02400 30283 30080 gene locus_tag LOCUS_02410 30283 30080 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816407.1 protein_id gnl|my_center|LOCUS_02410 30662 30396 gene locus_tag LOCUS_02420 30662 30396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 30643 30951 gene locus_tag LOCUS_02430 30643 30951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 31208 31921 gene locus_tag LOCUS_02440 31208 31921 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389717.1 protein_id gnl|my_center|LOCUS_02440 32153 33226 gene locus_tag LOCUS_02450 32153 33226 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053183.1 protein_id gnl|my_center|LOCUS_02450 33223 34212 gene locus_tag LOCUS_02460 33223 34212 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053182.1 protein_id gnl|my_center|LOCUS_02460 34205 34732 gene locus_tag LOCUS_02470 34205 34732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389714.1 protein_id gnl|my_center|LOCUS_02470 34741 35823 gene locus_tag LOCUS_02480 34741 35823 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812506.1 protein_id gnl|my_center|LOCUS_02480 35820 36851 gene locus_tag LOCUS_02490 35820 36851 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782716.1 protein_id gnl|my_center|LOCUS_02490 36848 37474 gene locus_tag LOCUS_02500 36848 37474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 37709 37912 gene locus_tag LOCUS_02510 37709 37912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 37912 39441 gene locus_tag LOCUS_02520 37912 39441 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782718.1 protein_id gnl|my_center|LOCUS_02520 39493 40977 gene locus_tag LOCUS_02530 gene purB 39493 40977 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816427.1 protein_id gnl|my_center|LOCUS_02530 41172 43595 gene locus_tag LOCUS_02540 41172 43595 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389709.1 protein_id gnl|my_center|LOCUS_02540 43993 44274 gene locus_tag LOCUS_02550 43993 44274 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112617.1 protein_id gnl|my_center|LOCUS_02550 45842 44340 gene locus_tag LOCUS_02560 gene pafA 45842 44340 CDS product Pup--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389708.1 protein_id gnl|my_center|LOCUS_02560 46027 45842 gene locus_tag LOCUS_02570 46027 45842 CDS product ubiquitin-like protein Pup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812488.1 protein_id gnl|my_center|LOCUS_02570 46875 46048 gene locus_tag LOCUS_02580 46875 46048 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812487.1 protein_id gnl|my_center|LOCUS_02580 48633 46912 gene locus_tag LOCUS_02590 gene dop 48633 46912 CDS product depupylase/deamidase Dop inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068844.1 protein_id gnl|my_center|LOCUS_02590 50330 48630 gene locus_tag LOCUS_02600 gene arc 50330 48630 CDS product proteasome ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389705.1 protein_id gnl|my_center|LOCUS_02600 51153 50305 gene locus_tag LOCUS_02610 51153 50305 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057155.1 protein_id gnl|my_center|LOCUS_02610 51198 51857 gene locus_tag LOCUS_02620 gene serB 51198 51857 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812481.1 protein_id gnl|my_center|LOCUS_02620 52838 51867 gene locus_tag LOCUS_02630 gene fmt 52838 51867 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815830.1 protein_id gnl|my_center|LOCUS_02630 53634 52930 gene locus_tag LOCUS_02640 53634 52930 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812477.1 protein_id gnl|my_center|LOCUS_02640 56112 53872 gene locus_tag LOCUS_02650 56112 53872 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389703.1 protein_id gnl|my_center|LOCUS_02650 57466 56252 gene locus_tag LOCUS_02660 gene metK 57466 56252 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068839.1 protein_id gnl|my_center|LOCUS_02660 57990 57706 gene locus_tag LOCUS_02670 gene rpoZ 57990 57706 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812470.1 protein_id gnl|my_center|LOCUS_02670 58183 60006 gene locus_tag LOCUS_02680 gene ilvD 58183 60006 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389701.1 protein_id gnl|my_center|LOCUS_02680 60301 62328 gene locus_tag LOCUS_02690 gene phoA 60301 62328 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390363.1 protein_id gnl|my_center|LOCUS_02690 63090 62491 gene locus_tag LOCUS_02700 gene gmk 63090 62491 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053267.1 protein_id gnl|my_center|LOCUS_02700 64138 63200 gene locus_tag LOCUS_02710 gene pyrF 64138 63200 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053266.1 protein_id gnl|my_center|LOCUS_02710 67518 64138 gene locus_tag LOCUS_02720 gene carB 67518 64138 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056239.1 protein_id gnl|my_center|LOCUS_02720 68737 67511 gene locus_tag LOCUS_02730 gene carA 68737 67511 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782674.1 protein_id gnl|my_center|LOCUS_02730 69576 68794 gene locus_tag LOCUS_02740 gene nusB 69576 68794 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819348.1 protein_id gnl|my_center|LOCUS_02740 70158 69589 gene locus_tag LOCUS_02750 gene efp 70158 69589 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111770.1 protein_id gnl|my_center|LOCUS_02750 71641 70442 gene locus_tag LOCUS_02760 gene tuf 71641 70442 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112314.1 protein_id gnl|my_center|LOCUS_02760 73976 71850 gene locus_tag LOCUS_02770 gene fusA 73976 71850 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112311.1 protein_id gnl|my_center|LOCUS_02770 74475 74005 gene locus_tag LOCUS_02780 gene rpsG 74475 74005 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813834.1 protein_id gnl|my_center|LOCUS_02780 74850 74479 gene locus_tag LOCUS_02790 gene rpsL 74850 74479 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813881.1 protein_id gnl|my_center|LOCUS_02790 75661 75170 gene locus_tag LOCUS_02800 75661 75170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 76447 75671 gene locus_tag LOCUS_02810 76447 75671 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030055.1 protein_id gnl|my_center|LOCUS_02810 77620 76604 gene locus_tag LOCUS_02820 77620 76604 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_02820 77768 78088 gene locus_tag LOCUS_02830 77768 78088 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059470.1 protein_id gnl|my_center|LOCUS_02830 78845 78258 gene locus_tag LOCUS_02840 78845 78258 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243530.1 protein_id gnl|my_center|LOCUS_02840 78995 79720 gene locus_tag LOCUS_02850 78995 79720 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027927.1 protein_id gnl|my_center|LOCUS_02850 80235 79762 gene locus_tag LOCUS_02860 80235 79762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 81320 80310 gene locus_tag LOCUS_02870 81320 80310 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067971.1 protein_id gnl|my_center|LOCUS_02870 81410 82924 gene locus_tag LOCUS_02880 81410 82924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052115.1 protein_id gnl|my_center|LOCUS_02880 83085 83636 gene locus_tag LOCUS_02890 83085 83636 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390104.1 protein_id gnl|my_center|LOCUS_02890 84345 83665 gene locus_tag LOCUS_02900 84345 83665 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002359998.1 protein_id gnl|my_center|LOCUS_02900 85367 84342 gene locus_tag LOCUS_02910 85367 84342 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296186.1 protein_id gnl|my_center|LOCUS_02910 86339 85524 gene locus_tag LOCUS_02920 86339 85524 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002390147.1 protein_id gnl|my_center|LOCUS_02920 87559 86513 gene locus_tag LOCUS_02930 87559 86513 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016957.1 protein_id gnl|my_center|LOCUS_02930 88792 87776 gene locus_tag LOCUS_02940 88792 87776 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994499.1 protein_id gnl|my_center|LOCUS_02940 90521 89325 gene locus_tag LOCUS_02950 90521 89325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 91675 90638 gene locus_tag LOCUS_02960 91675 90638 CDS product TMEM175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567693.1 protein_id gnl|my_center|LOCUS_02960 92490 92059 gene locus_tag LOCUS_02970 92490 92059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 92815 93234 gene locus_tag LOCUS_02980 92815 93234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 93466 94374 gene locus_tag LOCUS_02990 93466 94374 CDS product DUF805 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068502.1 protein_id gnl|my_center|LOCUS_02990 94616 94786 gene locus_tag LOCUS_03000 94616 94786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 95722 94937 gene locus_tag LOCUS_03010 95722 94937 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027810.1 protein_id gnl|my_center|LOCUS_03010 95925 96623 gene locus_tag LOCUS_03020 95925 96623 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389990.1 protein_id gnl|my_center|LOCUS_03020 97121 96684 gene locus_tag LOCUS_03030 97121 96684 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000571271.1 protein_id gnl|my_center|LOCUS_03030 97098 97262 gene locus_tag LOCUS_03040 97098 97262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 97267 97797 gene locus_tag LOCUS_03050 97267 97797 CDS product DNA topology modulation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002897695.1 protein_id gnl|my_center|LOCUS_03050 98103 98759 gene locus_tag LOCUS_03060 98103 98759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 98832 99266 gene locus_tag LOCUS_03070 98832 99266 CDS product MepB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858809.1 protein_id gnl|my_center|LOCUS_03070 100128 99376 gene locus_tag LOCUS_03080 100128 99376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 100490 100693 gene locus_tag LOCUS_03090 100490 100693 CDS product DUF4177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525227.1 protein_id gnl|my_center|LOCUS_03090 100888 101160 gene locus_tag LOCUS_03100 100888 101160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 102153 101422 gene locus_tag LOCUS_03110 102153 101422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 102828 102753 gene locus_tag LOCUS_t00120 102828 102753 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 103026 104408 gene locus_tag LOCUS_03120 103026 104408 CDS product alpha-amylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057983.1 protein_id gnl|my_center|LOCUS_03120 104565 105590 gene locus_tag LOCUS_03130 104565 105590 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000902186.1 protein_id gnl|my_center|LOCUS_03130 106847 105675 gene locus_tag LOCUS_03140 106847 105675 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390044.1 protein_id gnl|my_center|LOCUS_03140 107061 108395 gene locus_tag LOCUS_03150 gene purT 107061 108395 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390100.1 protein_id gnl|my_center|LOCUS_03150 108494 109279 gene locus_tag LOCUS_03160 108494 109279 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994280.1 protein_id gnl|my_center|LOCUS_03160 109336 113067 gene locus_tag LOCUS_03170 109336 113067 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068298.1 protein_id gnl|my_center|LOCUS_03170 113161 114675 gene locus_tag LOCUS_03180 gene purF 113161 114675 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051228.1 protein_id gnl|my_center|LOCUS_03180 114751 115791 gene locus_tag LOCUS_03190 gene purM 114751 115791 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081095.1 protein_id gnl|my_center|LOCUS_03190 115858 117129 gene locus_tag LOCUS_03200 gene purD 115858 117129 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813917.1 protein_id gnl|my_center|LOCUS_03200 117404 118495 gene locus_tag LOCUS_03210 117404 118495 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113976.1 protein_id gnl|my_center|LOCUS_03210 118495 119307 gene locus_tag LOCUS_03220 118495 119307 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813940.1 protein_id gnl|my_center|LOCUS_03220 121744 119480 gene locus_tag LOCUS_03230 121744 119480 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014760479.1 protein_id gnl|my_center|LOCUS_03230 122900 122028 gene locus_tag LOCUS_03240 122900 122028 CDS product metal ABC transporter solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390109.1 protein_id gnl|my_center|LOCUS_03240 122794 122994 gene locus_tag LOCUS_03250 122794 122994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 124734 123199 gene locus_tag LOCUS_03260 124734 123199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 124785 125024 gene locus_tag LOCUS_03270 124785 125024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 125126 125296 gene locus_tag LOCUS_03280 gene rpmG 125126 125296 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003858439.1 protein_id gnl|my_center|LOCUS_03280 125313 125618 gene locus_tag LOCUS_03290 gene rpsN 125313 125618 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813933.1 protein_id gnl|my_center|LOCUS_03290 125666 125950 gene locus_tag LOCUS_03300 125666 125950 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390112.1 protein_id gnl|my_center|LOCUS_03300 126069 126236 gene locus_tag LOCUS_03310 gene rpmF 126069 126236 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390113.1 protein_id gnl|my_center|LOCUS_03310 126671 128032 gene locus_tag LOCUS_03320 126671 128032 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390107.1 protein_id gnl|my_center|LOCUS_03320 128153 130729 gene locus_tag LOCUS_03330 128153 130729 CDS product DUF2156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390108.1 protein_id gnl|my_center|LOCUS_03330 131374 130982 gene locus_tag LOCUS_03340 131374 130982 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051236.1 protein_id gnl|my_center|LOCUS_03340 132563 131433 gene locus_tag LOCUS_03350 gene purK 132563 131433 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051237.1 protein_id gnl|my_center|LOCUS_03350 133125 132586 gene locus_tag LOCUS_03360 gene purE 133125 132586 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813948.1 protein_id gnl|my_center|LOCUS_03360 133474 133548 gene locus_tag LOCUS_t00130 133474 133548 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 136002 134956 gene locus_tag LOCUS_03370 gene nrdF 136002 134956 CDS product class 1b ribonucleoside-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114270.1 protein_id gnl|my_center|LOCUS_03370 136299 136847 gene locus_tag LOCUS_03380 136299 136847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 138974 136986 gene locus_tag LOCUS_03390 138974 136986 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068542.1 protein_id gnl|my_center|LOCUS_03390 141339 139273 gene locus_tag LOCUS_03400 gene dnaG 141339 139273 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817922.1 protein_id gnl|my_center|LOCUS_03400 143190 141895 gene locus_tag LOCUS_03410 143190 141895 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740616.1 protein_id gnl|my_center|LOCUS_03410 144727 143309 gene locus_tag LOCUS_03420 144727 143309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112416.1 protein_id gnl|my_center|LOCUS_03420 145882 144914 gene locus_tag LOCUS_03430 145882 144914 CDS product nucleoside hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112414.1 protein_id gnl|my_center|LOCUS_03430 150358 146132 gene locus_tag LOCUS_03440 150358 146132 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390329.1 protein_id gnl|my_center|LOCUS_03440 151202 150738 gene locus_tag LOCUS_03450 151202 150738 CDS product organic hydroperoxide resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976410.1 protein_id gnl|my_center|LOCUS_03450 152729 151371 gene locus_tag LOCUS_03460 gene alr 152729 151371 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068317.1 protein_id gnl|my_center|LOCUS_03460 153744 152995 gene locus_tag LOCUS_03470 153744 152995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 154587 154108 gene locus_tag LOCUS_03480 154587 154108 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390122.1 protein_id gnl|my_center|LOCUS_03480 156848 154914 gene locus_tag LOCUS_03490 156848 154914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 156964 157239 gene locus_tag LOCUS_03500 156964 157239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 159358 157262 gene locus_tag LOCUS_03510 159358 157262 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390123.1 protein_id gnl|my_center|LOCUS_03510 160698 159523 gene locus_tag LOCUS_03520 160698 159523 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390124.1 protein_id gnl|my_center|LOCUS_03520 161929 160916 gene locus_tag LOCUS_03530 161929 160916 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363729.1 protein_id gnl|my_center|LOCUS_03530 163373 162477 gene locus_tag LOCUS_03540 163373 162477 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021647864.1 protein_id gnl|my_center|LOCUS_03540 164187 163363 gene locus_tag LOCUS_03550 164187 163363 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068323.1 protein_id gnl|my_center|LOCUS_03550 165152 164184 gene locus_tag LOCUS_03560 165152 164184 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143524.1 protein_id gnl|my_center|LOCUS_03560 166120 165149 gene locus_tag LOCUS_03570 166120 165149 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814940.1 protein_id gnl|my_center|LOCUS_03570 167886 166186 gene locus_tag LOCUS_03580 167886 166186 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390129.1 protein_id gnl|my_center|LOCUS_03580 168185 168955 gene locus_tag LOCUS_03590 168185 168955 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783138.1 protein_id gnl|my_center|LOCUS_03590 169169 173281 gene locus_tag LOCUS_03600 169169 173281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 175348 174002 gene locus_tag LOCUS_03610 175348 174002 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068327.1 protein_id gnl|my_center|LOCUS_03610 175536 177182 gene locus_tag LOCUS_03620 175536 177182 CDS product alpha-L-arabinofuranosidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068328.1 protein_id gnl|my_center|LOCUS_03620 179378 177297 gene locus_tag LOCUS_03630 179378 177297 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390132.1 protein_id gnl|my_center|LOCUS_03630 180573 179542 gene locus_tag LOCUS_03640 180573 179542 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032738944.1 protein_id gnl|my_center|LOCUS_03640 181496 180570 gene locus_tag LOCUS_03650 181496 180570 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051281.1 protein_id gnl|my_center|LOCUS_03650 181677 182699 gene locus_tag LOCUS_03660 181677 182699 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814924.1 protein_id gnl|my_center|LOCUS_03660 183624 182800 gene locus_tag LOCUS_03670 183624 182800 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389633.1 protein_id gnl|my_center|LOCUS_03670 185661 183835 gene locus_tag LOCUS_03680 gene glmS 185661 183835 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051287.1 protein_id gnl|my_center|LOCUS_03680 186614 185805 gene locus_tag LOCUS_03690 186614 185805 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051288.1 protein_id gnl|my_center|LOCUS_03690 187588 186611 gene locus_tag LOCUS_03700 187588 186611 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053710.1 protein_id gnl|my_center|LOCUS_03700 188733 187759 gene locus_tag LOCUS_03710 188733 187759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025221252.1 protein_id gnl|my_center|LOCUS_03710 189465 188983 gene locus_tag LOCUS_03720 gene smpB 189465 188983 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812219.1 protein_id gnl|my_center|LOCUS_03720 191334 189883 gene locus_tag LOCUS_03730 191334 189883 CDS product CHAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389632.1 protein_id gnl|my_center|LOCUS_03730 192367 191444 gene locus_tag LOCUS_03740 gene ftsX 192367 191444 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812215.1 protein_id gnl|my_center|LOCUS_03740 193671 192367 gene locus_tag LOCUS_03750 gene ftsE 193671 192367 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389631.1 protein_id gnl|my_center|LOCUS_03750 194789 193680 gene locus_tag LOCUS_03760 gene prfB 194789 193680 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812212.1 protein_id gnl|my_center|LOCUS_03760 195205 195029 gene locus_tag LOCUS_03770 195205 195029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 195258 196232 gene locus_tag LOCUS_03780 gene dapD 195258 196232 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052463.1 protein_id gnl|my_center|LOCUS_03780 197691 196402 gene locus_tag LOCUS_03790 197691 196402 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053894.1 protein_id gnl|my_center|LOCUS_03790 198698 197919 gene locus_tag LOCUS_03800 gene map 198698 197919 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004132877.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence03 1641 70 gene locus_tag LOCUS_03810 1641 70 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930192.1 protein_id gnl|my_center|LOCUS_03810 1926 2897 gene locus_tag LOCUS_03820 gene rsmI 1926 2897 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390356.1 protein_id gnl|my_center|LOCUS_03820 3149 3385 gene locus_tag LOCUS_03830 3149 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3896 3393 gene locus_tag LOCUS_03840 3896 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4283 6166 gene locus_tag LOCUS_03850 gene metG 4283 6166 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390353.1 protein_id gnl|my_center|LOCUS_03850 6748 8664 gene locus_tag LOCUS_03860 6748 8664 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582988.1 protein_id gnl|my_center|LOCUS_03860 8668 10554 gene locus_tag LOCUS_03870 8668 10554 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052919.1 protein_id gnl|my_center|LOCUS_03870 10622 11578 gene locus_tag LOCUS_03880 10622 11578 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068671.1 protein_id gnl|my_center|LOCUS_03880 11808 14354 gene locus_tag LOCUS_03890 11808 14354 CDS product KUP/HAK/KT family potassium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816051.1 protein_id gnl|my_center|LOCUS_03890 14421 15290 gene locus_tag LOCUS_03900 14421 15290 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058535.1 protein_id gnl|my_center|LOCUS_03900 15412 16881 gene locus_tag LOCUS_03910 gene gndA 15412 16881 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399773.1 protein_id gnl|my_center|LOCUS_03910 17265 17053 gene locus_tag LOCUS_03920 17265 17053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 18217 17423 gene locus_tag LOCUS_03930 gene pgl 18217 17423 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143563.1 protein_id gnl|my_center|LOCUS_03930 19248 18322 gene locus_tag LOCUS_03940 19248 18322 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818892.1 protein_id gnl|my_center|LOCUS_03940 20834 19245 gene locus_tag LOCUS_03950 gene zwf 20834 19245 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817686.1 protein_id gnl|my_center|LOCUS_03950 20977 21672 gene locus_tag LOCUS_03960 20977 21672 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052900.1 protein_id gnl|my_center|LOCUS_03960 22435 21800 gene locus_tag LOCUS_03970 22435 21800 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434707.1 protein_id gnl|my_center|LOCUS_03970 23633 22647 gene locus_tag LOCUS_03980 23633 22647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 24041 25303 gene locus_tag LOCUS_03990 24041 25303 CDS product LLM class flavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223202.1 protein_id gnl|my_center|LOCUS_03990 25323 26048 gene locus_tag LOCUS_04000 25323 26048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 27483 26059 gene locus_tag LOCUS_04010 27483 26059 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011673958.1 protein_id gnl|my_center|LOCUS_04010 28155 27667 gene locus_tag LOCUS_04020 28155 27667 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258443.1 protein_id gnl|my_center|LOCUS_04020 29597 28206 gene locus_tag LOCUS_04030 29597 28206 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369213.1 protein_id gnl|my_center|LOCUS_04030 29842 30543 gene locus_tag LOCUS_04040 29842 30543 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777093.1 protein_id gnl|my_center|LOCUS_04040 31630 30710 gene locus_tag LOCUS_04050 31630 30710 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836351.1 protein_id gnl|my_center|LOCUS_04050 33192 31774 gene locus_tag LOCUS_04060 33192 31774 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390347.1 protein_id gnl|my_center|LOCUS_04060 34511 33189 gene locus_tag LOCUS_04070 34511 33189 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068675.1 protein_id gnl|my_center|LOCUS_04070 36412 34892 gene locus_tag LOCUS_04080 36412 34892 CDS product PTS ascorbate transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389335.1 protein_id gnl|my_center|LOCUS_04080 36782 36510 gene locus_tag LOCUS_04090 36782 36510 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817396.1 protein_id gnl|my_center|LOCUS_04090 37274 36825 gene locus_tag LOCUS_04100 37274 36825 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817398.1 protein_id gnl|my_center|LOCUS_04100 38990 37341 gene locus_tag LOCUS_04110 gene ptsP 38990 37341 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814167.1 protein_id gnl|my_center|LOCUS_04110 39227 39496 gene locus_tag LOCUS_04120 39227 39496 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814166.1 protein_id gnl|my_center|LOCUS_04120 39567 40604 gene locus_tag LOCUS_04130 39567 40604 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814163.1 protein_id gnl|my_center|LOCUS_04130 40671 41183 gene locus_tag LOCUS_04140 40671 41183 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369322.1 protein_id gnl|my_center|LOCUS_04140 42327 41299 gene locus_tag LOCUS_04150 42327 41299 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730353.1 protein_id gnl|my_center|LOCUS_04150 42884 42465 gene locus_tag LOCUS_04160 42884 42465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 43114 43542 gene locus_tag LOCUS_04170 43114 43542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 45247 43616 gene locus_tag LOCUS_04180 45247 43616 CDS product assimilatory sulfite reductase (NADPH) flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980903.1 protein_id gnl|my_center|LOCUS_04180 45442 45984 gene locus_tag LOCUS_04190 45442 45984 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057098.1 protein_id gnl|my_center|LOCUS_04190 46225 46428 gene locus_tag LOCUS_04200 46225 46428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 46783 48057 gene locus_tag LOCUS_04210 46783 48057 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775349.1 protein_id gnl|my_center|LOCUS_04210 48079 49713 gene locus_tag LOCUS_04220 48079 49713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04220 49732 50394 gene locus_tag LOCUS_04230 49732 50394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 51990 51571 gene locus_tag LOCUS_04240 51990 51571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 52117 52395 gene locus_tag LOCUS_04250 52117 52395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 52429 52656 gene locus_tag LOCUS_04260 52429 52656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 53029 54231 gene locus_tag LOCUS_04270 53029 54231 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 protein_id gnl|my_center|LOCUS_04270 54374 56458 gene locus_tag LOCUS_04280 54374 56458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 56731 56646 gene locus_tag LOCUS_t00140 56731 56646 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 57955 56870 gene locus_tag LOCUS_04290 57955 56870 CDS product glycerol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083283.1 protein_id gnl|my_center|LOCUS_04290 58440 63659 gene locus_tag LOCUS_04300 58440 63659 CDS product lamin tail domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053545967.1 protein_id gnl|my_center|LOCUS_04300 63932 65176 gene locus_tag LOCUS_04310 63932 65176 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204864755.1 protein_id gnl|my_center|LOCUS_04310 65847 65314 gene locus_tag LOCUS_04320 65847 65314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 66125 68326 gene locus_tag LOCUS_04330 66125 68326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 68592 69620 gene locus_tag LOCUS_04340 68592 69620 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389365.1 protein_id gnl|my_center|LOCUS_04340 69764 70792 gene locus_tag LOCUS_04350 gene rfbB 69764 70792 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003836804.1 protein_id gnl|my_center|LOCUS_04350 70886 72322 gene locus_tag LOCUS_04360 70886 72322 CDS product sugar nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068371.1 protein_id gnl|my_center|LOCUS_04360 74064 74954 gene locus_tag LOCUS_04370 gene rfbA 74064 74954 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389370.1 protein_id gnl|my_center|LOCUS_04370 74966 78127 gene locus_tag LOCUS_04380 74966 78127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 78204 79043 gene locus_tag LOCUS_04390 78204 79043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025301480.1 protein_id gnl|my_center|LOCUS_04390 79043 80287 gene locus_tag LOCUS_04400 79043 80287 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068683.1 protein_id gnl|my_center|LOCUS_04400 80431 80727 gene locus_tag LOCUS_04410 gene rpsF 80431 80727 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886572.1 protein_id gnl|my_center|LOCUS_04410 80800 81405 gene locus_tag LOCUS_04420 80800 81405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 81494 81742 gene locus_tag LOCUS_04430 gene rpsR 81494 81742 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105399.1 protein_id gnl|my_center|LOCUS_04430 81757 82206 gene locus_tag LOCUS_04440 gene rplI 81757 82206 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117309.1 protein_id gnl|my_center|LOCUS_04440 82780 82433 gene locus_tag LOCUS_04450 82780 82433 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811601.1 protein_id gnl|my_center|LOCUS_04450 83448 82930 gene locus_tag LOCUS_04460 83448 82930 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114300.1 protein_id gnl|my_center|LOCUS_04460 84876 83551 gene locus_tag LOCUS_04470 84876 83551 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811607.1 protein_id gnl|my_center|LOCUS_04470 85221 85880 gene locus_tag LOCUS_04480 85221 85880 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389452.1 protein_id gnl|my_center|LOCUS_04480 86011 86898 gene locus_tag LOCUS_04490 86011 86898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068504.1 protein_id gnl|my_center|LOCUS_04490 87807 86989 gene locus_tag LOCUS_04500 87807 86989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 88676 87993 gene locus_tag LOCUS_04510 88676 87993 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389454.1 protein_id gnl|my_center|LOCUS_04510 89877 88792 gene locus_tag LOCUS_04520 89877 88792 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389455.1 protein_id gnl|my_center|LOCUS_04520 90162 90896 gene locus_tag LOCUS_04530 90162 90896 CDS product YoaK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819623.1 protein_id gnl|my_center|LOCUS_04530 92284 92087 gene locus_tag LOCUS_04540 92284 92087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 93402 93629 gene locus_tag LOCUS_04550 93402 93629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 94177 95031 gene locus_tag LOCUS_04560 94177 95031 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390345.1 protein_id gnl|my_center|LOCUS_04560 95401 97815 gene locus_tag LOCUS_04570 gene nrdD 95401 97815 CDS product anaerobic ribonucleoside-triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112200.1 protein_id gnl|my_center|LOCUS_04570 97837 98553 gene locus_tag LOCUS_04580 gene nrdG 97837 98553 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389607.1 protein_id gnl|my_center|LOCUS_04580 100012 98882 gene locus_tag LOCUS_04590 100012 98882 CDS product low temperature requirement protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079771.1 protein_id gnl|my_center|LOCUS_04590 100127 101803 gene locus_tag LOCUS_04600 gene gltX 100127 101803 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051591.1 protein_id gnl|my_center|LOCUS_04600 101868 101941 gene locus_tag LOCUS_t00150 101868 101941 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 101985 102059 gene locus_tag LOCUS_t00160 101985 102059 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 102371 103144 gene locus_tag LOCUS_04610 102371 103144 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054642.1 protein_id gnl|my_center|LOCUS_04610 103403 103786 gene locus_tag LOCUS_04620 103403 103786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 104580 103840 gene locus_tag LOCUS_04630 104580 103840 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227194.1 protein_id gnl|my_center|LOCUS_04630 105117 104893 gene locus_tag LOCUS_04640 105117 104893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 106221 105283 gene locus_tag LOCUS_04650 106221 105283 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390031.1 protein_id gnl|my_center|LOCUS_04650 106309 107418 gene locus_tag LOCUS_04660 106309 107418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 107582 108325 gene locus_tag LOCUS_04670 107582 108325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 108501 108376 gene locus_tag LOCUS_04680 108501 108376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 108681 108920 gene locus_tag LOCUS_04690 108681 108920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 109082 108873 gene locus_tag LOCUS_04700 109082 108873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 109893 109120 gene locus_tag LOCUS_04710 109893 109120 CDS product (S)-acetoin forming diacetyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905614.1 protein_id gnl|my_center|LOCUS_04710 110119 111591 gene locus_tag LOCUS_04720 110119 111591 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389459.1 protein_id gnl|my_center|LOCUS_04720 112473 111634 gene locus_tag LOCUS_04730 112473 111634 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081262.1 protein_id gnl|my_center|LOCUS_04730 112605 114008 gene locus_tag LOCUS_04740 gene leuC 112605 114008 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811629.1 protein_id gnl|my_center|LOCUS_04740 114122 114808 gene locus_tag LOCUS_04750 gene leuD 114122 114808 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817545.1 protein_id gnl|my_center|LOCUS_04750 115074 116231 gene locus_tag LOCUS_04760 115074 116231 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068709.1 protein_id gnl|my_center|LOCUS_04760 116375 117706 gene locus_tag LOCUS_04770 gene murA 116375 117706 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811644.1 protein_id gnl|my_center|LOCUS_04770 117978 118808 gene locus_tag LOCUS_04780 117978 118808 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081634.1 protein_id gnl|my_center|LOCUS_04780 118930 119925 gene locus_tag LOCUS_04790 118930 119925 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811732.1 protein_id gnl|my_center|LOCUS_04790 120133 121329 gene locus_tag LOCUS_04800 120133 121329 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055652.1 protein_id gnl|my_center|LOCUS_04800 121812 122969 gene locus_tag LOCUS_04810 121812 122969 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051466.1 protein_id gnl|my_center|LOCUS_04810 123079 122897 gene locus_tag LOCUS_04820 123079 122897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 123078 123890 gene locus_tag LOCUS_04830 123078 123890 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068438.1 protein_id gnl|my_center|LOCUS_04830 123980 124807 gene locus_tag LOCUS_04840 123980 124807 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782830.1 protein_id gnl|my_center|LOCUS_04840 124811 126106 gene locus_tag LOCUS_04850 124811 126106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068437.1 protein_id gnl|my_center|LOCUS_04850 127579 126302 gene locus_tag LOCUS_04860 127579 126302 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389794.1 protein_id gnl|my_center|LOCUS_04860 128810 127566 gene locus_tag LOCUS_04870 128810 127566 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068186.1 protein_id gnl|my_center|LOCUS_04870 129899 128853 gene locus_tag LOCUS_04880 129899 128853 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057287.1 protein_id gnl|my_center|LOCUS_04880 130081 131424 gene locus_tag LOCUS_04890 130081 131424 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389791.1 protein_id gnl|my_center|LOCUS_04890 131448 132095 gene locus_tag LOCUS_04900 131448 132095 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052109.1 protein_id gnl|my_center|LOCUS_04900 133034 132246 gene locus_tag LOCUS_04910 133034 132246 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010081708.1 protein_id gnl|my_center|LOCUS_04910 134459 133176 gene locus_tag LOCUS_04920 134459 133176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 135466 134453 gene locus_tag LOCUS_04930 135466 134453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 136020 135466 gene locus_tag LOCUS_04940 136020 135466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 137275 136244 gene locus_tag LOCUS_04950 137275 136244 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161270038.1 protein_id gnl|my_center|LOCUS_04950 138754 137357 gene locus_tag LOCUS_04960 138754 137357 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068433.1 protein_id gnl|my_center|LOCUS_04960 139145 140245 gene locus_tag LOCUS_04970 139145 140245 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811813.1 protein_id gnl|my_center|LOCUS_04970 140399 140593 gene locus_tag LOCUS_04980 gene rpmB 140399 140593 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105392.1 protein_id gnl|my_center|LOCUS_04980 140951 143314 gene locus_tag LOCUS_04990 140951 143314 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994858.1 protein_id gnl|my_center|LOCUS_04990 143393 143995 gene locus_tag LOCUS_05000 143393 143995 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811847.1 protein_id gnl|my_center|LOCUS_05000 144213 144824 gene locus_tag LOCUS_05010 144213 144824 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389535.1 protein_id gnl|my_center|LOCUS_05010 145904 145062 gene locus_tag LOCUS_05020 gene trmD 145904 145062 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054789.1 protein_id gnl|my_center|LOCUS_05020 146680 146087 gene locus_tag LOCUS_05030 gene rimM 146680 146087 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389537.1 protein_id gnl|my_center|LOCUS_05030 146923 146690 gene locus_tag LOCUS_05040 146923 146690 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811858.1 protein_id gnl|my_center|LOCUS_05040 147398 146925 gene locus_tag LOCUS_05050 gene rpsP 147398 146925 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054806.1 protein_id gnl|my_center|LOCUS_05050 150983 147777 gene locus_tag LOCUS_05060 150983 147777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 152276 151197 gene locus_tag LOCUS_05070 152276 151197 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994865.1 protein_id gnl|my_center|LOCUS_05070 153901 152285 gene locus_tag LOCUS_05080 gene ffh 153901 152285 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389541.1 protein_id gnl|my_center|LOCUS_05080 154344 156191 gene locus_tag LOCUS_05090 gene spxB 154344 156191 CDS product pyruvate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646223.1 protein_id gnl|my_center|LOCUS_05090 157949 156408 gene locus_tag LOCUS_05100 gene cysS 157949 156408 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389542.1 protein_id gnl|my_center|LOCUS_05100 158109 158840 gene locus_tag LOCUS_05110 158109 158840 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811881.1 protein_id gnl|my_center|LOCUS_05110 158934 160967 gene locus_tag LOCUS_05120 158934 160967 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811882.1 protein_id gnl|my_center|LOCUS_05120 161717 161163 gene locus_tag LOCUS_05130 gene ilvN 161717 161163 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054813.1 protein_id gnl|my_center|LOCUS_05130 163660 161735 gene locus_tag LOCUS_05140 163660 161735 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054814.1 protein_id gnl|my_center|LOCUS_05140 164646 163861 gene locus_tag LOCUS_05150 gene rnc 164646 163861 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811893.1 protein_id gnl|my_center|LOCUS_05150 164978 164784 gene locus_tag LOCUS_05160 gene rpmF 164978 164784 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811892.1 protein_id gnl|my_center|LOCUS_05160 165797 165192 gene locus_tag LOCUS_05170 165797 165192 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811890.1 protein_id gnl|my_center|LOCUS_05170 166580 165819 gene locus_tag LOCUS_05180 166580 165819 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057854.1 protein_id gnl|my_center|LOCUS_05180 167074 166577 gene locus_tag LOCUS_05190 gene coaD 167074 166577 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389543.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence04 186 1079 gene locus_tag LOCUS_05200 gene pdxS 186 1079 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815352.1 protein_id gnl|my_center|LOCUS_05200 1076 1684 gene locus_tag LOCUS_05210 gene pdxT 1076 1684 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000689963.1 protein_id gnl|my_center|LOCUS_05210 2496 1759 gene locus_tag LOCUS_05220 2496 1759 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389580.1 protein_id gnl|my_center|LOCUS_05220 2552 3535 gene locus_tag LOCUS_05230 2552 3535 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812023.1 protein_id gnl|my_center|LOCUS_05230 3586 4197 gene locus_tag LOCUS_05240 3586 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057770.1 protein_id gnl|my_center|LOCUS_05240 4510 8076 gene locus_tag LOCUS_05250 gene rpoB 4510 8076 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399741.1 protein_id gnl|my_center|LOCUS_05250 8176 12216 gene locus_tag LOCUS_05260 8176 12216 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399740.1 protein_id gnl|my_center|LOCUS_05260 13029 14801 gene locus_tag LOCUS_05270 13029 14801 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143234.1 protein_id gnl|my_center|LOCUS_05270 14849 16240 gene locus_tag LOCUS_05280 14849 16240 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389555.1 protein_id gnl|my_center|LOCUS_05280 16573 17076 gene locus_tag LOCUS_05290 16573 17076 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234318.1 protein_id gnl|my_center|LOCUS_05290 17073 18710 gene locus_tag LOCUS_05300 17073 18710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 21391 18791 gene locus_tag LOCUS_05310 21391 18791 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399334.1 protein_id gnl|my_center|LOCUS_05310 22104 21403 gene locus_tag LOCUS_05320 22104 21403 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_05320 22257 22958 gene locus_tag LOCUS_05330 22257 22958 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094667284.1 protein_id gnl|my_center|LOCUS_05330 23740 23006 gene locus_tag LOCUS_05340 23740 23006 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031779.1 protein_id gnl|my_center|LOCUS_05340 23791 24498 gene locus_tag LOCUS_05350 23791 24498 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020640423.1 protein_id gnl|my_center|LOCUS_05350 24749 26209 gene locus_tag LOCUS_05360 24749 26209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05360 26243 26611 gene locus_tag LOCUS_05370 26243 26611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05370 26611 28311 gene locus_tag LOCUS_05380 26611 28311 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031834.1 protein_id gnl|my_center|LOCUS_05380 28442 29746 gene locus_tag LOCUS_05390 28442 29746 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224282.1 protein_id gnl|my_center|LOCUS_05390 29987 29793 gene locus_tag LOCUS_05400 29987 29793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 31223 30039 gene locus_tag LOCUS_05410 31223 30039 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002351560.1 protein_id gnl|my_center|LOCUS_05410 31643 36217 gene locus_tag LOCUS_05420 31643 36217 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389589.1 protein_id gnl|my_center|LOCUS_05420 36214 40254 gene locus_tag LOCUS_05430 36214 40254 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068346.1 protein_id gnl|my_center|LOCUS_05430 40534 41241 gene locus_tag LOCUS_05440 40534 41241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 41401 42147 gene locus_tag LOCUS_05450 gene dapB 41401 42147 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816186.1 protein_id gnl|my_center|LOCUS_05450 42223 43128 gene locus_tag LOCUS_05460 gene dapA 42223 43128 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053723.1 protein_id gnl|my_center|LOCUS_05460 43358 45052 gene locus_tag LOCUS_05470 43358 45052 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812067.1 protein_id gnl|my_center|LOCUS_05470 45351 47969 gene locus_tag LOCUS_05480 gene pepN 45351 47969 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068343.1 protein_id gnl|my_center|LOCUS_05480 48257 49567 gene locus_tag LOCUS_05490 gene glmM 48257 49567 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812074.1 protein_id gnl|my_center|LOCUS_05490 49584 50279 gene locus_tag LOCUS_05500 49584 50279 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816189.1 protein_id gnl|my_center|LOCUS_05500 50354 51319 gene locus_tag LOCUS_05510 50354 51319 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052472.1 protein_id gnl|my_center|LOCUS_05510 51492 52817 gene locus_tag LOCUS_05520 51492 52817 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112315.1 protein_id gnl|my_center|LOCUS_05520 52880 53674 gene locus_tag LOCUS_05530 52880 53674 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975536.1 protein_id gnl|my_center|LOCUS_05530 54414 53776 gene locus_tag LOCUS_05540 54414 53776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 54748 56160 gene locus_tag LOCUS_05550 54748 56160 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030268.1 protein_id gnl|my_center|LOCUS_05550 57530 56253 gene locus_tag LOCUS_05560 57530 56253 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593047.1 protein_id gnl|my_center|LOCUS_05560 57671 58075 gene locus_tag LOCUS_05570 57671 58075 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887754.1 protein_id gnl|my_center|LOCUS_05570 58276 58803 gene locus_tag LOCUS_05580 58276 58803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 59023 59664 gene locus_tag LOCUS_05590 59023 59664 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762312.1 protein_id gnl|my_center|LOCUS_05590 59759 60406 gene locus_tag LOCUS_05600 59759 60406 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052445.1 protein_id gnl|my_center|LOCUS_05600 60860 60513 gene locus_tag LOCUS_05610 60860 60513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 61386 60964 gene locus_tag LOCUS_05620 61386 60964 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085007.1 protein_id gnl|my_center|LOCUS_05620 62572 61538 gene locus_tag LOCUS_05630 62572 61538 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389605.1 protein_id gnl|my_center|LOCUS_05630 62846 62919 gene locus_tag LOCUS_t00170 62846 62919 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 63313 64479 gene locus_tag LOCUS_05640 63313 64479 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903257.1 protein_id gnl|my_center|LOCUS_05640 64508 65548 gene locus_tag LOCUS_05650 64508 65548 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674412.1 protein_id gnl|my_center|LOCUS_05650 65541 66221 gene locus_tag LOCUS_05660 65541 66221 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003822142.1 protein_id gnl|my_center|LOCUS_05660 66416 67270 gene locus_tag LOCUS_05670 66416 67270 CDS product MetQ/NlpA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905282.1 protein_id gnl|my_center|LOCUS_05670 67343 68203 gene locus_tag LOCUS_05680 67343 68203 CDS product DUF1684 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227879.1 protein_id gnl|my_center|LOCUS_05680 68196 69482 gene locus_tag LOCUS_05690 68196 69482 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390044.1 protein_id gnl|my_center|LOCUS_05690 69627 70694 gene locus_tag LOCUS_05700 69627 70694 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675073.1 protein_id gnl|my_center|LOCUS_05700 70725 70919 gene locus_tag LOCUS_05710 70725 70919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 71308 70955 gene locus_tag LOCUS_05720 71308 70955 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812098.1 protein_id gnl|my_center|LOCUS_05720 72709 71360 gene locus_tag LOCUS_05730 gene xseA 72709 71360 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389606.1 protein_id gnl|my_center|LOCUS_05730 72991 77664 gene locus_tag LOCUS_05740 72991 77664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 77778 79046 gene locus_tag LOCUS_05750 77778 79046 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821099.1 protein_id gnl|my_center|LOCUS_05750 79356 79186 gene locus_tag LOCUS_05760 79356 79186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 79422 82769 gene locus_tag LOCUS_05770 gene ileS 79422 82769 CDS product mupirocin-resistant isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390135.1 protein_id gnl|my_center|LOCUS_05770 83120 83740 gene locus_tag LOCUS_05780 83120 83740 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723214.1 protein_id gnl|my_center|LOCUS_05780 84088 85743 gene locus_tag LOCUS_05790 84088 85743 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974530.1 protein_id gnl|my_center|LOCUS_05790 85730 87112 gene locus_tag LOCUS_05800 85730 87112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 87109 87735 gene locus_tag LOCUS_05810 87109 87735 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230184.1 protein_id gnl|my_center|LOCUS_05810 87899 88258 gene locus_tag LOCUS_05820 87899 88258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 88542 89363 gene locus_tag LOCUS_05830 gene proC 88542 89363 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392379.1 protein_id gnl|my_center|LOCUS_05830 89437 90213 gene locus_tag LOCUS_05840 89437 90213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 91565 90336 gene locus_tag LOCUS_05850 91565 90336 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390070.1 protein_id gnl|my_center|LOCUS_05850 92385 91582 gene locus_tag LOCUS_05860 gene proC 92385 91582 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898446.1 protein_id gnl|my_center|LOCUS_05860 93848 92541 gene locus_tag LOCUS_05870 93848 92541 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390138.1 protein_id gnl|my_center|LOCUS_05870 94210 95280 gene locus_tag LOCUS_05880 94210 95280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 95370 96560 gene locus_tag LOCUS_05890 95370 96560 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089637.1 protein_id gnl|my_center|LOCUS_05890 96976 98790 gene locus_tag LOCUS_05900 96976 98790 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965650.1 protein_id gnl|my_center|LOCUS_05900 98796 100622 gene locus_tag LOCUS_05910 98796 100622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 100600 101352 gene locus_tag LOCUS_05920 100600 101352 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015125.1 protein_id gnl|my_center|LOCUS_05920 102492 101548 gene locus_tag LOCUS_05930 102492 101548 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230820.1 protein_id gnl|my_center|LOCUS_05930 102817 104043 gene locus_tag LOCUS_05940 102817 104043 CDS product PLP-dependent transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053275.1 protein_id gnl|my_center|LOCUS_05940 104244 105170 gene locus_tag LOCUS_05950 104244 105170 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390137.1 protein_id gnl|my_center|LOCUS_05950 106794 105295 gene locus_tag LOCUS_05960 106794 105295 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051460.1 protein_id gnl|my_center|LOCUS_05960 106934 107890 gene locus_tag LOCUS_05970 106934 107890 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730689.1 protein_id gnl|my_center|LOCUS_05970 108717 107848 gene locus_tag LOCUS_05980 108717 107848 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389614.1 protein_id gnl|my_center|LOCUS_05980 109566 108787 gene locus_tag LOCUS_05990 gene murI 109566 108787 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812126.1 protein_id gnl|my_center|LOCUS_05990 109677 110636 gene locus_tag LOCUS_06000 gene dapF 109677 110636 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389615.1 protein_id gnl|my_center|LOCUS_06000 111312 110650 gene locus_tag LOCUS_06010 111312 110650 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389616.1 protein_id gnl|my_center|LOCUS_06010 111430 112308 gene locus_tag LOCUS_06020 111430 112308 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054041.1 protein_id gnl|my_center|LOCUS_06020 112643 112419 gene locus_tag LOCUS_06030 112643 112419 CDS product DUF3107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821409.1 protein_id gnl|my_center|LOCUS_06030 114395 112746 gene locus_tag LOCUS_06040 114395 112746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 114429 115943 gene locus_tag LOCUS_06050 114429 115943 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389619.1 protein_id gnl|my_center|LOCUS_06050 117608 116004 gene locus_tag LOCUS_06060 117608 116004 CDS product zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389620.1 protein_id gnl|my_center|LOCUS_06060 117715 118536 gene locus_tag LOCUS_06070 117715 118536 CDS product Lon protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389621.1 protein_id gnl|my_center|LOCUS_06070 118841 119269 gene locus_tag LOCUS_06080 118841 119269 CDS product DUF3052 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053292.1 protein_id gnl|my_center|LOCUS_06080 119610 120890 gene locus_tag LOCUS_06090 119610 120890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 121024 121362 gene locus_tag LOCUS_06100 121024 121362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 121628 124426 gene locus_tag LOCUS_06110 121628 124426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 124658 124879 gene locus_tag LOCUS_06120 124658 124879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 124876 125295 gene locus_tag LOCUS_06130 124876 125295 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052118.1 protein_id gnl|my_center|LOCUS_06130 125402 125872 gene locus_tag LOCUS_06140 125402 125872 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887910.1 protein_id gnl|my_center|LOCUS_06140 126812 125922 gene locus_tag LOCUS_06150 126812 125922 CDS product PhzF family phenazine biosynthesis isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668695.1 protein_id gnl|my_center|LOCUS_06150 127509 126982 gene locus_tag LOCUS_06160 127509 126982 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029744075.1 protein_id gnl|my_center|LOCUS_06160 127893 127576 gene locus_tag LOCUS_06170 127893 127576 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152231551.1 protein_id gnl|my_center|LOCUS_06170 128409 128017 gene locus_tag LOCUS_06180 128409 128017 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086131.1 protein_id gnl|my_center|LOCUS_06180 129123 128488 gene locus_tag LOCUS_06190 129123 128488 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287459.1 protein_id gnl|my_center|LOCUS_06190 129608 129120 gene locus_tag LOCUS_06200 129608 129120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 130396 129872 gene locus_tag LOCUS_06210 130396 129872 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028212.1 protein_id gnl|my_center|LOCUS_06210 130594 131007 gene locus_tag LOCUS_06220 130594 131007 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890794.1 protein_id gnl|my_center|LOCUS_06220 132025 132774 gene locus_tag LOCUS_06230 132025 132774 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567984.1 protein_id gnl|my_center|LOCUS_06230 133187 133543 gene locus_tag LOCUS_06240 133187 133543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 135005 133716 gene locus_tag LOCUS_06250 135005 133716 CDS product arsenic transport integral membrane protein ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419420.1 protein_id gnl|my_center|LOCUS_06250 135193 135732 gene locus_tag LOCUS_06260 135193 135732 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389882.1 protein_id gnl|my_center|LOCUS_06260 135985 135910 gene locus_tag LOCUS_t00180 135985 135910 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 136242 138068 gene locus_tag LOCUS_06270 136242 138068 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053293.1 protein_id gnl|my_center|LOCUS_06270 138491 139657 gene locus_tag LOCUS_06280 gene dxr 138491 139657 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389635.1 protein_id gnl|my_center|LOCUS_06280 139688 141043 gene locus_tag LOCUS_06290 gene ispG 139688 141043 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812233.1 protein_id gnl|my_center|LOCUS_06290 >Feature sequence05 2329 788 gene locus_tag LOCUS_06300 gene gatA 2329 788 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814276.1 protein_id gnl|my_center|LOCUS_06300 2601 2338 gene locus_tag LOCUS_06310 gene gatC 2601 2338 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815962.1 protein_id gnl|my_center|LOCUS_06310 3659 2727 gene locus_tag LOCUS_06320 3659 2727 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009993690.1 protein_id gnl|my_center|LOCUS_06320 4636 3656 gene locus_tag LOCUS_06330 4636 3656 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152349884.1 protein_id gnl|my_center|LOCUS_06330 5520 4798 gene locus_tag LOCUS_06340 5520 4798 CDS product TrmH family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116438129.1 protein_id gnl|my_center|LOCUS_06340 6266 5517 gene locus_tag LOCUS_06350 6266 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 7703 6297 gene locus_tag LOCUS_06360 7703 6297 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390292.1 protein_id gnl|my_center|LOCUS_06360 8053 9975 gene locus_tag LOCUS_06370 8053 9975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 12861 10108 gene locus_tag LOCUS_06380 gene clpB 12861 10108 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057489.1 protein_id gnl|my_center|LOCUS_06380 14000 13173 gene locus_tag LOCUS_06390 14000 13173 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389507.1 protein_id gnl|my_center|LOCUS_06390 14221 14769 gene locus_tag LOCUS_06400 14221 14769 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052759.1 protein_id gnl|my_center|LOCUS_06400 15747 14914 gene locus_tag LOCUS_06410 15747 14914 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389501.1 protein_id gnl|my_center|LOCUS_06410 16780 15806 gene locus_tag LOCUS_06420 16780 15806 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053096.1 protein_id gnl|my_center|LOCUS_06420 17715 16846 gene locus_tag LOCUS_06430 17715 16846 CDS product DUF3152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811773.1 protein_id gnl|my_center|LOCUS_06430 18622 17891 gene locus_tag LOCUS_06440 18622 17891 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051540.1 protein_id gnl|my_center|LOCUS_06440 18855 18781 gene locus_tag LOCUS_t00190 18855 18781 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 20495 18969 gene locus_tag LOCUS_06450 20495 18969 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389451.1 protein_id gnl|my_center|LOCUS_06450 22144 20603 gene locus_tag LOCUS_06460 22144 20603 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389450.1 protein_id gnl|my_center|LOCUS_06460 22772 22230 gene locus_tag LOCUS_06470 22772 22230 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817572.1 protein_id gnl|my_center|LOCUS_06470 24077 22890 gene locus_tag LOCUS_06480 24077 22890 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068508.1 protein_id gnl|my_center|LOCUS_06480 24778 24074 gene locus_tag LOCUS_06490 gene tmk 24778 24074 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814160.1 protein_id gnl|my_center|LOCUS_06490 27815 24783 gene locus_tag LOCUS_06500 gene topA 27815 24783 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390327.1 protein_id gnl|my_center|LOCUS_06500 28961 27906 gene locus_tag LOCUS_06510 28961 27906 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055559.1 protein_id gnl|my_center|LOCUS_06510 28936 29151 gene locus_tag LOCUS_06520 28936 29151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 29348 30532 gene locus_tag LOCUS_06530 gene glf 29348 30532 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068697.1 protein_id gnl|my_center|LOCUS_06530 31846 30704 gene locus_tag LOCUS_06540 31846 30704 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 protein_id gnl|my_center|LOCUS_06540 32012 34330 gene locus_tag LOCUS_06550 32012 34330 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390331.1 protein_id gnl|my_center|LOCUS_06550 36440 34533 gene locus_tag LOCUS_06560 gene leuA 36440 34533 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814147.1 protein_id gnl|my_center|LOCUS_06560 37287 36667 gene locus_tag LOCUS_06570 37287 36667 CDS product DUF5701 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816090.1 protein_id gnl|my_center|LOCUS_06570 38574 37507 gene locus_tag LOCUS_06580 38574 37507 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994594.1 protein_id gnl|my_center|LOCUS_06580 39148 38576 gene locus_tag LOCUS_06590 39148 38576 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819192.1 protein_id gnl|my_center|LOCUS_06590 40016 39222 gene locus_tag LOCUS_06600 40016 39222 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814135.1 protein_id gnl|my_center|LOCUS_06600 40766 40164 gene locus_tag LOCUS_06610 gene recR 40766 40164 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051621.1 protein_id gnl|my_center|LOCUS_06610 43489 40766 gene locus_tag LOCUS_06620 43489 40766 CDS product DNA polymerase III subunit gamma and tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068519.1 protein_id gnl|my_center|LOCUS_06620 44197 43694 gene locus_tag LOCUS_06630 44197 43694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 44631 44194 gene locus_tag LOCUS_06640 44631 44194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 44984 44676 gene locus_tag LOCUS_06650 44984 44676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 45896 45348 gene locus_tag LOCUS_06660 gene tadC 45896 45348 CDS product Flp pilus assembly protein TadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051628.1 protein_id gnl|my_center|LOCUS_06660 46579 45881 gene locus_tag LOCUS_06670 gene tadB 46579 45881 CDS product Flp pilus assembly protein TadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054679.1 protein_id gnl|my_center|LOCUS_06670 47639 46569 gene locus_tag LOCUS_06680 47639 46569 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051629.1 protein_id gnl|my_center|LOCUS_06680 48489 47632 gene locus_tag LOCUS_06690 48489 47632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06690 49343 51586 gene locus_tag LOCUS_06700 49343 51586 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814112.1 protein_id gnl|my_center|LOCUS_06700 51611 52693 gene locus_tag LOCUS_06710 51611 52693 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507753.1 protein_id gnl|my_center|LOCUS_06710 52683 53411 gene locus_tag LOCUS_06720 52683 53411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364002.1 protein_id gnl|my_center|LOCUS_06720 53814 54452 gene locus_tag LOCUS_06730 gene upp 53814 54452 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114100.1 protein_id gnl|my_center|LOCUS_06730 55369 54602 gene locus_tag LOCUS_06740 55369 54602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06740 56732 55914 gene locus_tag LOCUS_06750 56732 55914 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728545.1 protein_id gnl|my_center|LOCUS_06750 57388 56723 gene locus_tag LOCUS_06760 57388 56723 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776971.1 protein_id gnl|my_center|LOCUS_06760 58450 57482 gene locus_tag LOCUS_06770 58450 57482 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776972.1 protein_id gnl|my_center|LOCUS_06770 60328 58661 gene locus_tag LOCUS_06780 60328 58661 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143601.1 protein_id gnl|my_center|LOCUS_06780 60712 60485 gene locus_tag LOCUS_06790 60712 60485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 61607 60858 gene locus_tag LOCUS_06800 61607 60858 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815981.1 protein_id gnl|my_center|LOCUS_06800 63207 61717 gene locus_tag LOCUS_06810 63207 61717 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068484.1 protein_id gnl|my_center|LOCUS_06810 64507 63209 gene locus_tag LOCUS_06820 gene dnaB 64507 63209 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171023377.1 protein_id gnl|my_center|LOCUS_06820 65059 66393 gene locus_tag LOCUS_06830 65059 66393 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051563.1 protein_id gnl|my_center|LOCUS_06830 68395 66581 gene locus_tag LOCUS_06840 68395 66581 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058100.1 protein_id gnl|my_center|LOCUS_06840 68878 68540 gene locus_tag LOCUS_06850 68878 68540 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814240.1 protein_id gnl|my_center|LOCUS_06850 70166 68880 gene locus_tag LOCUS_06860 70166 68880 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054727.1 protein_id gnl|my_center|LOCUS_06860 71708 70482 gene locus_tag LOCUS_06870 gene ftsY 71708 70482 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056312.1 protein_id gnl|my_center|LOCUS_06870 72229 71834 gene locus_tag LOCUS_06880 72229 71834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 72381 73145 gene locus_tag LOCUS_06890 72381 73145 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054725.1 protein_id gnl|my_center|LOCUS_06890 74591 73401 gene locus_tag LOCUS_06900 74591 73401 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068021.1 protein_id gnl|my_center|LOCUS_06900 75441 74578 gene locus_tag LOCUS_06910 gene nadC 75441 74578 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068020.1 protein_id gnl|my_center|LOCUS_06910 77519 75435 gene locus_tag LOCUS_06920 gene nadB 77519 75435 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068019.1 protein_id gnl|my_center|LOCUS_06920 78781 77516 gene locus_tag LOCUS_06930 gene nadA 78781 77516 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010080872.1 protein_id gnl|my_center|LOCUS_06930 79620 78778 gene locus_tag LOCUS_06940 79620 78778 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389687.1 protein_id gnl|my_center|LOCUS_06940 79897 79730 gene locus_tag LOCUS_06950 79897 79730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 80033 80311 gene locus_tag LOCUS_06960 80033 80311 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805023.1 protein_id gnl|my_center|LOCUS_06960 80531 80604 gene locus_tag LOCUS_t00200 80531 80604 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 81588 80767 gene locus_tag LOCUS_06970 81588 80767 CDS product TipAS antibiotic-recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230943.1 protein_id gnl|my_center|LOCUS_06970 82272 82808 gene locus_tag LOCUS_06980 82272 82808 CDS product ClbS/DfsB family four-helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011675062.1 protein_id gnl|my_center|LOCUS_06980 83914 83045 gene locus_tag LOCUS_06990 83914 83045 CDS product DSBA oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054647.1 protein_id gnl|my_center|LOCUS_06990 84092 84298 gene locus_tag LOCUS_07000 84092 84298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 88923 84277 gene locus_tag LOCUS_07010 88923 84277 CDS product ExeM/NucH family extracellular endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390206.1 protein_id gnl|my_center|LOCUS_07010 90273 89179 gene locus_tag LOCUS_07020 90273 89179 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033373915.1 protein_id gnl|my_center|LOCUS_07020 91952 90405 gene locus_tag LOCUS_07030 91952 90405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 93046 91952 gene locus_tag LOCUS_07040 93046 91952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 94044 93091 gene locus_tag LOCUS_07050 94044 93091 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538207.1 protein_id gnl|my_center|LOCUS_07050 95032 94049 gene locus_tag LOCUS_07060 95032 94049 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973969.1 protein_id gnl|my_center|LOCUS_07060 96231 95062 gene locus_tag LOCUS_07070 96231 95062 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385612.1 protein_id gnl|my_center|LOCUS_07070 97213 96614 gene locus_tag LOCUS_07080 97213 96614 CDS product DUF1345 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005079604.1 protein_id gnl|my_center|LOCUS_07080 98906 97578 gene locus_tag LOCUS_07090 98906 97578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 99922 99224 gene locus_tag LOCUS_07100 99922 99224 CDS product L-ribulose-5-phosphate 4-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051389.1 protein_id gnl|my_center|LOCUS_07100 100814 99924 gene locus_tag LOCUS_07110 100814 99924 CDS product L-ribulose-5-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820268.1 protein_id gnl|my_center|LOCUS_07110 102340 100817 gene locus_tag LOCUS_07120 102340 100817 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389559.1 protein_id gnl|my_center|LOCUS_07120 103629 102367 gene locus_tag LOCUS_07130 103629 102367 CDS product PTS galactitol transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389558.1 protein_id gnl|my_center|LOCUS_07130 103959 104936 gene locus_tag LOCUS_07140 103959 104936 CDS product sugar-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389557.1 protein_id gnl|my_center|LOCUS_07140 107303 105036 gene locus_tag LOCUS_07150 gene fni 107303 105036 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994855.1 protein_id gnl|my_center|LOCUS_07150 108431 107388 gene locus_tag LOCUS_07160 gene mvaD 108431 107388 CDS product diphosphomevalonate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399717.1 protein_id gnl|my_center|LOCUS_07160 109528 108428 gene locus_tag LOCUS_07170 gene mvk 109528 108428 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012774950.1 protein_id gnl|my_center|LOCUS_07170 110601 109975 gene locus_tag LOCUS_07180 110601 109975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 113262 110650 gene locus_tag LOCUS_07190 113262 110650 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805172.1 protein_id gnl|my_center|LOCUS_07190 114021 113347 gene locus_tag LOCUS_07200 114021 113347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 114853 114314 gene locus_tag LOCUS_07210 114853 114314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 116080 114971 gene locus_tag LOCUS_07220 116080 114971 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296820.1 protein_id gnl|my_center|LOCUS_07220 116748 116077 gene locus_tag LOCUS_07230 116748 116077 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286323.1 protein_id gnl|my_center|LOCUS_07230 118396 116858 gene locus_tag LOCUS_07240 118396 116858 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015605.1 protein_id gnl|my_center|LOCUS_07240 119099 120271 gene locus_tag LOCUS_07250 119099 120271 CDS product lactonase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357153.1 protein_id gnl|my_center|LOCUS_07250 120747 120397 gene locus_tag LOCUS_07260 120747 120397 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051538.1 protein_id gnl|my_center|LOCUS_07260 121009 123828 gene locus_tag LOCUS_07270 121009 123828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 124126 125568 gene locus_tag LOCUS_07280 124126 125568 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051261.1 protein_id gnl|my_center|LOCUS_07280 125780 126634 gene locus_tag LOCUS_07290 125780 126634 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003709302.1 protein_id gnl|my_center|LOCUS_07290 127130 126681 gene locus_tag LOCUS_07300 127130 126681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 127289 127867 gene locus_tag LOCUS_07310 127289 127867 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035107705.1 protein_id gnl|my_center|LOCUS_07310 128382 127993 gene locus_tag LOCUS_07320 128382 127993 CDS product DUF4186 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812258.1 protein_id gnl|my_center|LOCUS_07320 128560 129849 gene locus_tag LOCUS_07330 128560 129849 CDS product cyclopropane-fatty-acyl-phospholipid synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814846.1 protein_id gnl|my_center|LOCUS_07330 130465 129944 gene locus_tag LOCUS_07340 130465 129944 CDS product FMN-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390315.1 protein_id gnl|my_center|LOCUS_07340 131354 130512 gene locus_tag LOCUS_07350 131354 130512 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068491.1 protein_id gnl|my_center|LOCUS_07350 132780 131515 gene locus_tag LOCUS_07360 132780 131515 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068492.1 protein_id gnl|my_center|LOCUS_07360 134149 132806 gene locus_tag LOCUS_07370 134149 132806 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051582.1 protein_id gnl|my_center|LOCUS_07370 135445 134165 gene locus_tag LOCUS_07380 135445 134165 CDS product DUF2318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390318.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence06 244 83 gene locus_tag LOCUS_07390 244 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 351 1313 gene locus_tag LOCUS_07400 351 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002273626.1 protein_id gnl|my_center|LOCUS_07400 1377 2954 gene locus_tag LOCUS_07410 1377 2954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4115 3057 gene locus_tag LOCUS_07420 gene ychF 4115 3057 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813598.1 protein_id gnl|my_center|LOCUS_07420 5051 4254 gene locus_tag LOCUS_07430 gene proC 5051 4254 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363628.1 protein_id gnl|my_center|LOCUS_07430 6630 5215 gene locus_tag LOCUS_07440 6630 5215 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068205.1 protein_id gnl|my_center|LOCUS_07440 6741 9431 gene locus_tag LOCUS_07450 6741 9431 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047379863.1 protein_id gnl|my_center|LOCUS_07450 9575 10336 gene locus_tag LOCUS_07460 9575 10336 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052073.1 protein_id gnl|my_center|LOCUS_07460 13128 10498 gene locus_tag LOCUS_07470 13128 10498 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390053.1 protein_id gnl|my_center|LOCUS_07470 14217 13252 gene locus_tag LOCUS_07480 14217 13252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 14551 15501 gene locus_tag LOCUS_07490 14551 15501 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230727.1 protein_id gnl|my_center|LOCUS_07490 17059 15749 gene locus_tag LOCUS_07500 17059 15749 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363634.1 protein_id gnl|my_center|LOCUS_07500 17405 18283 gene locus_tag LOCUS_07510 17405 18283 CDS product pyridoxamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052069.1 protein_id gnl|my_center|LOCUS_07510 18481 18921 gene locus_tag LOCUS_07520 18481 18921 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813644.1 protein_id gnl|my_center|LOCUS_07520 18921 20519 gene locus_tag LOCUS_07530 18921 20519 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052067.1 protein_id gnl|my_center|LOCUS_07530 20609 22288 gene locus_tag LOCUS_07540 20609 22288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 22718 22374 gene locus_tag LOCUS_07550 22718 22374 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813638.1 protein_id gnl|my_center|LOCUS_07550 22837 24798 gene locus_tag LOCUS_07560 22837 24798 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414641.1 protein_id gnl|my_center|LOCUS_07560 24844 25872 gene locus_tag LOCUS_07570 24844 25872 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390058.1 protein_id gnl|my_center|LOCUS_07570 26011 26682 gene locus_tag LOCUS_07580 26011 26682 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052063.1 protein_id gnl|my_center|LOCUS_07580 27888 26923 gene locus_tag LOCUS_07590 27888 26923 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068210.1 protein_id gnl|my_center|LOCUS_07590 29446 28151 gene locus_tag LOCUS_07600 29446 28151 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390061.1 protein_id gnl|my_center|LOCUS_07600 30605 29424 gene locus_tag LOCUS_07610 30605 29424 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390062.1 protein_id gnl|my_center|LOCUS_07610 30822 30896 gene locus_tag LOCUS_t00210 30822 30896 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 31023 31523 gene locus_tag LOCUS_07620 31023 31523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 31780 32586 gene locus_tag LOCUS_07630 31780 32586 CDS product putative hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015201.1 protein_id gnl|my_center|LOCUS_07630 32763 33527 gene locus_tag LOCUS_07640 32763 33527 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973420.1 protein_id gnl|my_center|LOCUS_07640 33534 35189 gene locus_tag LOCUS_07650 33534 35189 CDS product 5-oxoprolinase/urea amidolyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973422.1 protein_id gnl|my_center|LOCUS_07650 35186 36925 gene locus_tag LOCUS_07660 35186 36925 CDS product acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973423.1 protein_id gnl|my_center|LOCUS_07660 37254 38081 gene locus_tag LOCUS_07670 37254 38081 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064572.1 protein_id gnl|my_center|LOCUS_07670 39531 38257 gene locus_tag LOCUS_07680 39531 38257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 40400 40218 gene locus_tag LOCUS_07690 40400 40218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 41755 40445 gene locus_tag LOCUS_07700 gene clpX 41755 40445 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390063.1 protein_id gnl|my_center|LOCUS_07700 42571 41900 gene locus_tag LOCUS_07710 42571 41900 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816849.1 protein_id gnl|my_center|LOCUS_07710 43192 42575 gene locus_tag LOCUS_07720 43192 42575 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112615.1 protein_id gnl|my_center|LOCUS_07720 44729 43341 gene locus_tag LOCUS_07730 gene tig 44729 43341 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390065.1 protein_id gnl|my_center|LOCUS_07730 46069 44765 gene locus_tag LOCUS_07740 46069 44765 CDS product HRDC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068215.1 protein_id gnl|my_center|LOCUS_07740 46844 46140 gene locus_tag LOCUS_07750 46844 46140 CDS product DUF3000 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068216.1 protein_id gnl|my_center|LOCUS_07750 47939 47058 gene locus_tag LOCUS_07760 gene pflA 47939 47058 CDS product pyruvate formate-lyase-activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112608.1 protein_id gnl|my_center|LOCUS_07760 50407 48032 gene locus_tag LOCUS_07770 gene pflB 50407 48032 CDS product formate C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582507.1 protein_id gnl|my_center|LOCUS_07770 50736 50545 gene locus_tag LOCUS_07780 50736 50545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055377.1 protein_id gnl|my_center|LOCUS_07780 52563 50869 gene locus_tag LOCUS_07790 52563 50869 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052049.1 protein_id gnl|my_center|LOCUS_07790 53813 52632 gene locus_tag LOCUS_07800 53813 52632 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390070.1 protein_id gnl|my_center|LOCUS_07800 54140 54955 gene locus_tag LOCUS_07810 54140 54955 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068222.1 protein_id gnl|my_center|LOCUS_07810 56835 55153 gene locus_tag LOCUS_07820 56835 55153 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641742.1 protein_id gnl|my_center|LOCUS_07820 60054 57250 gene locus_tag LOCUS_07830 60054 57250 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390052.1 protein_id gnl|my_center|LOCUS_07830 60392 60916 gene locus_tag LOCUS_07840 60392 60916 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112594.1 protein_id gnl|my_center|LOCUS_07840 61045 61536 gene locus_tag LOCUS_07850 61045 61536 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812079.1 protein_id gnl|my_center|LOCUS_07850 61703 62743 gene locus_tag LOCUS_07860 61703 62743 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390188.1 protein_id gnl|my_center|LOCUS_07860 63450 62821 gene locus_tag LOCUS_07870 63450 62821 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112368.1 protein_id gnl|my_center|LOCUS_07870 63707 65047 gene locus_tag LOCUS_07880 63707 65047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 65293 65598 gene locus_tag LOCUS_07890 65293 65598 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111562.1 protein_id gnl|my_center|LOCUS_07890 66790 65693 gene locus_tag LOCUS_07900 66790 65693 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101884.1 protein_id gnl|my_center|LOCUS_07900 68474 66864 gene locus_tag LOCUS_07910 68474 66864 CDS product FGGY family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067976.1 protein_id gnl|my_center|LOCUS_07910 69993 68620 gene locus_tag LOCUS_07920 69993 68620 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389730.1 protein_id gnl|my_center|LOCUS_07920 72892 70265 gene locus_tag LOCUS_07930 72892 70265 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389729.1 protein_id gnl|my_center|LOCUS_07930 74100 73057 gene locus_tag LOCUS_07940 74100 73057 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390364.1 protein_id gnl|my_center|LOCUS_07940 74329 76173 gene locus_tag LOCUS_07950 74329 76173 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390152.1 protein_id gnl|my_center|LOCUS_07950 77297 76284 gene locus_tag LOCUS_07960 77297 76284 CDS product polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055606.1 protein_id gnl|my_center|LOCUS_07960 77951 77454 gene locus_tag LOCUS_07970 77951 77454 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051756.1 protein_id gnl|my_center|LOCUS_07970 79309 78125 gene locus_tag LOCUS_07980 79309 78125 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390286.1 protein_id gnl|my_center|LOCUS_07980 81562 79766 gene locus_tag LOCUS_07990 gene aspS 81562 79766 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111605.1 protein_id gnl|my_center|LOCUS_07990 83003 81621 gene locus_tag LOCUS_08000 gene hisS 83003 81621 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782706.1 protein_id gnl|my_center|LOCUS_08000 83144 84607 gene locus_tag LOCUS_08010 83144 84607 CDS product DUF349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053980.1 protein_id gnl|my_center|LOCUS_08010 87264 84886 gene locus_tag LOCUS_08020 87264 84886 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471819.1 protein_id gnl|my_center|LOCUS_08020 87930 87454 gene locus_tag LOCUS_08030 gene dut 87930 87454 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055963.1 protein_id gnl|my_center|LOCUS_08030 88223 87930 gene locus_tag LOCUS_08040 88223 87930 CDS product DUF4193 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813752.1 protein_id gnl|my_center|LOCUS_08040 88380 89603 gene locus_tag LOCUS_08050 gene sepH 88380 89603 CDS product septation protein SepH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813754.1 protein_id gnl|my_center|LOCUS_08050 90888 89641 gene locus_tag LOCUS_08060 90888 89641 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390077.1 protein_id gnl|my_center|LOCUS_08060 91040 93673 gene locus_tag LOCUS_08070 91040 93673 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068049.1 protein_id gnl|my_center|LOCUS_08070 94830 93700 gene locus_tag LOCUS_08080 94830 93700 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582790.1 protein_id gnl|my_center|LOCUS_08080 95505 95290 gene locus_tag LOCUS_08090 95505 95290 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829211.1 protein_id gnl|my_center|LOCUS_08090 96030 95506 gene locus_tag LOCUS_08100 96030 95506 CDS product DUF2975 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971631.1 protein_id gnl|my_center|LOCUS_08100 96477 97877 gene locus_tag LOCUS_08110 96477 97877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 100317 98032 gene locus_tag LOCUS_08120 100317 98032 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399529.1 protein_id gnl|my_center|LOCUS_08120 101939 100416 gene locus_tag LOCUS_08130 101939 100416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 102250 102041 gene locus_tag LOCUS_08140 102250 102041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 103221 104501 gene locus_tag LOCUS_08150 103221 104501 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363673.1 protein_id gnl|my_center|LOCUS_08150 104585 106699 gene locus_tag LOCUS_08160 104585 106699 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390081.1 protein_id gnl|my_center|LOCUS_08160 107484 106804 gene locus_tag LOCUS_08170 107484 106804 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390082.1 protein_id gnl|my_center|LOCUS_08170 107534 108109 gene locus_tag LOCUS_08180 107534 108109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390083.1 protein_id gnl|my_center|LOCUS_08180 109339 108275 gene locus_tag LOCUS_08190 gene trpD 109339 108275 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068039.1 protein_id gnl|my_center|LOCUS_08190 112449 109528 gene locus_tag LOCUS_08200 gene secA 112449 109528 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390085.1 protein_id gnl|my_center|LOCUS_08200 113354 112692 gene locus_tag LOCUS_08210 gene raiA 113354 112692 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813792.1 protein_id gnl|my_center|LOCUS_08210 114620 114156 gene locus_tag LOCUS_08220 114620 114156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 115970 114801 gene locus_tag LOCUS_08230 gene recA 115970 114801 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820771.1 protein_id gnl|my_center|LOCUS_08230 116443 116201 gene locus_tag LOCUS_08240 116443 116201 CDS product DUF3046 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113620.1 protein_id gnl|my_center|LOCUS_08240 117075 116554 gene locus_tag LOCUS_08250 117075 116554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815448.1 protein_id gnl|my_center|LOCUS_08250 117805 117236 gene locus_tag LOCUS_08260 117805 117236 CDS product nicotinamide-nucleotide amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813803.1 protein_id gnl|my_center|LOCUS_08260 118467 117805 gene locus_tag LOCUS_08270 gene pgsA 118467 117805 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058588.1 protein_id gnl|my_center|LOCUS_08270 121428 118663 gene locus_tag LOCUS_08280 121428 118663 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363681.1 protein_id gnl|my_center|LOCUS_08280 121764 122480 gene locus_tag LOCUS_08290 121764 122480 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390090.1 protein_id gnl|my_center|LOCUS_08290 123371 122619 gene locus_tag LOCUS_08300 123371 122619 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816623.1 protein_id gnl|my_center|LOCUS_08300 124524 123454 gene locus_tag LOCUS_08310 gene miaA 124524 123454 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390091.1 protein_id gnl|my_center|LOCUS_08310 126072 124642 gene locus_tag LOCUS_08320 gene miaB 126072 124642 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021648605.1 protein_id gnl|my_center|LOCUS_08320 126260 127000 gene locus_tag LOCUS_08330 126260 127000 CDS product GTP pyrophosphokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815463.1 protein_id gnl|my_center|LOCUS_08330 128041 127163 gene locus_tag LOCUS_08340 128041 127163 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052514.1 protein_id gnl|my_center|LOCUS_08340 128307 129119 gene locus_tag LOCUS_08350 128307 129119 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815467.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence07 863 48 gene locus_tag LOCUS_08360 863 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2139 796 gene locus_tag LOCUS_08370 2139 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4336 3290 gene locus_tag LOCUS_08380 gene era 4336 3290 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816894.1 protein_id gnl|my_center|LOCUS_08380 5734 4340 gene locus_tag LOCUS_08390 5734 4340 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052157.1 protein_id gnl|my_center|LOCUS_08390 6312 5737 gene locus_tag LOCUS_08400 gene ybeY 6312 5737 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052156.1 protein_id gnl|my_center|LOCUS_08400 7415 6309 gene locus_tag LOCUS_08410 7415 6309 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052155.1 protein_id gnl|my_center|LOCUS_08410 7791 7453 gene locus_tag LOCUS_08420 7791 7453 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055091.1 protein_id gnl|my_center|LOCUS_08420 8692 7895 gene locus_tag LOCUS_08430 8692 7895 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052153.1 protein_id gnl|my_center|LOCUS_08430 8861 8948 gene locus_tag LOCUS_t00220 8861 8948 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9026 9901 gene locus_tag LOCUS_08440 9026 9901 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812896.1 protein_id gnl|my_center|LOCUS_08440 11235 9907 gene locus_tag LOCUS_08450 11235 9907 CDS product solute carrier family 23 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052100.1 protein_id gnl|my_center|LOCUS_08450 11438 12682 gene locus_tag LOCUS_08460 gene glgC 11438 12682 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052151.1 protein_id gnl|my_center|LOCUS_08460 13361 12789 gene locus_tag LOCUS_08470 13361 12789 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812893.1 protein_id gnl|my_center|LOCUS_08470 13947 13363 gene locus_tag LOCUS_08480 13947 13363 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816902.1 protein_id gnl|my_center|LOCUS_08480 15275 13992 gene locus_tag LOCUS_08490 15275 13992 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389815.1 protein_id gnl|my_center|LOCUS_08490 16054 15275 gene locus_tag LOCUS_08500 gene sufC 16054 15275 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389814.1 protein_id gnl|my_center|LOCUS_08500 17297 16056 gene locus_tag LOCUS_08510 gene sufD 17297 16056 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052146.1 protein_id gnl|my_center|LOCUS_08510 18811 17297 gene locus_tag LOCUS_08520 gene sufB 18811 17297 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055081.1 protein_id gnl|my_center|LOCUS_08520 20689 19031 gene locus_tag LOCUS_08530 20689 19031 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812880.1 protein_id gnl|my_center|LOCUS_08530 21431 20985 gene locus_tag LOCUS_08540 gene aroQ 21431 20985 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816942.1 protein_id gnl|my_center|LOCUS_08540 23169 21496 gene locus_tag LOCUS_08550 23169 21496 CDS product bifunctional shikimate kinase/3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052140.1 protein_id gnl|my_center|LOCUS_08550 24439 23246 gene locus_tag LOCUS_08560 gene aroC 24439 23246 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052139.1 protein_id gnl|my_center|LOCUS_08560 24533 24985 gene locus_tag LOCUS_08570 24533 24985 CDS product prepilin peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143357.1 protein_id gnl|my_center|LOCUS_08570 26164 24968 gene locus_tag LOCUS_08580 gene mltG 26164 24968 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053383.1 protein_id gnl|my_center|LOCUS_08580 26635 26165 gene locus_tag LOCUS_08590 gene ruvX 26635 26165 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812865.1 protein_id gnl|my_center|LOCUS_08590 29334 26644 gene locus_tag LOCUS_08600 gene alaS 29334 26644 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389808.1 protein_id gnl|my_center|LOCUS_08600 29686 29450 gene locus_tag LOCUS_08610 29686 29450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812861.1 protein_id gnl|my_center|LOCUS_08610 30120 29686 gene locus_tag LOCUS_08620 30120 29686 CDS product DUF948 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812859.1 protein_id gnl|my_center|LOCUS_08620 30801 30223 gene locus_tag LOCUS_08630 30801 30223 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117424.1 protein_id gnl|my_center|LOCUS_08630 30949 31314 gene locus_tag LOCUS_08640 30949 31314 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818305.1 protein_id gnl|my_center|LOCUS_08640 32109 31483 gene locus_tag LOCUS_08650 gene rpsD 32109 31483 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812853.1 protein_id gnl|my_center|LOCUS_08650 35050 32435 gene locus_tag LOCUS_08660 35050 32435 CDS product exodeoxyribonuclease V subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389805.1 protein_id gnl|my_center|LOCUS_08660 36690 35128 gene locus_tag LOCUS_08670 gene guaA 36690 35128 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399520.1 protein_id gnl|my_center|LOCUS_08670 37347 39824 gene locus_tag LOCUS_08680 37347 39824 CDS product phosphoketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112522.1 protein_id gnl|my_center|LOCUS_08680 40065 41753 gene locus_tag LOCUS_08690 gene pta 40065 41753 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812775.1 protein_id gnl|my_center|LOCUS_08690 41852 43078 gene locus_tag LOCUS_08700 41852 43078 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068227.1 protein_id gnl|my_center|LOCUS_08700 44119 43286 gene locus_tag LOCUS_08710 gene hisN 44119 43286 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081049.1 protein_id gnl|my_center|LOCUS_08710 45486 44134 gene locus_tag LOCUS_08720 gene aroA 45486 44134 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582494.1 protein_id gnl|my_center|LOCUS_08720 46767 45586 gene locus_tag LOCUS_08730 46767 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052026.1 protein_id gnl|my_center|LOCUS_08730 46908 46984 gene locus_tag LOCUS_t00230 46908 46984 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 49107 47251 gene locus_tag LOCUS_08740 49107 47251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 50186 49206 gene locus_tag LOCUS_08750 50186 49206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 51624 51361 gene locus_tag LOCUS_08760 51624 51361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 53135 51768 gene locus_tag LOCUS_08770 53135 51768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 53765 53136 gene locus_tag LOCUS_08780 53765 53136 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_125968857.1 protein_id gnl|my_center|LOCUS_08780 54050 54442 gene locus_tag LOCUS_08790 54050 54442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 56648 54513 gene locus_tag LOCUS_08800 gene glgX 56648 54513 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055470.1 protein_id gnl|my_center|LOCUS_08800 57781 56855 gene locus_tag LOCUS_08810 57781 56855 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389779.1 protein_id gnl|my_center|LOCUS_08810 60712 57797 gene locus_tag LOCUS_08820 gene polA 60712 57797 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389778.1 protein_id gnl|my_center|LOCUS_08820 61355 60741 gene locus_tag LOCUS_08830 61355 60741 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805096.1 protein_id gnl|my_center|LOCUS_08830 61512 61438 gene locus_tag LOCUS_t00240 61512 61438 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 61628 62227 gene locus_tag LOCUS_08840 61628 62227 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815571.1 protein_id gnl|my_center|LOCUS_08840 63852 62410 gene locus_tag LOCUS_08850 gene pyk 63852 62410 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812729.1 protein_id gnl|my_center|LOCUS_08850 65009 64014 gene locus_tag LOCUS_08860 65009 64014 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051920.1 protein_id gnl|my_center|LOCUS_08860 67198 65087 gene locus_tag LOCUS_08870 gene uvrB 67198 65087 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389776.1 protein_id gnl|my_center|LOCUS_08870 67873 67220 gene locus_tag LOCUS_08880 gene coaE 67873 67220 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815565.1 protein_id gnl|my_center|LOCUS_08880 69636 68152 gene locus_tag LOCUS_08890 gene rpsA 69636 68152 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812721.1 protein_id gnl|my_center|LOCUS_08890 70645 69767 gene locus_tag LOCUS_08900 70645 69767 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053562.1 protein_id gnl|my_center|LOCUS_08900 70785 71801 gene locus_tag LOCUS_08910 70785 71801 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389774.1 protein_id gnl|my_center|LOCUS_08910 71900 72778 gene locus_tag LOCUS_08920 71900 72778 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819774.1 protein_id gnl|my_center|LOCUS_08920 72775 73608 gene locus_tag LOCUS_08930 72775 73608 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812712.1 protein_id gnl|my_center|LOCUS_08930 74348 73815 gene locus_tag LOCUS_08940 gene ispF 74348 73815 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068243.1 protein_id gnl|my_center|LOCUS_08940 75039 74446 gene locus_tag LOCUS_08950 75039 74446 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068244.1 protein_id gnl|my_center|LOCUS_08950 75287 77494 gene locus_tag LOCUS_08960 gene glgB 75287 77494 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812706.1 protein_id gnl|my_center|LOCUS_08960 77540 78271 gene locus_tag LOCUS_08970 77540 78271 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051909.1 protein_id gnl|my_center|LOCUS_08970 78322 79413 gene locus_tag LOCUS_08980 78322 79413 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389772.1 protein_id gnl|my_center|LOCUS_08980 79753 80466 gene locus_tag LOCUS_08990 79753 80466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 80471 81862 gene locus_tag LOCUS_09000 80471 81862 CDS product Y-family DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705677.1 protein_id gnl|my_center|LOCUS_09000 82043 82603 gene locus_tag LOCUS_09010 82043 82603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 83739 82903 gene locus_tag LOCUS_09020 83739 82903 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051905.1 protein_id gnl|my_center|LOCUS_09020 83913 84275 gene locus_tag LOCUS_09030 83913 84275 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658181.1 protein_id gnl|my_center|LOCUS_09030 85817 84279 gene locus_tag LOCUS_09040 85817 84279 CDS product DUF5719 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053571.1 protein_id gnl|my_center|LOCUS_09040 88879 85814 gene locus_tag LOCUS_09050 88879 85814 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389766.1 protein_id gnl|my_center|LOCUS_09050 89355 89005 gene locus_tag LOCUS_09060 89355 89005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 89635 91068 gene locus_tag LOCUS_09070 89635 91068 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947073.1 protein_id gnl|my_center|LOCUS_09070 91138 92475 gene locus_tag LOCUS_09080 91138 92475 CDS product LCP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068246.1 protein_id gnl|my_center|LOCUS_09080 92610 94715 gene locus_tag LOCUS_09090 92610 94715 CDS product FtsK/SpoIIIE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051899.1 protein_id gnl|my_center|LOCUS_09090 94849 95127 gene locus_tag LOCUS_09100 94849 95127 CDS product WhiB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812680.1 protein_id gnl|my_center|LOCUS_09100 96870 95314 gene locus_tag LOCUS_09110 96870 95314 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051898.1 protein_id gnl|my_center|LOCUS_09110 96938 97870 gene locus_tag LOCUS_09120 96938 97870 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389762.1 protein_id gnl|my_center|LOCUS_09120 98481 98002 gene locus_tag LOCUS_09130 98481 98002 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112265.1 protein_id gnl|my_center|LOCUS_09130 99004 98597 gene locus_tag LOCUS_09140 99004 98597 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051894.1 protein_id gnl|my_center|LOCUS_09140 99676 99101 gene locus_tag LOCUS_09150 99676 99101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817844.1 protein_id gnl|my_center|LOCUS_09150 100237 101211 gene locus_tag LOCUS_09160 gene rhuM 100237 101211 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_09160 101979 101323 gene locus_tag LOCUS_09170 101979 101323 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268572.1 protein_id gnl|my_center|LOCUS_09170 102643 102434 gene locus_tag LOCUS_09180 102643 102434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 103191 102658 gene locus_tag LOCUS_09190 103191 102658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 103469 103215 gene locus_tag LOCUS_09200 103469 103215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 104453 103665 gene locus_tag LOCUS_09210 104453 103665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 104558 104477 gene locus_tag LOCUS_t00250 104558 104477 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 105598 104588 gene locus_tag LOCUS_09220 105598 104588 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389759.1 protein_id gnl|my_center|LOCUS_09220 106433 105891 gene locus_tag LOCUS_09230 106433 105891 CDS product DUF501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068253.1 protein_id gnl|my_center|LOCUS_09230 106907 106485 gene locus_tag LOCUS_09240 106907 106485 CDS product septum formation initiator family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414620.1 protein_id gnl|my_center|LOCUS_09240 106900 107103 gene locus_tag LOCUS_09250 106900 107103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 108409 107114 gene locus_tag LOCUS_09260 gene eno 108409 107114 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111823.1 protein_id gnl|my_center|LOCUS_09260 112328 108669 gene locus_tag LOCUS_09270 gene mfd 112328 108669 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389755.1 protein_id gnl|my_center|LOCUS_09270 112917 112318 gene locus_tag LOCUS_09280 gene pth 112917 112318 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812652.1 protein_id gnl|my_center|LOCUS_09280 113856 113200 gene locus_tag LOCUS_09290 113856 113200 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068257.1 protein_id gnl|my_center|LOCUS_09290 117040 113849 gene locus_tag LOCUS_09300 117040 113849 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389747.1 protein_id gnl|my_center|LOCUS_09300 117919 117308 gene locus_tag LOCUS_09310 117919 117308 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813432.1 protein_id gnl|my_center|LOCUS_09310 118102 119118 gene locus_tag LOCUS_09320 118102 119118 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152580630.1 protein_id gnl|my_center|LOCUS_09320 119377 119892 gene locus_tag LOCUS_09330 119377 119892 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051196.1 protein_id gnl|my_center|LOCUS_09330 119889 120263 gene locus_tag LOCUS_09340 119889 120263 CDS product CrcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053642.1 protein_id gnl|my_center|LOCUS_09340 121469 120435 gene locus_tag LOCUS_09350 121469 120435 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056371.1 protein_id gnl|my_center|LOCUS_09350 122210 121656 gene locus_tag LOCUS_09360 122210 121656 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922028.1 protein_id gnl|my_center|LOCUS_09360 123624 122362 gene locus_tag LOCUS_09370 123624 122362 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056294.1 protein_id gnl|my_center|LOCUS_09370 124690 123749 gene locus_tag LOCUS_09380 124690 123749 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053078.1 protein_id gnl|my_center|LOCUS_09380 125058 126449 gene locus_tag LOCUS_09390 125058 126449 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086774.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence08 2201 186 gene locus_tag LOCUS_09400 2201 186 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582533.1 protein_id gnl|my_center|LOCUS_09400 2353 3489 gene locus_tag LOCUS_09410 2353 3489 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816824.1 protein_id gnl|my_center|LOCUS_09410 3492 3845 gene locus_tag LOCUS_09420 3492 3845 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816822.1 protein_id gnl|my_center|LOCUS_09420 3842 5248 gene locus_tag LOCUS_09430 3842 5248 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055089.1 protein_id gnl|my_center|LOCUS_09430 5479 6111 gene locus_tag LOCUS_09440 5479 6111 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052163.1 protein_id gnl|my_center|LOCUS_09440 6307 7434 gene locus_tag LOCUS_09450 6307 7434 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812920.1 protein_id gnl|my_center|LOCUS_09450 7688 8119 gene locus_tag LOCUS_09460 7688 8119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09460 8129 8464 gene locus_tag LOCUS_09470 8129 8464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09470 8931 8671 gene locus_tag LOCUS_09480 gene rpsT 8931 8671 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052167.1 protein_id gnl|my_center|LOCUS_09480 9363 9139 gene locus_tag LOCUS_09490 9363 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 9245 12613 gene locus_tag LOCUS_09500 9245 12613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 12568 17160 gene locus_tag LOCUS_09510 12568 17160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 17338 19215 gene locus_tag LOCUS_09520 gene lepA 17338 19215 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994121.1 protein_id gnl|my_center|LOCUS_09520 19455 20678 gene locus_tag LOCUS_09530 gene hemW 19455 20678 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545203.1 protein_id gnl|my_center|LOCUS_09530 20942 25513 gene locus_tag LOCUS_09540 gene gltB 20942 25513 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033496496.1 protein_id gnl|my_center|LOCUS_09540 25515 27047 gene locus_tag LOCUS_09550 25515 27047 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812939.1 protein_id gnl|my_center|LOCUS_09550 27141 27590 gene locus_tag LOCUS_09560 27141 27590 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068160.1 protein_id gnl|my_center|LOCUS_09560 27614 28849 gene locus_tag LOCUS_09570 gene glgA 27614 28849 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068159.1 protein_id gnl|my_center|LOCUS_09570 28911 29795 gene locus_tag LOCUS_09580 28911 29795 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812945.1 protein_id gnl|my_center|LOCUS_09580 30161 31921 gene locus_tag LOCUS_09590 30161 31921 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014012.1 protein_id gnl|my_center|LOCUS_09590 31921 33864 gene locus_tag LOCUS_09600 31921 33864 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227096.1 protein_id gnl|my_center|LOCUS_09600 33944 34987 gene locus_tag LOCUS_09610 33944 34987 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389848.1 protein_id gnl|my_center|LOCUS_09610 35087 35641 gene locus_tag LOCUS_09620 35087 35641 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389849.1 protein_id gnl|my_center|LOCUS_09620 35810 38122 gene locus_tag LOCUS_09630 gene metE 35810 38122 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052219.1 protein_id gnl|my_center|LOCUS_09630 38124 38969 gene locus_tag LOCUS_09640 gene metF 38124 38969 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056260.1 protein_id gnl|my_center|LOCUS_09640 39332 39117 gene locus_tag LOCUS_09650 39332 39117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 39327 42197 gene locus_tag LOCUS_09660 39327 42197 CDS product bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389891.1 protein_id gnl|my_center|LOCUS_09660 42310 43377 gene locus_tag LOCUS_09670 gene pyrB 42310 43377 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054218.1 protein_id gnl|my_center|LOCUS_09670 43377 43796 gene locus_tag LOCUS_09680 43377 43796 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052224.1 protein_id gnl|my_center|LOCUS_09680 43798 45369 gene locus_tag LOCUS_09690 43798 45369 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389893.1 protein_id gnl|my_center|LOCUS_09690 45366 46349 gene locus_tag LOCUS_09700 gene pyrF 45366 46349 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_09700 46346 47155 gene locus_tag LOCUS_09710 46346 47155 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389895.1 protein_id gnl|my_center|LOCUS_09710 47152 48150 gene locus_tag LOCUS_09720 47152 48150 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813106.1 protein_id gnl|my_center|LOCUS_09720 48144 48863 gene locus_tag LOCUS_09730 gene pyrE 48144 48863 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052229.1 protein_id gnl|my_center|LOCUS_09730 50007 49084 gene locus_tag LOCUS_09740 50007 49084 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052232.1 protein_id gnl|my_center|LOCUS_09740 50941 50114 gene locus_tag LOCUS_09750 50941 50114 CDS product phosphoglyceromutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222392.1 protein_id gnl|my_center|LOCUS_09750 52897 50981 gene locus_tag LOCUS_09760 52897 50981 CDS product NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813148.1 protein_id gnl|my_center|LOCUS_09760 54771 53170 gene locus_tag LOCUS_09770 54771 53170 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052765.1 protein_id gnl|my_center|LOCUS_09770 54844 55320 gene locus_tag LOCUS_09780 54844 55320 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052767.1 protein_id gnl|my_center|LOCUS_09780 55630 58524 gene locus_tag LOCUS_09790 gene uvrA 55630 58524 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068107.1 protein_id gnl|my_center|LOCUS_09790 58696 61092 gene locus_tag LOCUS_09800 gene uvrC 58696 61092 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389954.1 protein_id gnl|my_center|LOCUS_09800 61170 62099 gene locus_tag LOCUS_09810 61170 62099 CDS product shikimate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389953.1 protein_id gnl|my_center|LOCUS_09810 62099 63028 gene locus_tag LOCUS_09820 gene rapZ 62099 63028 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363500.1 protein_id gnl|my_center|LOCUS_09820 63254 64198 gene locus_tag LOCUS_09830 gene whiA 63254 64198 CDS product DNA-binding protein WhiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813277.1 protein_id gnl|my_center|LOCUS_09830 64437 65633 gene locus_tag LOCUS_09840 64437 65633 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363499.1 protein_id gnl|my_center|LOCUS_09840 65959 66753 gene locus_tag LOCUS_09850 gene tpiA 65959 66753 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052784.1 protein_id gnl|my_center|LOCUS_09850 66815 67063 gene locus_tag LOCUS_09860 gene secG 66815 67063 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813271.1 protein_id gnl|my_center|LOCUS_09860 67201 68046 gene locus_tag LOCUS_09870 67201 68046 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389950.1 protein_id gnl|my_center|LOCUS_09870 69378 68269 gene locus_tag LOCUS_09880 gene tal 69378 68269 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054288.1 protein_id gnl|my_center|LOCUS_09880 71585 69483 gene locus_tag LOCUS_09890 gene tkt 71585 69483 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117899.1 protein_id gnl|my_center|LOCUS_09890 72019 73164 gene locus_tag LOCUS_09900 gene hrcA 72019 73164 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068110.1 protein_id gnl|my_center|LOCUS_09900 73321 74463 gene locus_tag LOCUS_09910 gene dnaJ 73321 74463 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052794.1 protein_id gnl|my_center|LOCUS_09910 75502 74708 gene locus_tag LOCUS_09920 75502 74708 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817478.1 protein_id gnl|my_center|LOCUS_09920 75687 76559 gene locus_tag LOCUS_09930 gene uppP 75687 76559 CDS product undecaprenyl-diphosphatase UppP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052850.1 protein_id gnl|my_center|LOCUS_09930 77647 76793 gene locus_tag LOCUS_09940 77647 76793 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813243.1 protein_id gnl|my_center|LOCUS_09940 77852 77925 gene locus_tag LOCUS_t00260 77852 77925 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 77952 78023 gene locus_tag LOCUS_t00270 77952 78023 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 78042 78114 gene locus_tag LOCUS_t00280 78042 78114 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 78142 78215 gene locus_tag LOCUS_t00290 78142 78215 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 79666 78341 gene locus_tag LOCUS_09950 79666 78341 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054367.1 protein_id gnl|my_center|LOCUS_09950 80581 79901 gene locus_tag LOCUS_09960 80581 79901 CDS product TenA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000449822.1 protein_id gnl|my_center|LOCUS_09960 81132 82745 gene locus_tag LOCUS_09970 81132 82745 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_09970 82782 83837 gene locus_tag LOCUS_09980 82782 83837 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_09980 83849 84814 gene locus_tag LOCUS_09990 83849 84814 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_09990 84930 85613 gene locus_tag LOCUS_10000 84930 85613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 85616 87649 gene locus_tag LOCUS_10010 85616 87649 CDS product glycoside hydrolase family 32 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003042923.1 protein_id gnl|my_center|LOCUS_10010 88348 88980 gene locus_tag LOCUS_10020 88348 88980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 89192 90493 gene locus_tag LOCUS_10030 89192 90493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 90497 91501 gene locus_tag LOCUS_10040 90497 91501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 91688 93739 gene locus_tag LOCUS_10050 gene thrS 91688 93739 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115326.1 protein_id gnl|my_center|LOCUS_10050 93811 94464 gene locus_tag LOCUS_10060 93811 94464 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052854.1 protein_id gnl|my_center|LOCUS_10060 94464 95126 gene locus_tag LOCUS_10070 94464 95126 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113650.1 protein_id gnl|my_center|LOCUS_10070 95136 96146 gene locus_tag LOCUS_10080 95136 96146 CDS product phosphatidylinositol mannoside acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027829.1 protein_id gnl|my_center|LOCUS_10080 96177 97346 gene locus_tag LOCUS_10090 96177 97346 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_10090 97450 98205 gene locus_tag LOCUS_10100 97450 98205 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052855.1 protein_id gnl|my_center|LOCUS_10100 98212 98793 gene locus_tag LOCUS_10110 gene ruvC 98212 98793 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813230.1 protein_id gnl|my_center|LOCUS_10110 99070 99681 gene locus_tag LOCUS_10120 gene ruvA 99070 99681 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817463.1 protein_id gnl|my_center|LOCUS_10120 99683 100750 gene locus_tag LOCUS_10130 gene ruvB 99683 100750 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054282.1 protein_id gnl|my_center|LOCUS_10130 100826 101254 gene locus_tag LOCUS_10140 100826 101254 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052859.1 protein_id gnl|my_center|LOCUS_10140 101301 101882 gene locus_tag LOCUS_10150 101301 101882 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068112.1 protein_id gnl|my_center|LOCUS_10150 101982 103229 gene locus_tag LOCUS_10160 gene sucC 101982 103229 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052861.1 protein_id gnl|my_center|LOCUS_10160 103229 104149 gene locus_tag LOCUS_10170 gene sucD 103229 104149 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389936.1 protein_id gnl|my_center|LOCUS_10170 104149 105636 gene locus_tag LOCUS_10180 104149 105636 CDS product DUF6350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389935.1 protein_id gnl|my_center|LOCUS_10180 105636 107243 gene locus_tag LOCUS_10190 gene purH 105636 107243 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052864.1 protein_id gnl|my_center|LOCUS_10190 107582 107902 gene locus_tag LOCUS_10200 107582 107902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813210.1 protein_id gnl|my_center|LOCUS_10200 108835 107819 gene locus_tag LOCUS_10210 108835 107819 CDS product aquaporin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052865.1 protein_id gnl|my_center|LOCUS_10210 108982 109755 gene locus_tag LOCUS_10220 108982 109755 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813203.1 protein_id gnl|my_center|LOCUS_10220 109752 111881 gene locus_tag LOCUS_10230 gene der 109752 111881 CDS product bifunctional cytidylate kinase/GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389933.1 protein_id gnl|my_center|LOCUS_10230 111998 113368 gene locus_tag LOCUS_10240 111998 113368 CDS product cobalamin-independent methionine synthase II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804855.1 protein_id gnl|my_center|LOCUS_10240 113613 113687 gene locus_tag LOCUS_t00300 113613 113687 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 114362 114144 gene locus_tag LOCUS_10250 114362 114144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 114677 114477 gene locus_tag LOCUS_10260 114677 114477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 115136 114903 gene locus_tag LOCUS_10270 115136 114903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 115592 117022 gene locus_tag LOCUS_10280 115592 117022 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004115085.1 protein_id gnl|my_center|LOCUS_10280 117173 119110 gene locus_tag LOCUS_10290 117173 119110 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817902.1 protein_id gnl|my_center|LOCUS_10290 119123 119440 gene locus_tag LOCUS_10300 119123 119440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389921.1 protein_id gnl|my_center|LOCUS_10300 119446 122184 gene locus_tag LOCUS_10310 119446 122184 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068114.1 protein_id gnl|my_center|LOCUS_10310 122306 122653 gene locus_tag LOCUS_10320 122306 122653 CDS product RNA polymerase-binding protein RbpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052872.1 protein_id gnl|my_center|LOCUS_10320 122775 123497 gene locus_tag LOCUS_10330 122775 123497 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813164.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence09 1160 69 gene locus_tag LOCUS_10340 gene trpS 1160 69 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003827911.1 protein_id gnl|my_center|LOCUS_10340 1329 1874 gene locus_tag LOCUS_10350 1329 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2378 1974 gene locus_tag LOCUS_10360 2378 1974 CDS product sterol carrier family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022527180.1 protein_id gnl|my_center|LOCUS_10360 2518 4974 gene locus_tag LOCUS_10370 2518 4974 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389382.1 protein_id gnl|my_center|LOCUS_10370 5939 5667 gene locus_tag LOCUS_10380 5939 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 6114 6899 gene locus_tag LOCUS_10390 6114 6899 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013362938.1 protein_id gnl|my_center|LOCUS_10390 7512 7048 gene locus_tag LOCUS_10400 gene crgA 7512 7048 CDS product cell division protein CrgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051717.1 protein_id gnl|my_center|LOCUS_10400 7667 8344 gene locus_tag LOCUS_10410 7667 8344 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816156.1 protein_id gnl|my_center|LOCUS_10410 8352 9467 gene locus_tag LOCUS_10420 8352 9467 CDS product class E sortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068569.1 protein_id gnl|my_center|LOCUS_10420 9635 10285 gene locus_tag LOCUS_10430 9635 10285 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811402.1 protein_id gnl|my_center|LOCUS_10430 12593 10437 gene locus_tag LOCUS_10440 gene pknB 12593 10437 CDS product Stk1 family PASTA domain-containing Ser/Thr kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389386.1 protein_id gnl|my_center|LOCUS_10440 13624 12590 gene locus_tag LOCUS_10450 13624 12590 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068567.1 protein_id gnl|my_center|LOCUS_10450 15081 13621 gene locus_tag LOCUS_10460 15081 13621 CDS product penicillin-binding transpeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389388.1 protein_id gnl|my_center|LOCUS_10460 16610 15078 gene locus_tag LOCUS_10470 16610 15078 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056849.1 protein_id gnl|my_center|LOCUS_10470 18184 16607 gene locus_tag LOCUS_10480 18184 16607 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389389.1 protein_id gnl|my_center|LOCUS_10480 18706 18191 gene locus_tag LOCUS_10490 18706 18191 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051708.1 protein_id gnl|my_center|LOCUS_10490 19432 18731 gene locus_tag LOCUS_10500 19432 18731 CDS product DUF3662 and FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068566.1 protein_id gnl|my_center|LOCUS_10500 19567 21834 gene locus_tag LOCUS_10510 19567 21834 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144418951.1 protein_id gnl|my_center|LOCUS_10510 22019 24805 gene locus_tag LOCUS_10520 22019 24805 CDS product YhgE/Pip family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143686.1 protein_id gnl|my_center|LOCUS_10520 24802 27042 gene locus_tag LOCUS_10530 24802 27042 CDS product YhgE/Pip domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068631.1 protein_id gnl|my_center|LOCUS_10530 27089 28135 gene locus_tag LOCUS_10540 27089 28135 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389392.1 protein_id gnl|my_center|LOCUS_10540 28413 28252 gene locus_tag LOCUS_10550 28413 28252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 30625 28589 gene locus_tag LOCUS_10560 30625 28589 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389613.1 protein_id gnl|my_center|LOCUS_10560 32478 30625 gene locus_tag LOCUS_10570 32478 30625 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052496.1 protein_id gnl|my_center|LOCUS_10570 32924 32475 gene locus_tag LOCUS_10580 32924 32475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 34740 33436 gene locus_tag LOCUS_10590 34740 33436 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068213.1 protein_id gnl|my_center|LOCUS_10590 34911 35351 gene locus_tag LOCUS_10600 34911 35351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 35351 36298 gene locus_tag LOCUS_10610 35351 36298 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055692.1 protein_id gnl|my_center|LOCUS_10610 36627 36379 gene locus_tag LOCUS_10620 36627 36379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 38684 36780 gene locus_tag LOCUS_10630 38684 36780 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068648.1 protein_id gnl|my_center|LOCUS_10630 38845 38684 gene locus_tag LOCUS_10640 38845 38684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 40614 38842 gene locus_tag LOCUS_10650 40614 38842 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068647.1 protein_id gnl|my_center|LOCUS_10650 40652 40846 gene locus_tag LOCUS_10660 40652 40846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 41474 40971 gene locus_tag LOCUS_10670 41474 40971 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811587.1 protein_id gnl|my_center|LOCUS_10670 42505 41849 gene locus_tag LOCUS_10680 42505 41849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 42776 42693 gene locus_tag LOCUS_t00310 42776 42693 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 44187 42889 gene locus_tag LOCUS_10690 gene tgt 44187 42889 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389403.1 protein_id gnl|my_center|LOCUS_10690 44529 46676 gene locus_tag LOCUS_10700 44529 46676 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068543.1 protein_id gnl|my_center|LOCUS_10700 46969 48486 gene locus_tag LOCUS_10710 46969 48486 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068540.1 protein_id gnl|my_center|LOCUS_10710 48562 49500 gene locus_tag LOCUS_10720 gene htpX 48562 49500 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055925.1 protein_id gnl|my_center|LOCUS_10720 49822 52734 gene locus_tag LOCUS_10730 49822 52734 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012028020.1 protein_id gnl|my_center|LOCUS_10730 53011 55452 gene locus_tag LOCUS_10740 53011 55452 CDS product glycoside hydrolase family 3 C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775403.1 protein_id gnl|my_center|LOCUS_10740 55445 56029 gene locus_tag LOCUS_10750 55445 56029 CDS product GtrA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775404.1 protein_id gnl|my_center|LOCUS_10750 56182 56901 gene locus_tag LOCUS_10760 56182 56901 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775405.1 protein_id gnl|my_center|LOCUS_10760 56898 58220 gene locus_tag LOCUS_10770 56898 58220 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775459.1 protein_id gnl|my_center|LOCUS_10770 59335 58280 gene locus_tag LOCUS_10780 59335 58280 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056302.1 protein_id gnl|my_center|LOCUS_10780 59760 59831 gene locus_tag LOCUS_t00320 59760 59831 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 60037 60750 gene locus_tag LOCUS_10790 60037 60750 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820352.1 protein_id gnl|my_center|LOCUS_10790 60964 62358 gene locus_tag LOCUS_10800 60964 62358 CDS product PTS sugar transporter subunit IIC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363970.1 protein_id gnl|my_center|LOCUS_10800 62480 62782 gene locus_tag LOCUS_10810 62480 62782 CDS product PTS sugar transporter subunit IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814192.1 protein_id gnl|my_center|LOCUS_10810 62794 63126 gene locus_tag LOCUS_10820 62794 63126 CDS product PTS lactose/cellobiose transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390312.1 protein_id gnl|my_center|LOCUS_10820 63149 64612 gene locus_tag LOCUS_10830 63149 64612 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390311.1 protein_id gnl|my_center|LOCUS_10830 64770 65030 gene locus_tag LOCUS_10840 64770 65030 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051543.1 protein_id gnl|my_center|LOCUS_10840 65027 66670 gene locus_tag LOCUS_10850 gene ptsP 65027 66670 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051542.1 protein_id gnl|my_center|LOCUS_10850 66917 71965 gene locus_tag LOCUS_10860 66917 71965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 72082 74070 gene locus_tag LOCUS_10870 72082 74070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 76413 74206 gene locus_tag LOCUS_10880 76413 74206 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029390.1 protein_id gnl|my_center|LOCUS_10880 77342 76413 gene locus_tag LOCUS_10890 77342 76413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 78918 77650 gene locus_tag LOCUS_10900 78918 77650 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080545147.1 protein_id gnl|my_center|LOCUS_10900 79285 79578 gene locus_tag LOCUS_10910 79285 79578 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223409.1 protein_id gnl|my_center|LOCUS_10910 79578 80096 gene locus_tag LOCUS_10920 79578 80096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 80093 81007 gene locus_tag LOCUS_10930 80093 81007 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385088.1 protein_id gnl|my_center|LOCUS_10930 81449 81129 gene locus_tag LOCUS_10940 81449 81129 CDS product MazG-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003705442.1 protein_id gnl|my_center|LOCUS_10940 81513 82121 gene locus_tag LOCUS_10950 81513 82121 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002394583.1 protein_id gnl|my_center|LOCUS_10950 82311 83018 gene locus_tag LOCUS_10960 82311 83018 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081527.1 protein_id gnl|my_center|LOCUS_10960 83223 84290 gene locus_tag LOCUS_10970 gene fbaA 83223 84290 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389412.1 protein_id gnl|my_center|LOCUS_10970 84448 85749 gene locus_tag LOCUS_10980 84448 85749 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811495.1 protein_id gnl|my_center|LOCUS_10980 86103 87506 gene locus_tag LOCUS_10990 86103 87506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 87630 88613 gene locus_tag LOCUS_11000 87630 88613 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173609.1 protein_id gnl|my_center|LOCUS_11000 88606 89580 gene locus_tag LOCUS_11010 88606 89580 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073601368.1 protein_id gnl|my_center|LOCUS_11010 89592 90407 gene locus_tag LOCUS_11020 89592 90407 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055908.1 protein_id gnl|my_center|LOCUS_11020 90785 92029 gene locus_tag LOCUS_11030 90785 92029 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056637.1 protein_id gnl|my_center|LOCUS_11030 92302 93567 gene locus_tag LOCUS_11040 92302 93567 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389415.1 protein_id gnl|my_center|LOCUS_11040 93876 95369 gene locus_tag LOCUS_11050 gene gtfA 93876 95369 CDS product sucrose phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068532.1 protein_id gnl|my_center|LOCUS_11050 95428 96972 gene locus_tag LOCUS_11060 95428 96972 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389417.1 protein_id gnl|my_center|LOCUS_11060 97502 98932 gene locus_tag LOCUS_11070 97502 98932 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582327.1 protein_id gnl|my_center|LOCUS_11070 99302 100354 gene locus_tag LOCUS_11080 gene ilvC 99302 100354 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051650.1 protein_id gnl|my_center|LOCUS_11080 102589 100586 gene locus_tag LOCUS_11090 102589 100586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 104226 102715 gene locus_tag LOCUS_11100 104226 102715 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193349417.1 protein_id gnl|my_center|LOCUS_11100 104470 105171 gene locus_tag LOCUS_11110 104470 105171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068640.1 protein_id gnl|my_center|LOCUS_11110 105179 107827 gene locus_tag LOCUS_11120 105179 107827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 108942 107881 gene locus_tag LOCUS_11130 108942 107881 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032740908.1 protein_id gnl|my_center|LOCUS_11130 109146 110849 gene locus_tag LOCUS_11140 109146 110849 CDS product FTR1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390320.1 protein_id gnl|my_center|LOCUS_11140 110911 111525 gene locus_tag LOCUS_11150 110911 111525 CDS product iron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051584.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence10 1149 46 gene locus_tag LOCUS_11160 1149 46 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363316.1 protein_id gnl|my_center|LOCUS_11160 1843 1166 gene locus_tag LOCUS_11170 1843 1166 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053211.1 protein_id gnl|my_center|LOCUS_11170 2813 1956 gene locus_tag LOCUS_11180 2813 1956 CDS product glutamate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012471745.1 protein_id gnl|my_center|LOCUS_11180 4162 3377 gene locus_tag LOCUS_11190 4162 3377 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004137994.1 protein_id gnl|my_center|LOCUS_11190 5398 4439 gene locus_tag LOCUS_11200 5398 4439 CDS product magnesium transporter CorA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054371.1 protein_id gnl|my_center|LOCUS_11200 5770 5576 gene locus_tag LOCUS_11210 5770 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 6578 5790 gene locus_tag LOCUS_11220 6578 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 7540 6575 gene locus_tag LOCUS_11230 7540 6575 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582853.1 protein_id gnl|my_center|LOCUS_11230 7771 7586 gene locus_tag LOCUS_11240 7771 7586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 9507 7834 gene locus_tag LOCUS_11250 9507 7834 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102265.1 protein_id gnl|my_center|LOCUS_11250 11269 9608 gene locus_tag LOCUS_11260 11269 9608 CDS product SLC45 family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102208.1 protein_id gnl|my_center|LOCUS_11260 11504 12499 gene locus_tag LOCUS_11270 11504 12499 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102263.1 protein_id gnl|my_center|LOCUS_11270 15200 12510 gene locus_tag LOCUS_11280 15200 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 16487 15495 gene locus_tag LOCUS_11290 16487 15495 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068827.1 protein_id gnl|my_center|LOCUS_11290 17583 16606 gene locus_tag LOCUS_11300 17583 16606 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906069.1 protein_id gnl|my_center|LOCUS_11300 18648 17689 gene locus_tag LOCUS_11310 18648 17689 CDS product ribose ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906070.1 protein_id gnl|my_center|LOCUS_11310 20134 18650 gene locus_tag LOCUS_11320 20134 18650 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906071.1 protein_id gnl|my_center|LOCUS_11320 20572 20174 gene locus_tag LOCUS_11330 gene rbsD 20572 20174 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000750743.1 protein_id gnl|my_center|LOCUS_11330 21770 20745 gene locus_tag LOCUS_11340 21770 20745 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180947091.1 protein_id gnl|my_center|LOCUS_11340 22301 22822 gene locus_tag LOCUS_11350 22301 22822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 23145 23678 gene locus_tag LOCUS_11360 23145 23678 CDS product dihydrofolate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179664825.1 protein_id gnl|my_center|LOCUS_11360 24763 23864 gene locus_tag LOCUS_11370 24763 23864 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674264.1 protein_id gnl|my_center|LOCUS_11370 24863 26512 gene locus_tag LOCUS_11380 24863 26512 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296476.1 protein_id gnl|my_center|LOCUS_11380 26520 27476 gene locus_tag LOCUS_11390 26520 27476 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101262.1 protein_id gnl|my_center|LOCUS_11390 27733 28200 gene locus_tag LOCUS_11400 27733 28200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 29927 28266 gene locus_tag LOCUS_11410 29927 28266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 30856 29930 gene locus_tag LOCUS_11420 30856 29930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 31575 30853 gene locus_tag LOCUS_11430 31575 30853 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681373.1 protein_id gnl|my_center|LOCUS_11430 34657 31562 gene locus_tag LOCUS_11440 34657 31562 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041594898.1 protein_id gnl|my_center|LOCUS_11440 35811 34654 gene locus_tag LOCUS_11450 35811 34654 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938994.1 protein_id gnl|my_center|LOCUS_11450 38261 35808 gene locus_tag LOCUS_11460 38261 35808 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681381.1 protein_id gnl|my_center|LOCUS_11460 39769 38717 gene locus_tag LOCUS_11470 39769 38717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 40001 39928 gene locus_tag LOCUS_t00330 40001 39928 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 41414 40362 gene locus_tag LOCUS_11480 41414 40362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 42275 41553 gene locus_tag LOCUS_11490 42275 41553 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813453.1 protein_id gnl|my_center|LOCUS_11490 42786 42277 gene locus_tag LOCUS_11500 42786 42277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 44315 42930 gene locus_tag LOCUS_11510 gene glmU 44315 42930 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782812.1 protein_id gnl|my_center|LOCUS_11510 45116 44319 gene locus_tag LOCUS_11520 45116 44319 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893817.1 protein_id gnl|my_center|LOCUS_11520 45256 45185 gene locus_tag LOCUS_t00340 45256 45185 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 46290 45385 gene locus_tag LOCUS_11530 46290 45385 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052033.1 protein_id gnl|my_center|LOCUS_11530 47191 46502 gene locus_tag LOCUS_11540 gene nadD 47191 46502 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390005.1 protein_id gnl|my_center|LOCUS_11540 47743 47195 gene locus_tag LOCUS_11550 47743 47195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053591.1 protein_id gnl|my_center|LOCUS_11550 49086 47740 gene locus_tag LOCUS_11560 49086 47740 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051136.1 protein_id gnl|my_center|LOCUS_11560 50646 49324 gene locus_tag LOCUS_11570 gene glyA 50646 49324 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003856790.1 protein_id gnl|my_center|LOCUS_11570 50912 52411 gene locus_tag LOCUS_11580 gene thrC 50912 52411 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068263.1 protein_id gnl|my_center|LOCUS_11580 53194 52478 gene locus_tag LOCUS_11590 gene tenA 53194 52478 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171842511.1 protein_id gnl|my_center|LOCUS_11590 54040 53372 gene locus_tag LOCUS_11600 54040 53372 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390012.1 protein_id gnl|my_center|LOCUS_11600 54861 54037 gene locus_tag LOCUS_11610 gene thiD 54861 54037 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948480.1 protein_id gnl|my_center|LOCUS_11610 56950 55100 gene locus_tag LOCUS_11620 gene recN 56950 55100 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813477.1 protein_id gnl|my_center|LOCUS_11620 57934 56963 gene locus_tag LOCUS_11630 57934 56963 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818094.1 protein_id gnl|my_center|LOCUS_11630 59052 58279 gene locus_tag LOCUS_11640 59052 58279 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818085.1 protein_id gnl|my_center|LOCUS_11640 59245 59054 gene locus_tag LOCUS_11650 59245 59054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 60330 59260 gene locus_tag LOCUS_11660 60330 59260 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053603.1 protein_id gnl|my_center|LOCUS_11660 62246 60327 gene locus_tag LOCUS_11670 62246 60327 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390015.1 protein_id gnl|my_center|LOCUS_11670 63680 62358 gene locus_tag LOCUS_11680 gene tyrS 63680 62358 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813495.1 protein_id gnl|my_center|LOCUS_11680 64596 63871 gene locus_tag LOCUS_11690 64596 63871 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143549.1 protein_id gnl|my_center|LOCUS_11690 66158 64671 gene locus_tag LOCUS_11700 gene argH 66158 64671 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363574.1 protein_id gnl|my_center|LOCUS_11700 67616 66378 gene locus_tag LOCUS_11710 67616 66378 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813515.1 protein_id gnl|my_center|LOCUS_11710 68321 67716 gene locus_tag LOCUS_11720 gene argR 68321 67716 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817270.1 protein_id gnl|my_center|LOCUS_11720 69330 68356 gene locus_tag LOCUS_11730 gene argF 69330 68356 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813521.1 protein_id gnl|my_center|LOCUS_11730 70686 69397 gene locus_tag LOCUS_11740 70686 69397 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390022.1 protein_id gnl|my_center|LOCUS_11740 71629 70673 gene locus_tag LOCUS_11750 gene argB 71629 70673 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813526.1 protein_id gnl|my_center|LOCUS_11750 72898 71729 gene locus_tag LOCUS_11760 gene argJ 72898 71729 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390023.1 protein_id gnl|my_center|LOCUS_11760 73986 72895 gene locus_tag LOCUS_11770 gene argC 73986 72895 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068279.1 protein_id gnl|my_center|LOCUS_11770 74948 74130 gene locus_tag LOCUS_11780 74948 74130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782767.1 protein_id gnl|my_center|LOCUS_11780 77570 74952 gene locus_tag LOCUS_11790 gene pheT 77570 74952 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390025.1 protein_id gnl|my_center|LOCUS_11790 78645 77578 gene locus_tag LOCUS_11800 gene pheS 78645 77578 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051172.1 protein_id gnl|my_center|LOCUS_11800 79623 78742 gene locus_tag LOCUS_11810 79623 78742 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053618.1 protein_id gnl|my_center|LOCUS_11810 79850 81526 gene locus_tag LOCUS_11820 79850 81526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 81667 82452 gene locus_tag LOCUS_11830 81667 82452 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986489.1 protein_id gnl|my_center|LOCUS_11830 82837 83457 gene locus_tag LOCUS_11840 82837 83457 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775980.1 protein_id gnl|my_center|LOCUS_11840 86403 83674 gene locus_tag LOCUS_11850 86403 83674 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004116779.1 protein_id gnl|my_center|LOCUS_11850 87070 86438 gene locus_tag LOCUS_11860 87070 86438 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782764.1 protein_id gnl|my_center|LOCUS_11860 87140 87376 gene locus_tag LOCUS_11870 87140 87376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 88804 87395 gene locus_tag LOCUS_11880 88804 87395 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068282.1 protein_id gnl|my_center|LOCUS_11880 88836 89450 gene locus_tag LOCUS_11890 88836 89450 CDS product DUF3043 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812622.1 protein_id gnl|my_center|LOCUS_11890 89521 91062 gene locus_tag LOCUS_11900 89521 91062 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051179.1 protein_id gnl|my_center|LOCUS_11900 91342 92079 gene locus_tag LOCUS_11910 91342 92079 CDS product DUF4191 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051180.1 protein_id gnl|my_center|LOCUS_11910 92283 93719 gene locus_tag LOCUS_11920 gene glnA 92283 93719 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068284.1 protein_id gnl|my_center|LOCUS_11920 93966 94652 gene locus_tag LOCUS_11930 93966 94652 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035335.1 protein_id gnl|my_center|LOCUS_11930 95193 94696 gene locus_tag LOCUS_11940 95193 94696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 95171 96109 gene locus_tag LOCUS_11950 gene rarD 95171 96109 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814542.1 protein_id gnl|my_center|LOCUS_11950 97832 96258 gene locus_tag LOCUS_11960 97832 96258 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390163.1 protein_id gnl|my_center|LOCUS_11960 99595 98441 gene locus_tag LOCUS_11970 99595 98441 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363328.1 protein_id gnl|my_center|LOCUS_11970 102419 99732 gene locus_tag LOCUS_11980 gene ligA 102419 99732 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389738.1 protein_id gnl|my_center|LOCUS_11980 105894 102412 gene locus_tag LOCUS_11990 105894 102412 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582850.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence11 261 1871 gene locus_tag LOCUS_12000 261 1871 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054433.1 protein_id gnl|my_center|LOCUS_12000 1868 3094 gene locus_tag LOCUS_12010 1868 3094 CDS product carboxylate--amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389675.1 protein_id gnl|my_center|LOCUS_12010 3192 3932 gene locus_tag LOCUS_12020 3192 3932 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812371.1 protein_id gnl|my_center|LOCUS_12020 7612 3911 gene locus_tag LOCUS_12030 gene smc 7612 3911 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068006.1 protein_id gnl|my_center|LOCUS_12030 8997 7612 gene locus_tag LOCUS_12040 8997 7612 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389673.1 protein_id gnl|my_center|LOCUS_12040 9377 10957 gene locus_tag LOCUS_12050 9377 10957 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068002.1 protein_id gnl|my_center|LOCUS_12050 11062 11586 gene locus_tag LOCUS_12060 11062 11586 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817058.1 protein_id gnl|my_center|LOCUS_12060 11834 13339 gene locus_tag LOCUS_12070 11834 13339 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008782901.1 protein_id gnl|my_center|LOCUS_12070 13597 14826 gene locus_tag LOCUS_12080 13597 14826 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812341.1 protein_id gnl|my_center|LOCUS_12080 14911 15813 gene locus_tag LOCUS_12090 14911 15813 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389668.1 protein_id gnl|my_center|LOCUS_12090 15876 17120 gene locus_tag LOCUS_12100 15876 17120 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389667.1 protein_id gnl|my_center|LOCUS_12100 17391 17787 gene locus_tag LOCUS_tm00010 17391 17787 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 18906 18034 gene locus_tag LOCUS_12110 18906 18034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 19590 18946 gene locus_tag LOCUS_12120 19590 18946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 19888 19643 gene locus_tag LOCUS_12130 19888 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 21237 20599 gene locus_tag LOCUS_12140 21237 20599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 21526 21209 gene locus_tag LOCUS_12150 21526 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 22594 21731 gene locus_tag LOCUS_12160 22594 21731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 27876 22618 gene locus_tag LOCUS_12170 27876 22618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 28255 27971 gene locus_tag LOCUS_12180 28255 27971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 32867 28353 gene locus_tag LOCUS_12190 gene essC 32867 28353 CDS product type VII secretion protein EssC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966969.1 protein_id gnl|my_center|LOCUS_12190 34054 32903 gene locus_tag LOCUS_12200 gene essB 34054 32903 CDS product type VII secretion protein EssB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966970.1 protein_id gnl|my_center|LOCUS_12200 34320 34051 gene locus_tag LOCUS_12210 34320 34051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 34891 34313 gene locus_tag LOCUS_12220 34891 34313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 35056 38076 gene locus_tag LOCUS_12230 gene esaA 35056 38076 CDS product type VII secretion protein EsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966957.1 protein_id gnl|my_center|LOCUS_12230 40128 38362 gene locus_tag LOCUS_12240 40128 38362 CDS product zinc ABC transporter substrate-binding protein AdcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387410.1 protein_id gnl|my_center|LOCUS_12240 40355 41095 gene locus_tag LOCUS_12250 40355 41095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 41088 41579 gene locus_tag LOCUS_12260 41088 41579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 41896 41965 gene locus_tag LOCUS_t00350 41896 41965 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 42279 42815 gene locus_tag LOCUS_12270 gene dtd 42279 42815 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812335.1 protein_id gnl|my_center|LOCUS_12270 44332 43196 gene locus_tag LOCUS_12280 44332 43196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 45999 44329 gene locus_tag LOCUS_12290 gene murC 45999 44329 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389664.1 protein_id gnl|my_center|LOCUS_12290 47231 46026 gene locus_tag LOCUS_12300 47231 46026 CDS product UDP-N-acetylglucosamine--N-acetylmuramyl-(pentapeptide) pyrophosphoryl-undecaprenol N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052550.1 protein_id gnl|my_center|LOCUS_12300 48624 47278 gene locus_tag LOCUS_12310 48624 47278 CDS product putative peptidoglycan glycosyltransferase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389663.1 protein_id gnl|my_center|LOCUS_12310 50128 48617 gene locus_tag LOCUS_12320 gene murD 50128 48617 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389662.1 protein_id gnl|my_center|LOCUS_12320 51251 50148 gene locus_tag LOCUS_12330 gene mraY 51251 50148 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052547.1 protein_id gnl|my_center|LOCUS_12330 52864 51248 gene locus_tag LOCUS_12340 52864 51248 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389661.1 protein_id gnl|my_center|LOCUS_12340 53753 52866 gene locus_tag LOCUS_12350 53753 52866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067982.1 protein_id gnl|my_center|LOCUS_12350 55663 53867 gene locus_tag LOCUS_12360 55663 53867 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389659.1 protein_id gnl|my_center|LOCUS_12360 56121 55660 gene locus_tag LOCUS_12370 56121 55660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389658.1 protein_id gnl|my_center|LOCUS_12370 57182 56124 gene locus_tag LOCUS_12380 gene rsmH 57182 56124 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052542.1 protein_id gnl|my_center|LOCUS_12380 57691 57182 gene locus_tag LOCUS_12390 gene mraZ 57691 57182 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812311.1 protein_id gnl|my_center|LOCUS_12390 57941 60229 gene locus_tag LOCUS_12400 57941 60229 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052539.1 protein_id gnl|my_center|LOCUS_12400 60231 61427 gene locus_tag LOCUS_12410 gene serA 60231 61427 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363235.1 protein_id gnl|my_center|LOCUS_12410 61829 61503 gene locus_tag LOCUS_12420 61829 61503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 62554 62207 gene locus_tag LOCUS_12430 62554 62207 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056652.1 protein_id gnl|my_center|LOCUS_12430 62780 63544 gene locus_tag LOCUS_12440 gene lexA 62780 63544 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052535.1 protein_id gnl|my_center|LOCUS_12440 64682 63708 gene locus_tag LOCUS_12450 64682 63708 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812298.1 protein_id gnl|my_center|LOCUS_12450 65984 65022 gene locus_tag LOCUS_12460 65984 65022 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112440.1 protein_id gnl|my_center|LOCUS_12460 67719 66142 gene locus_tag LOCUS_12470 gene hflX 67719 66142 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067980.1 protein_id gnl|my_center|LOCUS_12470 67848 68750 gene locus_tag LOCUS_12480 67848 68750 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389654.1 protein_id gnl|my_center|LOCUS_12480 68761 72798 gene locus_tag LOCUS_12490 gene hrpA 68761 72798 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389653.1 protein_id gnl|my_center|LOCUS_12490 72910 73854 gene locus_tag LOCUS_12500 72910 73854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067979.1 protein_id gnl|my_center|LOCUS_12500 74766 74059 gene locus_tag LOCUS_12510 74766 74059 CDS product DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813127.1 protein_id gnl|my_center|LOCUS_12510 76072 74735 gene locus_tag LOCUS_12520 gene glnA 76072 74735 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812280.1 protein_id gnl|my_center|LOCUS_12520 76886 76161 gene locus_tag LOCUS_12530 gene priA 76886 76161 CDS product bifunctional 1-(5-phosphoribosyl)-5-((5-phosphoribosylamino)methylideneamino)imidazole-4-carboxamide isomerase/phosphoribosylanthranilate isomerase PriA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389648.1 protein_id gnl|my_center|LOCUS_12530 77635 76958 gene locus_tag LOCUS_12540 gene hisH 77635 76958 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812274.1 protein_id gnl|my_center|LOCUS_12540 78450 77650 gene locus_tag LOCUS_12550 78450 77650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815225.1 protein_id gnl|my_center|LOCUS_12550 79046 78447 gene locus_tag LOCUS_12560 gene hisB 79046 78447 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052519.1 protein_id gnl|my_center|LOCUS_12560 80397 79252 gene locus_tag LOCUS_12570 80397 79252 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067977.1 protein_id gnl|my_center|LOCUS_12570 81791 80394 gene locus_tag LOCUS_12580 gene hisD 81791 80394 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812265.1 protein_id gnl|my_center|LOCUS_12580 85555 81995 gene locus_tag LOCUS_12590 gene dnaE 85555 81995 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582833.1 protein_id gnl|my_center|LOCUS_12590 86582 85650 gene locus_tag LOCUS_12600 86582 85650 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389630.1 protein_id gnl|my_center|LOCUS_12600 87100 86579 gene locus_tag LOCUS_12610 87100 86579 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812197.1 protein_id gnl|my_center|LOCUS_12610 88436 87168 gene locus_tag LOCUS_12620 88436 87168 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812192.1 protein_id gnl|my_center|LOCUS_12620 88816 88535 gene locus_tag LOCUS_12630 88816 88535 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812190.1 protein_id gnl|my_center|LOCUS_12630 89533 89069 gene locus_tag LOCUS_12640 89533 89069 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053320.1 protein_id gnl|my_center|LOCUS_12640 90745 89552 gene locus_tag LOCUS_12650 gene ftsZ 90745 89552 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112391.1 protein_id gnl|my_center|LOCUS_12650 92147 90879 gene locus_tag LOCUS_12660 gene dusB 92147 90879 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812184.1 protein_id gnl|my_center|LOCUS_12660 93651 92134 gene locus_tag LOCUS_12670 93651 92134 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363202.1 protein_id gnl|my_center|LOCUS_12670 93971 94900 gene locus_tag LOCUS_12680 93971 94900 CDS product hydroxyethylthiazole kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817328.1 protein_id gnl|my_center|LOCUS_12680 95046 95771 gene locus_tag LOCUS_12690 95046 95771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 95927 96280 gene locus_tag LOCUS_12700 95927 96280 CDS product thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053312.1 protein_id gnl|my_center|LOCUS_12700 97185 96394 gene locus_tag LOCUS_12710 97185 96394 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812239.1 protein_id gnl|my_center|LOCUS_12710 97976 97188 gene locus_tag LOCUS_12720 gene recO 97976 97188 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055411.1 protein_id gnl|my_center|LOCUS_12720 99695 98055 gene locus_tag LOCUS_12730 99695 98055 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067955.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence12 1764 139 gene locus_tag LOCUS_12740 1764 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 2571 3434 gene locus_tag LOCUS_12750 2571 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254037.1 protein_id gnl|my_center|LOCUS_12750 3434 3583 gene locus_tag LOCUS_12760 3434 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3620 4912 gene locus_tag LOCUS_12770 3620 4912 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002267735.1 protein_id gnl|my_center|LOCUS_12770 4922 6058 gene locus_tag LOCUS_12780 4922 6058 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003548666.1 protein_id gnl|my_center|LOCUS_12780 6072 7187 gene locus_tag LOCUS_12790 gene wecB 6072 7187 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003646267.1 protein_id gnl|my_center|LOCUS_12790 8975 7227 gene locus_tag LOCUS_12800 8975 7227 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114980.1 protein_id gnl|my_center|LOCUS_12800 9538 10605 gene locus_tag LOCUS_12810 gene glsA 9538 10605 CDS product glutaminase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816578.1 protein_id gnl|my_center|LOCUS_12810 10657 12321 gene locus_tag LOCUS_12820 10657 12321 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213976.1 protein_id gnl|my_center|LOCUS_12820 13130 12345 gene locus_tag LOCUS_12830 13130 12345 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000640334.1 protein_id gnl|my_center|LOCUS_12830 14081 13230 gene locus_tag LOCUS_12840 14081 13230 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287475.1 protein_id gnl|my_center|LOCUS_12840 14287 14754 gene locus_tag LOCUS_12850 14287 14754 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287477.1 protein_id gnl|my_center|LOCUS_12850 15926 14856 gene locus_tag LOCUS_12860 15926 14856 CDS product aldehyde reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088575.1 protein_id gnl|my_center|LOCUS_12860 16189 17082 gene locus_tag LOCUS_12870 16189 17082 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052677.1 protein_id gnl|my_center|LOCUS_12870 17352 17960 gene locus_tag LOCUS_12880 17352 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 19301 17988 gene locus_tag LOCUS_12890 19301 17988 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389592.1 protein_id gnl|my_center|LOCUS_12890 20965 19379 gene locus_tag LOCUS_12900 20965 19379 CDS product PucR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223101.1 protein_id gnl|my_center|LOCUS_12900 21174 22127 gene locus_tag LOCUS_12910 21174 22127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 22213 23601 gene locus_tag LOCUS_12920 22213 23601 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113879.1 protein_id gnl|my_center|LOCUS_12920 23638 24489 gene locus_tag LOCUS_12930 23638 24489 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228350.1 protein_id gnl|my_center|LOCUS_12930 24564 25940 gene locus_tag LOCUS_12940 gene gabT 24564 25940 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112244.1 protein_id gnl|my_center|LOCUS_12940 27129 26086 gene locus_tag LOCUS_12950 27129 26086 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003824238.1 protein_id gnl|my_center|LOCUS_12950 28360 27134 gene locus_tag LOCUS_12960 28360 27134 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819405.1 protein_id gnl|my_center|LOCUS_12960 29056 28484 gene locus_tag LOCUS_12970 29056 28484 CDS product DUF3566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051760.1 protein_id gnl|my_center|LOCUS_12970 31786 29123 gene locus_tag LOCUS_12980 gene gyrA 31786 29123 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399363.1 protein_id gnl|my_center|LOCUS_12980 34001 31866 gene locus_tag LOCUS_12990 gene gyrB 34001 31866 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994524.1 protein_id gnl|my_center|LOCUS_12990 34642 34142 gene locus_tag LOCUS_13000 34642 34142 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815036.1 protein_id gnl|my_center|LOCUS_13000 35862 34645 gene locus_tag LOCUS_13010 35862 34645 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054593.1 protein_id gnl|my_center|LOCUS_13010 37024 35900 gene locus_tag LOCUS_13020 gene dnaN 37024 35900 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815931.1 protein_id gnl|my_center|LOCUS_13020 39046 37439 gene locus_tag LOCUS_13030 gene dnaA 39046 37439 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815928.1 protein_id gnl|my_center|LOCUS_13030 39557 39937 gene locus_tag LOCUS_13040 gene rnpA 39557 39937 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051769.1 protein_id gnl|my_center|LOCUS_13040 39934 40245 gene locus_tag LOCUS_13050 gene yidD 39934 40245 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051770.1 protein_id gnl|my_center|LOCUS_13050 40248 41267 gene locus_tag LOCUS_13060 gene yidC 40248 41267 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819388.1 protein_id gnl|my_center|LOCUS_13060 41528 42085 gene locus_tag LOCUS_13070 41528 42085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390392.1 protein_id gnl|my_center|LOCUS_13070 42282 43103 gene locus_tag LOCUS_13080 gene rsmG 42282 43103 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390391.1 protein_id gnl|my_center|LOCUS_13080 44214 45215 gene locus_tag LOCUS_13090 44214 45215 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013364057.1 protein_id gnl|my_center|LOCUS_13090 45217 46659 gene locus_tag LOCUS_13100 45217 46659 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068597.1 protein_id gnl|my_center|LOCUS_13100 47840 46776 gene locus_tag LOCUS_13110 gene trxB 47840 46776 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114045.1 protein_id gnl|my_center|LOCUS_13110 48172 48708 gene locus_tag LOCUS_13120 48172 48708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 49142 51181 gene locus_tag LOCUS_13130 49142 51181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 52552 51464 gene locus_tag LOCUS_13140 52552 51464 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231062.1 protein_id gnl|my_center|LOCUS_13140 53940 52621 gene locus_tag LOCUS_13150 53940 52621 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231061.1 protein_id gnl|my_center|LOCUS_13150 57971 54120 gene locus_tag LOCUS_13160 57971 54120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 60247 57968 gene locus_tag LOCUS_13170 60247 57968 CDS product DUF6049 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173361541.1 protein_id gnl|my_center|LOCUS_13170 60909 60244 gene locus_tag LOCUS_13180 60909 60244 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815006.1 protein_id gnl|my_center|LOCUS_13180 60987 62405 gene locus_tag LOCUS_13190 60987 62405 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051791.1 protein_id gnl|my_center|LOCUS_13190 63295 62672 gene locus_tag LOCUS_13200 63295 62672 CDS product LytR C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815003.1 protein_id gnl|my_center|LOCUS_13200 64316 63396 gene locus_tag LOCUS_13210 64316 63396 CDS product 4-diphosphocytidyl-2C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143648.1 protein_id gnl|my_center|LOCUS_13210 65233 64313 gene locus_tag LOCUS_13220 gene rsmA 65233 64313 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819709.1 protein_id gnl|my_center|LOCUS_13220 66710 65244 gene locus_tag LOCUS_13230 66710 65244 CDS product ubiquitin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390384.1 protein_id gnl|my_center|LOCUS_13230 67373 67299 gene locus_tag LOCUS_t00360 67373 67299 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 68496 67528 gene locus_tag LOCUS_13240 68496 67528 CDS product protein disulfide-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390383.1 protein_id gnl|my_center|LOCUS_13240 70717 68594 gene locus_tag LOCUS_13250 70717 68594 CDS product serine/threonine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783044.1 protein_id gnl|my_center|LOCUS_13250 71090 72217 gene locus_tag LOCUS_13260 gene ugpC 71090 72217 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051809.1 protein_id gnl|my_center|LOCUS_13260 72484 73881 gene locus_tag LOCUS_13270 72484 73881 CDS product DUF4032 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390376.1 protein_id gnl|my_center|LOCUS_13270 75066 74077 gene locus_tag LOCUS_13280 gene rlmB 75066 74077 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814978.1 protein_id gnl|my_center|LOCUS_13280 75376 78324 gene locus_tag LOCUS_13290 75376 78324 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390375.1 protein_id gnl|my_center|LOCUS_13290 79073 78483 gene locus_tag LOCUS_13300 gene dcd 79073 78483 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814973.1 protein_id gnl|my_center|LOCUS_13300 79484 80287 gene locus_tag LOCUS_13310 79484 80287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068622.1 protein_id gnl|my_center|LOCUS_13310 80343 81104 gene locus_tag LOCUS_13320 80343 81104 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143642.1 protein_id gnl|my_center|LOCUS_13320 83564 81273 gene locus_tag LOCUS_13330 83564 81273 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068624.1 protein_id gnl|my_center|LOCUS_13330 84039 86834 gene locus_tag LOCUS_13340 84039 86834 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545920.1 protein_id gnl|my_center|LOCUS_13340 86901 87494 gene locus_tag LOCUS_13350 86901 87494 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390371.1 protein_id gnl|my_center|LOCUS_13350 87734 89959 gene locus_tag LOCUS_13360 87734 89959 CDS product alpha-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390374.1 protein_id gnl|my_center|LOCUS_13360 90237 91055 gene locus_tag LOCUS_13370 90237 91055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 92451 91165 gene locus_tag LOCUS_13380 92451 91165 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054616.1 protein_id gnl|my_center|LOCUS_13380 92678 93997 gene locus_tag LOCUS_13390 92678 93997 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068626.1 protein_id gnl|my_center|LOCUS_13390 94023 94949 gene locus_tag LOCUS_13400 94023 94949 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051829.1 protein_id gnl|my_center|LOCUS_13400 94951 95829 gene locus_tag LOCUS_13410 94951 95829 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051830.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence13 1718 141 gene locus_tag LOCUS_13420 1718 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1947 4703 gene locus_tag LOCUS_13430 1947 4703 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068577.1 protein_id gnl|my_center|LOCUS_13430 4924 5973 gene locus_tag LOCUS_13440 4924 5973 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905888.1 protein_id gnl|my_center|LOCUS_13440 6351 7628 gene locus_tag LOCUS_13450 6351 7628 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068584.1 protein_id gnl|my_center|LOCUS_13450 9695 7899 gene locus_tag LOCUS_13460 9695 7899 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056574.1 protein_id gnl|my_center|LOCUS_13460 10437 9874 gene locus_tag LOCUS_13470 gene ahpC 10437 9874 CDS product alkyl hydroperoxide reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817384.1 protein_id gnl|my_center|LOCUS_13470 10696 11328 gene locus_tag LOCUS_13480 10696 11328 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389340.1 protein_id gnl|my_center|LOCUS_13480 11424 12752 gene locus_tag LOCUS_13490 11424 12752 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582296.1 protein_id gnl|my_center|LOCUS_13490 12919 13398 gene locus_tag LOCUS_13500 12919 13398 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051742.1 protein_id gnl|my_center|LOCUS_13500 15701 13548 gene locus_tag LOCUS_13510 15701 13548 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002391620.1 protein_id gnl|my_center|LOCUS_13510 19306 15791 gene locus_tag LOCUS_13520 19306 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002386656.1 protein_id gnl|my_center|LOCUS_13520 20388 19483 gene locus_tag LOCUS_13530 20388 19483 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030092.1 protein_id gnl|my_center|LOCUS_13530 22116 20464 gene locus_tag LOCUS_13540 22116 20464 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538283.1 protein_id gnl|my_center|LOCUS_13540 23069 22113 gene locus_tag LOCUS_13550 23069 22113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 24055 23075 gene locus_tag LOCUS_13560 24055 23075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803789.1 protein_id gnl|my_center|LOCUS_13560 25689 24202 gene locus_tag LOCUS_13570 25689 24202 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383105.1 protein_id gnl|my_center|LOCUS_13570 25652 25891 gene locus_tag LOCUS_13580 25652 25891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 26154 27272 gene locus_tag LOCUS_13590 26154 27272 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920175.1 protein_id gnl|my_center|LOCUS_13590 28007 27447 gene locus_tag LOCUS_13600 28007 27447 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389336.1 protein_id gnl|my_center|LOCUS_13600 28384 28458 gene locus_tag LOCUS_t00370 28384 28458 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 29603 28395 gene locus_tag LOCUS_13610 29603 28395 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262511.1 protein_id gnl|my_center|LOCUS_13610 29836 29600 gene locus_tag LOCUS_13620 29836 29600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 30624 29833 gene locus_tag LOCUS_13630 30624 29833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 31447 31106 gene locus_tag LOCUS_13640 31447 31106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 31672 32403 gene locus_tag LOCUS_13650 31672 32403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 34412 32454 gene locus_tag LOCUS_13660 34412 32454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 35628 34474 gene locus_tag LOCUS_13670 35628 34474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 35682 35957 gene locus_tag LOCUS_13680 35682 35957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 36759 36082 gene locus_tag LOCUS_13690 36759 36082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 37070 37777 gene locus_tag LOCUS_13700 37070 37777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 37875 38972 gene locus_tag LOCUS_13710 37875 38972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 39414 39106 gene locus_tag LOCUS_13720 39414 39106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 39553 39783 gene locus_tag LOCUS_13730 39553 39783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 40543 39791 gene locus_tag LOCUS_13740 40543 39791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 41023 41097 gene locus_tag LOCUS_t00380 41023 41097 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 42254 41100 gene locus_tag LOCUS_13750 42254 41100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 42913 42449 gene locus_tag LOCUS_13760 42913 42449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 43099 43353 gene locus_tag LOCUS_13770 43099 43353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 43446 43718 gene locus_tag LOCUS_13780 43446 43718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 43766 45073 gene locus_tag LOCUS_13790 43766 45073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 45073 45414 gene locus_tag LOCUS_13800 45073 45414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 45407 45721 gene locus_tag LOCUS_13810 45407 45721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 45714 45977 gene locus_tag LOCUS_13820 45714 45977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 45974 46132 gene locus_tag LOCUS_13830 45974 46132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 46132 46419 gene locus_tag LOCUS_13840 46132 46419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 46416 47150 gene locus_tag LOCUS_13850 46416 47150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 47237 47674 gene locus_tag LOCUS_13860 47237 47674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 47893 48426 gene locus_tag LOCUS_13870 47893 48426 CDS product bifunctional DNA primase/polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389872.1 protein_id gnl|my_center|LOCUS_13870 48583 48858 gene locus_tag LOCUS_13880 48583 48858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 49091 48846 gene locus_tag LOCUS_13890 49091 48846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 49780 49457 gene locus_tag LOCUS_13900 49780 49457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 50159 51478 gene locus_tag LOCUS_13910 50159 51478 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899420.1 protein_id gnl|my_center|LOCUS_13910 51979 51494 gene locus_tag LOCUS_13920 51979 51494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 52358 51969 gene locus_tag LOCUS_13930 52358 51969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 52445 52744 gene locus_tag LOCUS_13940 52445 52744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 52737 52964 gene locus_tag LOCUS_13950 52737 52964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 52961 53833 gene locus_tag LOCUS_13960 52961 53833 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389865.1 protein_id gnl|my_center|LOCUS_13960 54435 58166 gene locus_tag LOCUS_13970 54435 58166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 58252 58398 gene locus_tag LOCUS_13980 58252 58398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 58532 59602 gene locus_tag LOCUS_13990 58532 59602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 59613 60242 gene locus_tag LOCUS_14000 59613 60242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 60239 61576 gene locus_tag LOCUS_14010 60239 61576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 61704 62030 gene locus_tag LOCUS_14020 61704 62030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 62031 62756 gene locus_tag LOCUS_14030 62031 62756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 62756 64375 gene locus_tag LOCUS_14040 62756 64375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 64372 65889 gene locus_tag LOCUS_14050 64372 65889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068083.1 protein_id gnl|my_center|LOCUS_14050 65900 67384 gene locus_tag LOCUS_14060 65900 67384 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080790597.1 protein_id gnl|my_center|LOCUS_14060 67371 69086 gene locus_tag LOCUS_14070 67371 69086 CDS product type IV secretory system conjugative DNA transfer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068079.1 protein_id gnl|my_center|LOCUS_14070 69073 69579 gene locus_tag LOCUS_14080 69073 69579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 70387 69533 gene locus_tag LOCUS_14090 70387 69533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 72123 70414 gene locus_tag LOCUS_14100 72123 70414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 72692 72120 gene locus_tag LOCUS_14110 72692 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 72846 73154 gene locus_tag LOCUS_14120 72846 73154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 73634 73260 gene locus_tag LOCUS_14130 73634 73260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 74804 74091 gene locus_tag LOCUS_14140 74804 74091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002389885.1 protein_id gnl|my_center|LOCUS_14140 75126 74818 gene locus_tag LOCUS_14150 75126 74818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 75377 75132 gene locus_tag LOCUS_14160 75377 75132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 75896 75528 gene locus_tag LOCUS_14170 75896 75528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 76517 76071 gene locus_tag LOCUS_14180 76517 76071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 77387 77818 gene locus_tag LOCUS_14190 77387 77818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 78175 77855 gene locus_tag LOCUS_14200 78175 77855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14200 78575 78282 gene locus_tag LOCUS_14210 78575 78282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 79165 78905 gene locus_tag LOCUS_14220 79165 78905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 79363 80487 gene locus_tag LOCUS_14230 gene arsB 79363 80487 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174265970.1 protein_id gnl|my_center|LOCUS_14230 80538 80951 gene locus_tag LOCUS_14240 gene arsD 80538 80951 CDS product arsenite efflux transporter metallochaperone ArsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012540111.1 protein_id gnl|my_center|LOCUS_14240 80981 82765 gene locus_tag LOCUS_14250 gene arsA 80981 82765 CDS product arsenite efflux transporter ATPase subunit ArsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817073.1 protein_id gnl|my_center|LOCUS_14250 82791 84185 gene locus_tag LOCUS_14260 82791 84185 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005112740.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence14 2710 452 gene locus_tag LOCUS_14270 2710 452 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964773.1 protein_id gnl|my_center|LOCUS_14270 3192 2707 gene locus_tag LOCUS_14280 3192 2707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 5131 3512 gene locus_tag LOCUS_14290 5131 3512 CDS product Cna B-type domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190216.1 protein_id gnl|my_center|LOCUS_14290 5538 6836 gene locus_tag LOCUS_14300 5538 6836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 7319 7074 gene locus_tag LOCUS_14310 7319 7074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 8449 8006 gene locus_tag LOCUS_14320 8449 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8740 9591 gene locus_tag LOCUS_14330 8740 9591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369253.1 protein_id gnl|my_center|LOCUS_14330 10723 9722 gene locus_tag LOCUS_14340 10723 9722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 10922 10743 gene locus_tag LOCUS_14350 10922 10743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 11586 10915 gene locus_tag LOCUS_14360 11586 10915 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976951.1 protein_id gnl|my_center|LOCUS_14360 11679 12260 gene locus_tag LOCUS_14370 11679 12260 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228115.1 protein_id gnl|my_center|LOCUS_14370 14301 12961 gene locus_tag LOCUS_14380 14301 12961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776735.1 protein_id gnl|my_center|LOCUS_14380 14725 14330 gene locus_tag LOCUS_14390 14725 14330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 15768 14860 gene locus_tag LOCUS_14400 15768 14860 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776965.1 protein_id gnl|my_center|LOCUS_14400 16482 15826 gene locus_tag LOCUS_14410 16482 15826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776966.1 protein_id gnl|my_center|LOCUS_14410 17150 16485 gene locus_tag LOCUS_14420 17150 16485 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083756.1 protein_id gnl|my_center|LOCUS_14420 17959 17147 gene locus_tag LOCUS_14430 17959 17147 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776968.1 protein_id gnl|my_center|LOCUS_14430 17916 18155 gene locus_tag LOCUS_14440 17916 18155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18765 18259 gene locus_tag LOCUS_14450 18765 18259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 19334 18762 gene locus_tag LOCUS_14460 19334 18762 CDS product TetR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031717.1 protein_id gnl|my_center|LOCUS_14460 19425 20009 gene locus_tag LOCUS_14470 19425 20009 CDS product DUF1349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804427.1 protein_id gnl|my_center|LOCUS_14470 20293 22416 gene locus_tag LOCUS_14480 20293 22416 CDS product glucose PTS transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390207.1 protein_id gnl|my_center|LOCUS_14480 22468 23331 gene locus_tag LOCUS_14490 22468 23331 CDS product PRD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363838.1 protein_id gnl|my_center|LOCUS_14490 23464 23730 gene locus_tag LOCUS_14500 23464 23730 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804003.1 protein_id gnl|my_center|LOCUS_14500 23720 25426 gene locus_tag LOCUS_14510 gene ptsP 23720 25426 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013231021.1 protein_id gnl|my_center|LOCUS_14510 25602 28238 gene locus_tag LOCUS_14520 25602 28238 CDS product excinuclease ABC subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389901.1 protein_id gnl|my_center|LOCUS_14520 28341 28601 gene locus_tag LOCUS_14530 28341 28601 CDS product SemiSWEET family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001291476.1 protein_id gnl|my_center|LOCUS_14530 29641 28691 gene locus_tag LOCUS_14540 29641 28691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 29616 29780 gene locus_tag LOCUS_14550 29616 29780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 29872 30372 gene locus_tag LOCUS_14560 29872 30372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 31289 30447 gene locus_tag LOCUS_14570 31289 30447 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_14570 31422 32321 gene locus_tag LOCUS_14580 31422 32321 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003644459.1 protein_id gnl|my_center|LOCUS_14580 33282 32332 gene locus_tag LOCUS_14590 33282 32332 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803844.1 protein_id gnl|my_center|LOCUS_14590 34426 33350 gene locus_tag LOCUS_14600 34426 33350 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049749196.1 protein_id gnl|my_center|LOCUS_14600 34802 34464 gene locus_tag LOCUS_14610 34802 34464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 34880 35905 gene locus_tag LOCUS_14620 34880 35905 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_14620 35937 36713 gene locus_tag LOCUS_14630 35937 36713 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020468.1 protein_id gnl|my_center|LOCUS_14630 36794 37744 gene locus_tag LOCUS_14640 36794 37744 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813997.1 protein_id gnl|my_center|LOCUS_14640 37842 38774 gene locus_tag LOCUS_14650 37842 38774 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225571.1 protein_id gnl|my_center|LOCUS_14650 38846 39919 gene locus_tag LOCUS_14660 38846 39919 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225577.1 protein_id gnl|my_center|LOCUS_14660 39916 40356 gene locus_tag LOCUS_14670 39916 40356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14670 40316 40879 gene locus_tag LOCUS_14680 40316 40879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14680 41515 40958 gene locus_tag LOCUS_14690 41515 40958 CDS product DapH/DapD/GlmU-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287468.1 protein_id gnl|my_center|LOCUS_14690 42163 41693 gene locus_tag LOCUS_14700 42163 41693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 42640 43923 gene locus_tag LOCUS_14710 42640 43923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 44419 43955 gene locus_tag LOCUS_14720 44419 43955 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005056723.1 protein_id gnl|my_center|LOCUS_14720 44509 45351 gene locus_tag LOCUS_14730 44509 45351 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015343.1 protein_id gnl|my_center|LOCUS_14730 45470 46372 gene locus_tag LOCUS_14740 45470 46372 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705071.1 protein_id gnl|my_center|LOCUS_14740 47119 46424 gene locus_tag LOCUS_14750 47119 46424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 47418 48356 gene locus_tag LOCUS_14760 gene lnrL 47418 48356 CDS product linearmycin resistance ATP-binding protein LnrL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244346.1 protein_id gnl|my_center|LOCUS_14760 48359 49141 gene locus_tag LOCUS_14770 48359 49141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 49248 50963 gene locus_tag LOCUS_14780 49248 50963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 52412 51003 gene locus_tag LOCUS_14790 52412 51003 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108360.1 protein_id gnl|my_center|LOCUS_14790 52736 54037 gene locus_tag LOCUS_14800 52736 54037 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814398.1 protein_id gnl|my_center|LOCUS_14800 56197 54110 gene locus_tag LOCUS_14810 56197 54110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 57080 56175 gene locus_tag LOCUS_14820 57080 56175 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922156.1 protein_id gnl|my_center|LOCUS_14820 57492 57073 gene locus_tag LOCUS_14830 57492 57073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 57717 58457 gene locus_tag LOCUS_14840 57717 58457 CDS product VIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003893323.1 protein_id gnl|my_center|LOCUS_14840 58537 58857 gene locus_tag LOCUS_14850 58537 58857 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948666.1 protein_id gnl|my_center|LOCUS_14850 58912 59523 gene locus_tag LOCUS_14860 58912 59523 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275226.1 protein_id gnl|my_center|LOCUS_14860 60597 59527 gene locus_tag LOCUS_14870 60597 59527 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003817320.1 protein_id gnl|my_center|LOCUS_14870 61793 60786 gene locus_tag LOCUS_14880 61793 60786 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931329.1 protein_id gnl|my_center|LOCUS_14880 62743 61790 gene locus_tag LOCUS_14890 gene yihV 62743 61790 CDS product sulfofructose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621642.1 protein_id gnl|my_center|LOCUS_14890 62911 63183 gene locus_tag LOCUS_14900 62911 63183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 66647 63072 gene locus_tag LOCUS_14910 66647 63072 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389461.1 protein_id gnl|my_center|LOCUS_14910 68065 66887 gene locus_tag LOCUS_14920 68065 66887 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005086973.1 protein_id gnl|my_center|LOCUS_14920 68463 68062 gene locus_tag LOCUS_14930 68463 68062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005083563.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence15 361 1185 gene locus_tag LOCUS_14940 361 1185 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219082261.1 protein_id gnl|my_center|LOCUS_14940 1210 1644 gene locus_tag LOCUS_14950 1210 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2031 1699 gene locus_tag LOCUS_14960 2031 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 2664 2050 gene locus_tag LOCUS_14970 2664 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 3566 2922 gene locus_tag LOCUS_14980 3566 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 5472 3574 gene locus_tag LOCUS_14990 5472 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 7073 5469 gene locus_tag LOCUS_15000 7073 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 7573 7178 gene locus_tag LOCUS_15010 7573 7178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 7992 7570 gene locus_tag LOCUS_15020 7992 7570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068459.1 protein_id gnl|my_center|LOCUS_15020 8411 7995 gene locus_tag LOCUS_15030 8411 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068458.1 protein_id gnl|my_center|LOCUS_15030 8792 8421 gene locus_tag LOCUS_15040 8792 8421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 9127 8789 gene locus_tag LOCUS_15050 9127 8789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068456.1 protein_id gnl|my_center|LOCUS_15050 10713 9139 gene locus_tag LOCUS_15060 10713 9139 CDS product HK97 family phage prohead protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068455.1 protein_id gnl|my_center|LOCUS_15060 11848 10727 gene locus_tag LOCUS_15070 11848 10727 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068454.1 protein_id gnl|my_center|LOCUS_15070 13392 11947 gene locus_tag LOCUS_15080 13392 11947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072725739.1 protein_id gnl|my_center|LOCUS_15080 13694 13389 gene locus_tag LOCUS_15090 13694 13389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 14542 13805 gene locus_tag LOCUS_15100 14542 13805 CDS product HNH endonuclease signature motif containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068451.1 protein_id gnl|my_center|LOCUS_15100 14736 14542 gene locus_tag LOCUS_15110 14736 14542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 15099 14749 gene locus_tag LOCUS_15120 15099 14749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 15384 15103 gene locus_tag LOCUS_15130 15384 15103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 15961 15761 gene locus_tag LOCUS_15140 15961 15761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 16098 15961 gene locus_tag LOCUS_15150 16098 15961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 16457 16095 gene locus_tag LOCUS_15160 16457 16095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 16656 16462 gene locus_tag LOCUS_15170 16656 16462 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068447.1 protein_id gnl|my_center|LOCUS_15170 17178 17104 gene locus_tag LOCUS_t00390 17178 17104 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17577 18635 gene locus_tag LOCUS_15180 gene metA 17577 18635 CDS product homoserine O-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054763.1 protein_id gnl|my_center|LOCUS_15180 18657 18860 gene locus_tag LOCUS_15190 18657 18860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 18890 19702 gene locus_tag LOCUS_15200 gene atpB 18890 19702 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051483.1 protein_id gnl|my_center|LOCUS_15200 19769 19999 gene locus_tag LOCUS_15210 gene atpE 19769 19999 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003831420.1 protein_id gnl|my_center|LOCUS_15210 20048 20578 gene locus_tag LOCUS_15220 20048 20578 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003819064.1 protein_id gnl|my_center|LOCUS_15220 20621 21451 gene locus_tag LOCUS_15230 20621 21451 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054765.1 protein_id gnl|my_center|LOCUS_15230 21498 23129 gene locus_tag LOCUS_15240 gene atpA 21498 23129 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051480.1 protein_id gnl|my_center|LOCUS_15240 23133 24065 gene locus_tag LOCUS_15250 23133 24065 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051479.1 protein_id gnl|my_center|LOCUS_15250 24074 25564 gene locus_tag LOCUS_15260 gene atpD 24074 25564 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004120484.1 protein_id gnl|my_center|LOCUS_15260 25564 25857 gene locus_tag LOCUS_15270 25564 25857 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054766.1 protein_id gnl|my_center|LOCUS_15270 26065 26853 gene locus_tag LOCUS_15280 gene nucS 26065 26853 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051476.1 protein_id gnl|my_center|LOCUS_15280 26985 26788 gene locus_tag LOCUS_15290 26985 26788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 27244 27480 gene locus_tag LOCUS_15300 27244 27480 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114274.1 protein_id gnl|my_center|LOCUS_15300 28622 27633 gene locus_tag LOCUS_15310 28622 27633 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389466.1 protein_id gnl|my_center|LOCUS_15310 28768 30126 gene locus_tag LOCUS_15320 28768 30126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 30123 31130 gene locus_tag LOCUS_15330 30123 31130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399332.1 protein_id gnl|my_center|LOCUS_15330 31225 32193 gene locus_tag LOCUS_15340 31225 32193 CDS product co-chaperone YbbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389468.1 protein_id gnl|my_center|LOCUS_15340 32976 32281 gene locus_tag LOCUS_15350 32976 32281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162098243.1 protein_id gnl|my_center|LOCUS_15350 33075 33148 gene locus_tag LOCUS_t00400 33075 33148 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 34220 33201 gene locus_tag LOCUS_15360 34220 33201 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051644.1 protein_id gnl|my_center|LOCUS_15360 34493 35893 gene locus_tag LOCUS_15370 34493 35893 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118145.1 protein_id gnl|my_center|LOCUS_15370 36018 36947 gene locus_tag LOCUS_15380 36018 36947 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994448.1 protein_id gnl|my_center|LOCUS_15380 36944 37759 gene locus_tag LOCUS_15390 36944 37759 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113800.1 protein_id gnl|my_center|LOCUS_15390 37810 40353 gene locus_tag LOCUS_15400 37810 40353 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_15400 40538 40933 gene locus_tag LOCUS_15410 40538 40933 CDS product Rid family detoxifying hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054771.1 protein_id gnl|my_center|LOCUS_15410 43405 41087 gene locus_tag LOCUS_15420 43405 41087 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052488.1 protein_id gnl|my_center|LOCUS_15420 43888 44967 gene locus_tag LOCUS_15430 43888 44967 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002382199.1 protein_id gnl|my_center|LOCUS_15430 44977 45903 gene locus_tag LOCUS_15440 44977 45903 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357901.1 protein_id gnl|my_center|LOCUS_15440 46030 47655 gene locus_tag LOCUS_15450 46030 47655 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357899.1 protein_id gnl|my_center|LOCUS_15450 47836 49236 gene locus_tag LOCUS_15460 47836 49236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 49233 49850 gene locus_tag LOCUS_15470 49233 49850 CDS product DUF624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921876.1 protein_id gnl|my_center|LOCUS_15470 49947 50591 gene locus_tag LOCUS_15480 49947 50591 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230338.1 protein_id gnl|my_center|LOCUS_15480 50808 52586 gene locus_tag LOCUS_15490 gene argS 50808 52586 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004138659.1 protein_id gnl|my_center|LOCUS_15490 52590 54188 gene locus_tag LOCUS_15500 52590 54188 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389477.1 protein_id gnl|my_center|LOCUS_15500 54299 55612 gene locus_tag LOCUS_15510 54299 55612 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389478.1 protein_id gnl|my_center|LOCUS_15510 55624 56691 gene locus_tag LOCUS_15520 55624 56691 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068713.1 protein_id gnl|my_center|LOCUS_15520 56745 58070 gene locus_tag LOCUS_15530 56745 58070 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389479.1 protein_id gnl|my_center|LOCUS_15530 58226 59029 gene locus_tag LOCUS_15540 58226 59029 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143208.1 protein_id gnl|my_center|LOCUS_15540 59026 60438 gene locus_tag LOCUS_15550 59026 60438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068715.1 protein_id gnl|my_center|LOCUS_15550 61410 60466 gene locus_tag LOCUS_15560 61410 60466 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053065.1 protein_id gnl|my_center|LOCUS_15560 61543 62817 gene locus_tag LOCUS_15570 gene dapE 61543 62817 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811704.1 protein_id gnl|my_center|LOCUS_15570 63057 63650 gene locus_tag LOCUS_15580 63057 63650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 63968 65161 gene locus_tag LOCUS_15590 63968 65161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 65688 68714 gene locus_tag LOCUS_15600 65688 68714 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582944.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence16 870 193 gene locus_tag LOCUS_15610 870 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814794.1 protein_id gnl|my_center|LOCUS_15610 1160 1468 gene locus_tag LOCUS_15620 gene rplU 1160 1468 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053062.1 protein_id gnl|my_center|LOCUS_15620 1496 1747 gene locus_tag LOCUS_15630 gene rpmA 1496 1747 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053061.1 protein_id gnl|my_center|LOCUS_15630 1945 3672 gene locus_tag LOCUS_15640 gene obgE 1945 3672 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053060.1 protein_id gnl|my_center|LOCUS_15640 3758 4891 gene locus_tag LOCUS_15650 gene proB 3758 4891 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055074.1 protein_id gnl|my_center|LOCUS_15650 4952 6166 gene locus_tag LOCUS_15660 4952 6166 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055070.1 protein_id gnl|my_center|LOCUS_15660 6365 6440 gene locus_tag LOCUS_t00410 6365 6440 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 6473 6703 gene locus_tag LOCUS_15670 gene secE 6473 6703 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389486.1 protein_id gnl|my_center|LOCUS_15670 6733 7710 gene locus_tag LOCUS_15680 gene nusG 6733 7710 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389487.1 protein_id gnl|my_center|LOCUS_15680 8135 8566 gene locus_tag LOCUS_15690 gene rplK 8135 8566 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004112010.1 protein_id gnl|my_center|LOCUS_15690 8633 9325 gene locus_tag LOCUS_15700 gene rplA 8633 9325 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003829786.1 protein_id gnl|my_center|LOCUS_15700 11092 9530 gene locus_tag LOCUS_15710 11092 9530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 12873 11089 gene locus_tag LOCUS_15720 12873 11089 CDS product DUF6020 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582940.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15720 13213 13446 gene locus_tag LOCUS_15730 13213 13446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 14095 13499 gene locus_tag LOCUS_15740 14095 13499 CDS product energy-coupling factor transporter transmembrane protein EcfT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889093.1 protein_id gnl|my_center|LOCUS_15740 14826 14092 gene locus_tag LOCUS_15750 14826 14092 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014785.1 protein_id gnl|my_center|LOCUS_15750 15527 14961 gene locus_tag LOCUS_15760 15527 14961 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233151.1 protein_id gnl|my_center|LOCUS_15760 15718 16626 gene locus_tag LOCUS_15770 15718 16626 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143590.1 protein_id gnl|my_center|LOCUS_15770 16751 18670 gene locus_tag LOCUS_15780 16751 18670 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390271.1 protein_id gnl|my_center|LOCUS_15780 18667 20316 gene locus_tag LOCUS_15790 18667 20316 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390270.1 protein_id gnl|my_center|LOCUS_15790 20421 29801 gene locus_tag LOCUS_15800 20421 29801 CDS product type I polyketide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390269.1 protein_id gnl|my_center|LOCUS_15800 30252 30746 gene locus_tag LOCUS_15810 30252 30746 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390268.1 protein_id gnl|my_center|LOCUS_15810 31721 30774 gene locus_tag LOCUS_15820 31721 30774 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507589.1 protein_id gnl|my_center|LOCUS_15820 32332 31721 gene locus_tag LOCUS_15830 32332 31721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 32789 32983 gene locus_tag LOCUS_15840 gene thiS 32789 32983 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814099.1 protein_id gnl|my_center|LOCUS_15840 32986 33708 gene locus_tag LOCUS_15850 gene thiF 32986 33708 CDS product sulfur carrier protein ThiS adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966206.1 protein_id gnl|my_center|LOCUS_15850 33759 34712 gene locus_tag LOCUS_15860 33759 34712 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390344.1 protein_id gnl|my_center|LOCUS_15860 35835 34834 gene locus_tag LOCUS_15870 35835 34834 CDS product LysR family transcriptional regulator ArgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003971834.1 protein_id gnl|my_center|LOCUS_15870 35906 36640 gene locus_tag LOCUS_15880 35906 36640 CDS product LysE/ArgO family amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038077.1 protein_id gnl|my_center|LOCUS_15880 36829 36902 gene locus_tag LOCUS_t00420 36829 36902 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 37234 37953 gene locus_tag LOCUS_15890 37234 37953 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406597.1 protein_id gnl|my_center|LOCUS_15890 37955 39661 gene locus_tag LOCUS_15900 37955 39661 CDS product allophanate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224504.1 protein_id gnl|my_center|LOCUS_15900 39739 40710 gene locus_tag LOCUS_15910 39739 40710 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_15910 40798 41643 gene locus_tag LOCUS_15920 40798 41643 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496487.1 protein_id gnl|my_center|LOCUS_15920 41701 42603 gene locus_tag LOCUS_15930 41701 42603 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206340.1 protein_id gnl|my_center|LOCUS_15930 43957 42719 gene locus_tag LOCUS_15940 43957 42719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 44688 44071 gene locus_tag LOCUS_15950 44688 44071 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231827.1 protein_id gnl|my_center|LOCUS_15950 44858 45736 gene locus_tag LOCUS_15960 44858 45736 CDS product dimethylarginine dimethylaminohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245320.1 protein_id gnl|my_center|LOCUS_15960 46666 45914 gene locus_tag LOCUS_15970 46666 45914 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973759.1 protein_id gnl|my_center|LOCUS_15970 46919 47485 gene locus_tag LOCUS_15980 46919 47485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 47775 48464 gene locus_tag LOCUS_15990 47775 48464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143587.1 protein_id gnl|my_center|LOCUS_15990 48756 49025 gene locus_tag LOCUS_16000 gene rpsO 48756 49025 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814361.1 protein_id gnl|my_center|LOCUS_16000 49310 51961 gene locus_tag LOCUS_16010 49310 51961 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390266.1 protein_id gnl|my_center|LOCUS_16010 52109 52687 gene locus_tag LOCUS_16020 52109 52687 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814370.1 protein_id gnl|my_center|LOCUS_16020 52893 55154 gene locus_tag LOCUS_16030 52893 55154 CDS product DUF2207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390263.1 protein_id gnl|my_center|LOCUS_16030 55276 56142 gene locus_tag LOCUS_16040 55276 56142 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814383.1 protein_id gnl|my_center|LOCUS_16040 56220 57881 gene locus_tag LOCUS_16050 56220 57881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 58020 58871 gene locus_tag LOCUS_16060 58020 58871 CDS product IspD/TarI family cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821673.1 protein_id gnl|my_center|LOCUS_16060 58966 59322 gene locus_tag LOCUS_16070 58966 59322 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994575.1 protein_id gnl|my_center|LOCUS_16070 59309 59596 gene locus_tag LOCUS_16080 59309 59596 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057517.1 protein_id gnl|my_center|LOCUS_16080 59762 60439 gene locus_tag LOCUS_16090 59762 60439 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051445.1 protein_id gnl|my_center|LOCUS_16090 60631 62022 gene locus_tag LOCUS_16100 60631 62022 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390255.1 protein_id gnl|my_center|LOCUS_16100 62278 62090 gene locus_tag LOCUS_16110 62278 62090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 62383 63720 gene locus_tag LOCUS_16120 62383 63720 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004118354.1 protein_id gnl|my_center|LOCUS_16120 63772 63960 gene locus_tag LOCUS_16130 63772 63960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 63970 65118 gene locus_tag LOCUS_16140 63970 65118 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051442.1 protein_id gnl|my_center|LOCUS_16140 65221 66411 gene locus_tag LOCUS_16150 65221 66411 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051440.1 protein_id gnl|my_center|LOCUS_16150 66497 67246 gene locus_tag LOCUS_16160 gene mtnN 66497 67246 CDS product 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814409.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence17 2224 320 gene locus_tag LOCUS_16170 2224 320 CDS product histidine-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054753.1 protein_id gnl|my_center|LOCUS_16170 2969 4804 gene locus_tag LOCUS_16180 2969 4804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 5519 5437 gene locus_tag LOCUS_t00430 5519 5437 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5739 6197 gene locus_tag LOCUS_16190 gene furA3 5739 6197 CDS product fur family transcriptional regulator FurA3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731162.1 protein_id gnl|my_center|LOCUS_16190 6357 7736 gene locus_tag LOCUS_16200 6357 7736 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101823.1 protein_id gnl|my_center|LOCUS_16200 7912 7838 gene locus_tag LOCUS_t00440 7912 7838 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 8082 9224 gene locus_tag LOCUS_16210 8082 9224 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776146.1 protein_id gnl|my_center|LOCUS_16210 11220 9337 gene locus_tag LOCUS_16220 11220 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 11610 13304 gene locus_tag LOCUS_16230 gene pgi 11610 13304 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389549.1 protein_id gnl|my_center|LOCUS_16230 13721 14080 gene locus_tag LOCUS_16240 gene rplS 13721 14080 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811942.1 protein_id gnl|my_center|LOCUS_16240 14517 15416 gene locus_tag LOCUS_16250 gene lepB 14517 15416 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389561.1 protein_id gnl|my_center|LOCUS_16250 15459 16127 gene locus_tag LOCUS_16260 15459 16127 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414600.1 protein_id gnl|my_center|LOCUS_16260 16335 17447 gene locus_tag LOCUS_16270 16335 17447 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057860.1 protein_id gnl|my_center|LOCUS_16270 17633 18481 gene locus_tag LOCUS_16280 17633 18481 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815359.1 protein_id gnl|my_center|LOCUS_16280 18495 19244 gene locus_tag LOCUS_16290 18495 19244 CDS product HNH endonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013410358.1 protein_id gnl|my_center|LOCUS_16290 20905 19388 gene locus_tag LOCUS_16300 20905 19388 CDS product MDR family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582382.1 protein_id gnl|my_center|LOCUS_16300 21305 22597 gene locus_tag LOCUS_16310 21305 22597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055698.1 protein_id gnl|my_center|LOCUS_16310 22709 23422 gene locus_tag LOCUS_16320 22709 23422 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051437.1 protein_id gnl|my_center|LOCUS_16320 23798 24928 gene locus_tag LOCUS_16330 gene pstS 23798 24928 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051436.1 protein_id gnl|my_center|LOCUS_16330 25119 26072 gene locus_tag LOCUS_16340 gene pstC 25119 26072 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068423.1 protein_id gnl|my_center|LOCUS_16340 26072 27085 gene locus_tag LOCUS_16350 gene pstA 26072 27085 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050760736.1 protein_id gnl|my_center|LOCUS_16350 27123 27902 gene locus_tag LOCUS_16360 gene pstB 27123 27902 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814420.1 protein_id gnl|my_center|LOCUS_16360 28247 29647 gene locus_tag LOCUS_16370 28247 29647 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052999.1 protein_id gnl|my_center|LOCUS_16370 31032 29980 gene locus_tag LOCUS_16380 31032 29980 CDS product G5 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389571.1 protein_id gnl|my_center|LOCUS_16380 31570 31229 gene locus_tag LOCUS_16390 gene trxA 31570 31229 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821172.1 protein_id gnl|my_center|LOCUS_16390 31828 32448 gene locus_tag LOCUS_16400 31828 32448 CDS product NUDIX hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068356.1 protein_id gnl|my_center|LOCUS_16400 32652 33503 gene locus_tag LOCUS_16410 32652 33503 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811981.1 protein_id gnl|my_center|LOCUS_16410 33500 34606 gene locus_tag LOCUS_16420 gene nudC 33500 34606 CDS product NAD(+) diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389573.1 protein_id gnl|my_center|LOCUS_16420 34750 36429 gene locus_tag LOCUS_16430 34750 36429 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389574.1 protein_id gnl|my_center|LOCUS_16430 36470 36874 gene locus_tag LOCUS_16440 gene gcvH 36470 36874 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811987.1 protein_id gnl|my_center|LOCUS_16440 36895 38085 gene locus_tag LOCUS_16450 36895 38085 CDS product DUF2183 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811988.1 protein_id gnl|my_center|LOCUS_16450 38335 40911 gene locus_tag LOCUS_16460 38335 40911 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389575.1 protein_id gnl|my_center|LOCUS_16460 41132 42178 gene locus_tag LOCUS_16470 41132 42178 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811990.1 protein_id gnl|my_center|LOCUS_16470 42309 43544 gene locus_tag LOCUS_16480 42309 43544 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051334.1 protein_id gnl|my_center|LOCUS_16480 43609 44328 gene locus_tag LOCUS_16490 43609 44328 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811992.1 protein_id gnl|my_center|LOCUS_16490 44397 46559 gene locus_tag LOCUS_16500 44397 46559 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399464.1 protein_id gnl|my_center|LOCUS_16500 46828 48225 gene locus_tag LOCUS_16510 46828 48225 CDS product NADH:flavin oxidoreductase/NADH oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055215.1 protein_id gnl|my_center|LOCUS_16510 48557 49525 gene locus_tag LOCUS_16520 48557 49525 CDS product DUF2075 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674878.1 protein_id gnl|my_center|LOCUS_16520 50772 49684 gene locus_tag LOCUS_16530 50772 49684 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811998.1 protein_id gnl|my_center|LOCUS_16530 51427 50912 gene locus_tag LOCUS_16540 51427 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 51842 52612 gene locus_tag LOCUS_16550 51842 52612 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027779.1 protein_id gnl|my_center|LOCUS_16550 52684 53490 gene locus_tag LOCUS_16560 52684 53490 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023658105.1 protein_id gnl|my_center|LOCUS_16560 53493 54761 gene locus_tag LOCUS_16570 gene galT 53493 54761 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055169.1 protein_id gnl|my_center|LOCUS_16570 54781 56031 gene locus_tag LOCUS_16580 gene galK 54781 56031 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057651.1 protein_id gnl|my_center|LOCUS_16580 56174 56446 gene locus_tag LOCUS_16590 56174 56446 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812009.1 protein_id gnl|my_center|LOCUS_16590 56483 57859 gene locus_tag LOCUS_16600 56483 57859 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053739.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence18 1 756 gene locus_tag LOCUS_16610 1 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 838 1959 gene locus_tag LOCUS_16620 838 1959 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051529.1 protein_id gnl|my_center|LOCUS_16620 1964 2278 gene locus_tag LOCUS_16630 1964 2278 CDS product DUF2469 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105898.1 protein_id gnl|my_center|LOCUS_16630 2558 4147 gene locus_tag LOCUS_16640 2558 4147 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051527.1 protein_id gnl|my_center|LOCUS_16640 4576 6534 gene locus_tag LOCUS_16650 gene rho 4576 6534 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056503.1 protein_id gnl|my_center|LOCUS_16650 6769 7122 gene locus_tag LOCUS_16660 6769 7122 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814292.1 protein_id gnl|my_center|LOCUS_16660 9968 7233 gene locus_tag LOCUS_16670 gene valS 9968 7233 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054756.1 protein_id gnl|my_center|LOCUS_16670 11778 10240 gene locus_tag LOCUS_16680 11778 10240 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390283.1 protein_id gnl|my_center|LOCUS_16680 12480 11806 gene locus_tag LOCUS_16690 gene nth 12480 11806 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051520.1 protein_id gnl|my_center|LOCUS_16690 13377 12604 gene locus_tag LOCUS_16700 13377 12604 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814301.1 protein_id gnl|my_center|LOCUS_16700 13555 14298 gene locus_tag LOCUS_16710 13555 14298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582356.1 protein_id gnl|my_center|LOCUS_16710 15042 14548 gene locus_tag LOCUS_16720 15042 14548 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054759.1 protein_id gnl|my_center|LOCUS_16720 17356 15167 gene locus_tag LOCUS_16730 17356 15167 CDS product alpha-1,4-glucan--maltose-1-phosphate maltosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054760.1 protein_id gnl|my_center|LOCUS_16730 17531 19789 gene locus_tag LOCUS_16740 17531 19789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143591.1 protein_id gnl|my_center|LOCUS_16740 23136 19915 gene locus_tag LOCUS_16750 23136 19915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 24377 23364 gene locus_tag LOCUS_16760 24377 23364 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031380.1 protein_id gnl|my_center|LOCUS_16760 24579 26213 gene locus_tag LOCUS_16770 24579 26213 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775562.1 protein_id gnl|my_center|LOCUS_16770 26341 28161 gene locus_tag LOCUS_16780 26341 28161 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_16780 28175 29134 gene locus_tag LOCUS_16790 28175 29134 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775816.1 protein_id gnl|my_center|LOCUS_16790 29146 30114 gene locus_tag LOCUS_16800 29146 30114 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775817.1 protein_id gnl|my_center|LOCUS_16800 30385 32817 gene locus_tag LOCUS_16810 30385 32817 CDS product glycoside hydrolase family 31 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582331.1 protein_id gnl|my_center|LOCUS_16810 32929 33624 gene locus_tag LOCUS_16820 32929 33624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 33842 34846 gene locus_tag LOCUS_16830 33842 34846 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583055.1 protein_id gnl|my_center|LOCUS_16830 34890 35285 gene locus_tag LOCUS_16840 34890 35285 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_16840 36782 35334 gene locus_tag LOCUS_16850 36782 35334 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728155.1 protein_id gnl|my_center|LOCUS_16850 37084 36761 gene locus_tag LOCUS_16860 37084 36761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 37345 38286 gene locus_tag LOCUS_16870 37345 38286 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034284829.1 protein_id gnl|my_center|LOCUS_16870 38283 39164 gene locus_tag LOCUS_16880 38283 39164 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466499.1 protein_id gnl|my_center|LOCUS_16880 39161 41005 gene locus_tag LOCUS_16890 39161 41005 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083859.1 protein_id gnl|my_center|LOCUS_16890 42210 41245 gene locus_tag LOCUS_16900 42210 41245 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892121.1 protein_id gnl|my_center|LOCUS_16900 43978 42404 gene locus_tag LOCUS_16910 43978 42404 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742127.1 protein_id gnl|my_center|LOCUS_16910 45575 44145 gene locus_tag LOCUS_16920 45575 44145 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222025.1 protein_id gnl|my_center|LOCUS_16920 45937 46068 gene locus_tag LOCUS_16930 45937 46068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 47594 46254 gene locus_tag LOCUS_16940 gene fucP 47594 46254 CDS product L-fucose:H+ symporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816331.1 protein_id gnl|my_center|LOCUS_16940 48128 47739 gene locus_tag LOCUS_16950 48128 47739 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289210.1 protein_id gnl|my_center|LOCUS_16950 48278 49094 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaggggtttatccctcagaatgactcaaattccaac 49494 49180 gene locus_tag LOCUS_16960 gene cas2 49494 49180 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388211.1 protein_id gnl|my_center|LOCUS_16960 50435 49509 gene locus_tag LOCUS_16970 gene cas1 50435 49509 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_16970 51347 50517 gene locus_tag LOCUS_16980 51347 50517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 54271 51389 gene locus_tag LOCUS_16990 54271 51389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 55688 56518 gene locus_tag LOCUS_17000 gene yaaA 55688 56518 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014808.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence19 2821 110 gene locus_tag LOCUS_17010 gene acnA 2821 110 CDS product aconitate hydratase AcnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363285.1 protein_id gnl|my_center|LOCUS_17010 5527 2960 gene locus_tag LOCUS_17020 5527 2960 CDS product HAD-IC family P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068028.1 protein_id gnl|my_center|LOCUS_17020 6309 5680 gene locus_tag LOCUS_17030 6309 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 7644 6388 gene locus_tag LOCUS_17040 7644 6388 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055251.1 protein_id gnl|my_center|LOCUS_17040 8331 7654 gene locus_tag LOCUS_17050 8331 7654 CDS product DUF3159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389697.1 protein_id gnl|my_center|LOCUS_17050 9402 8452 gene locus_tag LOCUS_17060 9402 8452 CDS product DUF3710 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815851.1 protein_id gnl|my_center|LOCUS_17060 10482 9622 gene locus_tag LOCUS_17070 10482 9622 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007058594.1 protein_id gnl|my_center|LOCUS_17070 12852 10801 gene locus_tag LOCUS_17080 12852 10801 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783117.1 protein_id gnl|my_center|LOCUS_17080 13847 12864 gene locus_tag LOCUS_17090 13847 12864 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052615.1 protein_id gnl|my_center|LOCUS_17090 14820 13894 gene locus_tag LOCUS_17100 14820 13894 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052614.1 protein_id gnl|my_center|LOCUS_17100 16626 14980 gene locus_tag LOCUS_17110 16626 14980 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068025.1 protein_id gnl|my_center|LOCUS_17110 18059 16941 gene locus_tag LOCUS_17120 18059 16941 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389693.1 protein_id gnl|my_center|LOCUS_17120 18287 19237 gene locus_tag LOCUS_17130 18287 19237 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860245.1 protein_id gnl|my_center|LOCUS_17130 19230 21875 gene locus_tag LOCUS_17140 19230 21875 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003857914.1 protein_id gnl|my_center|LOCUS_17140 21882 22244 gene locus_tag LOCUS_17150 21882 22244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 23454 22378 gene locus_tag LOCUS_17160 23454 22378 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068024.1 protein_id gnl|my_center|LOCUS_17160 24404 23448 gene locus_tag LOCUS_17170 24404 23448 CDS product prephenate dehydratase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008783121.1 protein_id gnl|my_center|LOCUS_17170 24964 24401 gene locus_tag LOCUS_17180 24964 24401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 27306 25384 gene locus_tag LOCUS_17190 gene typA 27306 25384 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812425.1 protein_id gnl|my_center|LOCUS_17190 29354 27681 gene locus_tag LOCUS_17200 29354 27681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 29788 29351 gene locus_tag LOCUS_17210 29788 29351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 30233 29856 gene locus_tag LOCUS_17220 30233 29856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 30776 30255 gene locus_tag LOCUS_17230 30776 30255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 32506 31097 gene locus_tag LOCUS_17240 32506 31097 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068022.1 protein_id gnl|my_center|LOCUS_17240 33439 32675 gene locus_tag LOCUS_17250 gene scpB 33439 32675 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068017.1 protein_id gnl|my_center|LOCUS_17250 34493 33555 gene locus_tag LOCUS_17260 34493 33555 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389685.1 protein_id gnl|my_center|LOCUS_17260 35342 34503 gene locus_tag LOCUS_17270 35342 34503 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389684.1 protein_id gnl|my_center|LOCUS_17270 36559 35552 gene locus_tag LOCUS_17280 gene xerD 36559 35552 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068014.1 protein_id gnl|my_center|LOCUS_17280 37131 36748 gene locus_tag LOCUS_17290 gene rplT 37131 36748 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812406.1 protein_id gnl|my_center|LOCUS_17290 37368 37174 gene locus_tag LOCUS_17300 gene rpmI 37368 37174 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812404.1 protein_id gnl|my_center|LOCUS_17300 38059 37349 gene locus_tag LOCUS_17310 gene infC 38059 37349 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032682519.1 protein_id gnl|my_center|LOCUS_17310 39348 38452 gene locus_tag LOCUS_17320 gene msrB 39348 38452 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055903.1 protein_id gnl|my_center|LOCUS_17320 41212 39518 gene locus_tag LOCUS_17330 41212 39518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 41357 42091 gene locus_tag LOCUS_17340 41357 42091 CDS product thiamine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389681.1 protein_id gnl|my_center|LOCUS_17340 42189 42566 gene locus_tag LOCUS_17350 42189 42566 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459556.1 protein_id gnl|my_center|LOCUS_17350 42682 43734 gene locus_tag LOCUS_17360 gene gap 42682 43734 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812396.1 protein_id gnl|my_center|LOCUS_17360 43874 44389 gene locus_tag LOCUS_17370 gene ybaK 43874 44389 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812394.1 protein_id gnl|my_center|LOCUS_17370 45475 44408 gene locus_tag LOCUS_17380 45475 44408 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821233.1 protein_id gnl|my_center|LOCUS_17380 45635 46618 gene locus_tag LOCUS_17390 45635 46618 CDS product aldose 1-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068009.1 protein_id gnl|my_center|LOCUS_17390 47336 47058 gene locus_tag LOCUS_17400 47336 47058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054435.1 protein_id gnl|my_center|LOCUS_17400 48100 47339 gene locus_tag LOCUS_17410 48100 47339 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057260.1 protein_id gnl|my_center|LOCUS_17410 48331 49128 gene locus_tag LOCUS_17420 48331 49128 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004113025.1 protein_id gnl|my_center|LOCUS_17420 49343 50344 gene locus_tag LOCUS_17430 49343 50344 CDS product peptidoglycan bridge formation glycyltransferase FemA/FemB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462256.1 protein_id gnl|my_center|LOCUS_17430 51607 50402 gene locus_tag LOCUS_17440 51607 50402 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389676.1 protein_id gnl|my_center|LOCUS_17440 >Feature sequence20 1301 198 gene locus_tag LOCUS_17450 1301 198 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224198.1 protein_id gnl|my_center|LOCUS_17450 1647 1345 gene locus_tag LOCUS_17460 1647 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 2024 1836 gene locus_tag LOCUS_17470 2024 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 3355 2891 gene locus_tag LOCUS_17480 3355 2891 CDS product DUF3021 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100899.1 protein_id gnl|my_center|LOCUS_17480 3798 3352 gene locus_tag LOCUS_17490 3798 3352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 4732 4657 gene locus_tag LOCUS_t00450 4732 4657 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5607 4846 gene locus_tag LOCUS_17500 5607 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007053635.1 protein_id gnl|my_center|LOCUS_17500 6023 5604 gene locus_tag LOCUS_17510 6023 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 6141 6371 gene locus_tag LOCUS_17520 6141 6371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 6979 6476 gene locus_tag LOCUS_17530 6979 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 7139 7831 gene locus_tag LOCUS_17540 7139 7831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 8449 7931 gene locus_tag LOCUS_17550 8449 7931 CDS product HXXEE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263123.1 protein_id gnl|my_center|LOCUS_17550 8450 8662 gene locus_tag LOCUS_17560 8450 8662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 8568 9116 gene locus_tag LOCUS_17570 8568 9116 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964042.1 protein_id gnl|my_center|LOCUS_17570 10158 9289 gene locus_tag LOCUS_17580 10158 9289 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674118.1 protein_id gnl|my_center|LOCUS_17580 10871 10338 gene locus_tag LOCUS_17590 10871 10338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 10986 11438 gene locus_tag LOCUS_17600 10986 11438 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003643467.1 protein_id gnl|my_center|LOCUS_17600 11859 12470 gene locus_tag LOCUS_17610 11859 12470 CDS product MptD family putative ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680633.1 protein_id gnl|my_center|LOCUS_17610 12467 13231 gene locus_tag LOCUS_17620 12467 13231 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681157.1 protein_id gnl|my_center|LOCUS_17620 13228 14856 gene locus_tag LOCUS_17630 13228 14856 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068102.1 protein_id gnl|my_center|LOCUS_17630 14919 16832 gene locus_tag LOCUS_17640 14919 16832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390093.1 protein_id gnl|my_center|LOCUS_17640 16829 18601 gene locus_tag LOCUS_17650 16829 18601 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390092.1 protein_id gnl|my_center|LOCUS_17650 18802 19263 gene locus_tag LOCUS_17660 18802 19263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 20711 19485 gene locus_tag LOCUS_17670 gene eno 20711 19485 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051126.1 protein_id gnl|my_center|LOCUS_17670 21393 20899 gene locus_tag LOCUS_17680 21393 20899 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814306.1 protein_id gnl|my_center|LOCUS_17680 21750 22445 gene locus_tag LOCUS_17690 21750 22445 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864400.1 protein_id gnl|my_center|LOCUS_17690 22608 23090 gene locus_tag LOCUS_17700 22608 23090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17700 23090 23242 gene locus_tag LOCUS_17710 23090 23242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 23894 23268 gene locus_tag LOCUS_17720 23894 23268 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972952.1 protein_id gnl|my_center|LOCUS_17720 24280 23969 gene locus_tag LOCUS_17730 24280 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 24390 25415 gene locus_tag LOCUS_17740 24390 25415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 25652 26746 gene locus_tag LOCUS_17750 25652 26746 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495008.1 protein_id gnl|my_center|LOCUS_17750 26831 27988 gene locus_tag LOCUS_17760 26831 27988 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065845.1 protein_id gnl|my_center|LOCUS_17760 27985 28785 gene locus_tag LOCUS_17770 27985 28785 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065716.1 protein_id gnl|my_center|LOCUS_17770 29119 28862 gene locus_tag LOCUS_17780 29119 28862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 31060 29279 gene locus_tag LOCUS_17790 31060 29279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113016.1 protein_id gnl|my_center|LOCUS_17790 32076 31057 gene locus_tag LOCUS_17800 32076 31057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537833.1 protein_id gnl|my_center|LOCUS_17800 33059 32073 gene locus_tag LOCUS_17810 33059 32073 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537834.1 protein_id gnl|my_center|LOCUS_17810 34728 33070 gene locus_tag LOCUS_17820 34728 33070 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384717.1 protein_id gnl|my_center|LOCUS_17820 35135 36688 gene locus_tag LOCUS_17830 35135 36688 CDS product Sapep family Mn(2+)-dependent dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582529.1 protein_id gnl|my_center|LOCUS_17830 36727 37272 gene locus_tag LOCUS_17840 36727 37272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 37482 38147 gene locus_tag LOCUS_17850 37482 38147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 38131 38322 gene locus_tag LOCUS_17860 38131 38322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 38300 39571 gene locus_tag LOCUS_17870 38300 39571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 39589 39774 gene locus_tag LOCUS_17880 39589 39774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 40855 39764 gene locus_tag LOCUS_17890 gene tsaD 40855 39764 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054363.1 protein_id gnl|my_center|LOCUS_17890 41406 40852 gene locus_tag LOCUS_17900 41406 40852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 42308 41403 gene locus_tag LOCUS_17910 gene tsaB 42308 41403 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389971.1 protein_id gnl|my_center|LOCUS_17910 42976 42305 gene locus_tag LOCUS_17920 gene tsaE 42976 42305 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047289290.1 protein_id gnl|my_center|LOCUS_17920 44007 42994 gene locus_tag LOCUS_17930 44007 42994 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816492.1 protein_id gnl|my_center|LOCUS_17930 45778 44069 gene locus_tag LOCUS_17940 45778 44069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 46758 45838 gene locus_tag LOCUS_17950 46758 45838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 <49990 46978 gene locus_tag LOCUS_17960 <49990 46978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013389976.1:leucine--tRNA ligase >Feature sequence21 1073 408 gene locus_tag LOCUS_17970 1073 408 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821294.1 protein_id gnl|my_center|LOCUS_17970 1609 1166 gene locus_tag LOCUS_17980 1609 1166 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821296.1 protein_id gnl|my_center|LOCUS_17980 2517 1615 gene locus_tag LOCUS_17990 2517 1615 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007057094.1 protein_id gnl|my_center|LOCUS_17990 2853 2521 gene locus_tag LOCUS_18000 2853 2521 CDS product small basic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813185.1 protein_id gnl|my_center|LOCUS_18000 3839 2856 gene locus_tag LOCUS_18010 3839 2856 CDS product DUF881 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052289.1 protein_id gnl|my_center|LOCUS_18010 4446 3832 gene locus_tag LOCUS_18020 4446 3832 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052288.1 protein_id gnl|my_center|LOCUS_18020 5302 4451 gene locus_tag LOCUS_18030 gene hisG 5302 4451 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389929.1 protein_id gnl|my_center|LOCUS_18030 5595 5332 gene locus_tag LOCUS_18040 5595 5332 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813192.1 protein_id gnl|my_center|LOCUS_18040 6280 5615 gene locus_tag LOCUS_18050 gene rpe 6280 5615 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111648.1 protein_id gnl|my_center|LOCUS_18050 7340 6321 gene locus_tag LOCUS_18060 gene lgt 7340 6321 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389930.1 protein_id gnl|my_center|LOCUS_18060 8327 7428 gene locus_tag LOCUS_18070 gene trpA 8327 7428 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582574.1 protein_id gnl|my_center|LOCUS_18070 10428 8332 gene locus_tag LOCUS_18080 10428 8332 CDS product bifunctional indole-3-glycerol phosphate synthase/tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068116.1 protein_id gnl|my_center|LOCUS_18080 12146 10572 gene locus_tag LOCUS_18090 gene trpE 12146 10572 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052763.1 protein_id gnl|my_center|LOCUS_18090 12589 12146 gene locus_tag LOCUS_18100 gene hisI 12589 12146 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052762.1 protein_id gnl|my_center|LOCUS_18100 13467 12697 gene locus_tag LOCUS_18110 gene hisF 13467 12697 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813327.1 protein_id gnl|my_center|LOCUS_18110 14977 13757 gene locus_tag LOCUS_18120 gene rlmN 14977 13757 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363517.1 protein_id gnl|my_center|LOCUS_18120 16011 15019 gene locus_tag LOCUS_18130 16011 15019 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052757.1 protein_id gnl|my_center|LOCUS_18130 16607 16053 gene locus_tag LOCUS_18140 gene frr 16607 16053 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111654.1 protein_id gnl|my_center|LOCUS_18140 17629 16883 gene locus_tag LOCUS_18150 gene pyrH 17629 16883 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052755.1 protein_id gnl|my_center|LOCUS_18150 18857 18009 gene locus_tag LOCUS_18160 gene tsf 18857 18009 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813341.1 protein_id gnl|my_center|LOCUS_18160 19791 18913 gene locus_tag LOCUS_18170 gene rpsB 19791 18913 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816510.1 protein_id gnl|my_center|LOCUS_18170 20489 20004 gene locus_tag LOCUS_18180 gene def 20489 20004 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052751.1 protein_id gnl|my_center|LOCUS_18180 22600 20492 gene locus_tag LOCUS_18190 22600 20492 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004117868.1 protein_id gnl|my_center|LOCUS_18190 23124 22642 gene locus_tag LOCUS_18200 23124 22642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816504.1 protein_id gnl|my_center|LOCUS_18200 24415 23270 gene locus_tag LOCUS_18210 24415 23270 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052748.1 protein_id gnl|my_center|LOCUS_18210 24500 25717 gene locus_tag LOCUS_18220 24500 25717 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813356.1 protein_id gnl|my_center|LOCUS_18220 26107 25898 gene locus_tag LOCUS_18230 26107 25898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 26617 26405 gene locus_tag LOCUS_18240 26617 26405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 26616 27635 gene locus_tag LOCUS_18250 26616 27635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 29556 27739 gene locus_tag LOCUS_18260 29556 27739 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389968.1 protein_id gnl|my_center|LOCUS_18260 30084 29800 gene locus_tag LOCUS_18270 30084 29800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 30994 31197 gene locus_tag LOCUS_18280 30994 31197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 31136 31786 gene locus_tag LOCUS_18290 31136 31786 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776721.1 protein_id gnl|my_center|LOCUS_18290 32081 32794 gene locus_tag LOCUS_18300 32081 32794 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389903.1 protein_id gnl|my_center|LOCUS_18300 32796 33260 gene locus_tag LOCUS_18310 32796 33260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 33440 33667 gene locus_tag LOCUS_18320 33440 33667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 34059 36044 gene locus_tag LOCUS_18330 gene feoB 34059 36044 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337005.1 protein_id gnl|my_center|LOCUS_18330 36041 36343 gene locus_tag LOCUS_18340 36041 36343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 37096 36431 gene locus_tag LOCUS_18350 37096 36431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 38560 37106 gene locus_tag LOCUS_18360 38560 37106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 39563 38586 gene locus_tag LOCUS_18370 39563 38586 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642485.1 protein_id gnl|my_center|LOCUS_18370 <40185 39587 gene locus_tag LOCUS_18380 <40185 39587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011102097.1:phytoene desaturase family protein >Feature sequence22 1059 64 gene locus_tag LOCUS_18390 1059 64 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225578.1 protein_id gnl|my_center|LOCUS_18390 2104 1085 gene locus_tag LOCUS_18400 2104 1085 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804077.1 protein_id gnl|my_center|LOCUS_18400 2773 3429 gene locus_tag LOCUS_18410 2773 3429 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227434.1 protein_id gnl|my_center|LOCUS_18410 3551 4516 gene locus_tag LOCUS_18420 3551 4516 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020472.1 protein_id gnl|my_center|LOCUS_18420 4786 5589 gene locus_tag LOCUS_18430 4786 5589 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642522.1 protein_id gnl|my_center|LOCUS_18430 5774 5586 gene locus_tag LOCUS_18440 5774 5586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 6828 5788 gene locus_tag LOCUS_18450 6828 5788 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974028.1 protein_id gnl|my_center|LOCUS_18450 8117 6951 gene locus_tag LOCUS_18460 8117 6951 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101954.1 protein_id gnl|my_center|LOCUS_18460 8978 8160 gene locus_tag LOCUS_18470 8978 8160 CDS product DUF3737 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101955.1 protein_id gnl|my_center|LOCUS_18470 9828 10007 gene locus_tag LOCUS_18480 9828 10007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 12104 10317 gene locus_tag LOCUS_18490 12104 10317 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921966.1 protein_id gnl|my_center|LOCUS_18490 12922 12161 gene locus_tag LOCUS_18500 12922 12161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18500 13945 13577 gene locus_tag LOCUS_18510 13945 13577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 14111 13917 gene locus_tag LOCUS_18520 14111 13917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 14160 14453 gene locus_tag LOCUS_18530 14160 14453 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886398.1 protein_id gnl|my_center|LOCUS_18530 14594 15928 gene locus_tag LOCUS_18540 14594 15928 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101536.1 protein_id gnl|my_center|LOCUS_18540 16792 16364 gene locus_tag LOCUS_18550 16792 16364 CDS product YjdF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861328.1 protein_id gnl|my_center|LOCUS_18550 18740 17871 gene locus_tag LOCUS_18560 18740 17871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 20518 18977 gene locus_tag LOCUS_18570 20518 18977 CDS product SpaH/EbpB family LPXTG-anchored major pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013399737.1 protein_id gnl|my_center|LOCUS_18570 22954 20621 gene locus_tag LOCUS_18580 22954 20621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 >Feature sequence23 1842 79 gene locus_tag LOCUS_18590 1842 79 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055555.1 protein_id gnl|my_center|LOCUS_18590 3282 1924 gene locus_tag LOCUS_18600 3282 1924 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_18600 3679 4275 gene locus_tag LOCUS_18610 3679 4275 CDS product YesL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068637.1 protein_id gnl|my_center|LOCUS_18610 4472 6352 gene locus_tag LOCUS_18620 gene dnaK 4472 6352 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814044.1 protein_id gnl|my_center|LOCUS_18620 6352 7023 gene locus_tag LOCUS_18630 gene grpE 6352 7023 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390362.1 protein_id gnl|my_center|LOCUS_18630 7097 8122 gene locus_tag LOCUS_18640 7097 8122 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390361.1 protein_id gnl|my_center|LOCUS_18640 8197 8778 gene locus_tag LOCUS_18650 8197 8778 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054672.1 protein_id gnl|my_center|LOCUS_18650 9086 10714 gene locus_tag LOCUS_18660 9086 10714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 10788 11474 gene locus_tag LOCUS_18670 10788 11474 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816035.1 protein_id gnl|my_center|LOCUS_18670 12321 12085 gene locus_tag LOCUS_18680 12321 12085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 12634 13074 gene locus_tag LOCUS_18690 12634 13074 CDS product pyrimidine dimer DNA glycosylase/endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805109.1 protein_id gnl|my_center|LOCUS_18690 13087 14097 gene locus_tag LOCUS_18700 13087 14097 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804930.1 protein_id gnl|my_center|LOCUS_18700 14289 15614 gene locus_tag LOCUS_18710 14289 15614 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028589.1 protein_id gnl|my_center|LOCUS_18710 15818 16900 gene locus_tag LOCUS_18720 15818 16900 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227020.1 protein_id gnl|my_center|LOCUS_18720 16897 17841 gene locus_tag LOCUS_18730 16897 17841 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227021.1 protein_id gnl|my_center|LOCUS_18730 18008 19417 gene locus_tag LOCUS_18740 18008 19417 CDS product GH1 family beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031744.1 protein_id gnl|my_center|LOCUS_18740 20112 19549 gene locus_tag LOCUS_18750 20112 19549 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003593049.1 protein_id gnl|my_center|LOCUS_18750 >Feature sequence24 275 637 gene locus_tag LOCUS_18760 275 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 1836 820 gene locus_tag LOCUS_18770 1836 820 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013363756.1 protein_id gnl|my_center|LOCUS_18770 1964 2374 gene locus_tag LOCUS_18780 gene cueR 1964 2374 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613681.1 protein_id gnl|my_center|LOCUS_18780 3745 2381 gene locus_tag LOCUS_18790 3745 2381 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007055715.1 protein_id gnl|my_center|LOCUS_18790 3958 4602 gene locus_tag LOCUS_18800 3958 4602 CDS product Pr6Pr family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013582373.1 protein_id gnl|my_center|LOCUS_18800 4794 5558 gene locus_tag LOCUS_18810 gene rph 4794 5558 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811904.1 protein_id gnl|my_center|LOCUS_18810 5555 6268 gene locus_tag LOCUS_18820 5555 6268 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051401.1 protein_id gnl|my_center|LOCUS_18820 6842 6366 gene locus_tag LOCUS_18830 6842 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18830 7366 6764 gene locus_tag LOCUS_18840 7366 6764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18840 8035 7637 gene locus_tag LOCUS_18850 8035 7637 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389998.1 protein_id gnl|my_center|LOCUS_18850 8270 9268 gene locus_tag LOCUS_18860 8270 9268 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296415.1 protein_id gnl|my_center|LOCUS_18860 9874 9344 gene locus_tag LOCUS_18870 9874 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 10070 10579 gene locus_tag LOCUS_18880 10070 10579 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836468.1 protein_id gnl|my_center|LOCUS_18880 10977 12617 gene locus_tag LOCUS_18890 10977 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 14740 12728 gene locus_tag LOCUS_18900 14740 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 16605 14737 gene locus_tag LOCUS_18910 16605 14737 CDS product S53 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223434.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence25 497 1255 gene locus_tag LOCUS_18920 497 1255 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029414678.1 protein_id gnl|my_center|LOCUS_18920 2546 1281 gene locus_tag LOCUS_18930 gene ilvA 2546 1281 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007051833.1 protein_id gnl|my_center|LOCUS_18930 2545 2772 gene locus_tag LOCUS_18940 2545 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 2783 3934 gene locus_tag LOCUS_18950 2783 3934 CDS product iron-siderophore ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026198708.1 protein_id gnl|my_center|LOCUS_18950 4100 5077 gene locus_tag LOCUS_18960 4100 5077 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013804.1 protein_id gnl|my_center|LOCUS_18960 5092 6144 gene locus_tag LOCUS_18970 5092 6144 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967922.1 protein_id gnl|my_center|LOCUS_18970 6141 7067 gene locus_tag LOCUS_18980 6141 7067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339288.1 protein_id gnl|my_center|LOCUS_18980 7134 8135 gene locus_tag LOCUS_18990 7134 8135 CDS product siderophore-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100352.1 protein_id gnl|my_center|LOCUS_18990 10001 8142 gene locus_tag LOCUS_19000 10001 8142 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_19000 12573 10180 gene locus_tag LOCUS_19010 12573 10180 CDS product bifunctional alpha,alpha-trehalose-phosphate synthase (UDP-forming)/trehalose-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763077.1 protein_id gnl|my_center|LOCUS_19010 12736 12554 gene locus_tag LOCUS_19020 12736 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 14828 12969 gene locus_tag LOCUS_19030 14828 12969 CDS product alpha-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068628.1 protein_id gnl|my_center|LOCUS_19030 >Feature sequence26 578 883 gene locus_tag LOCUS_19040 578 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19040 792 1169 gene locus_tag LOCUS_19050 792 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 1226 1432 gene locus_tag LOCUS_19060 1226 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 1531 1908 gene locus_tag LOCUS_19070 1531 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 1901 2662 gene locus_tag LOCUS_19080 1901 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 2712 2894 gene locus_tag LOCUS_19090 2712 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 2891 3667 gene locus_tag LOCUS_19100 2891 3667 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060618489.1 protein_id gnl|my_center|LOCUS_19100 4271 3786 gene locus_tag LOCUS_19110 4271 3786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 4674 5513 gene locus_tag LOCUS_19120 4674 5513 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017143465.1 protein_id gnl|my_center|LOCUS_19120 5623 5931 gene locus_tag LOCUS_19130 5623 5931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 6026 6418 gene locus_tag LOCUS_19140 6026 6418 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813393.1 protein_id gnl|my_center|LOCUS_19140 6847 6695 gene locus_tag LOCUS_19150 6847 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19150 8051 7407 gene locus_tag LOCUS_19160 8051 7407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19160 8160 8705 gene locus_tag LOCUS_19170 8160 8705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 8702 9004 gene locus_tag LOCUS_19180 8702 9004 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002668966.1 protein_id gnl|my_center|LOCUS_19180 10334 9225 gene locus_tag LOCUS_19190 10334 9225 CDS product IS30 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389795.1 protein_id gnl|my_center|LOCUS_19190 10510 10899 gene locus_tag LOCUS_19200 10510 10899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 11060 11554 gene locus_tag LOCUS_19210 11060 11554 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004105658.1 protein_id gnl|my_center|LOCUS_19210 11640 12935 gene locus_tag LOCUS_19220 gene eno 11640 12935 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004111823.1 protein_id gnl|my_center|LOCUS_19220 13370 13657 gene locus_tag LOCUS_19230 13370 13657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 13689 14018 gene locus_tag LOCUS_19240 13689 14018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 14015 14563 gene locus_tag LOCUS_19250 14015 14563 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036809.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence27 772 563 gene locus_tag LOCUS_19260 772 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1643 807 gene locus_tag LOCUS_19270 1643 807 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068636.1 protein_id gnl|my_center|LOCUS_19270 2494 1640 gene locus_tag LOCUS_19280 2494 1640 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052964.1 protein_id gnl|my_center|LOCUS_19280 3223 4566 gene locus_tag LOCUS_19290 3223 4566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583013.1 protein_id gnl|my_center|LOCUS_19290 4871 5875 gene locus_tag LOCUS_19300 4871 5875 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007054086.1 protein_id gnl|my_center|LOCUS_19300 6594 5950 gene locus_tag LOCUS_19310 6594 5950 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013583014.1 protein_id gnl|my_center|LOCUS_19310 6889 7173 gene locus_tag LOCUS_19320 6889 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 7358 8107 gene locus_tag LOCUS_19330 7358 8107 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390367.1 protein_id gnl|my_center|LOCUS_19330 9336 8398 gene locus_tag LOCUS_19340 9336 8398 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674948.1 protein_id gnl|my_center|LOCUS_19340 11138 9579 gene locus_tag LOCUS_19350 11138 9579 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011067926.1 protein_id gnl|my_center|LOCUS_19350 >Feature sequence28 553 1293 gene locus_tag LOCUS_19360 553 1293 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013390357.1 protein_id gnl|my_center|LOCUS_19360 1380 1453 gene locus_tag LOCUS_t00460 1380 1453 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2434 1514 gene locus_tag LOCUS_19370 2434 1514 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776465.1 protein_id gnl|my_center|LOCUS_19370 2670 3413 gene locus_tag LOCUS_19380 2670 3413 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906025.1 protein_id gnl|my_center|LOCUS_19380 3568 4215 gene locus_tag LOCUS_19390 3568 4215 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101601.1 protein_id gnl|my_center|LOCUS_19390 4265 4621 gene locus_tag LOCUS_19400 4265 4621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4691 5050 gene locus_tag LOCUS_19410 4691 5050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5086 6309 gene locus_tag LOCUS_19420 5086 6309 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104410.1 protein_id gnl|my_center|LOCUS_19420 7581 6598 gene locus_tag LOCUS_19430 7581 6598 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366639.1 protein_id gnl|my_center|LOCUS_19430 8137 8508 gene locus_tag LOCUS_19440 8137 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19440 8615 9829 gene locus_tag LOCUS_19450 8615 9829 CDS product multidrug effflux MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776858.1 protein_id gnl|my_center|LOCUS_19450